Ankara University Faculty of Medicine, Department of Medical Microbiology, Ankara, Turkey.

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Ankara University Faculty of Medicine, Department of Medical Microbiology, Ankara, Turkey."

Transkript

1 Özgün Çalışma/Original Article Mikrobiyol Bul 2017; 51(3): doi: /mb Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim* Antimicrobial Susceptibilities and Molecular Characterization of Toxin-Positive Clostridium difficile Isolates: The First Report on the Presence of Hypervirulent Strains from Turkey Emrah SALMAN 1,2, Belkıs LEVENT 3, Zeynep Ceren KARAHAN 1 1 Ankara Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara. 1 Ankara University Faculty of Medicine, Department of Medical Microbiology, Ankara, Turkey. 2 Çukurova Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Tıbbi İmmünoloji Bilim Dalı, Adana. 2 Cukurova University Faculty of Medicine, Department of Medical Microbiology, Discipline of Medical Immunology, Adana, Turkey. 3 Türkiye Halk Sağlığı Kurumu, Mikrobiyoloji Referans Laboratuvarları Daire Başkanlığı, Ankara. 3 Turkish Public Health Institution, National Microbiology Reference Laboratory, Ankara, Turkey. Geliş Tarihi (Received): Kabul Ediliş Tarihi (Accepted): * Bu çalışma, Ankara Üniversitesi Bilimsel Araştırma Projeleri Koordinatörlüğü tarafından 13L proje numarasıyla desteklenmiş ve 3. Klinik Mikrobiyoloji Kongresi (18-22 Kasım 2015, Belek, Antalya) nde sözlü bildiri olarak sunulmuştur. ÖZ Clostridium difficile günümüzde en önemli hastane kökenli enfeksiyonlardan birisidir. Hipervirülan C.difficile suşları ile oluşan enfeksiyonlar daha yüksek morbidite ve mortalite, komplikasyonlar ve relaps oranları ile seyretmektedir. Yüksek düzeyde toksin üreten hipervirülan C.difficile suşları daha yüksek sporlanma oranı ve florokinolonlara artmış direnç özelliği taşımaktadır. Oluşabilecek yüksek oranda morbidite, mortalite ve sağlık maliyetlerindeki artışı önlemek için ciddi salgınlara yol açmadan önce, patojenitesi yüksek C.difficile izolatlarının tanımlanması gerekmektedir. Bu çalışmada, Eylül 2012-Kasım 2014 tarihleri arasında Ankara daki üç farklı laboratuvara başvuran hastaların toksin pozitifliği tespit edilen dışkı örneklerinden anaerobik kültür ile izole edilen 61 adet C.difficile izolatının antimikrobiyal duyarlılıklarının belirlenmesi ve moleküler özelliklerinin araştırılması amaçlanmıştır. Suşların antibiyotik İletişim (Correspondence): Uzm. Dr. Emrah Salman, Çukurova Üniversitesi Tıp Fakültesi, Tıbbi Immünoloji Bilim Dalı, Adana, Türkiye Tel (Phone): , E-posta ( ):

2 Salman E, Levent B, Karahan ZC. duyarlılıkları gradiyent test şeritleri kullanılarak saptanmış ve sonuçlar güncel Clinical and Laboratory Standards Institute (CLSI) ve The European Committee on Antibiotic Susceptibility Testing önerilerine göre yorumlanmıştır. Toksin genlerinin varlığı polimeraz zincir reaksiyonu (PCR) ile, tcdc geni mutasyonları PCR amplifikasyonunu takiben dizi analizi ile araştırılmıştır. Tespit edilen bir hipervirülan suşun genetik karakterizasyonu Türkiye Halk Sağlığı Kurumu tarafından GenoType CDiff (Hain Lifescience, Almanya) testi kullanılarak gerçekleştirilmiştir. Suşların tümünün vankomisin ve metronidazole duyarlı olduğu bulunmuştur. Üç (%4.9) suşun moksifloksasin için minimum inhibitör konsantrasyonu (MİK) > 8 µg/ml olup dirençlidir. Eritromisin için saptanan MİK 50 ve MİK 90 değerleri sırasıyla 1.5 µg/ml ve 3 µg/ml iken klindamisin için saptanan MİK 50 değeri 2 µg/ml, MİK 90 değeri 4 µg/ml dir. Suşların tümünün tcda ve tcdb geni taşıdığı tespit edilmiştir. Bir (%1.6) suşun binary-toksin genlerini (cdta ve cdtb) taşıdığı tespit edilmiştir. Binary-toksin pozitif bulunan izolatın tcdc geninde 54 bp lik delesyonla birlikte tek nükleotit değişimi tespit edilirken, 12 (%19.6) suşun tcdc geninde çeşitli tek nükleotit değişimleri taşıdığı tespit edilmiştir. Çalışmanın sonuçları ülkemizde hipervirülan suşların bulunduğunu fakat; henüz ribotip 027 varlığı açısından kanıta ulaşılamadığını göstermektedir. Bununla birlikte bu izolatların tüm dünya genelinde artan sıklıkta bildirilmesi nedeniyle, tüm dünyada olduğu gibi ülkemizde de sürveyans çalışmalarının yapılması ve izolatların karakterizasyonu önemli görülmektedir. Anahtar sözcükler: Clostridium difficile; antimikrobiyal direnç; toksin genleri; hipervirülan suş. ABSTRACT Clostridium difficile infection is one of the most important hospital-acquired infections. Infections caused by hypervirulent C.difficile strains which produce toxins at high levels, have higher morbidity and mortality rates, more complications and relapses. They are characterized by higher sporulation ratios and resistance rates for fluoroquinolones. In order to prevent serious morbidities, mortalities and remarkable increase in health costs, highly pathogenic C.difficile strains must be identified before causing severe outbreaks. The aim of this study was to determine the antimicrobial susceptibilities and molecular characteristics of 61 C.difficile strains isolated by culture from toxin-positive fecal samples of patients who were admitted to three different laboratories in Ankara, between September 2012 and November Antimicrobial susceptibilities were determined by using gradient test strips and results were interpreted according to the current CLSI and EUCAST criteria. The presence of toxin genes was investigated by polymerase chain reaction (PCR), and mutations in the tcdc gene were determined by sequence analysis following PCR amplification. Genetic characterization of one hypervirulent strain was performed by Public Health Institution of Turkey using the GenoType CDiff (Hain Lifescience, Germany) test. All strains were susceptible to vancomycin and metronidazole. Three (4.9%) isolates were resistant to moxifloxacin with a minimum inhibitory concentration (MIC) of > 8 µg/ml. The MIC 50 and MIC 90 values for erythromycin and clindamycin were µg/ml, and 2-4 µg/ml, respectively. All strains carried the tcda and tcdb genes, and 1 (1.6%) was positive for the binary-toxin (cdta and cdtb) genes. The binary-toxin positive strain carried a 54 bp deletion as well as a single nucleotide change in the tcdc gene. Various single nucleotide changes were found in the tcdc gene of 12 strains (19.6%). Our results have shown that, hypervirulent strains exist in our country, but we have no evidence for the presence of ribotype 027 yet. On the other hand, when the increasing incidence of these strains through out the world is taken into consideration, it would be of great importance to perform surveillance studies and characterize the isolated strains. Keywords: Clostridium difficile; antimicrobial resistance; toxin genes; hypervirulent strain. GİRİŞ Clostridium difficile anaerobik, gram-pozitif, sporlu bir basildir. Komplikasyonsuz hafif ishalden ölümcül toksik megakolon ve kolon perforasyonuna değişen hastalıkla ilişkilidir. 237

3 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim C.difficile enfeksiyonu (CDE) gelişiminde antibiyotik kullanımı en önemli risk faktörüdür 1. C.difficile, hastane kaynaklı ishalin de başlıca nedenidir ve artmış morbidite-mortaliteyle seyreden salgınlardan sorumludur 2. C.difficile nin majör toksinleri tcda ve tcdb genlerince kodlanan toksin A (enterotoksin) ve toksin B (sitotoksin) dir. tcdc, toksin A ve toksin B nin negatif düzenleyicisidir. Bazı C.difficile suşlarınca aktin spesifik ADP-ribozilleyici binary-toksin üretilmektedir. Yüksek düzeyde toksin üreten hipervirülan C.difficile suşları florokinolonlara dirençle karakterizedir ayrıca daha yüksek morbidite-mortalite, komplikasyonlar ve relapslarla ilişkilendirilmektedir. Patojenik C.difficile suşlarının varlığı, ağır bir C.difficile salgınına yol açmadan önce ortaya konmalıdır. Aksi takdirde kolektomi, ölümler ve sağlık hizmetlerinde ciddi maliyet artışlarına neden olabilmektedir. CDE riskini azaltıcı uygun önlemlerin alınabilmesi, etkin sürveyans çalışmalarıyla mümkündür 3. CDE tedavisinde sıklıkla metronidazol ve vankomisin kullanılmaktadır. C.difficile her iki antibiyotiğe duyarlı kabul edilse de C.difficile nin metronidazol ve vankomisine karşı artmış minimum inhibitör konsantrasyonu (MİK) ile ilişkili yayınlar bulunmaktadır 4. Bu çalışmada, amacımız 2012 Eylül-2014 Kasım ayları arasında Ankara daki üç farklı laboratuvardan alınan toksin-pozitif dışkı örneklerinden izole edilen C.difficile suşlarının antibiyotik duyarlılıkları ve moleküler özelliklerinin saptanmasıdır. GEREÇ ve YÖNTEM Bakterilerin İzolatlar Çalışmada Ankara Üniversitesi Tıp Fakültesi (AÜTF) Merkez Laboratuvarı, Hacettepe Üniversitesi Tıp Fakültesi (HÜTF) Merkez Laboratuvarı ve Düzen Laboratuvarlar Grubu (DLG) ndan Eylül 2012-Kasım 2014 tarihleri arasında randomize olarak toplanan 61 dışkı örneği değerlendirildi. Hastaların demografik bilgileri hastane kayıtlarından sağlandı ve son altı haftada antibiyotik kullanımı kaydedildi. Araştırma, AÜTF Etik Kurulu tarafından onaylandı (Onay no ). CDE şüphesiyle laboratuvarlara gönderilen ve kurumun rutin analizde kullandığı yöntemle [AÜTF de Xpect toxin A/B test (Remel, ABD), HÜTF de in-house PCR ve DLG de VIDAS C.difficile toxin A&B test (BioMérieux SA, Marcy l Etoile, Fransa) ] toksin pozitifliği tespit edilen dışkı örneklerinden suşların izolasyonu için örnekler AÜTF Tıbbi Mikrobiyoloji Anabilim Dalı Anaerob Laboratuvarında alkolle muamele edildikten sonra %7 at kanlı ve %0.1 taurokolik asitli, indirgenmiş sikloserin-sefoksitin-fruktoz agarda üretildi. Plaklar 37 o C de anaerobik şartlarda 48 saat inkübe edildi. Üreyen koloniler konvansiyonel yöntemler (tipik koloni morfolojisi, koku, Gram boya morfolojisi) ve Crystal Anaerop kit (BBL, ABD) kullanılarak tanımlandı. Toksin-pozitif ve toksin-negatif kontrol olarak sırasıyla BAA-1870 ve ATCC suşları kullanıldı. Antibiyotik Duyarlılık Testleri Vankomisin, metronidazol, moksifloksasin, eritromisin ve klindamisin için MİK değerleri gradiyent test (Gtest) şeritleri (Liofilchem, İtalya) kullanılarak saptanmıştır. He- 238

4 Salman E, Levent B, Karahan ZC. Tablo I. Çalışmada Kullanılan Primerler ve Reaksiyon Koşulları Hedef gen Primer adı Primer dizisi (5-3 ) NKV011 TTTTGATCCTATAGAATCTAACTTAGTAAC tcda NK9 CCACCAGCTGCAGCCATA NK104 GTGTAGCAATGAAAGTCCAAGTTTACGC tcdb NK105 CACTTAGCTCTTTGATTGCTGCACCT cdta CdtAfw TGAACCTGGAAAAGGTGATG CdtArev AGGATTATTTACTGGACCATTTG cdtb CdtBfw CTTAATGCAAGTAAATACTGAG CdtBrev AACGGATCTCTTGCTTCAGTC tcdcf-17 AAAAGGGAGATTGTATTATGTTTTTC tcdc tcdr+462 CAATAACTTGAATAACCTTACCTTCA Amplikon büyüklüğü (bp) Reaksiyon koşulları 95 o C de 20 saniye o C de 2 dakika (x35) o C de 20 saniye 55 o C de 2 dakika (x35) o C de 50 saniye 47 o C de 40 saniye o C de 50 saniye (x35) o C de 45 saniye 52 o C de 1 dakika (x30) Referans no

5 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim min, vitamin K1 ve %5 defibrine koyun kanlı indirgenmiş Brucella kanlı agar plaklarına 1 McFarland standardında inokulüm ekildikten sonra Gtest şeritleri yerleştirildi. Anaerobik koşullarda saat inkübasyondan sonra üreticinin talimatları doğrultusunda MİK değerleri kaydedildi. Kontrol suşu olarak C.difficile ATCC kullanıldı. Vankomisin ve metronidazol için MİK değerleri, The European Committee Antimicrobial Susceptibility Testing (EUCAST) 5 tarafından önerilen epidemiyolojik eşik (Epidemiological cut-off, Ecoff) değerleriyle değerlendirildi; her iki antibiyotik için de MİK 2 mg/l değerleri sokak izolatlarının dağılımına uygun olarak duyarlı kabul edildi. Moksifloksasin için duyarlılık kategorileri Clinical and Laboratory Standards Institute (CLSI) 6 önerileri doğrultusunda MİK 2 µg/ml için duyarlı, 8 µg/ml için dirençli olarak belirlendi. Klindamisin ve eritromisin için tespit edilen MİK değerleri kaydedildi ve izolatların MİK 50 ve MİK 90 değerleri belirlendi. İstatistiksel analiz SPSS programında Fisher kesin ki-kare testi kullanılarak yapıldı. Moleküler Analiz Brucella kanlı agar plaklarında üreyen C.difficile kolonilerinden ticari kit (DNeasy virus mini kit v2.0, Qiagen, ABD) kullanılarak üreticinin önerileri doğrultusunda DNA ekstraksiyonu gerçekleştirildi. C.difficile toksin genleri literatürde tanımlandığı şekilde PCR ile saptandı 7-9. Kullanılan primerler ve reaksiyon koşulları Tablo I de gösterilmiştir. tcdc geni mutasyonlarının belirlenmesi için literatürde tanımlandığı şekilde PCR ile amplifikasyonu takiben aynı primerlerle tek yönlü dizi analizi (Applied Biosystems 3130xl Genetic analyzer, AbiPrism, ABD) yapıldı, yeterli okuma sağlanamayan izolatlara karşı yön sekansı uygulandı 10. Elde edilen diziler, GenBank ta kayıtlı VPI10463 suşunun tcdc dizisiyle karşılaştırıldı. Hipervirülan Suşun Genetik Karakterizasyonu İzolatlar içerisinde binary-toksin genlerini taşıyan ve tcdc geninde delesyon saptanan tek hipervirülan suş Türkiye Halk Sağlığı Kurumuna gönderildi. Suşun genetik karakterizasyonu, toksin A, B ve binary-toksin genlerinin varlığını, tcdc genindeki delesyonları ve gyra genindeki mutasyonları tanımlayan ve hibridizasyon prensibiyle çalışan GenoType CDiff (Hain Lifescience, Almanya) kiti kullanılarak gerçekleştirildi (Şekil 1). BULGULAR Hastaların 26 (%42) sı erkek ve 35 (%58) i kadın olup ortalama yaş dir. Hastaların 38 (%62.2) inde hastanede yatış, tamamında antibiyotik kullanma öyküsü vardır. Hastaların 18 (%29.5) i sefalosporin, 15 (%24.5) i karbapenem, 14 (%22.9) ü penisilin, 10 (%16.3) u florokinolon, 9 (%14.7) u aminoglikozit ve 8 (%13.1) i glikopeptit sınıfı antibiyotikleri daha önceden kullanmıştır. Alınan antibiyotiklerle tespit edilen direnç profilleri arasında ilişki saptanmamıştır. Hastaların 42 (%68.9) sinde monoterapi, 19 (%31.1) unda kombine antibiyotik kullanımı olduğu belirlenmiştir. Hastaların 13 (%34) ünde malignite ve 17 (%44) sinde kronik hastalık öyküsü (kronik obstrüktif akciğer hastalığı, böbrek yetmezliği, diyabet, ülseratif kolit) saptanmıştır. 240

6 Salman E, Levent B, Karahan ZC. Tablo II. Eritromisin ve Klindamisin İçin İzolatların MİK Dağılımları, MİK 50 ve MİK 90 Değerleri MİK 50 (µg/ml) MİK 90 (µg/ml) Eritromisin için izolatların MİK değerleri (µg/ml) > 256 n (%) (1.6) 2 (3.2) 3 (4.8) 2 (3.2) 12 (19.2) 19 (30.4) 15 (24) 3 4.8) 2 (3.2) - 2 (3.2) MİK 50 (µg/ml) MİK 90 (µg/ml) Klindamisin için izolatların MİK değerleri (µg/ml) > 256 n (%) (1.6) 1 (1.6) 5 (8) 12 (19.2) 11 (17.6) 13 (20.8) 6 (9.6) 10 (16) 1 (1.6) - 1 (1.6) MİK: Minimum inhibitör konsantrasyonu. 241

7 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim Suşların tamamı vankomisin ve metronidazole, 58 (%95.1) i moksifloksasine duyarlı olarak saptanmıştır. Eritromisin ve klindamisin için tespit edilen MİK aralıklarıyla MİK 50 ve MİK 90 değerleri Tablo II de verilmiştir. Çoklu antibiyotik direncine rastlanılmamıştır. Merkezler arasında direnç dağılımları arasında fark bulunmamıştır (p> 0.05). Hastanede yatış öyküsü olan 38 (%62.2) hasta hastane kaynaklı, diğerleri toplum kaynaklı olarak değerlendirildiğinde, iki grup arasında izolatların antibiyotik direnç oranları açısından anlamlı fark bulunmamıştır (p> 0.05). Suşların tümü tcda ve tcdb genleri taşımaktadır. Bir (%1.6) C.difficile suşunun binarytoksin genlerini (cdta ve cdtb) taşıdığı saptanmıştır. Bir C.difficile suşunda tcdc geninde 54 bp lik delesyon ve 378. pozisyonda guanin Adenin değişimi (G378A) saptanmıştır (GenBank erişim numarası: ). On (%16.4) izolatta 50. Aminoasitte Ala Ser değişimine neden olan G148T değişimi, 1 (%1.6) izolatta T150C sessiz mutasyonu ve 1 (%1.6) izolatta 138. aminoasitte Asp Glu değişimine neden olan C414A değişimi tespit edilmiştir (GenBank erişim numaraları sırasıyla , , ). tcdc geninde 54 bp lik delesyon saptanan suşta florokinolonlara dirençle karakterize gyra geninde mutasyon gözlenmemiş; ribotip 027 dışı hipervirülan suş olarak tanımlanmıştır (Şekil 1). Şekil 1. Binary-toksin üreten izolatın GenoType CDiff (Hain Lifescience, Almanya) kiti ile moleküler karakterizasyonu. 242

8 Salman E, Levent B, Karahan ZC. TARTIŞMA C.difficile antibiyotikle ilişkili ishalin başlıca sebebi olup nozokomiyal enfeksiyonların önde gelen nedenidir. Beta-laktamlar, beta-laktam/beta-laktamaz inhibitör kombinasyonları, florokinolonlar ve linkozamidler, CDE ile en sık ilişkili antimikrobiyal ilaçlardır 11. Çalışmamız kapsamındaki hasta grubunda en fazla kullanılan antibiyotikler beta-laktamlar (n= 47, %77) olup, bu grubu florokinolonlar, aminoglikozitler ve glikopeptitler izlemektedir. Tedavi açısından daha ucuz olması, kullanım kolaylığı ve vankomisine dirençli enterokokların seçimine neden olmaması dolayısıyla, metronidazol daha çok tercih edilmektedir 12. Yapılan çalışmalarda metronidazol direnci %2-6.3 olarak bildirilmiştir 13,14. Vankomisine dirençli ilk C.difficile suşu 1991 de Polonya da bildirilmiş 15, ardından vankomisine dirençli suşların sıklığında artış (2000 de % , 2005 te %21.6) gözlenmiştir 14,16,17. Çalışmamızda değerlendirilen suşların tümü CDE tedavisinde ilk seçenek olan metronidazol ve vankomisine duyarlı olarak saptanmıştır. Moksifloksasin direnci C.difficile hipervirülan suşlarının önceden belirlenmesinde önemlidir ve çeşitli çalışmalarda % arasında moksifloksasin direnci bildirilmiştir Çalışmamızda moksifloksasin direnci %4.9 olarak tespit edilmiştir. Göreceli düşük direnç oranının, hipervirülan suşların veya hastaneler tarafından bildirilen salgınların az olmasından kaynaklanmaktadır. Geçmiş yıllarda, dünya genelinde hipervirülan (ribotip 027/NAP1/B1 gibi) veya varyant (tcda-/tcdb+) suşlarla artan sıklıkta salgınlar bildirilmiştir 22. Hipervirülan suşlar binary-toksin üretimi, tcdc geninde delesyonlar ve moksifloksasin direnciyle karakterizedir 23. Günümüze kadar ülkemizden bu suşlarla ilgili bildirim yapılmamıştır 24,25. Türkiye yi de kapsayan 14 Avrupa ülkesinin yer aldığı çok merkezli çalışmada 354 toksijenik suşun %24.3 ünde varyant genler tespit edilmekle birlikte, varyant genler Türkiye den gönderilen örneklerde saptanmamıştır. Söz konusu varyant izolatların %17.2 sinde binary-toksin eksprese edilmektedir 22. Farklı çalışmalarda binary-toksin üreten C.difficile suşlarının prevalansı %6-23 arasında bildirilmiştir 6,7,20. Çalışmamızda sadece bir (%1.6) izolat binary-toksin pozitif bulunmuştur. Bu suş, bugüne kadar ülkemizde karakterize edilen ilk hipervirülan suştur. Bu suş, Haziran 2013 te Tokat ta özel bir klinikte prostat operasyonunu takiben kronik ishal yakınmasıyla başvuran 85 yaşında erkek hastadan izole edilmiştir. Siprofloksasin ve metronidazol başlanan hastaya, ishalin kötüleşmesi ve dışkıda kan varlığı nedeniyle kolonoskopi uygulanmış ve dışkı örneği C.difficile toksin değerlendirimi açısından DLG ye gönderilmiştir. Kolonoskopide, kolonda ülserasyonlar gözlenmesiyle hastanın tedavisine vankomisin eklenmiştir. Hasta herhangi bir komplikasyon gözlenmeksizin iyileşerek taburcu edilmiştir. Bu suşun metronidazol için MİK değeri 0.25 mg/l olup, metronidazole duyarlı bir izolattır ancak tedavi sırasında klinik tablonun ağırlaşması, kombine antibiyotik kullanımının etkisiyle ve/veya in vivo ortamdaki farmakokinetik etkileşimlerle açıklanabilir. tcdc genindeki çeşitli mutasyonlar genin inaktivasyonuna bağlı olarak artan toksin ekspresyonuna yol açmaktadır. Bu suşlarla olan enfeksiyonlar ağır seyreder ve salgın yap- 243

9 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim ma potansiyeli vardır. Bildirilen mutasyonlar; tek nükleotit polimorfizmleri, 18-, 39- veya 54-baz çiftlik delesyonlar, prematür stop kodonu oluşumu, trunkasyon veya çerçeve kayması mutasyonlardır 7,26. İzolatlarımızdan birinde 54-baz çiftlik delesyon saptanmış olup aminoasitleri kodlayan nükleotitlerin trunkasyonuyla sonuçlanmıştır. Bu izolat ayrıca 378. pozisyonda sessiz bir mutasyona sahiptir (Guanin Adenin değişikliği). Benzer şekilde, 54-baz çiftlik bir delesyon daha yüksek sıklıkta (57 toksijenik izolatın %10.5 inde) görülerek daha önceki bir çalışmada bildirilmiştir 26. İzolatlarımızda en sık tespit edilen mutasyon, önceki çalışmalarda da bildirilen G148T değişikliği olup, bu durum Alanin Serin değişikliğine neden olmaktadır (n= 10, %16.4) 27. Saptanan diğer iki nükleotit değişiminden T150C (n= 1, %1.6), kodlanan aminoasitte değişikliğe neden olmazken C414A (n= 1, %1.6), Asparajin Glutamin değişimine neden olmaktadır. Farklı ülkelerde C.difficile izolatları arasında hipervirülan suşların sıklığı değişkenlik göstermektedir ve ribotip 027 için sıklık %6-100 arasında değişmektedir 22,28,29. Hipervirülan suşların oluşturduğu nozokomiyal CDE de mortalite oranları daha yüksektir. Örneğin; 30 günlük mortalite binary-toksin negatif suşlarda %17 iken, binary-toksin pozitif suşlarda %28 olarak görülmektedir. Yaş, cinsiyet ve coğrafi dağılım ele alındığında tahmini rölatif mortalite riski binary-toksin eksprese eden hipervirülan suşlar için %60 düzeyinde olmaktadır 30. Binary-toksin pozitif olan izolatımız tcdc geninde 54 baz çiftlik delesyona sahip ribotip 027 dışı hipervirülan bir suş olup moksifloksasine duyarlı olarak saptanmıştır. Bu çalışmanın kısıtlılıkları, değerlendirilen suş sayısının nispeten az olması ve suşların genetik karakterizasyonu için ribotipleme yapılamamış olmasıdır. Suşların genetik yakınlıklarının ve ribotiplerinin tanımlanması epidemiyolojik olarak verileri daha ayrıntılı değerlendirmemizi sağlayabilirdi. Çalışmamız kapsamındaki izolatlar antibiyotikler için henüz düşük direnç oranlarıyla karakterize olup tümü metronidazol ve vankomisine duyarlı olarak bulunmuştur. İzolatlar arasında hipervirülan bir suşun tespiti çalışmanın önemli bir bulgusudur. Ülkemizdeki hipervirülan suşların gerçek prevalansı ve özelliklerini ortaya çıkarmak için kültür ve moleküler analizler gerçekleştirilmeli ve suşların ribotipleri saptanmalıdır. Hipervirülan suşlara ülkemizde nadir olarak rastlanması, henüz bu genotipteki bakterilerin ülkemizde salgın oluşturmaması, olası salgınların rapor edilememesiyle açıklanabileceği gibi, CDE tanısının sıklıkla dışkıda toksin varlığının gösterilmesiyle konması ve kültürle suşların izolasyonunu takiben fenotipik ve genotipik karakterizasyonlarının yapılmamasıyla da açıklanabilir. TEŞEKKÜR AÜTF İbn-i Sina Hastanesi Merkez Laboratuvarı, HÜTF Hastanesi Merkez Laboratuvarı ve Ankara DLG personeline dışkı örneklerinin temininde gösterdikleri yardımlardan dolayı teşekkür ederiz. 244

10 Salman E, Levent B, Karahan ZC. KAYNAKLAR 1. Abt MC, McKenney PT, Pamer EG. Clostridium difficile colitis: pathogenesis and host defence. Nat Rev Microbiol 2016; 14(10): Kazanowski M, Smolarek S, Kinnarney F, Grzebieniak Z. Clostridium difficile: epidemiology, diagnostic and therapeutic possibilities-a systematic review. Tech Coloproctol 2014; 18(3): van Dorp SM, Kinross P, Gastmeier P, et al. Standardised surveillance of Clostridium difficile infection in European acute care hospitals: a pilot study, Euro Surveill 2016; 21(29). 4. Simon DB, Mark HW. Antimicrobial resistance and reduced susceptibility in Clostridium difficile: potential consequences for induction, treatment, and recurrence of C.difficile infection. Antibiotics (Basel) 2015; 4(3): European committee on antimicrobial susceptibility testing (Eucast). Breakpoint tables for interpretation of MICs and zone diameters. Version Available at: [ Accessed: Clinical and Laboratory Standards Institute (CLSI). Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria M11-A , 7 th ed. Clinical and Laboratory Standards Institute, Wayne, PA. 7. Pinto LJ, Alcides AP, Ferreira EO, et al. Incidence and importance of Clostridium difficile in paediatric diarrhoea in Brazil. J Med Microbiol 2003; 52(Pt 12): van den Berg RJ, Claas EC, Oyib DH, et al. Characterization of toxin A-negative,toxin B-positive Clostridium difficile isolates from outbreaks in different countries by amplified fragment length polymorphism and PCR ribotyping. J Clin Microbiol 2004; 42(3): Gonçalves C, Decré D, Barbut F, Burghoffer B, Petit JC. Prevalence and characterization of a binary toxin (actin-specific ADP-ribosyltransferase) from Clostridium difficile. J Clin Microbiol 2004; 42(5): Persson S, Torpdahl M, Olsen KE. New multiplex PCR method for the detection of Clostridium difficile toxin A (tcda) and toxin B (tcdb) and the binary toxin (cdta/cdtb) genes applied to a Danish strain collection. Clin Microbiol Infect 2008; 14(11): Brown KA, Khanafer N, Daneman N, Fisman DN. Meta-analysis of antibiotics and the risk of communityassociated Clostridium difficile infection. Antimicrob Agents Chemother 2013; 57(5): Huang H, Weintraub A, Fang H, Nord CE. Antimicrobial resistance in Clostridium difficile. Int J Antimicrob Agents 2009; 34(6): Bishara J, Bloch Y, Garty M, Behor J, Samra Z. Antimicrobial resistance of Clostridium difficile isolates in a tertiary medical center, Israel. Diagn Microbiol Infect Dis 2006; 54(2): Peláez T, Alcalá L, Alonso Ret alrodríguez-créixems M, García-Lechuz JM, Bouza E. Reassessment of Clostridium difficile susceptibility to metronidazole and vancomycin. Antimicrob Agents Chemother 2002; 46(6): Dworczynski A, Sokol B, Meisel-Mikolajczyk F. Antibiotic resistance of Clostridium difficile isolates. Cytobios 1991; 65( ): Wong SS, Woo PC, Luk WK, Yuen KY. Susceptibility testing of Clostridium difficile against metronidazole and vancomycin by disk diffusion and Etest. Diagn Microbiol Infect Dis 1999; 34(1): Mutlu E, Wroe AJ, Sanchez-Hurtado K, Brazier JS, Poxton IR. Molecular characterization and antimicrobial susceptibility patterns of Clostridium difficile strains isolated from hospitals in south-east Scotland. J Med Microbiol 2007; 56(Pt 7): Ackermann G, Degner A, Cohen SH, Silva J Jr, Rodloff AC. Prevalence and association of macrolide lincosamide streptogramin B (MLSB) resistance with resistance to moxifloxacin in Clostridium difficile. J Antimicrob Chemother 2003; 51(3): Spigaglia P, Barbanti F, Mastrantonio P; European Study Group on Clostridium difficile (ESGCD). Multidrug resistance in European Clostridium difficile clinical isolates. J Antimicrob Chemother 2011; 66(10): Kim H, Jeong SH, Roh KH, et al. Investigation of toxin gene diversity. molecular epidemiology and antimicrobial resistance of Clostridium difficile isolated from 12 hospitals in South Korea. Korean J Lab Med 2010; 30(5): Huang H, Weintraub A, Fang H, Wu S, Zhang Y, Nord CE. Antimicrobial susceptibility and heteroresistance in Chinese Clostridium difficile strains. Anaerobe 2010; 16(6):

11 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim 22. Barbut F, Mastrantonio P, Delmée M, Brazier J, Kuijper E, Poxton I ; European Study Group on Clostridium difficile (ESGCD). Prospective study of Clostridium difficile infections in Europe with phenotypic and genotypic characterisation of the isolates. Clin Microbiol Infect 2007; 13(11): Harvala H, Alm E, Akerlund T, Rizzardi K. Emergence and spread of moxifloxacin-resistant Clostridium difficile ribotype 231 in Sweden between 2006 and New Microbe and New Infect 2016; 14: Ergen EK, Akalin H, Yilmaz E, et al. Nosocomial diarrhea and Clostridium difficile associated diarrhea in a turkish university hospital. Med Mal Infect 2009; 39(6): Deniz U, Ulger N, Aksu B, Karavuş M, Söyletir G. Investigation of toxin genes of Clostridium difficile strains isolated from hospitalized patients with diarrhoea at Marmara University Hospital. Mikrobiyol Bul 2011; 45(1): Bouvet PJ, Popoff MR. Genetic relatedness of Clostridium difficile isolates from various origins determined by triple-locus sequence analysis based on toxin regulatory genes tcdc, tcdr, and cdtr. J Clin Microbiol 2008; 46(11): Curry SR, Marsh JW, Muto CA, O Leary MM, Pasculle W, Harrison LH. tcdc genotypes associated with severe tcdc truncation in an epidemic clone and other strains of Clostridium difficile. J Clin Microbiol 2007; 45(1): Kuijper EJ, Coignard B, Brazier JS, et al. Update of Clostridium difficile associated disease due to PCR ribotype 027 in Europe. Euro Surveill 2007; 12(6): E MacCannell DR, Louie TJ, Gregson DB, et al. Molecular analysis of Clostridium difficile PCR ribotype 027 isolates from eastern and western Canada. J Clin Microbiol 2006; 44(6): Bacci S, Molbak K, Kjeldsen MK, Olsen KE. Binary toxin and death after Clostridium difficile infection. Emerg Infect Dis 2011; 17(6):