Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti"

Transkript

1 Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti, Gökmen Zararsız, Dinçer Göksülük, Osman Saraçbaşı Hacettepe Üniversitesi Tıp Fakültesi Biyoistatistik Anabilim Dalı XVI. Ulusal Biyoistatistik Kongresi, Eylül 2014, Antalya

2 İçerik 1 İlaç Keşfi 2 Proteinin 3B Yapısının Belirlenmesi 3 Homolog Proteinlerin Belirlenmesi 4 Makine Öğrenimi Yaklaşımı

3 İlaç Keşfi ve Gelişimi

4 İlaç Keşfi ve Gelişimi

5 İlaç Keşfi ve Gelişimi Protein = Reseptör

6 Proteinin 3B Yapısı Deneysel Yöntem: X-Işını Kristalografi (%90)

7 Çözüm Homoloji Modellemesi (Homology Modeling) Homoloji: Farklı türlerde, proteinler ve genler arasındaki ortak atanın varlığı. Homoloji modellemesi ile 3B yapısı bilinen protein yapıları kullanılarak 3B yapısı bilinmeyen protein yapıları kestirilebilir.

8 Nasıl? Benzer Dizilerin Bulunması Dizi Hizalama (Sequence Alignment) Evrimsel süreçte protein dizileri 3 boyutlu yapılardan daha hızlı bozulmuştur. Benzer Dizi > Benzer 3B Yapı > Benzer Fonksiyon

9 Nasıl? Benzer Dizilerin Bulunması Dizi Hizalama (Sequence Alignment) Evrimsel süreçte protein dizileri 3 boyutlu yapılardan daha hızlı bozulmuştur. Benzer Dizi > Benzer 3B Yapı > Benzer Fonksiyon

10 Homolog Protein Tespiti BLAST: Basic Local Alignment Search Tool

11 Homolog Protein Tespiti

12 Homolog Protein Tespiti

13 Homolog Protein Tespiti

14 Homolog Protein Tespiti

15 BLAST Yeterli mi? BLAST homolog proteinlerin tespitinde hızlı ancak duyarlılığı düşük (dizi benzerliği < %30) bir yöntemdir. Neden? Sadece dizi benzerliklerini kullanır. Dizi benzerlikleri dışında proteinler arasındaki benzerlikler nasıl ölçülebilir?

16 Çalışmada Kullanılan Değişkenler 1 PSI-BLAST (Position-Specific Iterated BLAST) 2 RPS-BLAST (Reversed Position Specific BLAST) 3 SSEA (Secondary Structural Elements Alignment) 4 PPA (Profile-profile-alignment) 5 PSPA (Profile-structural-profile-alignment)

17 Çalışmada Kullanılan Değişkenler

18 Protein Sınıflaması SCOP (Structural Classification of Proteins) veri tabanı

19 Protein Sınıflaması

20 Protein Sınıflaması

21 Veri Seti Çalışmada, aynı süper ailedeki proteinler homolog olarak kabul edildi (ilk 3 indis benzerliği). İlk 3 indis benzer ise homolog (+1) İlk üç indis farklı ise homolog değil (-1)

22 Veri Seti

23 Destek Vektör Makineleri (SVM)

24 Bagging SVM

25 Performans Çekirdek fonksiyonu: Radyal tabanlı fonksiyon Geçerlilik: 10 katlı çapraz geçerlilik SVM bagsvm DUY SEC PKD NKD DSO MCC Performans Olculeri

26 Değişken Önemlilikleri Recursive Feature Elimination (Tekrarlı Değişken Eleme): caret paketi PSI RPS PPA SSEA PSPA Degisken Onemlilikleri

27 Gelecek Çalışmalar Veri Seti 1835 protein > 1,682,695 protein çifti Veri tabanı oluşturma Homolog proteinlerin bulunması ile ilgili veri tabanı Server kurma. Tübitak projesi

28 Kaynaklar Altschul, Stephen F., et al. "Basic local alignment search tool." Journal of molecular biology (1990): Altschul, Stephen F., et al. "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs." Nucleic acids research (1997): Yan, Ren-Xiang, et al. "DescFold: a web server for protein fold recognition." BMC bioinformatics 10.1 (2009): 416. Zhang, Ziding, Sunil Kochhar, and Martin G. Grigorov. "Descriptor-based protein remote homology identification." Protein science 14.2 (2005): S.D. Jones, P.D. Warren, in: Drug Discovery and Development, M.S. Chorghade (Eds.) John Wiley and Sons, New Jersey, U. Rester, From virtuality to reality-virtual screening in lead discovery and lead optimization: a medicinal chemistry perspective, Curr Opin Drug Discov Devel 11 (2008) J.M. Rollinger, S. Hermann, L. Thierry, in: Natural Compounds as Drugs Volume I. F. Petersen, R. Amstutz (Eds) Birkhäuser, Basel, 2008.

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği sirna Doç.Dr. Metiner Tosun EÜ Eczacılık Fakültesi Farmakoloji AD Trabzon Ekim 07 Geleneksel ilaç geliştirme fazları: Doğrusal süreç 1-5 yıl

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

Ders Bilgisi. Öğretim Görevlisi ORTA DOĞU TEKNİK ÜNİVERSİTESİ 9080506-1 DERS İZLENCESİ. Ders Kodu 9080506. Ders Bölümü.

Ders Bilgisi. Öğretim Görevlisi ORTA DOĞU TEKNİK ÜNİVERSİTESİ 9080506-1 DERS İZLENCESİ. Ders Kodu 9080506. Ders Bölümü. Ders Bilgisi Ders Kodu 9080506 Ders Bölümü 1 Ders Başlığı PROTEİN VE DNA DİZİ ANALİZİ Ders Kredisi 3 ECTS 8.0 Ders Katalog Tanımı Bu derste, homoloji analizi, motif ve alt-birimlerin(domain) belirlenmesi,

Detaylı

ÇALIŞMA RAPORU TARİHCE KURULUŞ 19 Haziran 1996 Yeni Dönem Başlangıcı AKTİF DÖNEM 1. Faaliyet DÖNEMİ 13 Temmuz 1996 Yönetim Kurulu Prof. Dr. Mevlüt Ertan (Başkan) Prof. Dr. Dilek Erol (ıı. Başkan)

Detaylı

Çevrimsel Araştırma. Prof.Dr. Yağız Üresin. İ.Ü. İlaç Araştırmaları Birimi İTF Tıbbi Farmakoloji AD

Çevrimsel Araştırma. Prof.Dr. Yağız Üresin. İ.Ü. İlaç Araştırmaları Birimi İTF Tıbbi Farmakoloji AD Çevrimsel Araştırma Prof.Dr. Yağız Üresin İ.Ü. İlaç Araştırmaları Birimi İTF Tıbbi Farmakoloji AD 1 2 Çevrimsel ve Klinik Bilim- Yeni bir bakış açısı zamanı Çevrimsel Araştırma yayınlarının yıllara göre

Detaylı

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ]

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ] Programın Adı (Program Name) Moleküler Biyoloji ve Genetik (Molecular Biology and Genetics) Dersin Kodu (Course Code) MBG 305 Dersin Adı (Course Name) Uygulamalı Biyoenformatik (Applied Bioinformatics)

Detaylı

NEDEN BİYOİNFORMATİK?

NEDEN BİYOİNFORMATİK? 127 NEDEN BİYOİNFORMATİK? Rengün Çetin ATALAY* Recent progresses in molecular biology have revealed the large fractions of the genome sequences of several species during the last decades. Public sequence

Detaylı

SELÇUK KORKMAZ EĞĐTĐM ALDIĞI ÜNVANLAR TEZLER ĐŞ DENEYĐMĐ ĐLGĐ ALANLARI. YABANCI DĐL ve BĐLGĐSAYAR BECERĐSĐ

SELÇUK KORKMAZ EĞĐTĐM ALDIĞI ÜNVANLAR TEZLER ĐŞ DENEYĐMĐ ĐLGĐ ALANLARI. YABANCI DĐL ve BĐLGĐSAYAR BECERĐSĐ SELÇUK KORKMAZ Hacettepe Üniversitesi Tıp Fakültesi Biyoistatistik Anabilim Dalı, 06100, Sıhhiye/ANKARA Tel: +90 312 305 1467, Faks: +90 312 305 1459 e-mail: selcuk.korkmaz@hacettepe.edu.tr EĞĐTĐM 2012-

Detaylı

Markov Zinciri Monte Carlo Yaklaşımı. Aktüeryal Uygulamaları

Markov Zinciri Monte Carlo Yaklaşımı. Aktüeryal Uygulamaları Markov Zinciri Monte Carlo Yaklaşımı ve Aktüeryal Uygulamaları ŞİRZAT ÇETİNKAYA Aktüer Sistem Araştırma Geliştirme Bölümü AKTÜERLER DERNEĞİ 2.0.20080 2008 - İSTANBUL Sunum Planı. Giriş 2. Bayesci Metodun

Detaylı

Özyineleme (Recursion)

Özyineleme (Recursion) C PROGRAMLAMA Özyineleme (Recursion) Bir fonksiyonun kendisini çağırarak çözüme gitmesine özyineleme (recursion), böyle çalışan fonksiyonlara da özyinelemeli (recursive) fonksiyonlar denilir. Özyineleme,

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI Uzm. Dr. Özgür APPAK Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D GİRİŞ:

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Arş.Gör. ÖZLEM SULTAN ASLANTÜRK

Arş.Gör. ÖZLEM SULTAN ASLANTÜRK Arş.Gör. ÖZLEM SULTAN ASLANTÜRK Fen-edebiyat Fakültesi Biyoloji Bölümü Genel Biyoloji Anabilim Dalı Eğitim Bilgileri 1995-2000 Lisans Hacettepe Üniversitesi Eğitim Fakültesi Matematik Ve Fen Bilimleri

Detaylı

3682715757-4377 ONDOKUZ MAYIS ÜNİVERSİTESİ FEN-EDEBİYAT FAKÜLTESİ/FİZİK BÖLÜMÜ/KATIHAL FİZİĞİ ANABİLİM DALI

3682715757-4377 ONDOKUZ MAYIS ÜNİVERSİTESİ FEN-EDEBİYAT FAKÜLTESİ/FİZİK BÖLÜMÜ/KATIHAL FİZİĞİ ANABİLİM DALI ZARİFE SİBEL ŞAHİN YARDIMCI DOÇENT E-Posta Adresi zarifesibel@sinop.edu.tr Telefon (İş) Telefon (Cep) Faks Adres 3682715757-4377 5464077397 Sinop Üniversitesi, Mühendislik ve Mimarlık Fakültesi, Enerji

Detaylı

2 ALGORİTMA VE AKIŞ DİYAGRAMLARI

2 ALGORİTMA VE AKIŞ DİYAGRAMLARI İÇİNDEKİLER IX İÇİNDEKİLER 1 GİRİŞ 1 Kitabın Amacı 1 Algoritmanın Önemi 2 Bilgisayarın Doğuşu ve Kullanım Amaçları 3 Programlama Dili Nedir? 3 Entegre Geliştirme Ortamı (IDE) Nedir? 4 2 ALGORİTMA VE AKIŞ

Detaylı

Zahmetsiz örüntü tanıma: Nokta bulutlarının karşılaştırılması yoluyla veri-tabanlı ve parametresiz istatistiksel öğrenme

Zahmetsiz örüntü tanıma: Nokta bulutlarının karşılaştırılması yoluyla veri-tabanlı ve parametresiz istatistiksel öğrenme Zahmetsiz örüntü tanıma: Nokta bulutlarının karşılaştırılması yoluyla veri-tabanlı ve parametresiz istatistiksel öğrenme Doç. Dr. Bilge Karaçalı Biyomedikal Veri İşleme Laboratuvarı Elektrik-Elektronik

Detaylı

03.05.2012. Homoloji: Homolog iki gen, yüksek seviyede dizilim

03.05.2012. Homoloji: Homolog iki gen, yüksek seviyede dizilim 3.5.22 Nezahat Karahan DN, RN veya Protein dizilerinin düzenlenerek benzer bölgelerinin tespit edilmesidir. Biyoinformatikte birçok inceleme, iki ya da daha çok sayıda DN veya protein dizisinin karşılaştırılmasına

Detaylı

Ardışık Veri Tipleri. Prof.Dr. Bahadır AKTUĞ JFM212 Python ile Mühendislik Uygulamaları. *Kaynakça bölümünde verilen kaynaklardan derlenmiştir.

Ardışık Veri Tipleri. Prof.Dr. Bahadır AKTUĞ JFM212 Python ile Mühendislik Uygulamaları. *Kaynakça bölümünde verilen kaynaklardan derlenmiştir. Ardışık Veri Tipleri Prof.Dr. Bahadır AKTUĞ JFM212 Python ile Mühendislik Uygulamaları *Kaynakça bölümünde verilen kaynaklardan derlenmiştir. Ardışık Veri Tipleri Ardışık veri tipleri, Python programlarında

Detaylı

ÖRTEN ÇİFT YILDIZLARIN ETRAFINDA GÖRÜNMEYEN YILDIZLAR ve GEZEGENLER Osman Demircan. 16-17 Haziran 2014 Ötegezegenler ve Yaşam

ÖRTEN ÇİFT YILDIZLARIN ETRAFINDA GÖRÜNMEYEN YILDIZLAR ve GEZEGENLER Osman Demircan. 16-17 Haziran 2014 Ötegezegenler ve Yaşam ÖRTEN ÇİFT YILDIZLARIN ETRAFINDA GÖRÜNMEYEN YILDIZLAR ve GEZEGENLER Osman Demircan 16-17 Haziran 2014 1 Çift Yıldızlar ve diskler Minimum zamanları Görünmeyen bileşen yıldızlar Ötegezegenler 16-17 Haziran

Detaylı

İNTERNET PROGRAMCILIĞI DERSİ

İNTERNET PROGRAMCILIĞI DERSİ İNTERNET PROGRAMCILIĞI DERSİ Dersin Modülleri İnternet Programcılığı 1 İnternet Programcılığı 2 İnternet Programcılığı 3 İnternet Programcılığı 4 İnternet Programcılığı 5 Kazandırılan Yeterlikler Programlama

Detaylı

ELSEVIER E-REFERENCE KÜTÜPHANES

ELSEVIER E-REFERENCE KÜTÜPHANES ELSEVIER E-REFERENCE 1 Mimari, sanat, t p, i letme, ekonomi, kimya, bilgisayar, mühendislik, fizik, astronomi, sosyal bilimler, hukuk vb. konularda 79 adet elektronik ansiklopedi tam metin olarak yer almaktad

Detaylı

Ders Kodu Ders Adı Grup Gün Ders Saatleri Başlangıç Ders Saati Bitiş Ders No Sınıf 1 ADL102 HUKUK USULÜ BİLGİSİ GR01 Perşembe 1000 1050 3.

Ders Kodu Ders Adı Grup Gün Ders Saatleri Başlangıç Ders Saati Bitiş Ders No Sınıf 1 ADL102 HUKUK USULÜ BİLGİSİ GR01 Perşembe 1000 1050 3. Ders Kodu Ders Adı Grup Gün Ders Saatleri Başlangıç Ders Saati Bitiş Ders No Sınıf 1 ADL102 HUKUK USULÜ BİLGİSİ GR01 Perşembe 1000 1050 3.DERS B123 2 ADL102 HUKUK USULÜ BİLGİSİ GR01 Perşembe 1100 1150

Detaylı

Nükleotid Dizilerinin Aminoasit Formatına Dönüştürülmesi ve Dünya Veri Tabanlarındaki Verilerle Karşılaştırılması

Nükleotid Dizilerinin Aminoasit Formatına Dönüştürülmesi ve Dünya Veri Tabanlarındaki Verilerle Karşılaştırılması Kafkas Univ Vet Fak Derg 19 (2): 359-363, 2013 DOI: 10.9775/kvfd.2012.7909 Journal Home-Page: http://vetdergi.kafkas.edu.tr Online Submission: http://vetdergikafkas.org REVIEW * ** Nükleotid Dizilerinin

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

Elektronik Dergilerde Kullanım Analizi: ANKOS ve ODTÜ Örneği. Hacer ÖZEN Orta Doğu Teknik Üniversitesi

Elektronik Dergilerde Kullanım Analizi: ANKOS ve ODTÜ Örneği. Hacer ÖZEN Orta Doğu Teknik Üniversitesi Elektronik Dergilerde Kullanım Analizi: ANKOS ve ODTÜ Örneği Hacer ÖZEN Orta Doğu Teknik Üniversitesi KAPSAM Amaç ANKOS ve ODTÜ Veri Tabanları Kullanım Verileri Veri Analiz Yöntemleri ANKOS ve ODTÜ Dergi

Detaylı

Arş.Gör.Hüseyin TOPAN - http://jeodezi.karaelmas.edu.tr 1

Arş.Gör.Hüseyin TOPAN - http://jeodezi.karaelmas.edu.tr 1 Mikrodalga radyometre UZAKTAN ALGILAMADA GÖRÜNTÜLEME SİSTEMLERİ Hüseyin TOPAN Algılayıcı Pasif amaçlı olmayan amaçlı Manyetik algılayıcı Gravimetre Fourier spektrometresi Diğerleri Optik Film tabanlı Dijital

Detaylı

Çoktan Seçmeli Değerlendirme Soruları Akış Şemaları İle Algoritma Geliştirme Örnekleri Giriş 39 1.Gündelik Hayattan Algoritma Örnekleri 39 2.Say

Çoktan Seçmeli Değerlendirme Soruları Akış Şemaları İle Algoritma Geliştirme Örnekleri Giriş 39 1.Gündelik Hayattan Algoritma Örnekleri 39 2.Say İÇİNDEKİLER 1. Bilgisayarın Yapısı Ve Programlama Dilleri Giriş 1 Bilgisayar ve Programlamanın Kısa Bir Tarihçesi 2 Donanım ve Yazılım Kavramları 3 Bilgisayarın Donanımsal yapısı 4 Giriş Birimi (Input

Detaylı

Yazılım Nedir? 2. Yazılımın Tarihçesi 3. Yazılım Grupları 4 Sistem Yazılımları 4 Kullanıcı Yazılımları 5. Yazılımın Önemi 6

Yazılım Nedir? 2. Yazılımın Tarihçesi 3. Yazılım Grupları 4 Sistem Yazılımları 4 Kullanıcı Yazılımları 5. Yazılımın Önemi 6 ix Yazılım Nedir? 2 Yazılımın Tarihçesi 3 Yazılım Grupları 4 Sistem Yazılımları 4 Kullanıcı Yazılımları 5 Yazılımın Önemi 6 Yazılımcı (Programcı) Kimdir? 8 Yazılımcı Olmak 9 Adım Adım Yazılımcılık 9 Uzman

Detaylı

Mann-Whitney U ve Wilcoxon T Testleri

Mann-Whitney U ve Wilcoxon T Testleri Mann-Whitney U ve Wilcoxon T Testleri Doç. Dr. Ertuğrul ÇOLAK Eskişehir Osmangazi Üniversitesi Tıp Fakültesi Biyoistatistik Anabilim Dalı Konu Başlıkları Parametrik olmayan yöntem Mann-Whitney U testinin

Detaylı

Dr. Hidayet Takçı. Veri Madenciliği Dersi G Y T E Dr. Hidayet Takçı 10/05/2008 1

Dr. Hidayet Takçı. Veri Madenciliği Dersi G Y T E Dr. Hidayet Takçı 10/05/2008 1 Birinci Saat Veri Madenciliği: Giriş Dr. Hidayet Takçı Veri Madenciliği Dersi G Y T E Dr. Hidayet Takçı 10/05/2008 1 Neden Veri Madenciliği? Ticari Bakış Açısı Çok miktarda veri toplanmış ve ambarlanmıştır.

Detaylı

Erzurum İlinden Kasim Ayinda Elde Edilen Sütlerde Protein/Yağ Oraninin Farkli Peynir Çeşitleri Yapimina Uygunluğu

Erzurum İlinden Kasim Ayinda Elde Edilen Sütlerde Protein/Yağ Oraninin Farkli Peynir Çeşitleri Yapimina Uygunluğu Erzurum İlinden Kasim Ayinda Elde Edilen Sütlerde Protein/Yağ Oraninin Farkli Peynir Çeşitleri Yapimina Uygunluğu Remziye KOCAKAYA 1, Hividar KOCAKAYA 2*, Tolga İNAL 2 Özet Bu çalışma Kasım ayında Erzurum

Detaylı

Prof. Dr. Esin AKI E-Mail: esinaki@ankara.edu.tr. CADD 3D QSAR > 3D İlaç Tasarımının Uygulanma Yöntemleri

Prof. Dr. Esin AKI E-Mail: esinaki@ankara.edu.tr. CADD 3D QSAR > 3D İlaç Tasarımının Uygulanma Yöntemleri E-Mail: esinaki@ankara.edu.tr CADD 3D QSAR > 3D İlaç Tasarımının Uygulanma Yöntemleri MOLEKÜLER ELEKTROSTATİK POTANSİYEL (MEP) HESAPLAMALARI 2 Molekülün belli bir uzaklıkta iken etkileşmesinde ilk önemli

Detaylı

MİKROŞERİT HAT ENDÜKTANS BÜYÜKLÜĞÜNÜN BİLGİ TABANLI YAPAY SİNİR AĞLARI ile MODELLENMESİ

MİKROŞERİT HAT ENDÜKTANS BÜYÜKLÜĞÜNÜN BİLGİ TABANLI YAPAY SİNİR AĞLARI ile MODELLENMESİ MİKROŞERİT HAT ENDÜKTANS BÜYÜKLÜĞÜNÜN BİLGİ TABANLI YAPAY SİNİR AĞLARI ile MODELLENMESİ Levent AKSOY e-posta: levent@ehb.itu.edu.tr Neslihan Serap ŞENGÖR e-posta: neslihan@ehb.itu.edu.tr Elektronik ve

Detaylı

Bilgisayar Teknolojileri Bölümü Bilgisayar Programcılığı Programı. Öğr. Gör. Cansu AYVAZ GÜVEN

Bilgisayar Teknolojileri Bölümü Bilgisayar Programcılığı Programı. Öğr. Gör. Cansu AYVAZ GÜVEN Bilgisayar Teknolojileri Bölümü Bilgisayar Programcılığı Programı Öğr. Gör. Cansu AYVAZ GÜVEN NESNE TABANLI PROGRAMLAMA Java Değişkenler ve Veri Tipleri Operatörler JAVA Java Java SUN bilgisayar şirketince

Detaylı

Bilgisayar Programlama MATLAB

Bilgisayar Programlama MATLAB What is a computer??? Bilgisayar Programlama MATLAB Prof. Dr. İrfan KAYMAZ What Konular is a computer??? MATLAB ortamının tanıtımı Matlab sistemi (ara yüzey tanıtımı) a) Geliştirme ortamı b) Komut penceresi

Detaylı

FİLOGENİ ve HAYAT AĞACI

FİLOGENİ ve HAYAT AĞACI FİLOGENİ ve HAYAT AĞACI Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER Giriş Filogenetik veriler ile canlılar arasında oluşturulan akrabalık ilişkileri, canlılığın gelişimine dair bize akrabalık ağaçlarını

Detaylı

Y.T.Ü. Öğrenci Bilgi Sistemi USIS (University Student Information System) Tanıtımı. (Doküman No: KL-029; Revizyon Tarihi: ; Revizyon No:01)

Y.T.Ü. Öğrenci Bilgi Sistemi USIS (University Student Information System) Tanıtımı. (Doküman No: KL-029; Revizyon Tarihi: ; Revizyon No:01) Y.T.Ü. Öğrenci Bilgi Sistemi USIS (University Student Information System) Tanıtımı (Doküman No: KL-029; Revizyon Tarihi:01.11.2013; Revizyon No:01) 1 OGIS Öğrenci Sisteminin Yapısı Web Server Database

Detaylı

Aynı tipten çok sayıda değişken topluluğudur. X Y Score1 Score2 (0) (1) (2)...

Aynı tipten çok sayıda değişken topluluğudur. X Y Score1 Score2 (0) (1) (2)... Array (Diziler) Array Aynı tipten çok sayıda değişken topluluğudur. Birden fazla aynı tipteki değerle işlem yapmayı kolaylaştırır. X Y Score1 Score2 40 56 Grade 40 56 80 (0) (1) (2)... (13) Array tanımlama:

Detaylı

ADI SOYADI (Name Kasım TAKIM

ADI SOYADI (Name Kasım TAKIM ADI SOYADI (Name Kasım TAKIM Surname) FAKÜLTESİ (Faculty) VETERİNER BÖLÜMÜ (Department) Temel Bilimler ANABİLİM DALI Biyokimya İŞ TELEFONU (Office telephone) FAKS NUMARASI (Fax 318 39 22 number) MİLLİYETİ

Detaylı

Görsel Programlama DERS 04. Görsel Programlama - Ders04/ 1

Görsel Programlama DERS 04. Görsel Programlama - Ders04/ 1 Görsel Programlama DERS 04 Görsel Programlama - Ders04/ 1 Diziler ve Kolleksiyonlar(Collections) Diziler aynı tipli değişkenleri tutmak için kullanılan veri yapılarıdır. Diziler sabit uzunlukludur. Birkez

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

Maltepe Üniversitesi Bilgisayar Mühendisliği Bölümü Veri Tabanı ve Yönetimi (BİL 301)

Maltepe Üniversitesi Bilgisayar Mühendisliği Bölümü Veri Tabanı ve Yönetimi (BİL 301) Maltepe Üniversitesi Bilgisayar Mühendisliği Bölümü Veri Tabanı ve Yönetimi (BİL 301) GENEL DERS BİLGİLERİ Öğretim Elemanı : Öğr. Gör. Erdal GÜVENOĞLU Ofis : MUH 313 Ofis Saatleri : Pazartesi: 10.00-12.00,

Detaylı

İstatistikçiler Dergisi

İstatistikçiler Dergisi www.istatistikciler.org İstatistikçiler Dergisi (28) 6-22 İstatistikçiler Dergisi COX REGRESYON MODELİ VE AKCİĞER KANSERİ VERİLERİ İLE BİR UYGULAMA Durdu KARASOY Hacettepe Üniversitesi Fen Fakültesi İstatistik

Detaylı

Fen-Edebiyat Fakültesi. Sağlık Hizmetleri Meslek Yüksekokulu

Fen-Edebiyat Fakültesi. Sağlık Hizmetleri Meslek Yüksekokulu 1. KİŞİSEL BİLGİLER 1.1. Adı Soyadı: Gökhan ALPASLAN 1.2. Doğum Tarihi ve Yeri: 29.06.1982 / ANKARA 1.3. Ünvanı: Yrd.Doç.Dr 1.4. Öğrenim Durumu: Doktora 2. AKADEMİK DERECELER 2.1. Eğitim (dereceler, alan,

Detaylı

Biyoenformatik te Dizi Kıyaslaması

Biyoenformatik te Dizi Kıyaslaması Biyoenformatik te Dizi Kıyaslaması Editör Jens Allmer Yardımcı Editörler Canan Has Şule Yılmaz Biyoenformatik te Dizi Hizalamaları Editör: Jens Allmer Yardımcı Editörler: Canan Has, Şule Yılmaz Kapak Tasarımı:

Detaylı

k-en Yakın Komşu Algoritması ve Bir Uygulama (Kredi Riskini Sınıflandırma)

k-en Yakın Komşu Algoritması ve Bir Uygulama (Kredi Riskini Sınıflandırma) k-en Yakın Komşu Algoritması ve Bir Uygulama (Kredi Riskini Sınıflandırma) M. ERDAL BALABAN (mebalaban@gmail.com) Türkiye Toplum Hizmetleri Vakfı R Programlama Dili ile Veri Madenciliği Seminerleri SEMİNER

Detaylı

Frekans. Hemoglobin Düzeyi

Frekans. Hemoglobin Düzeyi GRUPLARARASI VE GRUPİÇİ KARŞILAŞTIRMA YÖNTEMLERİ Uzm. Derya ÖZTUNA Yrd. Doç. Dr. Atilla Halil ELHAN 1. ÖNEMLİLİK (HİPOTEZ) TESTLERİ Önemlilik testleri, araştırma sonucunda elde edilen değerlerin ya da

Detaylı

Örüntü Tanıma (EE 448) Ders Detayları

Örüntü Tanıma (EE 448) Ders Detayları Örüntü Tanıma (EE 448) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Saati Kredi AKTS Örüntü Tanıma EE 448 Bahar 3 0 0 3 5 Ön Koşul Ders(ler)i Dersin Dili Dersin Türü Dersin

Detaylı

Ankara Üniversitesi Eczacılık Fakültesi Farmasötik Kimya Anabilim Dalı. Prof. Dr. Esin AKI

Ankara Üniversitesi Eczacılık Fakültesi Farmasötik Kimya Anabilim Dalı. Prof. Dr. Esin AKI -YALÇIN Ankara Üniversitesi Eczacılık Fakültesi Farmasötik Kimya Anabilim Dalı 5000 in üzerinde ilaç etken maddesi var. 20000 in üzerinde farmasötik ürün var. ABD de Yaşam süresinin uzaması 2010 Kadınlarda

Detaylı

Kimya Mühendisliğinde Uygulamalı Matematik

Kimya Mühendisliğinde Uygulamalı Matematik Fen Bilimleri Enstitüsü Kimya Mühendisliği Anabilim Dalı Kimya Mühendisliğinde Uygulamalı Matematik DERS BİLGİ FORMU DERS BİLGİLERİ Dersin Adı Kodu Yarıyıl Kimya Mühendisliğinde Uygulamalı Matematik T

Detaylı

Yrd. Doç. Dr. İsmail KENAR

Yrd. Doç. Dr. İsmail KENAR Yrd. Doç. Dr. İsmail KENAR Dumlupınar Üniversitesi Eğitim Fakültesi İlköğretim Bölümü Fen Bilgisi Öğretmenliği Ana Bilim Dalı Evliya Çelebi Yerleşkesi (43100) KÜTAHYA Cep Telefonu: Telefon: 02742652031/4591

Detaylı

T.C. MARDİN ARTUKLU ÜNİVERSİTESİ MİDYAT MESLEK YÜKSEKOKULU BİLGİSAYAR PROGRAMCILIĞI (UZAKTAN ÖĞRETİM) ÖNLİSANS PROGRAMI Eğitim Öğretim Yılı

T.C. MARDİN ARTUKLU ÜNİVERSİTESİ MİDYAT MESLEK YÜKSEKOKULU BİLGİSAYAR PROGRAMCILIĞI (UZAKTAN ÖĞRETİM) ÖNLİSANS PROGRAMI Eğitim Öğretim Yılı T.C. MARDİN ARTUKLU ÜNİVERSİTESİ MİDYAT MESLEK YÜKSEKOKULU BİLGİSAYAR PROGRAMCILIĞI (UZAKTAN ÖĞRETİM) ÖNLİSANS PROGRAMI 2017-2018 Eğitim Öğretim Yılı ALGORİTMA VE PROGRAMLAMAYA GİRİŞ BPU101 5 AKTS 1. yıl/1.yarıyıl

Detaylı

Kalkülüs II (MATH 152) Ders Detayları

Kalkülüs II (MATH 152) Ders Detayları Kalkülüs II (MATH 152) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Saati Kredi AKTS Kalkülüs II MATH 152 Güz 4 2 0 5 7.5 Ön Koşul Ders(ler)i Math 151 Kalkülüs I Dersin

Detaylı

DİNAMİK - 7. Yrd. Doç. Dr. Mehmet Ali Dayıoğlu Ankara Üniversitesi Ziraat Fakültesi. Tarım Makinaları ve Teknolojileri Mühendisliği Bölümü

DİNAMİK - 7. Yrd. Doç. Dr. Mehmet Ali Dayıoğlu Ankara Üniversitesi Ziraat Fakültesi. Tarım Makinaları ve Teknolojileri Mühendisliği Bölümü DİNAMİK - 7 Yrd. Doç. Dr. Mehmet Ali Dayıoğlu Ankara Üniversitesi Ziraat Fakültesi Tarım Makinaları ve Teknolojileri Mühendisliği Bölümü 7. HAFTA Kapsam: Parçacık Kinetiği, Kuvvet İvme Yöntemi Newton hareket

Detaylı

Yrd.Doç.Dr.Yaşar EREN Selçuk üniversitesi Müh.-Mim. Fakültesi Jeoloji Mühendisliği Bölümü Konya-2003 Devam ediyor

Yrd.Doç.Dr.Yaşar EREN Selçuk üniversitesi Müh.-Mim. Fakültesi Jeoloji Mühendisliği Bölümü Konya-2003 Devam ediyor Selçuk Üniversitesi Mühendislik-Mimarlık Fakültesi Jeoloji Mühendisliği Bölümü 2. Sınıf Bahar Yarıyılında Okutulan Tektonik II Dersi kapsamında hazırlanan bu sunumlar 32 bölüm şeklinde hazırlanmıştır.

Detaylı

Biyoanorganik Kimya (CEAC 412) Ders Detayları

Biyoanorganik Kimya (CEAC 412) Ders Detayları Biyoanorganik Kimya (CEAC 412) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Kredi AKTS Saati Biyoanorganik Kimya CEAC 412 Her İkisi 3 0 0 3 5 Ön Koşul Ders(ler)i Dersin

Detaylı

ALGORİTMA VE PROGRAMLAMA I

ALGORİTMA VE PROGRAMLAMA I ALGORİTMA VE PROGRAMLAMA I YZM 1101 Celal Bayar Üniversitesi Hasan Ferdi Turgutlu Teknoloji Fakültesi Genel Bakış 2 Diziler Dizi Nedir? Dizilerin Bildirimi Dizilere Başlangıç Değeri Verme Dizilerde Arama

Detaylı

Ders Adı Kodu Yarıyılı T+U Saati Ulusal Kredisi AKTS. Veri Organizasyonu ve Yönetimi BIL303 5 3+0 3 5

Ders Adı Kodu Yarıyılı T+U Saati Ulusal Kredisi AKTS. Veri Organizasyonu ve Yönetimi BIL303 5 3+0 3 5 DERS BİLGİLERİ Ders Adı Kodu Yarıyılı T+U Saati Ulusal Kredisi AKTS Veri Organizasyonu ve Yönetimi BIL303 5 3+0 3 5 Ön Koşul Dersleri Dersin Dili Dersin Seviyesi Dersin Türü Türkçe Lisans Zorunlu / Yüz

Detaylı

Akciğer Kanseri Erken Teşhis Kiti

Akciğer Kanseri Erken Teşhis Kiti Şükrü Atakan Alper Poyraz Doç. Dr. Ali O. Güre - ASO Sağlık Odaklı Üniversite Sanayi İşbirliği Çalıştayı 2 Nisan 2015, Perşembe Sunum İçeriği Araştırma / Çalışma Alanı Kanser Erken Teşhisi Araştırma- Proje-

Detaylı

CBS Arc/Info Kavramları

CBS Arc/Info Kavramları Arc/Info Kavramları Prof.Dr. Emin Zeki BAŞKENT Karadeniz Teknik Üniversitesi Orman Fakültesi (ESRI) Environmental Systems Research Institute Dünyadaki 50 büyük yazılım şirketinden birisidir Pazarın 1/3

Detaylı

SÜRE BİLİŞİM TEKNOLOJİLERİ ÜNİTE 1: BİLİŞİM SİSTEMLERİ DERS SAATİ: 6

SÜRE BİLİŞİM TEKNOLOJİLERİ ÜNİTE 1: BİLİŞİM SİSTEMLERİ DERS SAATİ: 6 EKİM 6. 28Ekim -Kasım 203 EKİM 5. 2-25 Ekim 203 EKİM 4. 7- Ekim 203 EKİM 3. 30 Eylül -4 Ekim 203 EYLÜL 2. 23-27 Eylül 203 EYLÜL. 6-20 Eylül 203 203 204 ÖĞRETİM YILI BİLİŞİM TEKNOLOJİLERİ ÜNİTE : BİLİŞİM

Detaylı

INS4801 Coğrafi Bilgi Sistemleri (CBS) (3 + 0)

INS4801 Coğrafi Bilgi Sistemleri (CBS) (3 + 0) Dokuz Eylül Üniversitesi Mühendislik Fakültesi İnşaat Mühendisliği Bölümü INS4801 Coğrafi Bilgi Sistemleri (CBS) (3 + 0) Prof.Dr.YALÇIN ARISOY yalcin.arisoy@deu.edu.tr DERSİN KAPSAMI: Coğrafi Bilgi Sistemlerine

Detaylı

LİTERATÜRÜNE KATKILARI: MARMARA DEPREMİ NİN ETKİSİ. Zehra TAŞKIN HACETTEPE ÜNİVERSİTESİ BİLGİ VE BELGE YÖNETİMİ BÖLÜMÜ

LİTERATÜRÜNE KATKILARI: MARMARA DEPREMİ NİN ETKİSİ. Zehra TAŞKIN HACETTEPE ÜNİVERSİTESİ BİLGİ VE BELGE YÖNETİMİ BÖLÜMÜ TÜRK BİLİM ADAMLARININ DEPREM LİTERATÜRÜNE KATKILARI: MARMARA DEPREMİ NİN ETKİSİ Zehra TAŞKIN HACETTEPE ÜNİVERSİTESİ BİLGİ VE BELGE YÖNETİMİ BÖLÜMÜ ztaskin@hacettepe.edu.tr PLAN Giriş Araştırmanın amacı

Detaylı

BİLGİSAYAR MÜHENDİSLİĞİ DOKTORA DERS PROGRAMI (Lisanstan gelenler için)

BİLGİSAYAR MÜHENDİSLİĞİ DOKTORA DERS PROGRAMI (Lisanstan gelenler için) BİLGİSAYAR MÜHENDİSLİĞİ DOKTORA DERS PROGRAMI (Lisanstan gelenler için) HAZIRLIK PROGRAMI COME 27 İleri Nesneye Yönelik Programlama 5 COME 21 Veri Yapıları ve Algoritmalar COME 22 COME 1 COME 1 COME 411

Detaylı

Görev Unvanı Alan Üniversite Yıl Prof. Dr. Elek.-Eln Müh. Çukurova Üniversitesi Eylül 2014

Görev Unvanı Alan Üniversite Yıl Prof. Dr. Elek.-Eln Müh. Çukurova Üniversitesi Eylül 2014 ÖZGEÇMİŞ 1. Adı Soyadı : MUSTAFA GÖK 2. Doğum Tarihi: : 1972 3. Unvanı : Prof. Dr. 4. Öğrenim Durumu Derece Alan Üniversite Yıl Lisans Elektronik Mühendisliği İstanbul Üniversitesi 1995 Yüksek Lisans Electrical

Detaylı

AOSB 2017 EĞİTİM PROGRAMI

AOSB 2017 EĞİTİM PROGRAMI Eğitimin Konusu : Makro Excel Eğitim Tarihi : 04-05-10-11-12 Mayıs 2017 Eğitim Hedef Kitlesi : Excel kulllanıcıları arasında pratiklik ve hız kazanmış, Excel fonksiyonları, Veri Analizi araçlarını kullanma

Detaylı

YTÜ Makine Mühendisliği Bölümü Hidromekanik ve Hidrolik Makinalar Anabilim Dalı Özel Laboratuvar Dersi Radyal Vantilatör Deney Raporu

YTÜ Makine Mühendisliği Bölümü Hidromekanik ve Hidrolik Makinalar Anabilim Dalı Özel Laboratuvar Dersi Radyal Vantilatör Deney Raporu YTÜ Makine Mühendisliği Bölümü Hidromekanik ve Hidrolik Makinalar Anabilim Dalı Özel Laboratuvar Dersi Radyal Vantilatör Deney Raporu Laboratuar Tarihi: Numara: Adı Soyadı: Grup/Alt grup:.. /. Laboratuarı

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

BİL-341 ALGORİTMALAR BÜYÜK O NOTASYONU AHMET ATAKAN 0904.01036. atakanahmet@hotmail.com KIRGIZİSTAN-TÜRKİYE MANAS ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ

BİL-341 ALGORİTMALAR BÜYÜK O NOTASYONU AHMET ATAKAN 0904.01036. atakanahmet@hotmail.com KIRGIZİSTAN-TÜRKİYE MANAS ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ BİL-341 ALGORİTMALAR BÜYÜK O NOTASYONU AHMET ATAKAN 0904.01036 atakanahmet@hotmail.com KIRGIZİSTAN-TÜRKİYE MANAS ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ BİLGİSAYAR MÜHENDİSLİĞİ BÖLÜMÜ BİŞKEK 2012 Ahmet Atakan

Detaylı

Etiyolojide Sorumlu Olduğu Bilinen 11 Gende Mutasyon Tespit Edilmemiş Olan MODY Hastalarında Etiyolojide Sorumlu Yeni Genlerin Araştırılması

Etiyolojide Sorumlu Olduğu Bilinen 11 Gende Mutasyon Tespit Edilmemiş Olan MODY Hastalarında Etiyolojide Sorumlu Yeni Genlerin Araştırılması Etiyolojide Sorumlu Olduğu Bilinen 11 Gende Mutasyon Tespit Edilmemiş Olan MODY Hastalarında Etiyolojide Sorumlu Yeni Genlerin Araştırılması Aycan Z, Yılmaz AS, Ceylaner G Dr. Sami Ulus Kadın Doğum, Çocuk

Detaylı

Öğr. Gör. Cansu AYVAZ GÜVEN VERİTABANI-II. Değişken Tanımlama Ve Akış Kontrol Deyimleri

Öğr. Gör. Cansu AYVAZ GÜVEN VERİTABANI-II. Değişken Tanımlama Ve Akış Kontrol Deyimleri Öğr. Gör. Cansu AYVAZ GÜVEN VERİTABANI-II Değişken Tanımlama Ve Akış Kontrol Deyimleri Değişken Tanımlama Değişken isimlerinin başında @ sembolü bulunur. @ad, @soyad, @tarih değişken isimlerine birer örnektir.

Detaylı

ERCİYES ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTUSÜ BİLGİSAYAR MÜHENDİSLİĞİ ANABİLİMDALI. I. GENEL BİLGİLER Ders Adı

ERCİYES ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTUSÜ BİLGİSAYAR MÜHENDİSLİĞİ ANABİLİMDALI. I. GENEL BİLGİLER Ders Adı BİM618 Evrimsel Algoritmalar Öğretim Üyesi Prof. Dr. Derviş Karaboğa Görüşme Saatleri 8.00-17.00 E posta: karaboga@erciyes.edu.tr http://abis.erciyes.edu.tr/sorgu.aspx?sorgu=236 Erciyes Üniversitesi, Mühendislik

Detaylı

Konsorsiyal Elektronik Dergi Kullanımına Dayalı Lisans Modelleri

Konsorsiyal Elektronik Dergi Kullanımına Dayalı Lisans Modelleri Konsorsiyal Elektronik Dergi Kullanımına Dayalı Lisans Modelleri Yaşar Tonta Hacettepe Üniversitesi Bilgi ve Belge Yönetimi Bölümü tonta@hacettepe.edu.tr yunus.hacettepe.edu.tr/~tonta/tonta.html -1 Plan

Detaylı

T.C. Celal Bayar Üniversitesi ADIM Üniversiteleri Bilimsel Araştırma Destek Ve Teşvikler Toplantısı

T.C. Celal Bayar Üniversitesi ADIM Üniversiteleri Bilimsel Araştırma Destek Ve Teşvikler Toplantısı T.C. Celal Bayar Üniversitesi ADIM Üniversiteleri Bilimsel Araştırma Destek Ve Teşvikler Toplantısı InCites Programı ile ADIM Üniversitelerinin Akademik Performans Göstergeleri Prof.Dr. Ramazan GÖKBUNAR

Detaylı

Biological Diversity and Conservation. ISSN Online; ISSN Print 9/2 (S1) (2016) 84-91

Biological Diversity and Conservation. ISSN Online; ISSN Print 9/2 (S1) (2016) 84-91 www.biodicon.com Biological Diversity and Conservation ISSN 130-0 Online; ISSN 130-301 Print 9/2 (S1) (201) -91 Research article/araştırma makalesi Identification and bioinformatics analyzes of heat shock

Detaylı

EĞİTİM FAKÜLTESİ Ortaöğretim Fen ve Ortaöğretim Fen ve ENSTİTÜSÜ

EĞİTİM FAKÜLTESİ Ortaöğretim Fen ve Ortaöğretim Fen ve ENSTİTÜSÜ ÖZGEÇMİŞ VE ESERLER LİSTESİ Adı Soyadı E-posta : SAFİYE ASLAN : safiyeaslan@gmail.com 1. EĞİTİM DURUMU Unvan Bölüm/Anabilim Dalı Fakülte / Y.Okul Üniversite Yıllar Lisans Kimya Öğretmenliği/ EĞİTİM FAKÜLTESİ

Detaylı

Temel Tasarım I (ICM 101) Ders Detayları

Temel Tasarım I (ICM 101) Ders Detayları Temel Tasarım I (ICM 101) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Saati Kredi AKTS Temel Tasarım I ICM 101 Güz 4 6 0 7 12 Ön Koşul Ders(ler)i Yok Dersin Dili Dersin

Detaylı

EĞİTİM FAKÜLTESİ Ortaöğretim Fen ve Ortaöğretim Fen ve ENSTİTÜSÜ

EĞİTİM FAKÜLTESİ Ortaöğretim Fen ve Ortaöğretim Fen ve ENSTİTÜSÜ ÖZGEÇMİŞ VE ESERLER LİSTESİ Adı Soyadı : SAFİYE ASLAN Doğum Tarihi : 15/05/1979 E-posta : safiyeaslan@gmail.com 1. EĞİTİM DURUMU Unvan Bölüm/Anabilim Dalı Fakülte / Y.Okul Üniversite Yıllar Lisans Kimya

Detaylı

Zeki Optimizasyon Teknikleri

Zeki Optimizasyon Teknikleri Zeki Optimizasyon Teknikleri Genetik Algoritma (Genetic Algorithm) Doç.Dr. M. Ali Akcayol Genetik Algoritma 1970 li yıllarda John Holland tarafından geliştirilmiştir. 1989 yılında David E. Goldberg Genetik

Detaylı

Ders 10 - Diğer küçük kodlamayan RNA lar

Ders 10 - Diğer küçük kodlamayan RNA lar Ders 10 - Diğer küçük kodlamayan RNA lar ü Yüksek organizmalar ait proteomlar nispeten durağandır. ü Bir bireyde diğer insanlara göre her haploid genomun ~3.000.000 dizisinin farklı olmasına rağmen, bu

Detaylı

Akışkanlar Mekaniği II (ME 302) Ders Detayları

Akışkanlar Mekaniği II (ME 302) Ders Detayları Akışkanlar Mekaniği II (ME 302) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Saati Kredi AKTS Akışkanlar Mekaniği II ME 302 Güz 3 0 0 3 5 Ön Koşul Ders(ler)i ME 301 Dersin

Detaylı

DOKUZ EYLÜL ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ DEKANLIĞI DERS/MODÜL/BLOK TANITIM FORMU. Dersin Kodu: CME 4410

DOKUZ EYLÜL ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ DEKANLIĞI DERS/MODÜL/BLOK TANITIM FORMU. Dersin Kodu: CME 4410 Dersi Veren Birim: Bilgisayar Mühendisliği Dersin Türkçe Adı: ÖRÜNTÜ TANIMAYA GİRİŞ Dersin Orjinal Adı: INTRODUCTION TO PATTERN RECOGNITION Dersin Düzeyi:(Ön lisans, Lisans, Yüksek Lisans, Doktora) Lisans

Detaylı

Veritabanı Dersi. Teoriden Pratiğe. Çağıltay N.E., Tokdemir G. Veritabanı Sistemleri Dersi -Bölüm XXV: Web'den Erişim Çağıltay, N., Tokdemir, G.

Veritabanı Dersi. Teoriden Pratiğe. Çağıltay N.E., Tokdemir G. Veritabanı Sistemleri Dersi -Bölüm XXV: Web'den Erişim Çağıltay, N., Tokdemir, G. Veritabanı Dersi Teoriden Pratiğe Çağıltay N.E., Tokdemir G. Veritabanı Sistemleri Dersi -Bölüm XXV: Web'den Erişim Çağıltay, N., Tokdemir, G. BÖLÜM 25 Web den Erişim Ortak Geçit Arayüzü Bazı Web Kavramları

Detaylı

Ö Z G E Ç M İ Ş. 1. Adı Soyadı: Mustafa GÖÇKEN. 2. Doğum Tarihi: 12 Haziran 1976. 3. Unvanı: Yrd. Doç. Dr. 4. Öğrenim Durumu: Ph.D.

Ö Z G E Ç M İ Ş. 1. Adı Soyadı: Mustafa GÖÇKEN. 2. Doğum Tarihi: 12 Haziran 1976. 3. Unvanı: Yrd. Doç. Dr. 4. Öğrenim Durumu: Ph.D. Ö Z G E Ç M İ Ş 1. Adı Soyadı: Mustafa GÖÇKEN 2. Doğum Tarihi: 12 Haziran 1976 3. Unvanı: Yrd. Doç. Dr. 4. Öğrenim Durumu: Ph.D. Derece Alan Üniversite Yıl Lisans Endüstri Mühendisliği Çukurova Üniversitesi

Detaylı

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ]

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ] Programın Adı (Program Name) Dersin Kodu (Course Code) MBG 404 Molecüler Biyoloji ve Genetik (Molecular Biology and Genetics) Dersin Adı (Course Name) Bilişimsel Biyoloji (Computational Biology) Dersin

Detaylı

1. Adı Soyadı : Dr. Emir Alper TÜRKOĞLU

1. Adı Soyadı : Dr. Emir Alper TÜRKOĞLU ÖZGEÇMİŞ 1. Adı Soyadı : Dr. Emir Alper TÜRKOĞLU 2. Doğum Tarihi : 06.02.1984 3. Unvanı : Yardımcı Doçent 4. Öğrenim Durumu : Derece Alan Üniversite Yıl Lisans Biyoloji Hacettepe Üniversitesi 2007 Y. Lisans

Detaylı

İÇİNDEKİLER İÇİNDEKİLER KODLAB

İÇİNDEKİLER İÇİNDEKİLER KODLAB İÇİNDEKİLER IX İÇİNDEKİLER 1 GİRİŞ 1 Kitabın Amacı 1 Algoritmanın Önemi 2 Bilgisayarın Doğuşu ve Kullanım Amaçları 3 Programlama Dili Nedir? 3 Entegre Geliştirme Ortamı (IDE) Nedir? 4 2 ALGORİTMA VE AKIŞ

Detaylı

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ]

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ] Programın Adı (Program Name) Kodu (Course Code) CS 102 Molecüler Biyoloji ve Genetik (Molecular Biology and Genetics) Adı (Course Name) Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ]

Detaylı

DEÜ MÜHENDİSLİK FAKÜLTESİ MÜHENDİSLİK BİLİMLERİ DERGİSİ Cilt: 16 Sayı: 48 sh. 86-93 Eylül 2014

DEÜ MÜHENDİSLİK FAKÜLTESİ MÜHENDİSLİK BİLİMLERİ DERGİSİ Cilt: 16 Sayı: 48 sh. 86-93 Eylül 2014 DEÜ MÜHENDİSLİK FAKÜLTESİ MÜHENDİSLİK BİLİMLERİ DERGİSİ Cilt: 16 Sayı: 48 sh. 86-93 Eylül 2014 DESTEK VEKTÖR MAKİNELERİ PARAMETRE OPTİMİZASYONUNUN DUYGU ANALİZİ ÜZERİNDEKİ ETKİSİ (EFFECTS OF SUPPORT VECTOR

Detaylı

İlaç Ar-Ge sinde Darboğazlar ve Çözüm Önerileri

İlaç Ar-Ge sinde Darboğazlar ve Çözüm Önerileri İlaç Ar-Ge sinde Darboğazlar ve Çözüm Önerileri Ahmet Gül İstanbul Üniversitesi İstanbul Tıp Fakültesi İTAM Özgün İlaç Keşfi, İlaç Geliştirilmesi ve İstanbul İlaç Sektörü ne Bilgi ve Teknoloji Aktarma

Detaylı

Kurulum Öncesi Uyarılar

Kurulum Öncesi Uyarılar Kurulum Öncesi Uyarılar Ağ Kamerasından duman çıktığı görülür veya normal olmayan bir koku duyulursa Ağ Kamerasının elektrik bağlantısını kesin. Ağ Kamerasını, televizyon ya da fırın gibi ısı kaynaklarının

Detaylı

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8 DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS BİYOİNFORMATİĞE GİRİŞ BTEC 513 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce

Detaylı

ÖZGEÇMİŞ. Adresi : Dumlupınar Üniversitesi Fen-Edebiyat Fakültesi Kimya Bölümü

ÖZGEÇMİŞ. Adresi : Dumlupınar Üniversitesi Fen-Edebiyat Fakültesi Kimya Bölümü ÖZGEÇMİŞ Adı Soyadı : Halil İLKİMEN Doğum Tarihi : 13 Ekim 1982 Doğum Yeri : Tavas/DENİZLİ Adresi : Dumlupınar Üniversitesi Fen-Edebiyat Fakültesi Kimya Bölümü Unvan : Araştırma Görevlisi Doktor Öğrenim

Detaylı

T.C. MALTEPE ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ YAZILIM MÜHENDİSLİĞİ LİSANS PROGRAMI. 2011-12 Bahar Yarıyılı

T.C. MALTEPE ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ YAZILIM MÜHENDİSLİĞİ LİSANS PROGRAMI. 2011-12 Bahar Yarıyılı T.C. MALTEPE ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ YAZILIM MÜHENDİSLİĞİ LİSANS PROGRAMI 2011-12 Bahar Yarıyılı ALGORİTMA VE PROGRAMLAMA BİL 133 5 AKTS Kredisi 1. yıl 1. yarıyıl Lisans Zorunlu 4 saat/hafta

Detaylı

ÖZGEÇMİŞ. Expression Pattern Comparison of Two Ubiquitin Specific Proteases. Functional Characterization of Two Potential Breast Cancer Related Genes

ÖZGEÇMİŞ. Expression Pattern Comparison of Two Ubiquitin Specific Proteases. Functional Characterization of Two Potential Breast Cancer Related Genes ÖZGEÇMİŞ 1. Adı ve Soyadı: Shiva Akhavantabasi 2. Ünvanı: Yrd. Doç. Dr. 3. Email adresi: shiva.akhavan@yeniyuzyil.com 4. Öğrenim Durumu: Derece Alan Üniversite Yıl Lisans Mikrobiyoloji Jahrom Azad Üniversitesi

Detaylı

Bilgisayarın Tarihi. Prof. Dr. Eşref ADALI www. Adalı.net

Bilgisayarın Tarihi. Prof. Dr. Eşref ADALI www. Adalı.net Bilgisayarın Tarihi Prof. Dr. Eşref ADALI www. Adalı.net Hesaplama ve Hesap Makinesi Harizmili Musa (Musal El Harizmi) 0 ve bilinmeyen için «x» değişkenini yazdığı cebir kitabında kullandı 780 yılında

Detaylı

Dizin / Index. Dizin, Cilt 9 2008 / Index to Volume 9, 2008 (t) tanıtım yazısı / review (ç) çeviren / translator. Argan, Metin

Dizin / Index. Dizin, Cilt 9 2008 / Index to Volume 9, 2008 (t) tanıtım yazısı / review (ç) çeviren / translator. Argan, Metin Bilgi Dünyası 2008, 9(2):574-578 Dizin / Index Dizin, Cilt 9 2008 / Index to Volume 9, 2008 (t) tanıtım yazısı / review (ç) çeviren / translator açık erişim ağ analizi Airchinnigh, Mícheál Mac an Al, Umut

Detaylı

T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TEZ YAZIM KURALLARI

T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TEZ YAZIM KURALLARI T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TEZ YAZIM KURALLARI Tezin yazımında kullanılacak kağıt A4 standardında olmalıdır. Metin yazılırken her sayfanın sol kenarından, sağ kenarından

Detaylı