YURTDIŞI GEÇİCİ GÖREV DÖNÜŞÜ BİLGİLENDİRME TOPLANTISI Sunan: Dr. Suat KAYMAK. Zirai Mücadele Merkez Araştırma Enstitüsü Müdürlüğü.

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "YURTDIŞI GEÇİCİ GÖREV DÖNÜŞÜ BİLGİLENDİRME TOPLANTISI Sunan: Dr. Suat KAYMAK. Zirai Mücadele Merkez Araştırma Enstitüsü Müdürlüğü."

Transkript

1 YURTDIŞI GEÇİCİ GÖREV DÖNÜŞÜ BİLGİLENDİRME TOPLANTISI Sunan: Dr. Suat KAYMAK Zirai Mücadele Merkez Araştırma Enstitüsü Müdürlüğü 28 Ağustos 2013

2 Giriş Sunum Planı Mikrobiyal Adli Bilimler & Gıda ve Tarım Biyogüvenlik Ulusal Enstitüsü NIMFFAB Enstitüsü Hedefleri ve Öncelikleri NIMFFAB Enstitüsü Çalışanları Yurt Dışı Görevindeki Amaçlar Yapılan Çalışmalar Sonuç Primer Dizayn Çalışmaları Botryosphaeria obtusa ve B. dothidea Teşhis ve Tanımlama Çalışmaları Primer Dizayn Örneklerin toplanması, Örneklerin izolasyonu, DNA elde edilmesi High-Resolution DNA Melting Analysis DNA Dizi analizi ve Filogenetik Analizler Oklahoma sularında su kaynaklı bitki virüs hastalıklarının tespiti Su kaynaklı virüsler Örneklerin Toplanması, cdna elde edilmesi, DNA Dizi analizi ve Filogenetik Analizler Patojenisite Çalışmaları Oklahoma Çayır Meralarında Biyolojik Çeşitliliğin Tespitine Yönelik Çalışmalar Ders ve Seminerlere Katılım 2

3 Giriş 3

4 Yurtdışı Görev Yeri: Amerika Birleşik Devletleri (ABD) Oklahoma Devlet Üniversitesi Tarım Bilimleri ve Doğal kaynaklar Fakültesi, Mikrobiyal Adli Bilimler & Gıda ve Tarım Biyogüvenlik Ulusal Enstitüsü Görev Konusu: Bitki Genetik Kaynaklarının Toplanması, Tanımlanması Muhafaza ve Gen Bankası Görev Tarihleri: 15 Aralık Haziran

5 Mikrobiyal Adli Bilimler & Gıda ve Tarım Biyogüvenlik Ulusal Enstitüsü 5

6 6

7 Enstitü Öncelikleri ve Hedefleri Bitkilerde aşırı sıcaklık ve kuraklık şartlarında tepkilerini anlamak için araştırma çalışmaları başlatmak ve sürdürmek. Enerji üretimi için bitkilerin etkin kullanımını arttırırak genetik ve yönetim stratejilerinin geliştirilmesi Kuraklığa dayanıklı bitkilerin geliştirilmesi ve kullanımı ile su kaynaklarının korunmasının teşvik edilmesi Bitki patojenleri ve gıda güvenliği ile ilgili ihtiyaç ve kaynakların önceliğine göre Stratejik planlama yapmak Federal ve Devlet kurumları ile mikrobiyal adli tıp ve tarım biyogüvenlik için yüksek öncelikli araştırma ve teknoloji geliştirme

8 Mikrobiyal Adli Bilimler & Gıda ve Tarım Biyogüvenlik Ulusal Enstitüsü Hocaları Dr. Jacqueline Fletcher Professor Director Dr. Li (Maria) Ma, Assistant Professor NIMFFAB Dr. Astri Wayadande, Associate Professor, NIMFFAB Asst. Dir. Dr. Francisco Ochoa-Corona, Assistant Professor NIMFFAB Dr. Rakesh Kaundal, Assistant Professor NIMFFAB 8

9 Çalışma koşulları: Araştırmalar için gereken laboratuvar alt yapısını oluşturan cihazlar, deney malzeme ve gereçleri, kimyasal sarf malzemeleri ve yardımcı personel giderleri öğretim üyelerinin bulacakları kaynaklardan karşılanmaktadır. Bölümdeki öğretim üyeleri sözleşmeli statüde çalışmaktadır. Sözleşme süreleri sonunda, üretici birlikleri ve öğrencilere çeşitli anketler sunulmaktadır. Bu anketlerde ilgili öğretim üyesi hakkındaki memnuniyet durumları, bilimsel eser ve nitelikli proje üretme gibi kriterler baz alınarak sözleşmeleri yenilenmekte veya feshedilmektedir. Bu şekilde işleyen bir sistem araştırmacıları üretkenliğe zorlamakta ve dolayısıyla bilimsel araştırma verimliliği artmaktadır.

10 Laboratuvarları

11

12 Araştırma Ekibi

13 Danışman Hocam Dr. Francisco Ochoa-Corona

14 Yurtdışı Görevindeki Amaçlar 14

15 Önemli bitkisel ürünlerde hastalıklara yol açan patojenlerin biyolojileri öğrenmek, teşhis ve tanımlarını yapmak. Bu amaçla kullanılan moleküler teknik ve uygulamalar konusunda ayrıntılı olarak çalışmalar yapmak. Bu patojenlerin Filogenetik Analizlerini yapmak. 15

16 Yapılan Çalışmalar 16

17 Primer dizayn çalışmaları 1.Retrieve sequences from gene bank NCBI ( 2. Perform a sequence alignment using ClustalX2 (ftp://ftp.ebi.ac.uk/pub/software/clustalw2/). 3. Clean-up the sequence clean-up using Gel Doc software ( 4. Proceed to primer design using Primer3 ( 5. Access primers thermodynamics and secondary structure using Mfold ( 6. Continue with primer alignment using NCBI Blast tool (

18 Botryosphaeria obtusa ve B. dothidea Teşhis ve Tanımlama Çalışmaları 18

19 Bu amaçla; kültür ve süs bitkilerini hastalandırarak ölümüne neden olan Botryosphaeria obtusa ve B. dothidea patojeninin gen bankasından faydalanılarak gen dizileri çıkartılmış, gene spesifik primerler dizayn edilmiştir.

20 Hastalık Etmeninin Belirtileri Botryosphaeria spp. çok kompleks bir fungal etmenler olup, farklı hastalık belirtilerine neden olabilirler. Bu hastalık etmenleri bağlarda meyve çürüklüğü, yaprak sararması ve zayıf göz oluşumu neden olmaktadırlar. Hastalık etmeni ayrıca sürgünlerin, dalların ve ana gövdelerinde doku karamalarına da neden olur ve bu hastalık neticesinde bitkilerde geriye doğru ölümler meydana gelir. Odunsu bitkilerin kabuklarında sınırlı, çökük bir şekilde kanserler oluşturmaktadır. Bitkide oluşan bu kanser su ve besin alımını engellemekte ve nihaiyi olarak hastalıktan dolayı dalların ve ağaçların geriye doğru ölümüyle sonuçlanmaktadır. Hastalık etmeninin konukçuları arasında en fazla sözü geçen meşe ve asmalardır.

21 Organism Target Primer Size bp Sequnce 5-3 Comment 180 TGTAAGTTTGCGCTGTCTTTG Botrysphaeria obtusa Beta-Tubulin Apple CTTATTGTTGGATGCCTGCT 70 TGTAAGTTTGCGCTGTCTTTG GTCGGAGGTGCCATTGTAG 5.8 S Ribosomal 113 GCAGCGAAATGCGATAAG TAATGACGCTCGAACAGG Apple IT TGAACTACCTCTGTTGCTTTGG CGACGTTTACTGACTGGAGTTT ITS CTCAAGCTCTGCTTGGTATTG CTCCAAAGCGAGGTGTATTCT Botrysphaeria dothidea Beta-Tubulin 126 AATGGCACCTCGGACCTT Apple TGTTGTTGGACGCCTGCT 76 TAACGCGAATCGACACCA ATGCAGACTTACACGCCAGA

22 Örneklerin Toplanması

23

24

25

26

27

28

29 İzolasyon Çalışmaları

30 Elde edilen Botryosphaeria spp. saf kültürü

31 Moleküler Çalışmalar

32 Bd-Bt-F1&Bd-Bt-R1 Bo-Bt-F1&Bo-Bt-R1 Bo-ITS1-F1&Bo-ITS1-R1 Bo-5.8sRib-F1&R1 Bd-Bt-F1&Bd-Bt-R1 Bo-Bt-F1&Bo-Bt-R1 Bo-ITS1-F1&Bo-ITS1-R1 Bo-5.8sRib-F1&R1 Jel görüntüsü Botryoshaeria dothidea Botryosphaeria obtusa

33 df/dt df/dt High-Resolution DNA Melting Analysis B. obtusa 0.4 B. dothidea ºC 0.5 B. obtusa B. dothidea ºC

34 df/dt Fluorescence ºC ºC

35 DNA saflaştırma çalışmaları

36 DNA Dizilerinin Elde Edilmesi ve Patojen Teşhisleri DNA örnekleri özel tüpler içerisinde dizileme cihazına yollanırlar. Daha sonra bu diziler internet ortamında uluslararası gen bankasında araştırılarak, söz konusu patojenin teşhisi %99 olasılıkla tespit edilir. Aynı zamanda bu diziler özel bilgisayar programlarında analiz edilerek, herhangi bir patojen popülasyonu içerisindeki akrabalık ilişkileri ve soy ağacı ortaya koyulmaktadır. Bu analiz bir popülasyondaki virülens bireylerin hangi çoğunlukta olduğunu ve bölge için tehlike oluşturup oluşturmadıkları sonucuna varılabilir.

37 Filogenetik Soyağacı Oluşturarak Fungal Popülasyonlar Hakkında Fikir Edinmek

38 Oklahoma Sularında Su Kaynaklı Bitki Virüs Hastalıklarının Tespiti 38

39 200 den fazla göl 1 milyon dönüm su yüzeyi Çok sayıda nehir, dere ve gölet

40 Su kaynaklı virüsün anlamı nedir? Su yoluyla bulaşarak hastalık yapabilme yeteneğine sahip virüslerdir. Potexviruses Tobamovirus Tombusviridae

41 Potexviruses Tobamovirus Tombusviridae

42 Potexviruses Tobamovirus Tombusviridae

43 Örnek Toplarken

44

45

46

47 Örneklerin alındığı alanlar 1 2 3

48 Gerçekleştirilen aşamalar Collection Extraction PCR amplification Products Gel electrophoresis

49 Gel electrophoresis: Tombusvirus?

50 Gel electrophoresis: Potexvirus?

51 DNA bantlarının sekans analizi için kesilmesi

52 Bantların Sekans Sonuçları >Tombusvirus AAGGGTAAAAGGATGGTGAGGTATTCCGTTTTGACCATGTCGCCTGCGATCCAGGCATTGAGGGATA GGCATTGAGGGATCGCTTGTCCAACAAGGATTGGCGGATGCGGAACCTTTACCTCATCCTCGACGAG GAGGGTAGGACCGTTCCGTTTGTTATGCGGGGCGAGCAGGAGCAGTTCCTGCGGGAGAGGCACAAC CGGAATTTCATCCCCAAAGCTCGGAAGCTTGGGATGTCTACTGCCATCGTGCTAGCCAACCTCGATG ACTGCATTTTCAACGGCAATCTCGCGGCAGGGATCATCGACCTCACCAAGGACGATGCCTTCGCGAA ACTGTCGATGGCGAGGTTCGCATGGGCATCTGGGCCGCTCCATCCAGATCCCGCTATCGGCGCACTT TGGAAGTCACTGCACAAGGCCAATCCGCTTGAGAAGGATGCCGGGGGCGAGATGGTCTGGCGCAA CGGATCAAGGATCACCGCAGGTGTAGCCTTCACGGGCCGCACTCCACACCCCTACCAAA >Potexvirus GGGGCACCCGACTATCGAGATCGGATGACTTGTCGACCCACCGAGTCGACACGGCTGACTCGCCCG GCAGCCGGAAAGCCAACGGTGGCTTGCTGCCACCTGCCAGCTGATGCAGCTGGGTTTCTAGCCCAC GAGTCGTTTTATCGATCGAACCAAGCGCCGGCCGAACCAGTGCCTTCCAATCCGACTCGACCTTCTC CTTCTGAGCTCGCAGAGATGCGATTTCCGTCCGCTTGGGGTCCTTTTCCAGCGAAGCAATTCGCTTTC GGGAGTTCTGATAATCCTGGATGTCCTTCGACCACTGAGCGTAGATCGAATCGATTTGGTCGATCGCC TTATTGGCCAGCTTGTCGGCTTCCTGCTTGTTCTCGAATCCATAGTAGGTCGAGGCCTGCGCGACATA GTCGCCGATGACCTGAGCCATCTTGTCGCGGTCTAAGCGGATCGTCCCATCCTGGTCCGGGATCAAC GCCTGGAACTGCCCCGCCAGCGGCCCTTTGGCAGCCTGCAGAAAGCCAATCGAGGAAAACTTGCCG TCCCGAACCTTCGACCCAA

53 Sekans Sonuçlarının Gen Bankasında Taranması Tombusvirus sekansı 2 eşleşme Potexvirus PAMV Potexvirus Cactusvirus Her ikisi bitki patojeni!

54 Potexvirus sequence 4 eşleşme Tobamovirus Cactus mild mottle (2 matches) Bellpepper mottle virus (1 match) Potexvirus Narcissus mosaic virus Tümü bitki patojeni!

55 Sonuçların Doğrulanması

56 Patojenisite Testleri

57 Elde edilen bulgular ulusal bir kongrede sözlü olarak sunulmuştur Daniels, J., Kaymak, S., Corona, F.O., Finding the Known and Unknown, Plant Waterborne Virus in Oklahoma Water, Oklahoma Clean Lakes and Watersheds, 22nd Annual Conference Agenda, April 18-19, 2013

58 Oklahoma Çayır Meralarında Biyolojik Çeşitliliğin Tespitine Yönelik Çalışmalar 58

59

60

61

62

63

64

65 Diğer Eğitim Çalışmaları 65

66 Seminerlere katılım

67

68 Derslere Katılım

69

70 Uygulamalı Laboratuvar Derslerine Katılım

71

72 Helicase Dependent Amplification (thda) 72

73 HDA Plant Viruses HDA with PCR, Block Heater, and Water Bath

74 Next generation sequencing technology Roche 454

75 Sonuç 75

76 Yurt dışı eğitimi; bilgi alışverişi, yeni yöntem ve tekniklerin öğrenilmesi açısından amacına uygun bir şekilde gerçekleşmiştir. Edinilen bilgiler; Tarımsal Fauna ve Mikroflora Araştırmalarında kullanılabilecek, Türkiye deki biyolojik çeşitliliğin tanımlanması, değerlendirilmesi ve korunması açısından ışık tutacaktır. Bana rehberlik eden hocalarla iletişim devam edecek olup, yeni projelerde işbirliği içerisinde bulunulacaktır. Yurtdışı eğitimine katılma fırsatı veren Gıda Tarım ve Hayvancılık Bakanlığına ve yöneticilerime teşekkür ederim. 76

77 TEŞEKKÜRLER

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT gulden.haspolat@gthb.gov.tr

Detaylı

Moleküler Yaşam Bilimleri Yüksek Lisans Öğrencilerinin Bilimsel ve Akademik Yeterlilik Algıları ve Profesyonel Gelişime Yönelik Planları

Moleküler Yaşam Bilimleri Yüksek Lisans Öğrencilerinin Bilimsel ve Akademik Yeterlilik Algıları ve Profesyonel Gelişime Yönelik Planları Moleküler Yaşam Bilimleri Yüksek Lisans Öğrencilerinin Bilimsel ve Akademik Yeterlilik Algıları ve Profesyonel Gelişime Yönelik Planları Hasip Çirkin 1 Hadi Sağın 2, Ferhan Sağın 1 1 Ege Üniversitesi Tıp

Detaylı

BRCA 1/2 DNA Analiz Paneli

BRCA 1/2 DNA Analiz Paneli FAST-BRCA Sequencing Kit BRCA 1/2 DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR... 3 5

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

KUZEYDOĞU ANADOLU BÖLGESİ TARIM SEKTÖRÜ GZFT ANALİZİ

KUZEYDOĞU ANADOLU BÖLGESİ TARIM SEKTÖRÜ GZFT ANALİZİ T.C. KUZEYDOĞU ANADOLU KALKINMA AJANSI KUZEYDOĞU ANADOLU BÖLGESİ TARIM SEKTÖRÜ GZFT ANALİZİ Dr. Mehmet Ali ÇAKAL TRA1 2012 Her hakkı saklıdır. İÇİNDEKİLER 1. KAPSAM... 2 2. KUZEY DOĞU ANADOLU BÖLGESİ TARIM

Detaylı

Sebze Islahında Moleküler Markırların Kullanımı

Sebze Islahında Moleküler Markırların Kullanımı Sebze Islahında Moleküler Markırların Kullanımı Esra CEBECİ Ziraat Yüksek Mühendisi 28.12.2012-28.06.2013 Atatürk Bahçe Kültürleri Merkez Araştırma Enstitüsü YALOVA Sunu Planı Çalışmanın tanıtımı, Yapılan

Detaylı

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI Uzm. Dr. Özgür APPAK Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D GİRİŞ:

Detaylı

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Türkiye'de 2015-2016 İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Dilek Güldemir 1,Ayşe Başak Altaş 1,Fatma Filiz Arı 1,Zekiye Bakkaloğlu 1,Özlem Ünaldı 1,Fatma

Detaylı

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor!

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor! Uygulamalı Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları Yaz Dönemi Başlıyor! : DNA izolasyonu, Primer tasarımı, PCR Teknikleri, Agaroz Jel Elektroforezi,

Detaylı

TÜBİTAK MAM GEN MÜHENDM HENDİSLİĞİ VE BİYOTEKNOLOJB YOTEKNOLOJİ ENSTİTÜSÜ (GMBE) TANITIMI IKEV Türkiye için Biyoteknoloji Toplantısı 8 Kasım m 2007 1 GMBE Personeli Araştırmacı 50 Toplam Personel 65 Teknisyen

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

GIDA LABORATUVARLARI. 2015 Yılı Eğitim Programı

GIDA LABORATUVARLARI. 2015 Yılı Eğitim Programı GIDA LABORATUVARLARI 2015 Yılı Eğitim Programı Gıda Laboratuvarları Eğitim Hizmetleri Intertek, sağladığı eğitim hizmetleri ile teknik farkındalık yaratmakta ve sektörde faaliyet gösteren şirketlere uzman

Detaylı

KUZEY DOĞU ANADOLU BÖLGESİ TARIM SEKTÖRÜ GZFT (SWOT) ANALİZİ(2012)

KUZEY DOĞU ANADOLU BÖLGESİ TARIM SEKTÖRÜ GZFT (SWOT) ANALİZİ(2012) T.C. KUZEYDOĞU ANADOLU KALKINMA AJANSI KUZEY DOĞU ANADOLU BÖLGESİ TARIM SEKTÖRÜ GZFT (SWOT) ANALİZİ(2012) Dr. Mehmet Ali ÇAKAL TRA1 2012 Her hakkı saklıdır. İÇİNDEKİLER 1. KAPSAM... 3 2. KUZEY DOĞU ANADOLU

Detaylı

KAYISI ARAŞTIRMA İSTASYONU MÜDÜRLÜĞÜ EK 3 İŞ TANIMI VE GEREKLERİ BELGELERİ

KAYISI ARAŞTIRMA İSTASYONU MÜDÜRLÜĞÜ EK 3 İŞ TANIMI VE GEREKLERİ BELGELERİ KAYISI ARAŞTIRMA İSTASYONU MÜDÜRLÜĞÜ EK 3 BELGELERİ KAYISI ARAŞTIRMA İSTASYONU MÜDÜRLÜĞÜ EK 3.1 MÜDÜR Dök.No KAİM.İKS.FRM.082 Sayfa No 1 / 4 İŞİN KISA TANIMI: üst yönetimi tarafından belirlenen amaç, ilke

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyolojide Kullanılan Teknikler Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim

Detaylı

Hollanda da Avian Influenza nın İzleme (Monitoring) ve Sürveyansı. Ruth Bouwstra DVM PhD GD Animal Health

Hollanda da Avian Influenza nın İzleme (Monitoring) ve Sürveyansı. Ruth Bouwstra DVM PhD GD Animal Health Hollanda da Avian Influenza nın İzleme (Monitoring) ve Sürveyansı Ruth Bouwstra DVM PhD GD Animal Health Hollanda Hollanda; küçük bir ülke İhracatçı ülke: ürünler Tarımsal gıda endüstrisinden ihraç edilen

Detaylı

TARIMSAL BİYOTEKNOLOJİYE GİRİŞ

TARIMSAL BİYOTEKNOLOJİYE GİRİŞ TARIMSAL BİYOTEKNOLOJİYE GİRİŞ Bitki Doku Kültürü Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 4. Hafta (08.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü

Detaylı

ALTINBAŞ ÜNİVERSİTESİ DOĞAL ÜRÜNLER ARAŞTIRMA VE GELİŞTİRME MERKEZİ DÜAGEM YÖNETMELİĞİ

ALTINBAŞ ÜNİVERSİTESİ DOĞAL ÜRÜNLER ARAŞTIRMA VE GELİŞTİRME MERKEZİ DÜAGEM YÖNETMELİĞİ ALTINBAŞ ÜNİVERSİTESİ DOĞAL ÜRÜNLER ARAŞTIRMA VE GELİŞTİRME MERKEZİ DÜAGEM YÖNETMELİĞİ BİRİNCİ BÖLÜM Amaç, Kapsam, Dayanak ve Tanımlar Amaç MADDE 1 (1) Bu Yönetmeliğin amacı; Altınbaş Üniversitesi Doğal

Detaylı

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG)

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) TANIM Canlı hücre içindeki malzemeleri (DNA, Protein, Enzim vb.), hücre yapısının işlevini ve hücreler arasındaki etkileşimi laboratuvar ortamında inceleyerek ortaya çıkaran kişidir. A- GÖREVLER - Canlıları

Detaylı

Proje Faaliyetleri ve Beklenen Çıktılar

Proje Faaliyetleri ve Beklenen Çıktılar UNIDO EKO-VERİMLİLİK (TEMİZ ÜRETİM) PROGRAMI BİLGİLENDİRME TOPLANTISI Proje Faaliyetleri ve Beklenen Çıktılar Ferda Ulutaş, Emrah Alkaya Türkiye Teknoloji Geliştirme Vakfı Ankara, 20 Mayıs 2009 KAPSAM

Detaylı

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE VE GDO UYGULAMALARI GÜVENLİK VE GDO UYGULAMALARI Neslihan ATLIHAN Neslihan ATLIHAN Gıda Yüksek Mühendisi Gıda Yüksek Mühendisi Gıda ve Yem Kontrol

Detaylı

Madde 1- KAPSAM. Madde 2- Mera Kanunu nun 18. Maddesi ile Mera Yönetmeliğinin 10. Maddesi gereği yürütülecek çalışmaları kapsar.

Madde 1- KAPSAM. Madde 2- Mera Kanunu nun 18. Maddesi ile Mera Yönetmeliğinin 10. Maddesi gereği yürütülecek çalışmaları kapsar. PROTOKOL 4342 Sayılı Mera Kanunu gereği tespit, tahdit ve tahsisi yapılan mera, yaylak ve kışlaklar ile umuma ait çayır ve otlaklar için uygun ıslah ve amenajman tekniklerinin geliştirilerek verimliliklerinin

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

ULUDAĞ ÜNİVERSİTESİ ARICILIK GELİŞTİRME UYGULAMA VE ARAŞTIRMA MERKEZİ YÖNETMELİĞİ

ULUDAĞ ÜNİVERSİTESİ ARICILIK GELİŞTİRME UYGULAMA VE ARAŞTIRMA MERKEZİ YÖNETMELİĞİ Resmi Gazete Tarihi: 20 Şubat 2017 Resmi Gazete Sayısı: 29985 BİRİNCİ BÖLÜM Amaç, Kapsam, Dayanak ve Tanımlar Amaç ULUDAĞ ÜNİVERSİTESİ ARICILIK GELİŞTİRME UYGULAMA VE ARAŞTIRMA MERKEZİ YÖNETMELİĞİ MADDE

Detaylı

BATI AKDENİZ KALKINMA AJANSI (BAKA) TARIMSAL AR-GE PROJE DESTEKLERİ

BATI AKDENİZ KALKINMA AJANSI (BAKA) TARIMSAL AR-GE PROJE DESTEKLERİ BATI AKDENİZ KALKINMA AJANSI (BAKA) TARIMSAL AR-GE PROJE DESTEKLERİ Selin ŞEN Şubat 2015 SUNUM PLANI I. TARIMSAL AR-GE PROJE DESTEKLERİ II. TARIMSAL AR-GE PROJELERİ DESTEK SÜRESİ VE TUTARI III. DESTEKLENEN

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

ZİRAAT MÜHENDİSİ (TARIMSAL BİYOTEKNOLOJİ)

ZİRAAT MÜHENDİSİ (TARIMSAL BİYOTEKNOLOJİ) TANIM Tarımsal Biyoteknoloji, bitki, hayvan ve mikrobiyal organizmaların genleri, hücreleri, proteinleri, kültürleri ve dokuları üzerinde çalışarak, tarımsal üretimi, kaliteyi, verimi arttırmayı amaçlayan

Detaylı

zeytinist

zeytinist 1 T.C. BALIKESİR ÜNİVERSİTESİ EDREMİT MESLEK YÜKSEKOKULU Zeytincilik ve Zeytin İşleme Teknolojisi Programı Öğr. Gör. Mücahit KIVRAK 0 505 772 44 46 kivrak@gmail.com www.mucahitkivrak.com.tr 2 3 4 ZEYTİN

Detaylı

Proje alanı, süresi ve bütçesi

Proje alanı, süresi ve bütçesi 1 Proje Gelişim Süreci Projenin amacı Proje alanı, süresi ve bütçesi İşbirliği yapılan kurumlar Proje Bileşenleri Proje Faaliyetleri 2/21 Mart 2011 Mart 2011 Mart 2012 Mart 2012 Haziran 2012 Haziran 2013

Detaylı

Moleküler Biyoloji ve Genetik Bölümü

Moleküler Biyoloji ve Genetik Bölümü Moleküler Biyoloji ve Genetik Bölümü Doç. Dr. Işın N. Geren Yrd. Doç. Dr. Turgay Çakmak Yrd. Doç. Dr. Filiz Kısaayak Çollak Uzman Zeynep N. Koytak Araş. Gör. Fatma Sağır Araş. Gör. Kuaybe Yücebilgili (ÖYP)

Detaylı

Kistik Fibrozis DNA Analiz Paneli

Kistik Fibrozis DNA Analiz Paneli FAST-CFTR Sequencing Kit Kistik Fibrozis DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

I.ULUSAL HÜCRE KÜLTÜRÜ SİMPOZYUMU ve UYGULAMALI KURSU

I.ULUSAL HÜCRE KÜLTÜRÜ SİMPOZYUMU ve UYGULAMALI KURSU I.ULUSAL HÜCRE KÜLTÜRÜ SİMPOZYUMU ve UYGULAMALI KURSU Tarih: 6-10 Ekim 2011 Yer: İstanbul Üniversitesi Baltalimanı Sosyal Tesisleri Düzenleyen Kuruluşlar İstanbul Tıp Fakültesi Viroloji ve Temel İmmünoloji

Detaylı

Yrd. Doç. Dr. Deniz KOÇAN AKSARAY ÜNİVERSİTESİ Türkiye 11. Gıda Kongresi

Yrd. Doç. Dr. Deniz KOÇAN AKSARAY ÜNİVERSİTESİ Türkiye 11. Gıda Kongresi Yrd. Doç. Dr. Deniz KOÇAN AKSARAY ÜNİVERSİTESİ 11.10.2012 Türkiye 11. Gıda Kongresi 1 11.10.2012 Türkiye 11. Gıda Kongresi 2 Listeria monocytogenes ABD. de gıda ile ilişkili bakteriyel kökenli ölümlerin

Detaylı

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ SELÇUK KILIÇ, BEKİR ÇELEBİ, MEHMET GENÇ, CANAN KETRE, MUSTAFA KOLUKIRIK 1, Ankara 2 Bioeksen Ar-Ge Teknolojileri

Detaylı

Differential Display. Özgür Çakır

Differential Display. Özgür Çakır Differential Display Özgür Çakır Differential gen anlatımı Gelişmeye bağlı gen anlatımı değişiklikleri Ortam uyaranları ile gen anlatımı değişimleri Doku veya hücreye özel gen anlatımları Farklı anlatım

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Ulusal Ar-Ge Proje Destekleri

Ulusal Ar-Ge Proje Destekleri Ulusal Ar-Ge Proje Destekleri Mustafa AY Kamu Araştırmaları Destek Grubu Yürütme Komitesi Sekreteri 4 Nisan 2014, Girne Ar-Ge Harcamalarının GSYİH ya Oranı Hızla Artmaktadır* *TÜİK (Aralık, 2013) Kişi

Detaylı

I.ULUSAL HÜCRE KÜLTÜRÜ SİMPOZYUMU ve UYGULAMALI KURSU

I.ULUSAL HÜCRE KÜLTÜRÜ SİMPOZYUMU ve UYGULAMALI KURSU I.ULUSAL HÜCRE KÜLTÜRÜ SİMPOZYUMU ve UYGULAMALI KURSU Tarih: 4-7 Ekim 2011 Yer: İstanbul Üniversitesi Baltalimanı Sosyal Tesisleri Düzenleyen Kuruluşlar İstanbul Tıp Fakültesi Viroloji ve Temel İmmünoloji

Detaylı

BİTKİ MATERYALİ II: ANGIOSPERMAE

BİTKİ MATERYALİ II: ANGIOSPERMAE BİTKİ MATERYALİ II: ANGIOSPERMAE Prof.Dr. Yahya AYAŞLIGİL Yrd.Doç.Dr. Doğanay YENER İstanbul Üniversitesi, Orman Fakültesi Peyzaj Mimarlığı Bölümü Bitki Materyali ve Yetiştirme Tekniği Anabilim Dalı 23.02.2015

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

T.C. ORMAN VE SU İŞLERİ BAKANLIĞI ORMAN GENEL MÜDÜRLÜĞÜ TRÜF ORMANI

T.C. ORMAN VE SU İŞLERİ BAKANLIĞI ORMAN GENEL MÜDÜRLÜĞÜ TRÜF ORMANI T.C. ORMAN VE SU İŞLERİ BAKANLIĞI ORMAN GENEL MÜDÜRLÜĞÜ TRÜF ORMANI EYLEM PLANI 2014-2018 O R M A N G E N E L M Ü D Ü R L Ü Ğ Ü T R Ü F O R M A N I E Y L E M P L A N I 2 0 1 4-2 0 1 8 Orman Genel Müdürlüğümüzün

Detaylı

KARADENİZ İN TÜRKİYE KIYILARINDA DAĞILIM GÖSTEREN MERSİN BALIĞI TÜRLERİNİN MİTOKONDRİAL DNA SEKANS ANALİZİ YÖNTEMİYLE TANIMLANMASI

KARADENİZ İN TÜRKİYE KIYILARINDA DAĞILIM GÖSTEREN MERSİN BALIĞI TÜRLERİNİN MİTOKONDRİAL DNA SEKANS ANALİZİ YÖNTEMİYLE TANIMLANMASI MAKALE KARADENİZ İN TÜRKİYE KIYILARINDA DAĞILIM GÖSTEREN MERSİN BALIĞI TÜRLERİNİN MİTOKONDRİAL DNA SEKANS ANALİZİ YÖNTEMİYLE TANIMLANMASI Oğuzhan EROĞLU, SUMAE Mersin balıklarının Tethis Denizi kökenli

Detaylı

MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ

MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ FEN FAKÜLTESİ Fakültemiz, 13 Kasım 2010 tarih ve 2010/25 sayılı Bakanlar Kurulu kararı ile kapatılan FenEdebiyat Fakültesi yerine kurulan iki fakülteden (Fen Fakültesi ve

Detaylı

Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması

Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması Erdogdu C, Yalinay M, Karakan T, Battaglia T, Blaser MJ Ceren

Detaylı

Sağlıklı Tarım Politikası

Sağlıklı Tarım Politikası TARLADAN SOFRAYA SAĞLIKLI BESLENME Sağlıklı Tarım Politikası Prof. Dr. Ahmet ALTINDĠġLĠ Ege Üniversitesi Ziraat Fakültesi Bahçe Bitkileri Bölümü ahmet.altindisli@ege.edu.tr Tarım Alanları ALAN (1000 ha)

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

UÜ-SK TIBBİ GENETİK ANABİLİM DALI HİZMET KAPSAMI. Dok.Kodu : FR-YLY-15-401 İlk Yay.Tarihi : 15 Nisan 2007 Sayfa 1 / 6

UÜ-SK TIBBİ GENETİK ANABİLİM DALI HİZMET KAPSAMI. Dok.Kodu : FR-YLY-15-401 İlk Yay.Tarihi : 15 Nisan 2007 Sayfa 1 / 6 UÜ-SK TIBBİ GENETİK ANABİLİM DALI HİZMET KAPSAMI Dok.Kodu : FR-YLY-15-401 İlk Yay.Tarihi : Rev. No : 03 Rev.Tarihi : 28 Şubat 2012 1 / 6 1. HİZMET KAPSAMI: Tıbbi Genetik AD tüm yaş gruplarındaki hastalara,

Detaylı

Mitokondrial DNA Analiz Paneli

Mitokondrial DNA Analiz Paneli FAST-mtDNA Sequencing Kit Mitokondrial DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

MEVZUATLAR KANUNLAR. TEBLİĞ, TALİMAT ve KARARLAR YÖNETMELİKLER KANUNLAR. Zirai Mücadele ve Zirai Karantina Kanunu

MEVZUATLAR KANUNLAR. TEBLİĞ, TALİMAT ve KARARLAR YÖNETMELİKLER KANUNLAR. Zirai Mücadele ve Zirai Karantina Kanunu T.C. ANTALYA VALİLİĞİ Tarım İl Müdürlüğü MEVZUATLAR KANUNLAR 6968 Sayılı Zirai Mücadele ve Zirai Karantina Kanunu. 5179 Sayılı Gıdaların Üretimi, Tüketimi ve Denetlenmesine Dair Kanun Hükmünde Kararnamenin

Detaylı

Boğaziçi Üniversitesi Çevre Bilimleri Enstitüsü 34342 Bebek İstanbul-Türkiye

Boğaziçi Üniversitesi Çevre Bilimleri Enstitüsü 34342 Bebek İstanbul-Türkiye Gökhan Türker Cirriculum Vitae TC Kimlik No 14492401948 Doğum Tarihi ve Yeri: YazıĢma Adresi : 30.03.1979 - İstanbul Telefon : 212-3594602 Cep Telefonu: 532-6044810 Faks : 212-2575033 Yabancı Dili: e-posta

Detaylı

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG)

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) TANIM Canlı hücre içindeki malzemeleri (DNA, Protein, Enzim vb.), hücre yapısının işlevini ve hücreler arasındaki etkileşimi laboratuar ortamında inceleyerek

Detaylı

Türkiye Tenthredopsis (Hymenoptera: Symphyta: Tenthredinidae) Tür Sınırlarının Barkodlama Yöntemi İle Saptanması

Türkiye Tenthredopsis (Hymenoptera: Symphyta: Tenthredinidae) Tür Sınırlarının Barkodlama Yöntemi İle Saptanması Türkiye Tenthredopsis (Hymenoptera: Symphyta: Tenthredinidae) Tür Sınırlarının Barkodlama Yöntemi İle Saptanması Sevda HASTAOĞLU ÖRGEN 1, Mahir BUDAK 2, E. Mahir KORKMAZ 2, Hasan H. BAŞIBÜYÜK 3 1 Sivas

Detaylı

RUS BUĞDAY AFİTLERİNE KARŞI BİYOLOJİK KORUMA

RUS BUĞDAY AFİTLERİNE KARŞI BİYOLOJİK KORUMA RUS BUĞDAY AFİTLERİNE KARŞI BİYOLOJİK KORUMA HAZIRLAYAN ÖĞRENCİLER 7-F Miray DAĞCI Ömür Mehmet KANDEMİR DANIŞMAN ÖĞRETMEN NİLÜFER DEMİR İZMİR - 2013 İÇİNDEKİLER 1. Projenin Amacı ve Hedefi.. 2 2. Afit

Detaylı

BİYOTEKNOLOJİ BÖLÜMÜ

BİYOTEKNOLOJİ BÖLÜMÜ BİYOTEKNOLOJİ BÖLÜMÜ Bölüm Hakkında Biyoteknoloji Bölümü, Bartın Üniversitesi Fen Fakültesi bünyesinde Yüksek Öğretim Kurumu tarafından 2016 yılı itibari ile açılmış olup, Lisans Programına ilk öğrencilerini

Detaylı

LAND DEGRADATİON. Hanifi AVCI AGM Genel Müdür Yardımcısı

LAND DEGRADATİON. Hanifi AVCI AGM Genel Müdür Yardımcısı ARAZİ BOZULUMU LAND DEGRADATİON Hanifi AVCI AGM Genel Müdür Yardımcısı LAND DEGRADATİON ( ARAZİ BOZULUMU) SOİL DEGRADATİON (TOPRAK BOZULUMU) DESERTİFİCATİON (ÇÖLLEŞME) Arazi Bozulumu Nedir - Su ve rüzgar

Detaylı

KARADENİZ TEKNİK ÜNİVERSİTESİ SAĞLIK HİZMETLERİ MESLEK YÜKSEKOKULU PAYDAŞ ANALİZİ ANKETİ

KARADENİZ TEKNİK ÜNİVERSİTESİ SAĞLIK HİZMETLERİ MESLEK YÜKSEKOKULU PAYDAŞ ANALİZİ ANKETİ Hiç yeterli değil Yeterli değil Kararsızım Oldukça yeterli Tamamen yeterli KARADENİZ TEKNİK ÜNİVERSİTESİ SAĞLIK HİZMETLERİ MESLEK YÜKSEKOKULU PAYDAŞ ANALİZİ ANKETİ AKADEMİK PERSONEL Aşağıdaki ifadeler

Detaylı

TARIMSAL ARAŞTIRMALAR VE POLİTİKALAR GENEL MÜDÜRLÜĞÜ. TAGEM, DAİRE BAŞKANLIKLARI ve ÇALIŞMA GRUPLARI GÖREVLERİ

TARIMSAL ARAŞTIRMALAR VE POLİTİKALAR GENEL MÜDÜRLÜĞÜ. TAGEM, DAİRE BAŞKANLIKLARI ve ÇALIŞMA GRUPLARI GÖREVLERİ TARIMSAL ARAŞTIRMALAR VE POLİTİKALAR GENEL MÜDÜRLÜĞÜ TAGEM, DAİRE BAŞKANLIKLARI ve ÇALIŞMA GRUPLARI GÖREVLERİ TARIMSAL ARAŞTIRMALAR VE POLITIKALAR GENEL MÜDÜRLÜĞÜ Tarımsal Araştırmalar ve Politikalar Genel

Detaylı

Tarımın Anayasası Çıktı

Tarımın Anayasası Çıktı Tarımın Anayasası Çıktı Günnur BİNİCİ ALTINTAŞ Tarım sektörünün anayasası olan 5488 sayılı Tarım Kanunu iki yıllık yoğun bir çalışmanın ardından 18.04.2006 tarihinde kabul edildi. Resmi Gazete de 25.04.2006

Detaylı

İSTANBUL AYDIN ÜNİVERSİTESİ SAĞLIK HİZMETLERİ MESLEK YÜKSEKOKULU Etkinlikler

İSTANBUL AYDIN ÜNİVERSİTESİ SAĞLIK HİZMETLERİ MESLEK YÜKSEKOKULU Etkinlikler SAĞLIK HİZMETLERİ MESLEK YÜKSEKOKULU Etkinlikler Sağlık Hizmetleri Meslek Yüksekokulu Bülteni Yıl: 2 Sayı: 6 Ağustos 2015 İAÜ, Delightful Istanbul ile rekora imza attı 3-15 Ağustos 2015 - İstanbul Aydın

Detaylı

ORGANİK MANDA YETİŞTİRİCİLİĞİ. Vet. Hek. Ümit Özçınar

ORGANİK MANDA YETİŞTİRİCİLİĞİ. Vet. Hek. Ümit Özçınar ORGANİK MANDA YETİŞTİRİCİLİĞİ Vet. Hek. Ümit Özçınar ORGANİK TARIM VE HAYVANCILIK NEDİR? Organik tarımın temel stratejisi, kendine yeterli bir ekosistem oluşturarak, bu ekosistemdeki canlıların optimum

Detaylı

İçindekiler VII. Ön söz Çeviri editörünün ön sözü Teşekkür XV XIX XXI. I. Kısım Su teminine giriş

İçindekiler VII. Ön söz Çeviri editörünün ön sözü Teşekkür XV XIX XXI. I. Kısım Su teminine giriş Ön söz Çeviri editörünün ön sözü Teşekkür XV XIX XXI I. Kısım Su teminine giriş 1 Su sektörü 3 1.1 Giriş 3 1.2 Su tüketimi 3 1.3 Kabul edilebilir su kalitesi 7 1.4 Su sektörü hizmetleri 10 1.5 Su koruma

Detaylı

Amerikan Ticaret Servisi Hizmetinizde. ABD Başkonsolosluğu İstanbul 14 Aralık 2010

Amerikan Ticaret Servisi Hizmetinizde. ABD Başkonsolosluğu İstanbul 14 Aralık 2010 Amerikan Ticaret Servisi Hizmetinizde ABD Başkonsolosluğu İstanbul 14 Aralık 2010 ABD den Satın Almanın Sebepleri: Kalite: mükemmel kalite anlayışı ve yenilikçilik Yüksek Ürün Standartları: ABD deki işletmeler

Detaylı

VİRAL TANI KİTLERİ (GFJ-480)

VİRAL TANI KİTLERİ (GFJ-480) VİRAL TANI KİTLERİ (GFJ-480) CMV PCR Tanı Kiti Cytomegalovirus un Konvensiyonel PCR yöntemiyle tanınması. HHV-5 olarak da bilinen Sitomegalovirüs, herpes virus ailesinin bir üyesidir. Oldukça sık görülen

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

ULUDAĞ ÜNĠVERSĠTESĠ ARICILIK GELĠġTĠRME UYGULAMA VE ARAġTIRMA MERKEZĠ YÖNETMELĠĞĠ. BĠRĠNCĠ BÖLÜM Amaç, Kapsam, Dayanak ve Tanımlar

ULUDAĞ ÜNĠVERSĠTESĠ ARICILIK GELĠġTĠRME UYGULAMA VE ARAġTIRMA MERKEZĠ YÖNETMELĠĞĠ. BĠRĠNCĠ BÖLÜM Amaç, Kapsam, Dayanak ve Tanımlar ULUDAĞ ÜNĠVERSĠTESĠ ARICILIK GELĠġTĠRME UYGULAMA VE ARAġTIRMA MERKEZĠ YÖNETMELĠĞĠ Amaç BĠRĠNCĠ BÖLÜM Amaç, Kapsam, Dayanak ve Tanımlar MADDE 1- Bu Yönetmeliğin amacı; Uludağ Üniversitesi Arıcılık Geliştirme

Detaylı

SÜREKLİ İYİLEŞTİRME HEDEFLER PLANLA UYGULA ÖNLEM AL HEDEFLERİ YÜKSELT KONTROL KSE

SÜREKLİ İYİLEŞTİRME HEDEFLER PLANLA UYGULA ÖNLEM AL HEDEFLERİ YÜKSELT KONTROL KSE SÜREKLİ İYİLEŞTİRME HEDEFLER PLANLA ÖNLEM AL HEDEFLERİ YÜLT UYGULA KONTROL Bilgi Akışı EĞİTİM VE ÖĞRETİM SÜREÇLERİ ÖLÇME VE DEĞERLENDİRME İYİLEŞTİRME ARAŞTIRMA VE GELİŞTİRME SÜREÇLERİ YÖNETSEL SÜREÇLER

Detaylı

www.idc-defence.com - info@idc-defence.com - Tel : +90 312 466 4740 - Faks : +90 312 466 5966

www.idc-defence.com - info@idc-defence.com - Tel : +90 312 466 4740 - Faks : +90 312 466 5966 Biyoluminesans Hücre + Monoklonal Antikor BioSiS, genetik olarak önceden DNA sı değiştirilmiş Biyoluminesans hücreler ile tespit edilmesi istenen mikroorganizmaya spesifik Monoklonal Antikorların birlikte

Detaylı

Erken Uyarı-Cevap ve Saha Epidemiyolojisi

Erken Uyarı-Cevap ve Saha Epidemiyolojisi Erken Uyarı-Cevap ve Saha Epidemiyolojisi Dr. Mustafa Bahadır Sucaklı 2. Ulusal Klinik Mikrobiyoloji Kongresi 12 Kasım 2013 Antalya 1 Akut Sağlık Olaylarına Cevap İnceleme ve risk değerlendirmesi İnceleme

Detaylı

ULUSAL HAVZA YÖNETİM STRATEJİSİ

ULUSAL HAVZA YÖNETİM STRATEJİSİ ULUSAL HAVZA YÖNETİM STRATEJİSİ Bayram HOPUR Entegre Projeler Uygulama Şube Müdürü Çölleşme ve Erozyonla Mücadele Genel Müdürlüğü www.cem.gov.tr 3. Ulusal Taşkın Sempozyumu- 29.04.2013 İstanbul ULUSAL

Detaylı

2007 ÖSS BİYOLOJİ SORULARI VE CEVAPLARI

2007 ÖSS BİYOLOJİ SORULARI VE CEVAPLARI 2007 ÖSS BİYOLOJİ SORULARI VE CEVAPLARI 1. BÖLÜM 1. Aşağıdaki tabloda bazı canlı türlerinin kromozom sayıları verilmiştir. Bu tablodaki bilgilere göre, I. İki canlı türünün kromozom sayılarına bakılarak

Detaylı

ASMANIN ÇOĞALTILMASI

ASMANIN ÇOĞALTILMASI ASMANIN ÇOĞALTILMASI Asmalar başlıca iki yolla çoğaltılır; Eşeyli (tohumla) Eşeysiz TOHUMLA (EŞEYLİ) ÇOĞALTMA Asmalar biyolojik olarak yabancı döllenmeleri nedeniyle, tohumdan elde edilen bitkiler çok

Detaylı

T A Ş I N I R K E S İ N H E S A P C E T V E L İ

T A Ş I N I R K E S İ N H E S A P C E T V E L İ 150.01 ADI Kırtasiye Malzemeleri Grubu 1 150.01.01 Yazı Araçları 6.293,19 28.614,28 34.907,47 29.790,11 5.117,35 2 150.01.02 Yazım, Çizim ve Ölçüm Araç ve Malzemeleri 955,45 2.117,02 3.072,47 2.602,26

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

zeytinist

zeytinist 1 T.C. BALIKESİR ÜNİVERSİTESİ EDREMİT MESLEK YÜKSEKOKULU Zeytincilik ve Zeytin İşleme Teknolojisi Programı Öğr. Gör. Mücahit KIVRAK 0 505 772 44 46 kivrak@gmail.com www.mucahitkivrak.com.tr 2 3 4 Zeytin

Detaylı

Karbapeneme Dirençli Acinetobacter baumannii Suşlarının PFGE Yöntemiyle Genotiplendirilmesi

Karbapeneme Dirençli Acinetobacter baumannii Suşlarının PFGE Yöntemiyle Genotiplendirilmesi Karbapeneme Dirençli Acinetobacter baumannii Suşlarının PFGE Yöntemiyle Genotiplendirilmesi Yrd. Doç. Dr. Affan DENK Fırat Üniversitesi Tıp Fakültesi Enfeksiyon Hst. ve Klin. Mik. Araştırmacılar Yasemin

Detaylı

Meyve ve Sebze ile ilgili kavramlar ve GDO

Meyve ve Sebze ile ilgili kavramlar ve GDO Meyve ve Sebze ile ilgili kavramlar ve GDO Doğal Ürünler! Bu ürünler tamamen doğal koşullarda üretilen ürünlerdir. Kimyasal gübre ve tarım ilacı kullanmadan, doğal tohumlarla üretilirler. Organik Ürünler!

Detaylı

Tarım Sayımı Sonuçları

Tarım Sayımı Sonuçları Tarım Sayımı Sonuçları 2011 DEVLET PLANLAMA ÖRGÜTÜ İstatistik ve Araştırma Dairesi Ocak 2015 TARIM SAYIMININ AMACI Tarım Sayımı ile işletmenin yasal durumu, arazi kullanımı, ürün bazında ekili alan, sulama

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

İÇİNDEKİLER I. TARIMSAL ARAŞTIRMA ENSTİTÜLERİ VE İSTASYONLARI GÖREV YÖNERGESİ... 1

İÇİNDEKİLER I. TARIMSAL ARAŞTIRMA ENSTİTÜLERİ VE İSTASYONLARI GÖREV YÖNERGESİ... 1 İÇİNDEKİLER I. TARIMSAL ARAŞTIRMA ENSTİTÜLERİ VE İSTASYONLARI GÖREV YÖNERGESİ... 1 a. EK-1 - ARAŞTIRMA ENSTİTÜSÜ VE İSTASYONLARININ ÖZEL GÖREVLERİ... 5 1. ATATÜRK BAHÇE KÜLTÜRLERİ MERKEZ ARAŞTIRMA ENSTİTÜSÜ

Detaylı

Sorun Analizi (Sorunların Sektörlere Ayrılarak Belirlenmesi)

Sorun Analizi (Sorunların Sektörlere Ayrılarak Belirlenmesi) 1.1 Sorun Analizi I. Beş Yıllık Yönetim planı sürecinde oluşturulan sorun analizi, II. Beş Yıllık Yönetim Planı sürecinde gerçekleştirilen anket ve saha çalışmaları, ayrıca yönetim planı hazırlama sürecinde

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

Doğal Bileşikler ve Yeni İlaçların Keşfindeki Önemi

Doğal Bileşikler ve Yeni İlaçların Keşfindeki Önemi Doğal Bileşikler ve Yeni İlaçların Keşfindeki Önemi Doç. Dr. Ömer KOZ HO Bursa Teknik Üniversitesi, Kimya Bölümü HO BTÜ, 2014-2015 Güz Yarıyılı Seminerleri «Perşembe Seminerleri» 20 Kasım 2014 Bursa Başlıklar:

Detaylı

SÜLEYMAN DEMİREL ÜNİVERSİTESİ AKADEMİK PERSONEL MEMNUNİYET ANKETİ RAPORU- 2017

SÜLEYMAN DEMİREL ÜNİVERSİTESİ AKADEMİK PERSONEL MEMNUNİYET ANKETİ RAPORU- 2017 SÜLEYMAN DEMİREL ÜNİVERSİTESİ AKADEMİK PERSONEL MEMNUNİYET ANKETİ RAPORU- 2017 Üniversitemizde görev yapan akademik personelin kurumdan memnuniyet ve beklenti düzeylerini belirlemek amacıyla Süleyman Demirel

Detaylı

AB ÜLKELERİ, ABD 2. Epidemiyoloji Eğitimi. Epidemiyoloji Eğitimi. Epidemiyoloji Eğitimi. Sebzecilikte Biyotik Streslere Dayanıklılık Islahı

AB ÜLKELERİ, ABD 2. Epidemiyoloji Eğitimi. Epidemiyoloji Eğitimi. Epidemiyoloji Eğitimi. Sebzecilikte Biyotik Streslere Dayanıklılık Islahı Çalıştığı Birim Süresi Gideceği Ülke Ersin KARACABEY Yozgat İl Gıda, Tarım ve Hayvancılık 0-24 AY 1 Tarımsal İstatistik, 2 3 4 5 6 7 8 Mesut MANAV Tolga ARABACI Elektrik Elektronik Mühendisi Dr.Fevziye

Detaylı

TÜRKİYE TOHUMCULUĞUNUN AR-GE İHTİYACI. Dr. Vehbi ESER TÜRKTOB

TÜRKİYE TOHUMCULUĞUNUN AR-GE İHTİYACI. Dr. Vehbi ESER TÜRKTOB ب TÜRKİYE TOHUMCULUĞUNUN AR-GE İHTİYACI Dr. Vehbi ESER TÜRKTOB Neden Ar-Ge Farklı problemler Farklı çözümler gerektirir Başarının anahtarı ise Çok disiplinli çalışmaktır Ar-Ge Nedir? Yeni bilgi ve bulgular

Detaylı

Not: Programda belirtilmeyen dersler var ise öğretim üyesi ile temasa geçilmelidir.

Not: Programda belirtilmeyen dersler var ise öğretim üyesi ile temasa geçilmelidir. BAHÇE BİTKİLERİ BÖLÜMÜ GÜZ YARIYILI SINAV PROGRAMI Matematik Botanik (ZF306 ) Bahçe Bitkilerine Giriş Fizik Toprak Bilgisi Sebze Tohumculuğu Genel Meyvecilik Bahçe Bitkilerinde Hasat ve Muhafaza I I Genel

Detaylı

TEK SAĞLIK YAKLAŞIMIYLA ZOONOTİK HASTALIKLARA BAKIŞ (SAĞLIK BAKANLIĞI PERSPEKTİFİ)

TEK SAĞLIK YAKLAŞIMIYLA ZOONOTİK HASTALIKLARA BAKIŞ (SAĞLIK BAKANLIĞI PERSPEKTİFİ) TEK SAĞLIK YAKLAŞIMIYLA ZOONOTİK HASTALIKLARA BAKIŞ (SAĞLIK BAKANLIĞI PERSPEKTİFİ) Dr. Ebru AYDIN Zoonotik ve Vektörel Hastalıklar Daire Başkanı 1 SAĞLIK BAKANLIĞINDA ZOONOTİK HASTALIKLAR İLE İLGİLİ YAPILANMA

Detaylı

Çankaya Belediyesi Uygulamaları

Çankaya Belediyesi Uygulamaları Çankaya Belediyesi Uygulamaları İklim Değişikliğine Yerel Çözümler: Yağmur Hasadı Konferansı Ekim 2016 Yağmur Hasadı Planlaması Yapılacak Alanlar Köylerimiz-Kırsal Alanlarımız Parklarımız - Yaşar Kemal

Detaylı

TÜBİTAK 1003 Buğday Tuzluluğu Projesinin Üçüncü Dönem Raporu Özeti

TÜBİTAK 1003 Buğday Tuzluluğu Projesinin Üçüncü Dönem Raporu Özeti TÜBİTAK 1003 Buğday Tuzluluğu Projesinin Üçüncü Dönem Raporu Özeti Toprak tuzluluğu, özellikle kurak ve yarı kurak bölgelerde buğday verimliliğini etkileyen başlıca tarımsal sorunlardan biridir. Ayrıca,

Detaylı

2013 YILI İÇ PAYDAŞ ANALİZ RAPORU

2013 YILI İÇ PAYDAŞ ANALİZ RAPORU 2013 YILI İÇ PAYDAŞ ANALİZ RAPORU Burcu GENÇ ARALIK 2013 Çanakkale Ticaret Borsasına kayıtlı 55 şahıs ve 15 şirket olmak üzere toplam 70 üye ile yüz yüze anket yapılmıştır. Anket verileri 2013 kapsamaktadır.

Detaylı

ÇANKAYA BELEDİYESİ KIRSAL KALKINMA PROJESİ ONURLU VE DÜZENLİ TOKLUK İÇİN KIR KENT BARIŞI

ÇANKAYA BELEDİYESİ KIRSAL KALKINMA PROJESİ ONURLU VE DÜZENLİ TOKLUK İÇİN KIR KENT BARIŞI ÇANKAYA BELEDİYESİ KIRSAL KALKINMA PROJESİ ONURLU VE DÜZENLİ TOKLUK İÇİN KIR KENT BARIŞI Kent ve Tarım Çalışma Alanı: Akarlar Çavuşlu Evciler Karahasanlı Karataş Kömürcü Yakupabdal Yayla Tohumlar Çevre

Detaylı

GIDA ve KONTROL GENEL MÜDÜRLÜĞÜ. Dursun KODAZ Gıda Mühendisi Gıda İşletmeleri ve Kodeks Daire Başkanlığı

GIDA ve KONTROL GENEL MÜDÜRLÜĞÜ. Dursun KODAZ Gıda Mühendisi Gıda İşletmeleri ve Kodeks Daire Başkanlığı GIDA ve KONTROL GENEL MÜDÜRLÜĞÜ Dursun KODAZ Gıda Mühendisi Gıda İşletmeleri ve Kodeks Daire Başkanlığı GENEL MÜDÜRLÜK YAPISI GIDA VE KONTROL GENEL MÜDÜRLÜĞÜ-ORGANİZASYON ŞEMASI GENEL MÜDÜR GENEL MÜDÜR

Detaylı

Fen Edebiyat Fak. Moleküler Biyoloji ve Genetik Bölümü Kütahya 1977

Fen Edebiyat Fak. Moleküler Biyoloji ve Genetik Bölümü Kütahya 1977 Adı Soyadı Ünvanı Birimi Doğum Yeri Doğum Tarihi BİLECİK ŞEYH EDEBALİ ÜNİVERSİTESİ İsmail POYRAZ Yrd.Doç.Dr. AKADEMİK ÖZGEÇMİŞ FORMU KİŞİSEL BİLGİLER Fen Edebiyat Fak. Moleküler Biyoloji ve Genetik Bölümü

Detaylı

Biyokimya (CEAC 212) Ders Detayları

Biyokimya (CEAC 212) Ders Detayları Biyokimya (CEAC 212) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Saati Kredi AKTS Biyokimya CEAC 212 Güz 3 0 0 3 5 Ön Koşul Ders(ler)i CEAC 202 Dersin Dili Dersin Türü

Detaylı

2014 TARIM SEKTÖRÜ MUHTELİF İNŞAAT YAPIM VE BÜYÜK ONARIMLARI. İşin Başlama-Bitiş Tarihi. Aşı Muhafaza Deposu İnşaatı 2014-2014 75.

2014 TARIM SEKTÖRÜ MUHTELİF İNŞAAT YAPIM VE BÜYÜK ONARIMLARI. İşin Başlama-Bitiş Tarihi. Aşı Muhafaza Deposu İnşaatı 2014-2014 75. Karakteristik İşin Başlama-Bitiş Tarihi Proje Tutarı (TL) 1 Destek Hizmetleri Dairesi Başkanlığı Hizmet Binası Bakım ve Onarımı -.0.500,00 İl /Kuruluş Afyonkarahisar İl Gıda, Tarım ve Hayvancılık Ankara

Detaylı

Ara Dönem Özet Faaliyet Raporu Eylül Merrill Lynch Yatırım Bank A.Ş.

Ara Dönem Özet Faaliyet Raporu Eylül Merrill Lynch Yatırım Bank A.Ş. Ara Dönem Özet Faaliyet Raporu Eylül 2009 Merrill Lynch Yatırım Bank A.Ş. Yönetim Kurulu Başkanı ve Genel Müdür'ün Eylül 2009 Dönemi Değerlendirmeleri ve Beklentileri Merrill Lynch, küresel stratejisinin

Detaylı

Genetik Tanı ve Hücre Tedavi Hizmetlerinde İnovasyon

Genetik Tanı ve Hücre Tedavi Hizmetlerinde İnovasyon Genetik Tanı ve Hücre Tedavi Hizmetlerinde İnovasyon Fikirden Faturaya.. Ürün inovasyonu: pazarda bulunanlardan farklı mamul maddeler Servis inovasyonu: Farklı hizmetlerin yaratılması veya varolan servislerin

Detaylı

BİYOLOG TANIM. Canlı türlerinin tanımlanması, sınıflandırılması, yaşamı ve evrimini etkileyen koşullar üzerinde araştırma yapan kişidir.

BİYOLOG TANIM. Canlı türlerinin tanımlanması, sınıflandırılması, yaşamı ve evrimini etkileyen koşullar üzerinde araştırma yapan kişidir. TANIM Canlı türlerinin tanımlanması, sınıflandırılması, yaşamı ve evrimini etkileyen koşullar üzerinde araştırma yapan kişidir. A- GÖREVLER Biyologların görevleri araştırmacı ve uygulamacı olmalarına göre

Detaylı