Ankara University Faculty of Medicine, Department of Medical Microbiology, Ankara, Turkey.

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Ankara University Faculty of Medicine, Department of Medical Microbiology, Ankara, Turkey."

Transkript

1 Özgün Çalışma/Original Article Mikrobiyol Bul 2017; 51(3): doi: /mb Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim* Antimicrobial Susceptibilities and Molecular Characterization of Toxin-Positive Clostridium difficile Isolates: The First Report on the Presence of Hypervirulent Strains from Turkey Emrah SALMAN 1,2, Belkıs LEVENT 3, Zeynep Ceren KARAHAN 1 1 Ankara Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara. 1 Ankara University Faculty of Medicine, Department of Medical Microbiology, Ankara, Turkey. 2 Çukurova Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Tıbbi İmmünoloji Bilim Dalı, Adana. 2 Cukurova University Faculty of Medicine, Department of Medical Microbiology, Discipline of Medical Immunology, Adana, Turkey. 3 Türkiye Halk Sağlığı Kurumu, Mikrobiyoloji Referans Laboratuvarları Daire Başkanlığı, Ankara. 3 Turkish Public Health Institution, National Microbiology Reference Laboratory, Ankara, Turkey. Geliş Tarihi (Received): Kabul Ediliş Tarihi (Accepted): * Bu çalışma, Ankara Üniversitesi Bilimsel Araştırma Projeleri Koordinatörlüğü tarafından 13L proje numarasıyla desteklenmiş ve 3. Klinik Mikrobiyoloji Kongresi (18-22 Kasım 2015, Belek, Antalya) nde sözlü bildiri olarak sunulmuştur. ÖZ Clostridium difficile günümüzde en önemli hastane kökenli enfeksiyonlardan birisidir. Hipervirülan C.difficile suşları ile oluşan enfeksiyonlar daha yüksek morbidite ve mortalite, komplikasyonlar ve relaps oranları ile seyretmektedir. Yüksek düzeyde toksin üreten hipervirülan C.difficile suşları daha yüksek sporlanma oranı ve florokinolonlara artmış direnç özelliği taşımaktadır. Oluşabilecek yüksek oranda morbidite, mortalite ve sağlık maliyetlerindeki artışı önlemek için ciddi salgınlara yol açmadan önce, patojenitesi yüksek C.difficile izolatlarının tanımlanması gerekmektedir. Bu çalışmada, Eylül 2012-Kasım 2014 tarihleri arasında Ankara daki üç farklı laboratuvara başvuran hastaların toksin pozitifliği tespit edilen dışkı örneklerinden anaerobik kültür ile izole edilen 61 adet C.difficile izolatının antimikrobiyal duyarlılıklarının belirlenmesi ve moleküler özelliklerinin araştırılması amaçlanmıştır. Suşların antibiyotik İletişim (Correspondence): Uzm. Dr. Emrah Salman, Çukurova Üniversitesi Tıp Fakültesi, Tıbbi Immünoloji Bilim Dalı, Adana, Türkiye Tel (Phone): , E-posta ( ):

2 Salman E, Levent B, Karahan ZC. duyarlılıkları gradiyent test şeritleri kullanılarak saptanmış ve sonuçlar güncel Clinical and Laboratory Standards Institute (CLSI) ve The European Committee on Antibiotic Susceptibility Testing önerilerine göre yorumlanmıştır. Toksin genlerinin varlığı polimeraz zincir reaksiyonu (PCR) ile, tcdc geni mutasyonları PCR amplifikasyonunu takiben dizi analizi ile araştırılmıştır. Tespit edilen bir hipervirülan suşun genetik karakterizasyonu Türkiye Halk Sağlığı Kurumu tarafından GenoType CDiff (Hain Lifescience, Almanya) testi kullanılarak gerçekleştirilmiştir. Suşların tümünün vankomisin ve metronidazole duyarlı olduğu bulunmuştur. Üç (%4.9) suşun moksifloksasin için minimum inhibitör konsantrasyonu (MİK) > 8 µg/ml olup dirençlidir. Eritromisin için saptanan MİK 50 ve MİK 90 değerleri sırasıyla 1.5 µg/ml ve 3 µg/ml iken klindamisin için saptanan MİK 50 değeri 2 µg/ml, MİK 90 değeri 4 µg/ml dir. Suşların tümünün tcda ve tcdb geni taşıdığı tespit edilmiştir. Bir (%1.6) suşun binary-toksin genlerini (cdta ve cdtb) taşıdığı tespit edilmiştir. Binary-toksin pozitif bulunan izolatın tcdc geninde 54 bp lik delesyonla birlikte tek nükleotit değişimi tespit edilirken, 12 (%19.6) suşun tcdc geninde çeşitli tek nükleotit değişimleri taşıdığı tespit edilmiştir. Çalışmanın sonuçları ülkemizde hipervirülan suşların bulunduğunu fakat; henüz ribotip 027 varlığı açısından kanıta ulaşılamadığını göstermektedir. Bununla birlikte bu izolatların tüm dünya genelinde artan sıklıkta bildirilmesi nedeniyle, tüm dünyada olduğu gibi ülkemizde de sürveyans çalışmalarının yapılması ve izolatların karakterizasyonu önemli görülmektedir. Anahtar sözcükler: Clostridium difficile; antimikrobiyal direnç; toksin genleri; hipervirülan suş. ABSTRACT Clostridium difficile infection is one of the most important hospital-acquired infections. Infections caused by hypervirulent C.difficile strains which produce toxins at high levels, have higher morbidity and mortality rates, more complications and relapses. They are characterized by higher sporulation ratios and resistance rates for fluoroquinolones. In order to prevent serious morbidities, mortalities and remarkable increase in health costs, highly pathogenic C.difficile strains must be identified before causing severe outbreaks. The aim of this study was to determine the antimicrobial susceptibilities and molecular characteristics of 61 C.difficile strains isolated by culture from toxin-positive fecal samples of patients who were admitted to three different laboratories in Ankara, between September 2012 and November Antimicrobial susceptibilities were determined by using gradient test strips and results were interpreted according to the current CLSI and EUCAST criteria. The presence of toxin genes was investigated by polymerase chain reaction (PCR), and mutations in the tcdc gene were determined by sequence analysis following PCR amplification. Genetic characterization of one hypervirulent strain was performed by Public Health Institution of Turkey using the GenoType CDiff (Hain Lifescience, Germany) test. All strains were susceptible to vancomycin and metronidazole. Three (4.9%) isolates were resistant to moxifloxacin with a minimum inhibitory concentration (MIC) of > 8 µg/ml. The MIC 50 and MIC 90 values for erythromycin and clindamycin were µg/ml, and 2-4 µg/ml, respectively. All strains carried the tcda and tcdb genes, and 1 (1.6%) was positive for the binary-toxin (cdta and cdtb) genes. The binary-toxin positive strain carried a 54 bp deletion as well as a single nucleotide change in the tcdc gene. Various single nucleotide changes were found in the tcdc gene of 12 strains (19.6%). Our results have shown that, hypervirulent strains exist in our country, but we have no evidence for the presence of ribotype 027 yet. On the other hand, when the increasing incidence of these strains through out the world is taken into consideration, it would be of great importance to perform surveillance studies and characterize the isolated strains. Keywords: Clostridium difficile; antimicrobial resistance; toxin genes; hypervirulent strain. GİRİŞ Clostridium difficile anaerobik, gram-pozitif, sporlu bir basildir. Komplikasyonsuz hafif ishalden ölümcül toksik megakolon ve kolon perforasyonuna değişen hastalıkla ilişkilidir. 237

3 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim C.difficile enfeksiyonu (CDE) gelişiminde antibiyotik kullanımı en önemli risk faktörüdür 1. C.difficile, hastane kaynaklı ishalin de başlıca nedenidir ve artmış morbidite-mortaliteyle seyreden salgınlardan sorumludur 2. C.difficile nin majör toksinleri tcda ve tcdb genlerince kodlanan toksin A (enterotoksin) ve toksin B (sitotoksin) dir. tcdc, toksin A ve toksin B nin negatif düzenleyicisidir. Bazı C.difficile suşlarınca aktin spesifik ADP-ribozilleyici binary-toksin üretilmektedir. Yüksek düzeyde toksin üreten hipervirülan C.difficile suşları florokinolonlara dirençle karakterizedir ayrıca daha yüksek morbidite-mortalite, komplikasyonlar ve relapslarla ilişkilendirilmektedir. Patojenik C.difficile suşlarının varlığı, ağır bir C.difficile salgınına yol açmadan önce ortaya konmalıdır. Aksi takdirde kolektomi, ölümler ve sağlık hizmetlerinde ciddi maliyet artışlarına neden olabilmektedir. CDE riskini azaltıcı uygun önlemlerin alınabilmesi, etkin sürveyans çalışmalarıyla mümkündür 3. CDE tedavisinde sıklıkla metronidazol ve vankomisin kullanılmaktadır. C.difficile her iki antibiyotiğe duyarlı kabul edilse de C.difficile nin metronidazol ve vankomisine karşı artmış minimum inhibitör konsantrasyonu (MİK) ile ilişkili yayınlar bulunmaktadır 4. Bu çalışmada, amacımız 2012 Eylül-2014 Kasım ayları arasında Ankara daki üç farklı laboratuvardan alınan toksin-pozitif dışkı örneklerinden izole edilen C.difficile suşlarının antibiyotik duyarlılıkları ve moleküler özelliklerinin saptanmasıdır. GEREÇ ve YÖNTEM Bakterilerin İzolatlar Çalışmada Ankara Üniversitesi Tıp Fakültesi (AÜTF) Merkez Laboratuvarı, Hacettepe Üniversitesi Tıp Fakültesi (HÜTF) Merkez Laboratuvarı ve Düzen Laboratuvarlar Grubu (DLG) ndan Eylül 2012-Kasım 2014 tarihleri arasında randomize olarak toplanan 61 dışkı örneği değerlendirildi. Hastaların demografik bilgileri hastane kayıtlarından sağlandı ve son altı haftada antibiyotik kullanımı kaydedildi. Araştırma, AÜTF Etik Kurulu tarafından onaylandı (Onay no ). CDE şüphesiyle laboratuvarlara gönderilen ve kurumun rutin analizde kullandığı yöntemle [AÜTF de Xpect toxin A/B test (Remel, ABD), HÜTF de in-house PCR ve DLG de VIDAS C.difficile toxin A&B test (BioMérieux SA, Marcy l Etoile, Fransa) ] toksin pozitifliği tespit edilen dışkı örneklerinden suşların izolasyonu için örnekler AÜTF Tıbbi Mikrobiyoloji Anabilim Dalı Anaerob Laboratuvarında alkolle muamele edildikten sonra %7 at kanlı ve %0.1 taurokolik asitli, indirgenmiş sikloserin-sefoksitin-fruktoz agarda üretildi. Plaklar 37 o C de anaerobik şartlarda 48 saat inkübe edildi. Üreyen koloniler konvansiyonel yöntemler (tipik koloni morfolojisi, koku, Gram boya morfolojisi) ve Crystal Anaerop kit (BBL, ABD) kullanılarak tanımlandı. Toksin-pozitif ve toksin-negatif kontrol olarak sırasıyla BAA-1870 ve ATCC suşları kullanıldı. Antibiyotik Duyarlılık Testleri Vankomisin, metronidazol, moksifloksasin, eritromisin ve klindamisin için MİK değerleri gradiyent test (Gtest) şeritleri (Liofilchem, İtalya) kullanılarak saptanmıştır. He- 238

4 Salman E, Levent B, Karahan ZC. Tablo I. Çalışmada Kullanılan Primerler ve Reaksiyon Koşulları Hedef gen Primer adı Primer dizisi (5-3 ) NKV011 TTTTGATCCTATAGAATCTAACTTAGTAAC tcda NK9 CCACCAGCTGCAGCCATA NK104 GTGTAGCAATGAAAGTCCAAGTTTACGC tcdb NK105 CACTTAGCTCTTTGATTGCTGCACCT cdta CdtAfw TGAACCTGGAAAAGGTGATG CdtArev AGGATTATTTACTGGACCATTTG cdtb CdtBfw CTTAATGCAAGTAAATACTGAG CdtBrev AACGGATCTCTTGCTTCAGTC tcdcf-17 AAAAGGGAGATTGTATTATGTTTTTC tcdc tcdr+462 CAATAACTTGAATAACCTTACCTTCA Amplikon büyüklüğü (bp) Reaksiyon koşulları 95 o C de 20 saniye o C de 2 dakika (x35) o C de 20 saniye 55 o C de 2 dakika (x35) o C de 50 saniye 47 o C de 40 saniye o C de 50 saniye (x35) o C de 45 saniye 52 o C de 1 dakika (x30) Referans no

5 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim min, vitamin K1 ve %5 defibrine koyun kanlı indirgenmiş Brucella kanlı agar plaklarına 1 McFarland standardında inokulüm ekildikten sonra Gtest şeritleri yerleştirildi. Anaerobik koşullarda saat inkübasyondan sonra üreticinin talimatları doğrultusunda MİK değerleri kaydedildi. Kontrol suşu olarak C.difficile ATCC kullanıldı. Vankomisin ve metronidazol için MİK değerleri, The European Committee Antimicrobial Susceptibility Testing (EUCAST) 5 tarafından önerilen epidemiyolojik eşik (Epidemiological cut-off, Ecoff) değerleriyle değerlendirildi; her iki antibiyotik için de MİK 2 mg/l değerleri sokak izolatlarının dağılımına uygun olarak duyarlı kabul edildi. Moksifloksasin için duyarlılık kategorileri Clinical and Laboratory Standards Institute (CLSI) 6 önerileri doğrultusunda MİK 2 µg/ml için duyarlı, 8 µg/ml için dirençli olarak belirlendi. Klindamisin ve eritromisin için tespit edilen MİK değerleri kaydedildi ve izolatların MİK 50 ve MİK 90 değerleri belirlendi. İstatistiksel analiz SPSS programında Fisher kesin ki-kare testi kullanılarak yapıldı. Moleküler Analiz Brucella kanlı agar plaklarında üreyen C.difficile kolonilerinden ticari kit (DNeasy virus mini kit v2.0, Qiagen, ABD) kullanılarak üreticinin önerileri doğrultusunda DNA ekstraksiyonu gerçekleştirildi. C.difficile toksin genleri literatürde tanımlandığı şekilde PCR ile saptandı 7-9. Kullanılan primerler ve reaksiyon koşulları Tablo I de gösterilmiştir. tcdc geni mutasyonlarının belirlenmesi için literatürde tanımlandığı şekilde PCR ile amplifikasyonu takiben aynı primerlerle tek yönlü dizi analizi (Applied Biosystems 3130xl Genetic analyzer, AbiPrism, ABD) yapıldı, yeterli okuma sağlanamayan izolatlara karşı yön sekansı uygulandı 10. Elde edilen diziler, GenBank ta kayıtlı VPI10463 suşunun tcdc dizisiyle karşılaştırıldı. Hipervirülan Suşun Genetik Karakterizasyonu İzolatlar içerisinde binary-toksin genlerini taşıyan ve tcdc geninde delesyon saptanan tek hipervirülan suş Türkiye Halk Sağlığı Kurumuna gönderildi. Suşun genetik karakterizasyonu, toksin A, B ve binary-toksin genlerinin varlığını, tcdc genindeki delesyonları ve gyra genindeki mutasyonları tanımlayan ve hibridizasyon prensibiyle çalışan GenoType CDiff (Hain Lifescience, Almanya) kiti kullanılarak gerçekleştirildi (Şekil 1). BULGULAR Hastaların 26 (%42) sı erkek ve 35 (%58) i kadın olup ortalama yaş dir. Hastaların 38 (%62.2) inde hastanede yatış, tamamında antibiyotik kullanma öyküsü vardır. Hastaların 18 (%29.5) i sefalosporin, 15 (%24.5) i karbapenem, 14 (%22.9) ü penisilin, 10 (%16.3) u florokinolon, 9 (%14.7) u aminoglikozit ve 8 (%13.1) i glikopeptit sınıfı antibiyotikleri daha önceden kullanmıştır. Alınan antibiyotiklerle tespit edilen direnç profilleri arasında ilişki saptanmamıştır. Hastaların 42 (%68.9) sinde monoterapi, 19 (%31.1) unda kombine antibiyotik kullanımı olduğu belirlenmiştir. Hastaların 13 (%34) ünde malignite ve 17 (%44) sinde kronik hastalık öyküsü (kronik obstrüktif akciğer hastalığı, böbrek yetmezliği, diyabet, ülseratif kolit) saptanmıştır. 240

6 Salman E, Levent B, Karahan ZC. Tablo II. Eritromisin ve Klindamisin İçin İzolatların MİK Dağılımları, MİK 50 ve MİK 90 Değerleri MİK 50 (µg/ml) MİK 90 (µg/ml) Eritromisin için izolatların MİK değerleri (µg/ml) > 256 n (%) (1.6) 2 (3.2) 3 (4.8) 2 (3.2) 12 (19.2) 19 (30.4) 15 (24) 3 4.8) 2 (3.2) - 2 (3.2) MİK 50 (µg/ml) MİK 90 (µg/ml) Klindamisin için izolatların MİK değerleri (µg/ml) > 256 n (%) (1.6) 1 (1.6) 5 (8) 12 (19.2) 11 (17.6) 13 (20.8) 6 (9.6) 10 (16) 1 (1.6) - 1 (1.6) MİK: Minimum inhibitör konsantrasyonu. 241

7 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim Suşların tamamı vankomisin ve metronidazole, 58 (%95.1) i moksifloksasine duyarlı olarak saptanmıştır. Eritromisin ve klindamisin için tespit edilen MİK aralıklarıyla MİK 50 ve MİK 90 değerleri Tablo II de verilmiştir. Çoklu antibiyotik direncine rastlanılmamıştır. Merkezler arasında direnç dağılımları arasında fark bulunmamıştır (p> 0.05). Hastanede yatış öyküsü olan 38 (%62.2) hasta hastane kaynaklı, diğerleri toplum kaynaklı olarak değerlendirildiğinde, iki grup arasında izolatların antibiyotik direnç oranları açısından anlamlı fark bulunmamıştır (p> 0.05). Suşların tümü tcda ve tcdb genleri taşımaktadır. Bir (%1.6) C.difficile suşunun binarytoksin genlerini (cdta ve cdtb) taşıdığı saptanmıştır. Bir C.difficile suşunda tcdc geninde 54 bp lik delesyon ve 378. pozisyonda guanin Adenin değişimi (G378A) saptanmıştır (GenBank erişim numarası: ). On (%16.4) izolatta 50. Aminoasitte Ala Ser değişimine neden olan G148T değişimi, 1 (%1.6) izolatta T150C sessiz mutasyonu ve 1 (%1.6) izolatta 138. aminoasitte Asp Glu değişimine neden olan C414A değişimi tespit edilmiştir (GenBank erişim numaraları sırasıyla , , ). tcdc geninde 54 bp lik delesyon saptanan suşta florokinolonlara dirençle karakterize gyra geninde mutasyon gözlenmemiş; ribotip 027 dışı hipervirülan suş olarak tanımlanmıştır (Şekil 1). Şekil 1. Binary-toksin üreten izolatın GenoType CDiff (Hain Lifescience, Almanya) kiti ile moleküler karakterizasyonu. 242

8 Salman E, Levent B, Karahan ZC. TARTIŞMA C.difficile antibiyotikle ilişkili ishalin başlıca sebebi olup nozokomiyal enfeksiyonların önde gelen nedenidir. Beta-laktamlar, beta-laktam/beta-laktamaz inhibitör kombinasyonları, florokinolonlar ve linkozamidler, CDE ile en sık ilişkili antimikrobiyal ilaçlardır 11. Çalışmamız kapsamındaki hasta grubunda en fazla kullanılan antibiyotikler beta-laktamlar (n= 47, %77) olup, bu grubu florokinolonlar, aminoglikozitler ve glikopeptitler izlemektedir. Tedavi açısından daha ucuz olması, kullanım kolaylığı ve vankomisine dirençli enterokokların seçimine neden olmaması dolayısıyla, metronidazol daha çok tercih edilmektedir 12. Yapılan çalışmalarda metronidazol direnci %2-6.3 olarak bildirilmiştir 13,14. Vankomisine dirençli ilk C.difficile suşu 1991 de Polonya da bildirilmiş 15, ardından vankomisine dirençli suşların sıklığında artış (2000 de % , 2005 te %21.6) gözlenmiştir 14,16,17. Çalışmamızda değerlendirilen suşların tümü CDE tedavisinde ilk seçenek olan metronidazol ve vankomisine duyarlı olarak saptanmıştır. Moksifloksasin direnci C.difficile hipervirülan suşlarının önceden belirlenmesinde önemlidir ve çeşitli çalışmalarda % arasında moksifloksasin direnci bildirilmiştir Çalışmamızda moksifloksasin direnci %4.9 olarak tespit edilmiştir. Göreceli düşük direnç oranının, hipervirülan suşların veya hastaneler tarafından bildirilen salgınların az olmasından kaynaklanmaktadır. Geçmiş yıllarda, dünya genelinde hipervirülan (ribotip 027/NAP1/B1 gibi) veya varyant (tcda-/tcdb+) suşlarla artan sıklıkta salgınlar bildirilmiştir 22. Hipervirülan suşlar binary-toksin üretimi, tcdc geninde delesyonlar ve moksifloksasin direnciyle karakterizedir 23. Günümüze kadar ülkemizden bu suşlarla ilgili bildirim yapılmamıştır 24,25. Türkiye yi de kapsayan 14 Avrupa ülkesinin yer aldığı çok merkezli çalışmada 354 toksijenik suşun %24.3 ünde varyant genler tespit edilmekle birlikte, varyant genler Türkiye den gönderilen örneklerde saptanmamıştır. Söz konusu varyant izolatların %17.2 sinde binary-toksin eksprese edilmektedir 22. Farklı çalışmalarda binary-toksin üreten C.difficile suşlarının prevalansı %6-23 arasında bildirilmiştir 6,7,20. Çalışmamızda sadece bir (%1.6) izolat binary-toksin pozitif bulunmuştur. Bu suş, bugüne kadar ülkemizde karakterize edilen ilk hipervirülan suştur. Bu suş, Haziran 2013 te Tokat ta özel bir klinikte prostat operasyonunu takiben kronik ishal yakınmasıyla başvuran 85 yaşında erkek hastadan izole edilmiştir. Siprofloksasin ve metronidazol başlanan hastaya, ishalin kötüleşmesi ve dışkıda kan varlığı nedeniyle kolonoskopi uygulanmış ve dışkı örneği C.difficile toksin değerlendirimi açısından DLG ye gönderilmiştir. Kolonoskopide, kolonda ülserasyonlar gözlenmesiyle hastanın tedavisine vankomisin eklenmiştir. Hasta herhangi bir komplikasyon gözlenmeksizin iyileşerek taburcu edilmiştir. Bu suşun metronidazol için MİK değeri 0.25 mg/l olup, metronidazole duyarlı bir izolattır ancak tedavi sırasında klinik tablonun ağırlaşması, kombine antibiyotik kullanımının etkisiyle ve/veya in vivo ortamdaki farmakokinetik etkileşimlerle açıklanabilir. tcdc genindeki çeşitli mutasyonlar genin inaktivasyonuna bağlı olarak artan toksin ekspresyonuna yol açmaktadır. Bu suşlarla olan enfeksiyonlar ağır seyreder ve salgın yap- 243

9 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim ma potansiyeli vardır. Bildirilen mutasyonlar; tek nükleotit polimorfizmleri, 18-, 39- veya 54-baz çiftlik delesyonlar, prematür stop kodonu oluşumu, trunkasyon veya çerçeve kayması mutasyonlardır 7,26. İzolatlarımızdan birinde 54-baz çiftlik delesyon saptanmış olup aminoasitleri kodlayan nükleotitlerin trunkasyonuyla sonuçlanmıştır. Bu izolat ayrıca 378. pozisyonda sessiz bir mutasyona sahiptir (Guanin Adenin değişikliği). Benzer şekilde, 54-baz çiftlik bir delesyon daha yüksek sıklıkta (57 toksijenik izolatın %10.5 inde) görülerek daha önceki bir çalışmada bildirilmiştir 26. İzolatlarımızda en sık tespit edilen mutasyon, önceki çalışmalarda da bildirilen G148T değişikliği olup, bu durum Alanin Serin değişikliğine neden olmaktadır (n= 10, %16.4) 27. Saptanan diğer iki nükleotit değişiminden T150C (n= 1, %1.6), kodlanan aminoasitte değişikliğe neden olmazken C414A (n= 1, %1.6), Asparajin Glutamin değişimine neden olmaktadır. Farklı ülkelerde C.difficile izolatları arasında hipervirülan suşların sıklığı değişkenlik göstermektedir ve ribotip 027 için sıklık %6-100 arasında değişmektedir 22,28,29. Hipervirülan suşların oluşturduğu nozokomiyal CDE de mortalite oranları daha yüksektir. Örneğin; 30 günlük mortalite binary-toksin negatif suşlarda %17 iken, binary-toksin pozitif suşlarda %28 olarak görülmektedir. Yaş, cinsiyet ve coğrafi dağılım ele alındığında tahmini rölatif mortalite riski binary-toksin eksprese eden hipervirülan suşlar için %60 düzeyinde olmaktadır 30. Binary-toksin pozitif olan izolatımız tcdc geninde 54 baz çiftlik delesyona sahip ribotip 027 dışı hipervirülan bir suş olup moksifloksasine duyarlı olarak saptanmıştır. Bu çalışmanın kısıtlılıkları, değerlendirilen suş sayısının nispeten az olması ve suşların genetik karakterizasyonu için ribotipleme yapılamamış olmasıdır. Suşların genetik yakınlıklarının ve ribotiplerinin tanımlanması epidemiyolojik olarak verileri daha ayrıntılı değerlendirmemizi sağlayabilirdi. Çalışmamız kapsamındaki izolatlar antibiyotikler için henüz düşük direnç oranlarıyla karakterize olup tümü metronidazol ve vankomisine duyarlı olarak bulunmuştur. İzolatlar arasında hipervirülan bir suşun tespiti çalışmanın önemli bir bulgusudur. Ülkemizdeki hipervirülan suşların gerçek prevalansı ve özelliklerini ortaya çıkarmak için kültür ve moleküler analizler gerçekleştirilmeli ve suşların ribotipleri saptanmalıdır. Hipervirülan suşlara ülkemizde nadir olarak rastlanması, henüz bu genotipteki bakterilerin ülkemizde salgın oluşturmaması, olası salgınların rapor edilememesiyle açıklanabileceği gibi, CDE tanısının sıklıkla dışkıda toksin varlığının gösterilmesiyle konması ve kültürle suşların izolasyonunu takiben fenotipik ve genotipik karakterizasyonlarının yapılmamasıyla da açıklanabilir. TEŞEKKÜR AÜTF İbn-i Sina Hastanesi Merkez Laboratuvarı, HÜTF Hastanesi Merkez Laboratuvarı ve Ankara DLG personeline dışkı örneklerinin temininde gösterdikleri yardımlardan dolayı teşekkür ederiz. 244

10 Salman E, Levent B, Karahan ZC. KAYNAKLAR 1. Abt MC, McKenney PT, Pamer EG. Clostridium difficile colitis: pathogenesis and host defence. Nat Rev Microbiol 2016; 14(10): Kazanowski M, Smolarek S, Kinnarney F, Grzebieniak Z. Clostridium difficile: epidemiology, diagnostic and therapeutic possibilities-a systematic review. Tech Coloproctol 2014; 18(3): van Dorp SM, Kinross P, Gastmeier P, et al. Standardised surveillance of Clostridium difficile infection in European acute care hospitals: a pilot study, Euro Surveill 2016; 21(29). 4. Simon DB, Mark HW. Antimicrobial resistance and reduced susceptibility in Clostridium difficile: potential consequences for induction, treatment, and recurrence of C.difficile infection. Antibiotics (Basel) 2015; 4(3): European committee on antimicrobial susceptibility testing (Eucast). Breakpoint tables for interpretation of MICs and zone diameters. Version Available at: [ Accessed: Clinical and Laboratory Standards Institute (CLSI). Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria M11-A , 7 th ed. Clinical and Laboratory Standards Institute, Wayne, PA. 7. Pinto LJ, Alcides AP, Ferreira EO, et al. Incidence and importance of Clostridium difficile in paediatric diarrhoea in Brazil. J Med Microbiol 2003; 52(Pt 12): van den Berg RJ, Claas EC, Oyib DH, et al. Characterization of toxin A-negative,toxin B-positive Clostridium difficile isolates from outbreaks in different countries by amplified fragment length polymorphism and PCR ribotyping. J Clin Microbiol 2004; 42(3): Gonçalves C, Decré D, Barbut F, Burghoffer B, Petit JC. Prevalence and characterization of a binary toxin (actin-specific ADP-ribosyltransferase) from Clostridium difficile. J Clin Microbiol 2004; 42(5): Persson S, Torpdahl M, Olsen KE. New multiplex PCR method for the detection of Clostridium difficile toxin A (tcda) and toxin B (tcdb) and the binary toxin (cdta/cdtb) genes applied to a Danish strain collection. Clin Microbiol Infect 2008; 14(11): Brown KA, Khanafer N, Daneman N, Fisman DN. Meta-analysis of antibiotics and the risk of communityassociated Clostridium difficile infection. Antimicrob Agents Chemother 2013; 57(5): Huang H, Weintraub A, Fang H, Nord CE. Antimicrobial resistance in Clostridium difficile. Int J Antimicrob Agents 2009; 34(6): Bishara J, Bloch Y, Garty M, Behor J, Samra Z. Antimicrobial resistance of Clostridium difficile isolates in a tertiary medical center, Israel. Diagn Microbiol Infect Dis 2006; 54(2): Peláez T, Alcalá L, Alonso Ret alrodríguez-créixems M, García-Lechuz JM, Bouza E. Reassessment of Clostridium difficile susceptibility to metronidazole and vancomycin. Antimicrob Agents Chemother 2002; 46(6): Dworczynski A, Sokol B, Meisel-Mikolajczyk F. Antibiotic resistance of Clostridium difficile isolates. Cytobios 1991; 65( ): Wong SS, Woo PC, Luk WK, Yuen KY. Susceptibility testing of Clostridium difficile against metronidazole and vancomycin by disk diffusion and Etest. Diagn Microbiol Infect Dis 1999; 34(1): Mutlu E, Wroe AJ, Sanchez-Hurtado K, Brazier JS, Poxton IR. Molecular characterization and antimicrobial susceptibility patterns of Clostridium difficile strains isolated from hospitals in south-east Scotland. J Med Microbiol 2007; 56(Pt 7): Ackermann G, Degner A, Cohen SH, Silva J Jr, Rodloff AC. Prevalence and association of macrolide lincosamide streptogramin B (MLSB) resistance with resistance to moxifloxacin in Clostridium difficile. J Antimicrob Chemother 2003; 51(3): Spigaglia P, Barbanti F, Mastrantonio P; European Study Group on Clostridium difficile (ESGCD). Multidrug resistance in European Clostridium difficile clinical isolates. J Antimicrob Chemother 2011; 66(10): Kim H, Jeong SH, Roh KH, et al. Investigation of toxin gene diversity. molecular epidemiology and antimicrobial resistance of Clostridium difficile isolated from 12 hospitals in South Korea. Korean J Lab Med 2010; 30(5): Huang H, Weintraub A, Fang H, Wu S, Zhang Y, Nord CE. Antimicrobial susceptibility and heteroresistance in Chinese Clostridium difficile strains. Anaerobe 2010; 16(6):

11 Toksin Pozitif Clostridium difficile İzolatlarının Antimikrobiyal Duyarlılıkları ve Moleküler Karakterizasyonu: Türkiye den Hipervirülan Suşların Varlığı ile İlişkili İlk Bildirim 22. Barbut F, Mastrantonio P, Delmée M, Brazier J, Kuijper E, Poxton I ; European Study Group on Clostridium difficile (ESGCD). Prospective study of Clostridium difficile infections in Europe with phenotypic and genotypic characterisation of the isolates. Clin Microbiol Infect 2007; 13(11): Harvala H, Alm E, Akerlund T, Rizzardi K. Emergence and spread of moxifloxacin-resistant Clostridium difficile ribotype 231 in Sweden between 2006 and New Microbe and New Infect 2016; 14: Ergen EK, Akalin H, Yilmaz E, et al. Nosocomial diarrhea and Clostridium difficile associated diarrhea in a turkish university hospital. Med Mal Infect 2009; 39(6): Deniz U, Ulger N, Aksu B, Karavuş M, Söyletir G. Investigation of toxin genes of Clostridium difficile strains isolated from hospitalized patients with diarrhoea at Marmara University Hospital. Mikrobiyol Bul 2011; 45(1): Bouvet PJ, Popoff MR. Genetic relatedness of Clostridium difficile isolates from various origins determined by triple-locus sequence analysis based on toxin regulatory genes tcdc, tcdr, and cdtr. J Clin Microbiol 2008; 46(11): Curry SR, Marsh JW, Muto CA, O Leary MM, Pasculle W, Harrison LH. tcdc genotypes associated with severe tcdc truncation in an epidemic clone and other strains of Clostridium difficile. J Clin Microbiol 2007; 45(1): Kuijper EJ, Coignard B, Brazier JS, et al. Update of Clostridium difficile associated disease due to PCR ribotype 027 in Europe. Euro Surveill 2007; 12(6): E MacCannell DR, Louie TJ, Gregson DB, et al. Molecular analysis of Clostridium difficile PCR ribotype 027 isolates from eastern and western Canada. J Clin Microbiol 2006; 44(6): Bacci S, Molbak K, Kjeldsen MK, Olsen KE. Binary toxin and death after Clostridium difficile infection. Emerg Infect Dis 2011; 17(6):

Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı

Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Antibiyotik kullanımına bağlı ishal etkeni olan Clostridium difficile, nozokomiyal diyarenin en sık

Detaylı

Çocuk ve Yetişkin Üriner Escherichia coli İzolatlarında Plazmidik Kinolon Direnç Genlerinin Araştırılması

Çocuk ve Yetişkin Üriner Escherichia coli İzolatlarında Plazmidik Kinolon Direnç Genlerinin Araştırılması Çocuk ve Yetişkin Üriner Escherichia coli İzolatlarında Plazmidik Kinolon Direnç Genlerinin Araştırılması Melisa Akgöz 1, İrem Akman 1, Asuman Begüm Ateş 1, Cem Çelik 1, Betül Keskin 1, Büşra Betül Özmen

Detaylı

Ömer COŞKUN GATA Enfeksiyon Hast. ve Kl. Mik. AD

Ömer COŞKUN GATA Enfeksiyon Hast. ve Kl. Mik. AD Ömer COŞKUN GATA Enfeksiyon Hast. ve Kl. Mik. AD Clostridium difficile Anaerop, Gram (+), subteminal oval sporlu basil Doğada yaygın; Toprak, su, barsak florası, hastane yüzeylerinde Hafif diyare ölümcül

Detaylı

Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı?

Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı? Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı? Muharrem ÇİÇEK, Banu SANCAK, Burçin ŞENER Hacettepe Üniversitesi

Detaylı

Karbapenemlere dirençli Bacteroides fragilis grubu bakterilerin varlığını araştırmak için rektal sürüntü örnekleriyle tarama

Karbapenemlere dirençli Bacteroides fragilis grubu bakterilerin varlığını araştırmak için rektal sürüntü örnekleriyle tarama Karbapenemlere dirençli Bacteroides fragilis grubu bakterilerin varlığını araştırmak için rektal sürüntü örnekleriyle tarama Öncü Akgül, Nurver Ülger, Gülşen Altınkanat Gelmez, Hüseyin Bilgin, Nilüfer

Detaylı

Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri

Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Emel AZAK, Esra Ulukaya, Ayşe WILLKE Kocaeli Üniversitesi Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik

Detaylı

Prof.Dr.Ayşe Willke Topcu KLİMİK AYLIK TOPLANTISI 19 KASIM 2015, İSTANBUL

Prof.Dr.Ayşe Willke Topcu KLİMİK AYLIK TOPLANTISI 19 KASIM 2015, İSTANBUL Prof.Dr.Ayşe Willke Topcu KLİMİK AYLIK TOPLANTISI 19 KASIM 2015, İSTANBUL ABR antimikrobiyal ilaçların kullanımı ile artan doğal bir süreçtir Dirençli kökenler yayılarak varlıklarını sürdürür Günlük kullanımdaki

Detaylı

Kırıkkale Üniversitesi Tıp Fakültesi Cerrahi Yoğun Bakım Ünitesinde 2008-2009 Yıllarında İzole Edilen Mikroorganizmalar ve Antibiyotik Duyarlılıkları

Kırıkkale Üniversitesi Tıp Fakültesi Cerrahi Yoğun Bakım Ünitesinde 2008-2009 Yıllarında İzole Edilen Mikroorganizmalar ve Antibiyotik Duyarlılıkları 13 ƘŰƬƑƊ Özgün Araştırma / Original Article Kırıkkale Üniversitesi Tıp Fakültesi Cerrahi Yoğun Bakım Ünitesinde 2008-2009 Yıllarında İzole Edilen Mikroorganizmalar ve Antibiyotik Duyarlılıkları Microorganisms

Detaylı

Enterobacteriaceae Ġzolatlarında Karbapenemazların Saptanmasında Modifiye Hodge Testi ve Carba NP Testlerinin Karşılaştırılması

Enterobacteriaceae Ġzolatlarında Karbapenemazların Saptanmasında Modifiye Hodge Testi ve Carba NP Testlerinin Karşılaştırılması Enterobacteriaceae Ġzolatlarında Karbapenemazların Saptanmasında Modifiye Hodge Testi ve Carba NP Testlerinin Karşılaştırılması Gülçin BAYRAMOĞLU 1, Gülşen ULUÇAM 1, Çiğdem GENÇOĞLU ÖZGÜR 2, Ali Osman

Detaylı

Toplum başlangıçlı Escherichia coli

Toplum başlangıçlı Escherichia coli Toplum başlangıçlı Escherichia coli nin neden olduğu üriner sistem infeksiyonlarında siprofloksasin direnci ve risk faktörleri: Prospektif kohort çalışma Türkan TÜZÜN 1, Selda SAYIN KUTLU 2, Murat KUTLU

Detaylı

Acinetobacter baumannii'de kolistin direncine yol açan klinik ve moleküler etkenler

Acinetobacter baumannii'de kolistin direncine yol açan klinik ve moleküler etkenler Acinetobacter baumannii'de kolistin direncine yol açan klinik ve moleküler etkenler Elif Nurtop 1, Fulya Bayındır Bilman 2, Şirin Menekşe 3, Özlem Kurt Azap 4, Mehmet Gönen 5, Önder Ergönül 6, Füsun Can

Detaylı

Daptomisin: Laboratuvar Yaklaşım. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul

Daptomisin: Laboratuvar Yaklaşım. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul Daptomisin: Laboratuvar Yaklaşım Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul Daptomisin: Mikrobiyolojik Yaklaşım İn vitro çalışma sonuçları İn vitro testler Direnç gelişimi DAPTOMİSİN

Detaylı

HİPERVİRÜLAN ESCHERİCHİA COLİ ST131 KLONU ÜLKEMİZDE YENİ Mİ?

HİPERVİRÜLAN ESCHERİCHİA COLİ ST131 KLONU ÜLKEMİZDE YENİ Mİ? HİPERVİRÜLAN ESCHERİCHİA COLİ ST131 KLONU ÜLKEMİZDE YENİ Mİ? Elif Aktaş, Nezahat Gürler, Nafia Canan Gürsoy, Barış Otlu, Bahar Akgün Karapınar, Zuhal Kalaycı Çekin, Gülsüm İnanç, Emin Bulut, Çiğdem Kayacan

Detaylı

Genişlemiş Spektrumlu Beta-Laktamaz Üreten Gram Negatif Kan İzolatları: Karbapenemlere Duyarlılık ve Fenotipik/Genotipik Direnç Mekanizmaları

Genişlemiş Spektrumlu Beta-Laktamaz Üreten Gram Negatif Kan İzolatları: Karbapenemlere Duyarlılık ve Fenotipik/Genotipik Direnç Mekanizmaları Genişlemiş Spektrumlu Beta-Laktamaz Üreten Gram Negatif Kan İzolatları: Karbapenemlere Duyarlılık ve Fenotipik/Genotipik Direnç Mekanizmaları 1. ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 12-16 KASIM 2011, ANTALYA

Detaylı

CLOSTRIDIUM DIFFICILE

CLOSTRIDIUM DIFFICILE Clostridium difficile İnfeksiyonları ve Antibiyotiğe Bağlı İshal Sempozyumu 28 Mayıs 2014, Ankara CLOSTRIDIUM DIFFICILE İNFEKSİYONLARININ LABORATUVAR TANISI Dr. Belkıs LEVENT Türkiye Halk Sağlığı Kurumu

Detaylı

Marmara Üniversitesi Hastanesinde Yatan İshalli Hastalardan İzole Edilen Clostridium difficile Kökenlerinde Toksin Genlerinin Araştırılması*

Marmara Üniversitesi Hastanesinde Yatan İshalli Hastalardan İzole Edilen Clostridium difficile Kökenlerinde Toksin Genlerinin Araştırılması* Özgün Çalışma/Original Article Mikrobiyol Bul 2011; 45(1): 1-10 Marmara Üniversitesi Hastanesinde Yatan İshalli Hastalardan İzole Edilen Clostridium difficile Kökenlerinde Toksin Genlerinin Araştırılması*

Detaylı

Emine Zuhal Kalaycı Çekin 1, Gülşah Malkoçoğlu 3, Nicolas Fortineau 2, Banu Bayraktar 1, Thierry Naas 2, Elif Aktaş 1

Emine Zuhal Kalaycı Çekin 1, Gülşah Malkoçoğlu 3, Nicolas Fortineau 2, Banu Bayraktar 1, Thierry Naas 2, Elif Aktaş 1 Karbapenem dirençli Pseudomonas aeruginosa izolatlarında karbapenemaz varlığının genotipik ve fenotipik yöntemlerle araştırılması ve MALDI-TOF MS aracılığı ile yüksek riskli klon tayini Emine Zuhal Kalaycı

Detaylı

Enzimlerinin Saptanmasında

Enzimlerinin Saptanmasında Gram Negatif Bakterilerde Karbapenemaz Enzimlerinin Saptanmasında OXA-48 K-Se T, Blue-Carba Test ve PCR Testlerinin Etkinliğinin Karşılaştırılması Ayham Abulaila, Fatma Erdem, Zerrin Aktaş, Oral Öncül

Detaylı

STANDARDİZASYON KURUMLARI VE TÜRKİYE

STANDARDİZASYON KURUMLARI VE TÜRKİYE STANDARDİZASYON KURUMLARI VE TÜRKİYE (yalnızca CLSI mı?) Dr.ELViN DiNÇ OKMEYDANI E.A.H ENFEKSİYON HASTALIKLARI VE KLİNİK MİKROBİYOLOJİ KLİNİĞİ Antibiyotik tedavisi gerektiren bir enfeksiyonda rolü olan

Detaylı

Enfeksiyon odaklarından izole edilen Gram negatif ve Gram pozitif bakterilerde antimikrobiyal duyarlılık sonuçları

Enfeksiyon odaklarından izole edilen Gram negatif ve Gram pozitif bakterilerde antimikrobiyal duyarlılık sonuçları Enfeksiyon odaklarından izole edilen Gram negatif ve Gram pozitif bakterilerde antimikrobiyal duyarlılık sonuçları Doç. Dr. Gönül Şengöz 13 Haziran 2015 KAYIP DİLLERİN FISILDADIKLARI SERGİSİ-İSTANBUL Antimikrobiyal

Detaylı

Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları. Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna

Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları. Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları Dr Dilara

Detaylı

Antimikrobiyal tedavide yeni yaklaşım: Doripenem. İn vitro Veriler. Prof.Dr.Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul

Antimikrobiyal tedavide yeni yaklaşım: Doripenem. İn vitro Veriler. Prof.Dr.Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul Antimikrobiyal tedavide yeni yaklaşım: Doripenem İn vitro Veriler Prof.Dr.Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul Karbapenemler GRUP 1 Ertapenem GRUP 2 Imipenem Meropenem Biapenem Panipenem

Detaylı

Olgularla Antimikrobiyal Duyarlılık Testleri (Gram Negatif Bakteriler)

Olgularla Antimikrobiyal Duyarlılık Testleri (Gram Negatif Bakteriler) Olgularla Antimikrobiyal Duyarlılık Testleri (Gram Negatif Bakteriler) Uzm. Dr. Demet Hacıseyitoğlu Dr. Lütfi Kırdar Kartal Eğitim ve Araştırma Hastanesi Olgu 1 51 yaşındaki kadın hasta Doğalgaz patlaması

Detaylı

Karbapenemaz Üreten Enterobacteriaceae

Karbapenemaz Üreten Enterobacteriaceae Karbapenemaz Üreten Enterobacteriaceae Dr. Onur KARATUNA Acıbadem Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji A.D. Acıbadem Labmed Tıbbi Laboratuvarları Sunum Akışı Karbapenemaz Üreten Enterobacteriaceae

Detaylı

Çeşitli Klinik Örneklerden İzole Edilen Vankomisin Dirençli Enterokokların Antibiyotik Duyarlılıkları

Çeşitli Klinik Örneklerden İzole Edilen Vankomisin Dirençli Enterokokların Antibiyotik Duyarlılıkları doi:10.5222/tmcd.2014.056 Araştırma Çeşitli Klinik Örneklerden İzole Edilen Vankomisin Dirençli Enterokokların Antibiyotik Duyarlılıkları Neval AĞUŞ, Mümtaz Cem ŞİRİN, Nisel YILMAZ, Pınar ŞAMLIOĞLU, Yeşer

Detaylı

GRAM POZİTİF BAKTERİ ANTİBİYOGRAMLARI

GRAM POZİTİF BAKTERİ ANTİBİYOGRAMLARI GRAM POZİTİF BAKTERİ ANTİBİYOGRAMLARI Dr. Özlem KURT AZAP 26 Kasım 2008 Genel Kurallar Tek koloniden yapılan pasaj seçici olmayan besiyerinde (kanlı agar...) bir gece inkübe edilir Benzer morfolojideki

Detaylı

ANTİBİYOTİK DUYARLILIĞI VE DİRENÇLERİN YORUMLANMASINDA UZMAN SİSTEMLERİN ROLÜ

ANTİBİYOTİK DUYARLILIĞI VE DİRENÇLERİN YORUMLANMASINDA UZMAN SİSTEMLERİN ROLÜ ANTİBİYOTİK DUYARLILIĞI VE DİRENÇLERİN YORUMLANMASINDA UZMAN SİSTEMLERİN ROLÜ Dr.Arzu İLKİ Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Tüm Dünyada Klinik Mikrobiyoloji Laboratuvarları

Detaylı

Anaerop Haber Haziran 2015 sayısının konu başlığı : Yurt içi / yurt dışı anaerop yayınlar

Anaerop Haber Haziran 2015 sayısının konu başlığı : Yurt içi / yurt dışı anaerop yayınlar Haziran 2015 İletişim adresleri : "Güven Külekçi" gkulekci@istanbul.edu.tr, "Turk Mikrobiyoloji Cemiyeti" tmc@tmc-online.org Anaerop Haber Haziran 2015 sayısının konu başlığı : Yurt içi / yurt dışı anaerop

Detaylı

N. Tiryakioğlu, B. Aksu, M. U. Hasdemir. Marmara Üni. Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, İstanbul

N. Tiryakioğlu, B. Aksu, M. U. Hasdemir. Marmara Üni. Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, İstanbul Eritromisine dirençli klinik Streptococcus pneumoniae izolatlarında makrolid direncinin genetik profili ile serotip ilişkisi N. Tiryakioğlu, B. Aksu, M. U. Hasdemir Marmara Üni. Tıp Fakültesi, Tıbbi Mikrobiyoloji

Detaylı

İlaç direnci saptanmasında yeni yöntemler. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR

İlaç direnci saptanmasında yeni yöntemler. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR İlaç direnci saptanmasında yeni yöntemler Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR 2050 TB Eliminasyon Hedefi (WHO; Global Tuberculosis Report 2012)

Detaylı

HASTANE KÖKENLİ STAPHYLOCOCCUS AUREUS TÜRLERİNDE MAKROLİD-LİNKOZAMİD-STREPTOGRAMİN B DİRENCİNİN ARAŞTIRILMASI*

HASTANE KÖKENLİ STAPHYLOCOCCUS AUREUS TÜRLERİNDE MAKROLİD-LİNKOZAMİD-STREPTOGRAMİN B DİRENCİNİN ARAŞTIRILMASI* ANKEM Derg 2009;23(2):66-70 HASTANE KÖKENLİ STAPHYLOCOCCUS AUREUS TÜRLERİNDE MAKROLİD-LİNKOZAMİD-STREPTOGRAMİN B DİRENCİNİN ARAŞTIRILMASI* M. Hamidullah UYANIK*, Halil YAZGI*, Dilek BİLİCİ*, Kemalettin

Detaylı

İdrar Örneklerinden İzole Edilen Bakteriler ve Antibiyotiklere Duyarlılıkları

İdrar Örneklerinden İzole Edilen Bakteriler ve Antibiyotiklere Duyarlılıkları 95 Kocatepe Tıp Dergisi The Medical Journal of Kocatepe 12: 95-100 / Mayıs 2011 Afyon Kocatepe Üniversitesi İdrar Örneklerinden İzole Edilen Bakteriler ve Antibiyotiklere Duyarlılıkları Bacteria Isolated

Detaylı

METİSİLİNE DİRENÇLİ STAPHYLOCOCCUS AUREUS VE VANKOMİSİNE DİRENÇLİ ENTEROKOK SUŞLARININ İN VİTRO LİNEZOLİD DUYARLILIĞI

METİSİLİNE DİRENÇLİ STAPHYLOCOCCUS AUREUS VE VANKOMİSİNE DİRENÇLİ ENTEROKOK SUŞLARININ İN VİTRO LİNEZOLİD DUYARLILIĞI Kısa Bildiri/Short Communication Mikrobiyol Bul 2009; 43: 639-643 METİSİLİNE DİRENÇLİ STAPHYLOCOCCUS AUREUS VE VANKOMİSİNE DİRENÇLİ ENTEROKOK SUŞLARININ İN VİTRO LİNEZOLİD DUYARLILIĞI IN VITRO SUSCEPTIBILITY

Detaylı

Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test. Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul

Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test. Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul Sorunlu Mikroorganizmalar Nonfermentatif bakteriler Acinetobacter sp. Stenotrophomonas

Detaylı

Özgün Çalışma/Original Article. Mikrobiyol Bul 2009; 43: Erdinç GÜLDEN 1, Şafak ERMERTCAN 1 ÖZET

Özgün Çalışma/Original Article. Mikrobiyol Bul 2009; 43: Erdinç GÜLDEN 1, Şafak ERMERTCAN 1 ÖZET Özgün Çalışma/Original Article Mikrobiyol Bul 2009; 43: 53-60 STAPHYLOCOCCUS AUREUS VE ENTEROCOCCUS FAECIUM KLİNİK İZOLATLARI ÜZERİNE KİNUPRİSTİN/DALFOPRİSTİN İLE VANKOMİSİN VE GATİFLOKSASİN KOMBİNASYONLARININ

Detaylı

Meropenem E-test, Bacteroides fragilis Suşlarında Karbapenem Direnç Geni cfia Varlığını Tahmin Etmede Kullanılabilir mi?*

Meropenem E-test, Bacteroides fragilis Suşlarında Karbapenem Direnç Geni cfia Varlığını Tahmin Etmede Kullanılabilir mi?* Özgün Çalışma/Original Article Mikrobiyol Bul 2011; 45(3): 385-391 Meropenem E-test, Bacteroides fragilis Suşlarında Karbapenem Direnç Geni cfia Varlığını Tahmin Etmede Kullanılabilir mi?* Can Meropenem

Detaylı

MYCOBACTERIUM TUBERCULOSIS KOMPLEKS KLİNİK İZOLATLARINDA İZONİAZİD DİRENCİNE NEDEN OLAN DIŞA ATIM POMPALARININ SAPTANMASI

MYCOBACTERIUM TUBERCULOSIS KOMPLEKS KLİNİK İZOLATLARINDA İZONİAZİD DİRENCİNE NEDEN OLAN DIŞA ATIM POMPALARININ SAPTANMASI MYCOBACTERIUM TUBERCULOSIS KOMPLEKS KLİNİK İZOLATLARINDA İZONİAZİD DİRENCİNE NEDEN OLAN DIŞA ATIM POMPALARININ SAPTANMASI Özlem Tuncer¹, Orhan Kaya Köksalan², Zeynep Sarıbaş¹ ¹Hacettepe Üniversitesi Tıp

Detaylı

Kandan izole edilen Escherichia coli suşlarında antimikrobiyal duyarlılık : EARSS

Kandan izole edilen Escherichia coli suşlarında antimikrobiyal duyarlılık : EARSS Kandan izole edilen Escherichia coli suşlarında antimikrobiyal duyarlılık : EARSS 2003-2009 D. Gülmez 1, D. Gür 2, G. Hasçelik 1, EARSS-Türkiye Çalışma Grubu 1 Hacettepe Üniversitesi Tıp Fakültesi Tıbbi

Detaylı

GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60

GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60 Dr. Tolga BAŞKESEN GİRİŞ Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi ABD de yılda 200.000 KDE, mortalite % 35-60 Erken ve doğru tedavi ile mortaliteyi azaltmak mümkün GİRİŞ Kan

Detaylı

Antibiyotik Direncinde Laboratuvar

Antibiyotik Direncinde Laboratuvar Antibiyotik Direncinde Laboratuvar Doç.Dr.Füsun CAN Koç Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji KLİMİK 28 Mart 2015 Belek, ANTALYA Bad Bugs, No Drugs Bad Bugs, No drugs A disk diffusion test with

Detaylı

PNÖMOKOKLARDA DİRENÇ VE GELİŞMELER DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD

PNÖMOKOKLARDA DİRENÇ VE GELİŞMELER DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD PNÖMOKOKLARDA DİRENÇ VE GELİŞMELER DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD XXXIV. Türk Mikrobiyoloji Kongresi - 2010 İÇERİK Pnömokokal enfeksiyonların epidemiyolojisi

Detaylı

KAN VE BEYİN OMURİLİK SIVISI ÖRNEKLERİNDEN İZOLE EDİLEN STREPTOCOCCUS PNEUMONIAE SUŞLARINDA ANTİBİYOTİK DİRENCİ

KAN VE BEYİN OMURİLİK SIVISI ÖRNEKLERİNDEN İZOLE EDİLEN STREPTOCOCCUS PNEUMONIAE SUŞLARINDA ANTİBİYOTİK DİRENCİ Araştırma ANKEM Derg 05;9():85-89 doi: 0.5/ankem.05.085 KAN VE BEYİN OMURİLİK SIVISI ÖRNEKLERİNDEN İZOLE EDİLEN STREPTOCOCCUS PNEUMONIAE SUŞLARINDA ANTİBİYOTİK DİRENCİ Cem ÇELİK, Uğur TUTAR, Seyit Ali

Detaylı

Komplike deri ve yumuşak doku enfeksiyonu etkeni çoklu dirençli patojenlerin bakteriyofaj duyarlılıklarının araştırılması

Komplike deri ve yumuşak doku enfeksiyonu etkeni çoklu dirençli patojenlerin bakteriyofaj duyarlılıklarının araştırılması Komplike deri ve yumuşak doku enfeksiyonu etkeni çoklu dirençli patojenlerin bakteriyofaj duyarlılıklarının araştırılması Aycan Gundogdu, Ph.D. Erciyes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim

Detaylı

Duyarlılık testleri vetürkiye verileri: Anaeroblar Dr. Nurver Ülger (Toprak) Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD

Duyarlılık testleri vetürkiye verileri: Anaeroblar Dr. Nurver Ülger (Toprak) Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Duyarlılık testleri vetürkiye verileri: Anaeroblar Dr. Nurver Ülger (Toprak) Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Anaerop bakterilerde direnç Ampirik tdv de kullanılan ab e direnç

Detaylı

TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM

TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM Doç. Dr. Alpaslan Alp Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Dünya Sağlık Örgütü 2009 Yılı Raporu Aktif tüberkülozlu hasta

Detaylı

Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı. Cerrahpaşa Tıp Fakültesi Enfeksiyon Hastalıkları Anabilim Dalı

Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı. Cerrahpaşa Tıp Fakültesi Enfeksiyon Hastalıkları Anabilim Dalı Hematoloji ve Kemik İliği Transplantasyon Hastalarında Rektal Kolonizasyon ve Bakteriyemi İlişkisinin Araştırılması Asiye Karakullukçu 1, Mehtap Biçer 2, Gökhan Aygün 1 Şeniz Öngören 3, Cem Ar 3, Elvin

Detaylı

İnfektif Endokarditin Antibiyotik Tedavisinde Antimikrobiyal Direnç Bir Sorun mu? Penisilin

İnfektif Endokarditin Antibiyotik Tedavisinde Antimikrobiyal Direnç Bir Sorun mu? Penisilin İnfektif Endokarditin Antibiyotik Tedavisinde Antimikrobiyal Direnç Bir Sorun mu? Penisilin Dr Emel YILMAZ UÜTF-Enf Hast ve Kl Mikrob AD İEÇG-KLİMİK 21.10.2017 İnfektif Endokardit Koruyucu uygulamalara

Detaylı

Araştırma. Harun AĞCA 2011 DEÜ TIP FAKÜLTESİ DERGİSİ CİLT 25, SAYI 3, (EYLÜL) 2011,

Araştırma. Harun AĞCA 2011 DEÜ TIP FAKÜLTESİ DERGİSİ CİLT 25, SAYI 3, (EYLÜL) 2011, 169 Araştırma Escherichia Coli Ve Klebsiella Pneumoniae Suşlarının Genişlemiş Spektrumlu Beta Laktamaz Üretimleri Ve Antibiyotik Duyarlılık Oranları EXTENDED SPECTRUM BETA LACTAMASE PRODUCTION AND ANTIBIOTIC

Detaylı

Doğrudan klinik örnekte hızlı tanı. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR

Doğrudan klinik örnekte hızlı tanı. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR Doğrudan klinik örnekte hızlı tanı Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR TİCARİ KONVANSİYONEL PCR SİTEMLERİ TİCARİ REAL-TIME PCR SİTEMLERİ IN-HOUSE

Detaylı

HASTANE VE TOPLUM KAYNAKLI STAPHYLOCOCCUS AUREUS İZOLATLARINDA ÇEŞİTLİ VİRÜLANS FAKTÖRLERİNİN REAL-TİME PZR YÖNTEMİ İLE ARAŞTIRILMASI

HASTANE VE TOPLUM KAYNAKLI STAPHYLOCOCCUS AUREUS İZOLATLARINDA ÇEŞİTLİ VİRÜLANS FAKTÖRLERİNİN REAL-TİME PZR YÖNTEMİ İLE ARAŞTIRILMASI HASTANE VE TOPLUM KAYNAKLI STAPHYLOCOCCUS AUREUS İZOLATLARINDA ÇEŞİTLİ VİRÜLANS FAKTÖRLERİNİN REAL-TİME PZR YÖNTEMİ İLE ARAŞTIRILMASI Soner YILMAZ1, Abdullah KILIÇ1, Aylin Üsküdar Güçlü1, Orhan BEDİR1,

Detaylı

İzmir Atatürk Eğitim ve Araştırma Hastanesi, Mikrobiyoloji ve Klinik Mikrobiyoloji Servisi, İZMİR ÖZET SUMMARY

İzmir Atatürk Eğitim ve Araştırma Hastanesi, Mikrobiyoloji ve Klinik Mikrobiyoloji Servisi, İZMİR ÖZET SUMMARY Araştırma ANKEM Derg 2011;25(3):145-149 doi:10.5222/ankem.2011.145 STAPHYLOCOCCUS AUREUS DA METİSİLİN DİRENCİNİN SAPTANMASINDA DİSK DİFÜZYON, OKSASİLİN AGAR TARAMA, MİKRODİLÜSYON VE PBP2a LATEKS AGLÜTİNASYON

Detaylı

Gram-Negatif Bakterilerde Direncin Laboratuvar Tanısı ve Yorumlanması

Gram-Negatif Bakterilerde Direncin Laboratuvar Tanısı ve Yorumlanması Gram-Negatif Bakterilerde Direncin Laboratuvar Tanısı ve Yorumlanması Dr. Özlem Kurt-Azap Başkent Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Sunum planı Antimikrobiyal

Detaylı

Klinik Örneklerden İzole Edilen E.coli Suşlarının Kümülatif Antibiyotik Duyarlılıklarının Belirlenmesi

Klinik Örneklerden İzole Edilen E.coli Suşlarının Kümülatif Antibiyotik Duyarlılıklarının Belirlenmesi Klinik Örneklerden İzole Edilen E.coli Suşlarının Kümülatif Antibiyotik Duyarlılıklarının Belirlenmesi Mine Aydın Kurç,Özge Tombak,Dumrul Gülen,Hayati Güneş,Aynur Eren Topkaya Antibiyotik duyarlılık raporlarının

Detaylı

Mikobakteriyolojide yeni nesil dizileme ile analiz

Mikobakteriyolojide yeni nesil dizileme ile analiz Mikobakteriyolojide yeni nesil dizileme ile analiz Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, İzmir Mikobakteriyolojide kullanım alanları Moleküller epidemiyoloji

Detaylı

STREPTOMİSİNE DİRENÇLİ MYCOBACTERIUM TUBERCULOSIS KOMPLEKS İZOLATLARINDA rpsl VE rrs GEN BÖLGESİ MUTASYONLARININ ARAŞTIRILMASI*

STREPTOMİSİNE DİRENÇLİ MYCOBACTERIUM TUBERCULOSIS KOMPLEKS İZOLATLARINDA rpsl VE rrs GEN BÖLGESİ MUTASYONLARININ ARAŞTIRILMASI* Kısa Bildiri/Short Communication Mikrobiyol Bul 2009; 43: 115-120 STREPTOMİSİNE DİRENÇLİ MYCOBACTERIUM TUBERCULOSIS KOMPLEKS İZOLATLARINDA rpsl VE rrs GEN BÖLGESİ MUTASYONLARININ ARAŞTIRILMASI* INVESTIGATION

Detaylı

T.C. Sağlık Bakanlığı Türkiye Halk Sağlığı Kurumu

T.C. Sağlık Bakanlığı Türkiye Halk Sağlığı Kurumu 1 DIġKI ÖRNEKLERĠNDE SHIGA TOKSĠN OLUġTURAN E. COLI LERĠN SEROTĠP, VĠRÜLANS GENLERĠ VE ANTĠBĠYOTĠKLERE DĠRENÇLERĠNĠN DEĞERLENDĠRĠLMESĠ Dr. Revasiye GÜLEŞEN Mikrobiyoloji Referans Laboratuvarları Daire

Detaylı

STAPHYLOCOCCUS AUREUS SUŞLARINDA METİSİLİNE DİRENÇ ORANINDAKİ DEĞİŞİM: METİSİLİNE DİRENÇ AZALIYOR MU?

STAPHYLOCOCCUS AUREUS SUŞLARINDA METİSİLİNE DİRENÇ ORANINDAKİ DEĞİŞİM: METİSİLİNE DİRENÇ AZALIYOR MU? Araştırma ANKEM Derg 218;32(3):13-18 doi: 1.5222/ankem.218.1816 STAPHYLOCOCCUS AUREUS SUŞLARINDA METİSİLİNE DİRENÇ ORANINDAKİ DEĞİŞİM: METİSİLİNE DİRENÇ AZALIYOR MU? Murat TELLİ 1, Yavuz OKULU 2, Yağız

Detaylı

Dr. Aysun YALÇI Gülhane Eğitim Araştırma Hastanesi , ANKARA

Dr. Aysun YALÇI Gülhane Eğitim Araştırma Hastanesi , ANKARA Dr. Aysun YALÇI Gülhane Eğitim Araştırma Hastanesi 29.03.2017, ANKARA Sunum Planı Giriş Antimikrobiyal direnci önleme Direncin önlenmesinde WHO, İDSA,CDC önerileri El hijyeni Temas izolasyonu önlemleri

Detaylı

CLOSTRIDIUM DIFFICILE ENFEKSİYONUNDA GLUTAMAT DEHİDROGENAZ VE TOKSİN A/B TESTLERİNİN TANI DEĞERİ VE MALİYET ETKİNLİĞİ

CLOSTRIDIUM DIFFICILE ENFEKSİYONUNDA GLUTAMAT DEHİDROGENAZ VE TOKSİN A/B TESTLERİNİN TANI DEĞERİ VE MALİYET ETKİNLİĞİ CLOSTRIDIUM DIFFICILE ENFEKSİYONUNDA GLUTAMAT DEHİDROGENAZ VE TOKSİN A/B TESTLERİNİN TANI DEĞERİ VE MALİYET ETKİNLİĞİ Dr. Zahide Doyuk Bektaş Sağlık Bakanlığı Marmara Ünv. Pendik Eğitim Arş. Hastanesi

Detaylı

Dr. Emel UZUNOĞLU, Giresun Ömer Hekim Tıp Fakültesi

Dr. Emel UZUNOĞLU, Giresun Ömer Hekim Tıp Fakültesi Giresun Prof. Dr. A. İlhan Özdemir Devlet Hastanesi'nde Yatan Hastalara Ait Klinik Örneklerden İzole Edilen Myroides Türlerinin Genotiplendirilmesi ve Suşlar Arasındaki Klonal İlişkinin Araştırılmasına

Detaylı

ÇORUM HİTİT ÜNİVERSİTESİ EĞİTİM ARAŞTIRMA HASTANESİ NDE HEMODİYALİZ KATETER ENFEKSİYONLARI

ÇORUM HİTİT ÜNİVERSİTESİ EĞİTİM ARAŞTIRMA HASTANESİ NDE HEMODİYALİZ KATETER ENFEKSİYONLARI ÇORUM HİTİT ÜNİVERSİTESİ EĞİTİM ARAŞTIRMA HASTANESİ NDE HEMODİYALİZ KATETER ENFEKSİYONLARI DERYA YAPAR, ÖZLEM AKDOĞAN, İBRAHİM DOĞAN, FATİH KARADAĞ, NURCAN BAYKAM AMAÇ Kateter ile ilişkili enfeksiyonlar,

Detaylı

Riskli Ünitelerde Yatan Hastalarda Karbapenemaz Üreten Enterobacteriaceae taranması

Riskli Ünitelerde Yatan Hastalarda Karbapenemaz Üreten Enterobacteriaceae taranması Riskli Ünitelerde Yatan Hastalarda Karbapenemaz Üreten Enterobacteriaceae taranması BD MAX CRE Assay Yöntemi İle Karşılaştırmalı Bir Çalışma Ayşe Nur Sarı 1,2, Sema Alp Çavuş 1, Dokuz Eylül Enfeksiyon

Detaylı

Kolistin ilişkili nefrotoksisite oranları ve risk faktörlerinin değerlendirilmesi

Kolistin ilişkili nefrotoksisite oranları ve risk faktörlerinin değerlendirilmesi Kolistin ilişkili nefrotoksisite oranları ve risk faktörlerinin değerlendirilmesi DR. FATİH TEMOÇİN Fatih TEMOÇİN, Meryem DEMİRELLİ, Cemal BULUT, Necla Eren TÜLEK, Günay Tuncer ERTEM, Fatma Şebnem ERDİNÇ

Detaylı

Kolistine Dirençli E. coli Suşuyla Gelişen ÜSİ Olgusu ve Sonuçlar

Kolistine Dirençli E. coli Suşuyla Gelişen ÜSİ Olgusu ve Sonuçlar Kolistine Dirençli E. coli Suşuyla Gelişen ÜSİ Olgusu ve Sonuçlar Dr. Okan Derin Kocaeli VM Medical Park Hastanesi Sunum Planı Gerekçe Hastane kökenli Gram negatif enterik patojenlerde direncin epidemiyolojisi

Detaylı

Direnç hızla artıyor!!!!

Direnç hızla artıyor!!!! Direnç hızla artıyor!!!! http://www.cdc.gov/drugresistance/about.html Yoğun Bakım Üniteleri (YBÜ) Fizyolojik bakımdan stabil olmayan hastaların yaşam fonksiyonlarının düzeltilmesi Altta yatan hastalığın

Detaylı

İstanbul daki El Ayak Ağız Hastalığı Vakalarında Coxsackievirus A6 ve Coxsackievirus A16 nın Saptanması

İstanbul daki El Ayak Ağız Hastalığı Vakalarında Coxsackievirus A6 ve Coxsackievirus A16 nın Saptanması İstanbul daki El Ayak Ağız Hastalığı Vakalarında Coxsackievirus A6 ve Coxsackievirus A16 nın Saptanması Dr. Ayşe Nur CEYLAN Antalya 11/11/2017 Sunum Planı 1. Amaç 2. Enterovirüsler 3. El Ayak Ağız Hastalığı(EAAH)

Detaylı

Steril pyrüili böbrek nakli hastalarında gerçek zamanlı multipleks polimeraz zincir reaksiyon test sonuçları

Steril pyrüili böbrek nakli hastalarında gerçek zamanlı multipleks polimeraz zincir reaksiyon test sonuçları Steril pyrüili böbrek nakli hastalarında gerçek zamanlı multipleks polimeraz zincir reaksiyon test sonuçları Mehmet Sarıer 1, Meltem Demir 2, Şafak Göktaş 3, İbrahim Duman 1, Yücel Yüksel 4, Levent Yücetin

Detaylı

IV. KLİMUD Kongresi, Kasım 2017, Antalya

IV. KLİMUD Kongresi, Kasım 2017, Antalya IV. KLİMUD Kongresi, 08-12 Kasım 2017, Antalya 1 HCV Tanısında Cut off/ Sinyal (S/CO)/TV) Değerlerinin Tanısal Geçerliliklerinin Değerlendirilmesi TÜLİN DEMİR¹, DİLARA YILDIRAN¹, SELÇUK KILIǹ, SELÇUK

Detaylı

PNÖMOKOKLARDA DİRENÇ EPİDEMİYOLOJİSİ DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD

PNÖMOKOKLARDA DİRENÇ EPİDEMİYOLOJİSİ DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD PNÖMOKOKLARDA DİRENÇ EPİDEMİYOLOJİSİ DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD Streptococcus pneumoniae İnvaziv hastalıklar: Menenjit Bakteriyemik pnömoni Sepsis Non-invaziv

Detaylı

Keywords: Staphylococcus aureus, quinupristin/

Keywords: Staphylococcus aureus, quinupristin/ doi:10.5222/tmcd.2017.083 Araştırma Staphylococcus aureus Suşlarında Makrolid, Linkozamid ve Streptogramin B Direncinin Fenotipik Yöntemlerle Belirlenmesi ve Kinupristin/Dalfopristinin In Vitro Etkinliğinin

Detaylı

ADT Sonuçları Yorumlu ve Kısıtlı Bildirim, EUCAST Uzman Kurallar. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul

ADT Sonuçları Yorumlu ve Kısıtlı Bildirim, EUCAST Uzman Kurallar. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul ADT Sonuçları Yorumlu ve Kısıtlı Bildirim, EUCAST Uzman Kurallar Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul Antibiotic use in eastern Europe: a cross-national database study

Detaylı

Comparison of Susceptibility of Escherichia coli Strains Isolated from Urinary System Infections to Ciprofloxacin and Other Antibiotics

Comparison of Susceptibility of Escherichia coli Strains Isolated from Urinary System Infections to Ciprofloxacin and Other Antibiotics Araştırma Makalesi/Original Article ÜRİNER SİSTEM ENFEKSİYONLARINDAN İZOLE EDİLEN ESCHERICHIA COLI SUŞLARININ SİPROFLOKSASİN VE DİĞER ANTİBİYOTİKLERE KARŞI DUYARLILIKLARININ KARŞILAŞTIRILMASI Comparison

Detaylı

Enfeksiyon Hastalıkları Tanısında Sendromik Yaklaşım: Avantaj ve Dezavantajları: İshal

Enfeksiyon Hastalıkları Tanısında Sendromik Yaklaşım: Avantaj ve Dezavantajları: İshal Enfeksiyon Hastalıkları Tanısında Sendromik Yaklaşım: Avantaj ve Dezavantajları: İshal Ahmet Çağkan İnkaya Hacettepe Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları Anabilim Dalı inkaya@hacettepe.edu.tr

Detaylı

SAĞLIK HİZMETİ İLE İLİŞKİLİ KLEBSİELLA ENFEKSİYONLARI

SAĞLIK HİZMETİ İLE İLİŞKİLİ KLEBSİELLA ENFEKSİYONLARI SAĞLIK HİZMETİ İLE İLİŞKİLİ KLEBSİELLA ENFEKSİYONLARI KLEBSİELLA ENFEKSİYONLARI VE KLİNİK ÖNEMİ Dr. Aysun Yalçı Ankara Üniversitesi İbni Sina Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Ana

Detaylı

Gelişen teknoloji Tanı ve tedavide kullanım Uygulanan teknikler çok gelişmiş bile olsalar kendine özgü komplikasyon riskleri taşımaktadırlar

Gelişen teknoloji Tanı ve tedavide kullanım Uygulanan teknikler çok gelişmiş bile olsalar kendine özgü komplikasyon riskleri taşımaktadırlar Gelişen teknoloji Tanı ve tedavide kullanım Uygulanan teknikler çok gelişmiş bile olsalar kendine özgü komplikasyon riskleri taşımaktadırlar 2 Hastanın hastanede yatış süresini uzatmakta Tedavi maliyetini

Detaylı

ANTIBIOTIC RESISTANCE IN STREPTOCOCCUS PNEUMONIAE STRAINS ISOLATED FROM STERILE BODY SITES. Öznur AK*, Serdar ÖZER*, Nur A.

ANTIBIOTIC RESISTANCE IN STREPTOCOCCUS PNEUMONIAE STRAINS ISOLATED FROM STERILE BODY SITES. Öznur AK*, Serdar ÖZER*, Nur A. MİKROBİYOL MİKROBİYOLOJİ BÜLT 2006; 40: BÜLTENİ 179-184 179 STERİL BÖLGELERDEN İZOLE EDİLEN STREPTOCOCCUS PNEUMONIAE SUŞLARINDA ANTİBİYOTİK DİRENCİ ANTIBIOTIC RESISTANCE IN STREPTOCOCCUS PNEUMONIAE STRAINS

Detaylı

HIV İLE ENFEKTE OLMUŞ HASTALARDA M41L DİRENÇ MUTASYONUNUN REAL- TİME POLİMERAZ ZİNCİR REAKSİYONU İLE SAPTANMASI

HIV İLE ENFEKTE OLMUŞ HASTALARDA M41L DİRENÇ MUTASYONUNUN REAL- TİME POLİMERAZ ZİNCİR REAKSİYONU İLE SAPTANMASI YEDİTEPE ÜNİVERSİTESİ HIV İLE ENFEKTE OLMUŞ HASTALARDA M41L DİRENÇ MUTASYONUNUN REAL- TİME POLİMERAZ ZİNCİR REAKSİYONU İLE SAPTANMASI ZUHAL TEKKANAT TAZEGÜN, İSKENDER KARALTI, İBRAHİM ÇAĞATAY ACUNER, MERT

Detaylı

YILIN SES GETİREN MAKALELERİ

YILIN SES GETİREN MAKALELERİ YILIN SES GETİREN MAKALELERİ Dr. Yeşim Uygun Kızmaz SBÜ Kartal Koşuyolu Yüksek İhtisas Eğt. ve Araş. Hastanesi Türk Klinik Mikrobiyoloji ve İnfeksiyon Hastalıkları Derneği Aylık Toplantısı 25.12.2018,

Detaylı

Antibiyotiklerin Kullanımının Monitörizasyonu

Antibiyotiklerin Kullanımının Monitörizasyonu Antibiyotiklerin Kullanımının Monitörizasyonu Prof. Dr. Ayşe ERBAY Bozok Üniversitesi, Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Ana Bilim Dalı Antibiyotikler halen her gün hayat

Detaylı

Dr. Aysun Yalçı Ankara Üniversitesi Tıp Fakültesi İbn-i Sina Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji

Dr. Aysun Yalçı Ankara Üniversitesi Tıp Fakültesi İbn-i Sina Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Dr. Aysun Yalçı Ankara Üniversitesi Tıp Fakültesi İbn-i Sina Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji HKP Prognostik Faktör Tedavi Önceden antibiyotik kullanımı (90 gün içinde), 5 gün

Detaylı

Dr. Birgül Kaçmaz Kırıkkale Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

Dr. Birgül Kaçmaz Kırıkkale Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Dr. Birgül Kaçmaz Kırıkkale Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD İnhaler uygulama İntraventriküler/intratekal uygulama Antibiyotik kilit tedavisi Antibiyotik içerikli

Detaylı

ÖZEL MİKROORGANİZMALARDA DUYARLILIK TESTLERİ VE TÜRKİYE VERİLERİ. Brusella

ÖZEL MİKROORGANİZMALARDA DUYARLILIK TESTLERİ VE TÜRKİYE VERİLERİ. Brusella ÖZEL MİKROORGANİZMALARDA DUYARLILIK TESTLERİ VE TÜRKİYE VERİLERİ Brusella Prof.Dr.A.Sesin Kocagöz Acıbadem Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Brusellozis

Detaylı

VRE ile Gelişen Kan Dolaşımı Enfeksiyonu Olgusunda Tedavi

VRE ile Gelişen Kan Dolaşımı Enfeksiyonu Olgusunda Tedavi VRE ile Gelişen Kan Dolaşımı Enfeksiyonu Olgusunda Tedavi Dr. Sabri ATALAY SBÜ İzmir Tepecik Eğitim ve Araştırma Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Kliniği KLİMİK 2017 Kongresi -

Detaylı

Çeşitli Klinik Örneklerden İzole Edilen Stafilokok Türlerinde Vankomisin Direncinin Araştırılması

Çeşitli Klinik Örneklerden İzole Edilen Stafilokok Türlerinde Vankomisin Direncinin Araştırılması Family Practice & Palliative Care ISSN 2458-8865 Çeşitli Klinik Örneklerden İzole Edilen Stafilokok Türlerinde Vankomisin Direncinin Araştırılması Investigation of vancomycin resistance in staphylococcus

Detaylı

Karbapenem Gerekmez Funda TİMURKAYNAK Başkent Üniversitesi İstanbul Hastanesi 26.03.2015

Karbapenem Gerekmez Funda TİMURKAYNAK Başkent Üniversitesi İstanbul Hastanesi 26.03.2015 GSBL Üreten Enterik Bakterilerin Tedavisi: Karbapenem Gerekmez Funda TİMURKAYNAK Başkent Üniversitesi İstanbul Hastanesi 26.03.2015 GSBL (+) Enterik Bakteriler Önemli sağlık sorunu GSBL İzolatlarda

Detaylı

MAKALE SUNUMLARI. Dr. Ferda Tunçkanat Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

MAKALE SUNUMLARI. Dr. Ferda Tunçkanat Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı MAKALE SUNUMLARI Dr. Ferda Tunçkanat Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Neisseria gonorrhoeae de yüksek düzey azitromisin direncinin 23SrRNA nın peptidil transferaz

Detaylı

DİRENÇLİ BAKTERİ ENFEKSİYONLARINA KARŞI KULLANILAN ANTİBİYOTİKLER

DİRENÇLİ BAKTERİ ENFEKSİYONLARINA KARŞI KULLANILAN ANTİBİYOTİKLER DİRENÇLİ BAKTERİ ENFEKSİYONLARINA KARŞI KULLANILAN ANTİBİYOTİKLER 1. Vankomisin Vankomisin, Nocardia Orientalis in (eskiden Streptomyces orientalis olarak bilinen) belli suşlarından elde edilen amfoterik

Detaylı

Clostridium difficile Enfeksiyonu: Epidemiyoloji, Risk Faktörleri, Patogenez, Klinik Özellikler, Tanı ve Tedavi

Clostridium difficile Enfeksiyonu: Epidemiyoloji, Risk Faktörleri, Patogenez, Klinik Özellikler, Tanı ve Tedavi Derleme Yazı/Review Article Mikrobiyol Bul 2013; 47(3): 556-566 Clostridium difficile Enfeksiyonu: Epidemiyoloji, Risk Faktörleri, Patogenez, Klinik Özellikler, Tanı ve Tedavi Clostridium difficile Infection:

Detaylı

Prof.Dr. Müzeyyen MAMAL TORUN. İ.Ü.Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Prof.Dr. Müzeyyen MAMAL TORUN. İ.Ü.Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Prof.Dr. Müzeyyen MAMAL TORUN İ.Ü.Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Haemophilus influenzae de Antibiyotiklere Direnç Haemophilus influenzae de duyarlılık testleri-1 Disk difüzyon

Detaylı

Antimikrobiyal Duyarlılık Testleri (AMD) Hangi Durumlarda Yapılmalı? Genel kavramlar

Antimikrobiyal Duyarlılık Testleri (AMD) Hangi Durumlarda Yapılmalı? Genel kavramlar ULUSAL MİKROBİYOLOJİ STANDARTLARI (UMS) Antimikrobiyal Duyarlılık Testleri Hangi Durumlarda Yapılmalı? Genel kavramlar Hazırlayan Birim Klinik Bakteriyoloji Tanı Standartları Çalışma Grubu- 11 Onaylayan

Detaylı

Kolistin Dirençli Acinetobacter baumannii Suşlarına Vankomisinin İn-Vitro etkisi

Kolistin Dirençli Acinetobacter baumannii Suşlarına Vankomisinin İn-Vitro etkisi doi:10.5222/tmcd.2014.144 Araştırma Kolistin Dirençli Acinetobacter baumannii Suşlarına Vankomisinin İn-Vitro etkisi Deniz GAZEL*, Özlem ZANAPALIOĞLU GAZEL**, Alper AKÇALI***, Müşerref TATMAN OTKUN***

Detaylı

Acil Serviste Akılcı Antibiyotik Kullanımının Temel İlkeleri Dr. A. Çağrı Büke

Acil Serviste Akılcı Antibiyotik Kullanımının Temel İlkeleri Dr. A. Çağrı Büke Acil Serviste Akılcı Antibiyotik Kullanımının Temel İlkeleri Dr. A. Çağrı Büke Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji 12/o4/2014 Akılcı antibiyotik kullanımı Antibiyotiklere

Detaylı

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Türkiye'de 2015-2016 İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Dilek Güldemir 1,Ayşe Başak Altaş 1,Fatma Filiz Arı 1,Zekiye Bakkaloğlu 1,Özlem Ünaldı 1,Fatma

Detaylı

JCEI / 2015; 6 (3): 279-285

JCEI / 2015; 6 (3): 279-285 JCEI / 2015; 6 (3): 279-285 Journal of Clinical and Experimental Investigations doi: 10.5799/ahinjs.01.2015.03.0533 ÖZGÜN ARAŞTIRMA / ORIGINAL ARTICLE Yoğun bakım ünitelerinden izole edilen Pseudomonas

Detaylı

Yeliz Çağan Appak¹, Hörü Gazi², Semin Ayhan³, Beyhan Cengiz Özyurt⁴, Semra Kurutepe², Erhun Kasırga ⁵

Yeliz Çağan Appak¹, Hörü Gazi², Semin Ayhan³, Beyhan Cengiz Özyurt⁴, Semra Kurutepe², Erhun Kasırga ⁵ Helicobacter pylori enfeksiyonlu çocuklarda klaritromisin direncinin ve 23s rrna gen nokta mutasyonlarının parafin bloklarda polimeraz zincir reaksiyonu yöntemi ile belirlenmesi Yeliz Çağan Appak¹, Hörü

Detaylı

Ulusal Antimikrobiyal Direnç Sürveyans Sistemi (UAMDSS)

Ulusal Antimikrobiyal Direnç Sürveyans Sistemi (UAMDSS) Ulusal Antimikrobiyal Direnç Sürveyans Sistemi (UAMDSS) Uzm.Dr.Hüsniye Şimşek, Mikrobiyoloji Referans Laboratuvarları DB Ulusal Antimikrobiyal Direnç Sürveyans Birimi 37. TMC Kongresi 16-20 Kasım 2016,

Detaylı

Mine Doluca Dereli Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim

Mine Doluca Dereli Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim CANDIDA TÜRLERİNDE DİRENÇ EPİDEMİYOLOJİSİ Mine Doluca Dereli Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı İYİ Kİ DOĞDUNUZ MİNE HOCA GİRİŞ İnvaziv fungal infeksiyonların ve antifungal

Detaylı

Epidemiyolojik Çalışmalar

Epidemiyolojik Çalışmalar GRAM NEGATİF BAKTERİLERDE ANTİBİYOTİK DUYARLILIĞI : EPİDEMİYOLOJİ Dr. Ş. Barçın ÖZTÜRK Adnan Menderes Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D. Epidemiyolojik Çalışmalar

Detaylı

* XXXII.Türk Mikrobiyoloji Kongresinde (12-16 Eylül 2006, Antalya) poster olarak sunulmuştur.

* XXXII.Türk Mikrobiyoloji Kongresinde (12-16 Eylül 2006, Antalya) poster olarak sunulmuştur. MİKROBİYOL MİKROBİYOLOJİ BÜLT 2007; 41: BÜLTENİ 441-446 441 KISA BİLDİRİ: STREPTOCOCCUS PNEUMONIAE VE HAEMOPHILUS INFLUENZAE KLİNİK İZOLATLARININ TEDAVİDE KULLANILAN ANTİBİYOTİKLERE KARŞI İN VİTRO DİRENÇ

Detaylı