ERZURUM BÖLGESİNDE 0-5 YAŞ ARASI GASTROENTERİTLİ ÇOCUKLARDA TESPİT EDİLEN ROTAVİRUSLARIN MOLEKÜLER TİPLENDİRİLMESİ. Hakan AYDIN

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "ERZURUM BÖLGESİNDE 0-5 YAŞ ARASI GASTROENTERİTLİ ÇOCUKLARDA TESPİT EDİLEN ROTAVİRUSLARIN MOLEKÜLER TİPLENDİRİLMESİ. Hakan AYDIN"

Transkript

1 ERZURUM BÖLGESİNDE 0-5 YAŞ ARASI GASTROENTERİTLİ ÇOCUKLARDA TESPİT EDİLEN ROTAVİRUSLARIN MOLEKÜLER TİPLENDİRİLMESİ Hakan AYDIN Tıbbi Mikrobiyoloji Anabilim Dalı Tez Danışmanı Prof. Dr. Osman AKTAŞ Doktora Tezi 2014

2 T.C. ATATÜRK ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ ERZURUM BÖLGESİNDE 0-5 YAŞ ARASI GASTROENTERİTLİ ÇOCUKLARDA TESPİT EDİLEN ROTAVİRUSLARIN MOLEKÜLER TİPLENDİRİLMESİ Hakan AYDIN Tıbbi Mikrobiyoloji Anabilim Dalı Doktora Tezi Tez Danışmanı Prof. Dr. Osman AKTAŞ ERZURUM 2014

3 T.C. ATATÜRK ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ MİKROBİYOLOJİ ANABİLİM DALI ERZURUM BÖLGESİNDE 0-5 YAŞ ARASI GASTROENTERİTLİ ÇOCUKLARDA TESPİT EDİLEN ROTAVİRUSLARIN MOLEKÜLER TİPLENDİRİLMESİ Doktora Tezi ERZURUM-2014

4 İÇİNDEKİLER TEŞEKKÜR... III ÖZET... IV ABSTRACT... V SİMGELER VE KISALTMALAR DİZİNİ... VI ŞEKİLLER DİZİNİ... VII TABLOLAR DİZİNİ... VIII 1. GİRİŞ GENEL BİLGİLER Tarihçe Rotavirüslerin Sınıflandırılması Rotavirus Yapısı ve Antijenik Bileşenleri Viral Replikasyon RV Enfeksiyonlarının Patogenezi ve Önlenimi RV Enfeksiyonlarında Tanı RV Enfeksiyonlarının Tedavisi ve Aşılama RV Enfeksiyonlarının Epidemiyolojisi MATERYAL VE METOT Örneklerin Toplanması ve Ön Hazırlık Nükleik Asit İzolasyonu Pozitif Kontrol RT-PCR (cdna eldesi) Multipleks-PCR ile G Genotiplerinin belirlenmesi Multipleks-PCR ile P Genotiplerinin belirlenmesi Jel Elektroforez ve Görüntüleme İstatistiksel Analizler I

5 4. BULGULAR TARTIŞMA SONUÇ VE ÖNERİLER KAYNAKLAR EKLER EK-1. Özgeçmiş EK-2. Etik Kurul Onay Formu II

6 TEŞEKKÜR Doktora eğitimim boyunca engin bilgi ve becerileri ile akademik hayatımın sağlam temeller üzerine kurulmasında en büyük desteği olan danışmanım sayın Prof. Dr. Osman AKTAŞ başta olmak üzere; Tıbbi Mikrobiyoloji Anabilim Dalı Başkanı Sayın Prof. Dr. Ahmet AYYILDIZ a ve Anabilim dalının öğretim üyeleri Prof. Dr. Selahattin ÇELEBİ, Prof. Dr. Ülkü ALTOPARLAK, Prof. Dr. Halil YAZGI, Prof. Dr. Ayşe Esin AKTAŞ, sayın Doç. Dr. Hakan USLU ve Doç. Dr. Hamidullah UYANIK a; çalışmalarımda büyük desteğini gördüğüm Veteriner Fakültesi Viroloji Anabilim Dalı Başkanı Yrd. Doç. Dr. Mehmet Özkan TİMURKAN'a; birlikte çalışmaktan mutluluk duyduğum Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı asistan arkadaşlarıma ve tüm anabilim dalı çalışanlarına; bu güne kadarki başarılarımı borçlu olduğum, şefkat ve sevgi pınarlarım babam Osman AYDIN, annem Semra AYDIN, kardeşlerim Seval, Sinem ve İbrahim e; Fedakârlığı, iyi niyeti ve desteği ile her şartta yanımda olan yaşama sebebim eşim Ayşe AYDIN a; Lisans eğitimim boyunca emeklerini esirgemeyen başta Dekanımız Sayın Prof. Dr. Derviş ÖZDEMİR ve tüm Veteriner Fakültesi hocalarıma ve bu çalışmayı 2013/013 BAP proje numarası ile destekleyen Atatürk Üniversitesi Bilimsel Araştırma Projeleri Koordinatörlüğüne teşekkürü bir borç bilirim. Hakan AYDIN III

7 ÖZET Erzurum Bölgesinde 0-5 Yaş Arası Gastroenteritli Çocuklarda Tespit Edilen Rotavirusların Moleküler Tiplendirilmesi Amaç: Bu çalışmanın amacı, yöremizdeki gastroenteritli çocuklarda ilk kez rotavirüs genetik çeşitliliğini belirlemek ve yeni aşı çalışmalarına ışık tutacak epidemiyolojik bir veri sağlamaktır. Materyal ve Metot: Akut diyareli 0-5 yaş arası çocuklardan 329 gaita örneği elde edilmiştir. Dışkıdan izole edilen rotaviral RNA örnekleri VP6, VP4 ve VP7 gen bölgeleri yönünden reverz transkripsiyon polimeraz zincir reaksiyonu ile araştırılmıştır. Jel elektroforezi ile ayrıştırılan amplifikasyon ürünleri UV ışık altında görüntülenerek genotipik veriler elde edilmiştir. Bulgular: Gastroenteritli olguların 109 (% 33.1)'i rotavirus yönünden pozitif bulunmuştur. Bölgesel olarak en dominant genotip kombinasyonu G1P[8] (42.2%) olup bunu G9P[8] (21.1%), ve G12P[6] (% 11.0) izlemiştir. Rotavirus pozitif olgularda G genotipleri içinde en yaygın olanı G1 (% 45.0) bulunmuş bunu sırasıyla G9 (% 32.1), G12 (% 15.6), G2 (% 1.8), G4 (% 1.8) ve G3 (% 0.9) takip etmiştir. İki olguda G3+G9; bir olguda G1+G9 olmak üzere toplam 3 (% 2.7) olguda miks G genotipi tespit edilmiştir. P genotipleri arasında ise en yaygın olanı P[8] (% 72.5) bulunmuş bunu P[6] (% 16.5) ve P[4] (% 7.4) takip etmiştir. İki olguda (% 1.8) miks enfeksiyon (birinde P[4]+P[8], diğerinde P[6]+P[8]) tespit edilmiş 2 (% 1.8) olguda da P genotipi tiplendirilememiştir. Sonuç: Tüm dünyada olduğu gibi yöremizdeki rotavirus enfeksiyonu olan olgularda da G1 ve P[8] in en baskın genotipler olduğu görülmüştür. Çalışmadan alınan sonuçlara göre yöremize özgü bir aşının hazırlanması planlandığında bu aşının, G1, G9, G12 ve P[8] genotiplerine sahip RV suşlarıyla hazırlanması uygun olacaktır. Anahtar Kelimeler: Agaroz jel elektroforez, Gastroenterit, G genotip, P genotip, Rotavirus, RT-PCR. IV

8 ABSTRACT Molecular Typing of Rotaviruses Detected in Children Aged 0-5 with Gastroenteritis in Erzurum Region Aim: The aim of this study is to determine firstly the genetic diversity of rotaviruses in children with gastroenteritis in our region and to provide epidemiological data that will guide for the new vaccine studies. Material and Method: RNA samples isolated from stool specimens of 329 children aged 0-5 years with acute diarrhea were investigated by reverse transcription polymerase chain reaction for gene the presence regions of rotaviral VP6, VP4 and VP7. Genotypic data were obtained by visualizing under the UV light the amplification products separated by gel electrophoresis. Results: Rotavirus RNA positivity were found 109 (31.1%) in the patients. G1P[8] was the dominant genotype combinations regionally (42.2%), followed by G9P[8] (21.1%), and G12P[6] (11.0%). The most common G genotype was G1 (45.0%), followed by G9 (32.1%), G12 (15.6%), G2 (1.8 %), G4 (%1.8) and G3 (0.9%), respectively. Mixed G genotypes have been identified in three cases (2.7%) (G3+G9 in two cases and G1+G9 in one case). The most common P genotype was P[8] (72.5%), followed by P[6] (16.5%) and P[4] (7.4%). Mixed infections were identified in two cases (one P[4]+P[8] and the other P[6]+P[8]) and P genotype could not be typed in the 2 patients. Conclusion: As around the world, G1 and P[8] were found as the most predominant genotypes in also patients with rotavirus infection in our region. According to results from our study, a vaccine may composed of G1, G9, G12 and P[8] genotypes of RV strains when planned the preparation of the vaccine to be used in our region. Key Words: Agarose gel electrophoresis, Gastroenteritis, G genotypes, P genotypes, rotavirus; RT-PCR. V

9 SİMGELER VE KISALTMALAR DİZİNİ bp cdna DNA DSÖ ELISA ER μl NSP ORT PAGE PCR : Baz çifti : Komplementer DNA : Deoksiribonükleik asit : Dünya Sağlık Örgütü : Enzim bağlı immünosorbent deneyi (Enzyme Linked İmmunosorbent Assay) : Endoplazmik retikulum : Mikrolitre : Yapısal olmayan protein Oral rehidratasyon tuzları : Poliakrilamid jel elektroforezi : Polimeraz zincir reaksiyonu (Polymerase chain reaction) RNA RT-PCR RV TAE Ribonükleik asit : Reverz transkriptaz- Polimeraz zincir reaksiyonu Reverse transcriptase-polymerase chain reaction : Rotavirus : Tris asetat etilen diamin tetra asetik asit (Tris acetate ethylene diamine tetra acetic acid) VI

10 ŞEKİLLER DİZİNİ Şekil No Sayfa No Şekil 2.1. RV yapısının şematik gösterimi Şekil 2.2. RV replikasyonu Şekil 3.1. Çalışmada kullanılan jel elektroforez sistemi Şekil 3.2. Çalışmada kullanılan UV görüntüleme sistemi Şekil 3.3. Agaroz jel üzerinde VP6 pozitif sonuç görüntüsü Şekil 3.4. Agaroz jel üzerinde P genotipleri Şekil 3.5. Agaroz jel üzerinde VP4 pozitif sonuç Şekil 3.6. Agaroz jel üzerinde G genotipleri Şekil 3.7. Agaroz jel üzerinde VP7 pozitif sonuç Şekil 4.1. Erzurum'da RV enfeksiyonlarının moleküler prevalansı Şekil 4.2. RV pozitif olguların yaş gruplarına göre dağılımı VII

11 TABLOLAR DİZİNİ Tablo No Sayfa No Tablo 2.1. Avrupa Çocuklarında (0-5 yaş) Enteropatojenlerin Sıklığı Tablo 3.1. Nested-PCR'de Kullanılan Ürünler ve Gerçekleştirilen Isı Döngüleri Tablo 3.2. P Genotipleri Yönünden Multipleks-PCR de Kullanılan Reaksiyon Karışımları ve Isı Döngüleri Tablo 3.3. G Genotipleri Yönünden Multipleks-PCR de Kullanılan Reaksiyon Karışımları ve Isı Döngüleri Tablo 3.4. Kullanılan Primer Dizileri, Gen Bölgeleri ve Ürün Büyüklükleri Tablo 4.1. Cinsiyetlere Göre RV Pozitifliğinin Karşılaştırılması Tablo 4.2. Yaş Gruplarına Göre RV Pozitifliğinin Karşılaştırılması Tablo 4.3. RV Enfeksiyonlarının Yıllara ve Erzurum İli Mevsimsel Ortalama Sıcaklık ve Düşen Yağış Miktarındaki Farklılıklarına Göre Dağılımı Tablo 4.4. RV G Tiplerinin Dağılımı Tablo 4.5. RV P Tiplerinin Dağılımı Tablo 4.6. RV G-P Tip Kombinasyonlarının Dağılımı VIII

12 1. GİRİŞ Gastroenteritlere bakteri, parazit ve virüs gibi farklı patojen grupları içinde yer alan çok sayıda tür neden olmaktadır. Viral etkenlerden rotavirus (RV), akut gastroenterit olgularından en sık sorumlu olan patojenlerden biridir. 1 Dünyadaki tüm çocuk ölümü nedenleri arasında %5 gibi önemli bir orana sahip olan RV kaynaklı ishaller, Dünya Sağlık Örgütü (DSÖ) verilerine göre 2008 yılında yaklaşık çocuğun ölümüne yol açmıştır. 2 Parashar ve ark yılında yayınladıkları makalelerinde gelişmekte olan ülkelerde 1985 yılında ciddi ishal olgularının yaklaşık % 25'inin RV nedeniyle geliştiğini; ishal nedeniyle görülen 3.2 milyon ölüm olgusunun 'inin RV kaynaklı olduğunu bildirmişlerdir. Söz konusu makalede yılları arasında şiddetli ishal olgularının % 22'sine RV'nin neden olduğu; bu yıllar arasında 5 yaşından küçük çocuklarda dünya çapında görülen yıllık yaklaşık 2.1 milyon ölümün 'inin bu virüsten kaynaklandığı rapor edilmiştir döneminde şiddetli ishal olan çocuklar arasında RV'nin payının yaklaşık % 39 olduğu; DSÖ nün tahminlerine göre de ishal kaynaklı 1.56 milyon ölüm olgusunun yaklaşık 'inden RV'nin sorumlu olduğu belirtilmiştir. 3, 4 Günümüze daha yakın kaynaklarda da her yıl dünya genelinde yaklaşık iki milyar kişinin gastroenterite yakalandığı; özellikle 0-5 yaş arası çocuklarda hastalığa yakalanma oranı artmakla birlikte en riskli grubu 1 yaş altı çocukların oluşturduğu; gelişmekte olan ülkeler başta olmak üzere dünyada yıllık ortalama iki milyon çocuğun ölümüne yol açan gastroenteritlerin %18 oranıyla pnömonilerden sonra ikinci sırada ölüm olgularından sorumlu olduğu ifade edilmektedir. 5, 6 Sunduğumuz bu tez çalışmasının öznesi olan RV, Reoviridae ailesinin bir üyesidir. RV 11 segmentli ve çift zincirli RNA dan oluşan genom ve bu genomu 1

13 çevreleyen üç katmanlı protein yapıdan oluşur. Altısı yapısal ve altısı yapısal olmayan 12 adet protein kodlayan viral genom içte VP2, orta katmanda VP6, dışta ise VP7 ve VP4 yapısal proteinlerinin oluşturduğu kılıfla çevrilidir. VP6 proteini grup ve subgruplara özgün antijen olup, bu antijendeki farklılıklar temelinde A'dan H'ye kadar 8 gruba ayrılır. 7 A,B,C grubu RV'ler insanlarda enfeksiyon oluştururken Grup A RV'ler küçük yaşlardaki çocuk ishallerinde en sık rastlanan grup olarak öne çıkmaktadır. Viral kapsiti oluşturan VP4 ve VP7 proteinleri nötralizan antikor üretimini tetikleyen antijenlerdir ve sırasıyla RV P ve G serotip ve genotiplerini belirlemektedir. 8 RV üzerine yapılan moleküler çalışmaların yoğunluk kazanmasıyla 2010'lu yılların başlarına kadar 27 farklı G (G1- G27) genotipi ve en az 35 P genotipi (P[1] - P[35]) tespit edilmiştir. 9 Konağın ince bağırsağına yerleşen birden fazla RV'nin bağırsak hücrelerindeki replikasyonu sırasında segmentli genomu sayesinde; nokta mutasyon, reassortment (genler arasında parça değişimiyle oluşan yeni genomik kombinasyon) ve yeni genetik düzenlemeler geliştirebilmekte ve bunun sonucu olarak da RV nin birçok genotipik 10, 11 varyasyonları ortaya çıkmaktadır. Genlerin yeniden düzenlenmesi çoğunlukla virusun yapısal olmayan NSP5 ve NSP6 proteinlerini kodlayan segment 11 ve daha az olarak da segment 5-10'da görülür. 12 Yeni fenotiplerin ortaya çıkmasında rol oynayan bir diğer faktör ise miks enfeksiyonlardır. 13 RV, enfekte ettiği konakta bağırsak sinir sistemi uyarımı, epitelyum enterosit yıkımı ve toksin salınımı yaparak, emilim ve fonksiyon bozukluğuna yol açar. Bu sistematik bozukluk neticesinde ishal şekillenir. Hastalık su, besin ve mineral maddelerin vücuda yeterince sağlanamamasıyla devam edip konağın ölümüne kadar giden bir süreçle son bulmaktadır. 14 RV enfeksiyonu dünya çapında bir sorun olmakla birlikte gelişmekte olan ülkelerde mortalite oranı daha yüksektir. Kusma ve ishal ile 2

14 karakterize olan RV ilişkili akut gastroenterit vakalarında tedavide önce kaybedilen sıvı ve elektrolit hacminin dengelenmesi gerekir. Hijyen ve sanitasyon hastalığın önüne geçmede yeterli olmamakla birlikte kullanılmakta olan aşılar tüm dünyada hastalıktan 10, 15 korunmada en önemli silah olarak öne çıkmaktadır. Dünyanın çeşitli yerlerinde hâlihazırda kullanımda olan iki adet RV aşısı bulunmaktadır. Pentavalan Rota Teq reassortant (iki ya da daha fazla benzer virüsten elde edilen genetik materyal içeren) aşısı G1, G2, G3, G4 ve P1[8]viral yüzey antijenlerini içermektedir. Özellikle G1 tipine yönelik üretilen ve G1P1AP[8] antijeni 16, 17 içeren Monovalan Rotarix aşısı ise G tiplerinin birçoğunda etkili olmaktadır. Sonuç olarak RV'ler tüm dünyada büyük ekonomik ve can kayıplarına yol açan, hijyen ve sanitasyon ile önlenemeyen küresel bir sağlık sorunudur. Genetik yapısından kaynaklanan birçok tipinin varlığı ve sürekli yeni genotiplerin ortaya çıkışı bu virusa karşı geliştirilen ve geliştirilmesi gereken aşıların önemini artırmaktadır. Erzurum ve bölgesinde şimdiye kadar RV'ye yönelik genetik çeşitliliği ortaya koyacak herhangi bir çalışmasının bulunmayışı ülkemiz ve global veriler açısından bir eksiklik oluşturmaktadır. Bu eksikliğin giderilmesi ve yeni aşı çalışmaları için faydalı veriler sağlayacağı düşüncesiyle Doğu Anadolu nun en fazla hasta potansiyeline sahip iki hastanesine kusma ve ishal şikâyetiyle başvuran 0-5 yaş arası çocuklarda RV pozitifliği ve RV'nin genotipik çeşitliliği moleküler temelli yöntemlerle araştırılıp bölgesel verilerin ortaya konulması amaçlanmıştır. 3

15 2. GENEL BİLGİLER Rotaviral enfeksiyonlar özellikle küçük yaş grubu çocukları etkileyen küresel bir sorundur. Dünya genelinde çocukların tamamına yakını ilk 5 yaşına kadar RV ile karşılaşmaktadır. Bunların yaklaşık %20'si hastaneye getirilmekte, %2 si hastaneye yatırılmakta, 1000 de 3 ü ise hayatını kaybetmektedir. 18 RV'ler virüsün yapısını oluşturan proteinler (VP) den VP6 nın antijenik farklılığına göre A, B, C, D, E, F, G ve H den oluşan sekiz gruba ayrılmaktadır. Grup A, B ve C RV'ler insan ve hayvanları enfekte ederken diğer gruplar özellikle kanatlıları ve diğer hayvanları enfekte etmektedir. Özellikle A grubu RV'ler 0-5 yaş arası çocuklarda, memelilerin birçoğunda ve kanatlılarda şiddetli gastroenterit etkeni olarak öne çıkmaktadır. Günümüzden 8 yıl kadar öncesine kadar RV enfeksiyonları nedeniyle dünyada her bir dakikada bir bebeğin hayatını kaybettiği bilinmektedir. 19 RV enfeksiyonlarının yaygınlığının RV aşısının uygulandığı ülkelerde önemli ölçüde azaldığı ifade edilmektedir. Örneğin, küçük çocuklarda ishal olgularının yaygın olduğu El Salvador'da 2 yaşından küçük çocuklarda aşı uygulamasına geçildiği 2006 yılından sonra hastaneye ishal nedeniyle başvuran 5 yaşından küçük olgu sayısında önemli bir düşüşün görüldüğü belirtilmektedir. Bu sayının 2008 yılında % 40, 2009 yılında % 51 oranında azaldığı rapor edilmiştir. 20 Bu bilgiler dikkate alındığında RV enfeksiyonlarından korunmanın en önemli yolun aşılamadan geçtiği görülmektedir. Bu nedenle Amerikan ve Avrupa ülkeleri 2006 yılında RV aşılamasına geçmiş ve DSÖ Nisan 2009'da dünyanın tüm bölgelerine 21, 22 aşılama programlarına katılmayı ısrarla önermiştir. 4

16 2.1. Tarihçe RV ilk olarak 1973 tarihinde Bishop ve ark. 23 tarafından Avustralya da akut gastroenteritli çocuklardan alınan duodenal biyopsi kesitlerinin elektron mikroskopi (EM) ile incelenmesi sırasında enterositlerin (duodenal epitel hücrelerin) sitoplazmasında tespit edilmiştir. Daha sonra Amerika ve İngiltere yi de kapsayan birkaç ülkede diyareli kişilerin gaita örneklerinde tespit edildiği bildirilmiştir. İlk kez gösterildiği yıllarda buzağı ve neonatal farelerde ishal nedeni olan virüslere yakın benzerliği nedeniyle reovirus-like virus, orbivirus-like virus adı verilmiştir. Duovirus ve "infantile gastroenteritis virus" gibi isimlerle de adlandırılan bu yeni virüse 1974 yılında mikroskobik görünümü tekerleğe benzediği için (Latincede tekerlek anlamına gelen Rota sözcüğü ilave edilerek) RV adının verilmesi önerilmiştir. 19, Flewett ve ark. 26 tarafından 1974 yılında yayınlanan çalışmada akut gastroenteritli küçük çocukların dışkısında bulunan ve yeni doğan buzağılarda akut ishale neden olan reovirus benzeri partiküllerin boyut ve şekil olarak birbirinden ayırt edilemediğini belirtmektedir. Flewett ve ark. iyileşmiş sığırların serumlarının insan ve buzağı virüslerini aglütine ettiğini ve bu virüslerin hem reovirus hem de orbiviruslardan morfolojik olarak farklılık gösterdiğini de rapor etmiştir. Sadece insanlarda değil neredeyse tüm memeli ve kanatlı hayvan türlerinin yeni doğanlarında enfeksiyon oluşturabilen RV, insanlarda 1973 tarihinde bildirilmesine rağmen hayvanlardaki öyküsünün daha eski yıllara dayandığı görülmektedir. Angel ve ark. 27, 1963 yılında yavru farelerde ortaya çıkan salgında RV partikülünün gözlendiğini, 1969 yılında aynı partiküle Amerika da buzağılarda ortaya çıkan ishal salgınında rastlandığını bildirilmişlerdir. 5

17 RV'nin insanlarda tanımlandığı yıldan günümüze dek çocuklarda ciddi akut diyareden sorumlu olduğunu bildiren çok sayıda epidemiyolojik çalışma yapılmıştır. Günümüzde ileri tanısal teknikler sayesinde hayvan ve insan yenidoğan gastroenteritinin major etkeni olan RV açısından önemli veriler kaydedilmektedir Rotavirüslerin Sınıflandırılması Rotavirus cinsi; Orthoreovirus, Orbivirus, Coltivirus, Aquareovirus, Cypovirus, Fijivirus, Phytoreovirus, Oryzavirus, Seadornavirus, Idnoreovirus ve Mycoreovirus gibi cinslerle birlikte Reoviridae ailesi içinde sınıflandırılır. 18 RV suşlarının sınıflandırılması ise elektroferotip, G genotip, P genotip ve genogroup gibi genetik gruplandırmaların yanı sıra serogrup, alt grup, G serotip, ve P serotiplerine göre yapılmaktadır 28 RV'lerin grup, alt grup ve serotip olmak üzere üç önemli antijenik özgünlüğü vardır. Ağırlıklı olarak VP6 yapısal proteini tarafından aktarılan grup özelliğine göre RV'ler 8 gruba (A-H) ayrılmaktadır. 7 İnsanlarda RV ile ilişkili enfeksiyonlarda predominant olan A grubu olup seyrek olarak da Grup B ve C izole edilmektedir. Yine VP6 tarafından belirlenen alt-grup özgünlüğü, epidemiyolojik araştırmalarda çeşitli RV suşlarının antijenik özelliklerini tanımlamak için kullanılmaktadır. VP6 proteini taşıdığı çeşitli epitoplar sayesinde alt-gruplarının tanısında faydalanılmaktadır. En sık gözlenen insan RV'leri alt-grup I ve alt-grup II'ye aittir. Bağımsız olarak RV serotip özgünlüklerini belirleyen dış kapsit proteinleri VP4 ve VP7'dir. Bunlardan bir glikoprotein olan VP7 daha bol olarak bulunur ve virusun dış yüzeyinin büyük bir kısmını teşkil eder, VP4 ise daha seyrek bulunan bir proteindir. Nötralizan antikorları uyaran epitopları taşıyan bu iki dış kapsit proteinlerine karşı oluşan monoklonal antikorların koruyucu bir bağışıklık sağladığı gösterilmiştir. 11 6

18 RV'lerin grup ve serotiplerine göre sınıflandırılmasına dair 1985 yılında önerilerde bulunulmuş ve sonrasında Binary (ikili) sınıflandırma sistemi kullanılmaya başlanmıştır. Buna göre antijenik etkinliği yüksek olan VP4 ve VP7 proteinlerinin antijenik çeşitliliğine göre numaralandırılarak proteaza karşı duyalı olan VP4 serotipleri "P serotip" ve glikoprotein yapısına sahip olan VP7 serotipleri "G serotip" olarak adlandırılmaktadır. 29 Genotip ve serotiplerin adlandırması yapılırken G serotipi ve G genotipi genellikle aynı anda denk geldiği için tek şekilde kullanılırken P genotip ve serotipi için çift isimlendirme kullanılmaktadır. İlk önce P serotipi yazılır ve bunun hemen ardından köşeli parantez içerisinde P genotipi belirtilir (P6[1] gibi). Ayrıca P serotipinin alttiplere ayrıldığı durumlarda serotipin yanına alt-tip harfi konulur (P1A gibi). 18 Dokuz bölgeli bir glikoprotein olan VP7'in üç bölgesi (A, B, ve C bölgeleri) değişen sayılarda amino asit içermesi nedeniyle antijenik yapısı da değişime uğramaktadır. 30 RV suşlarının isimlendirilmesi G ve P tiplerinin kombinasyonu dayanır bu nedenle, sadece dış kapsit proteinleri bazında insanı enfekte edebilen olasılıkla antijenik olarak farklı 100 RV suşunun var olduğu ifade edilmektedir. 32 Yapılan moleküler epidemiyolojik araştırmalarla dünya çapında insanlarda en yaygın olarak ishallere neden olan G-P genotiplerinin G1P[8], G2P[4], G3P[8], G4P[8], G9P[8] ve G12P[8] olduğu ve son 20 yılda dünyada G9P[8] ve G12P[8] genotiplerinin insanlarda giderek arttığı vurgulanmaktadır. 29 İnsanlarda belirlenen G serotipleri ise G1-6, G8-10 ve G12; P serotipleri ise P1, P2A, P3, P4, P5A, P8 ve P11 olarak bildirilmiştir. 11 A grubu RV'lerin 11 genom segmenti üzerinde yapılan en son tam genom sekans analizlerine göre 2013 yılı itibariyle en az 9 "R" (VP1), 9 "C" (VP2), 8 "M" (VP3), 37 "P" (VP4), 17 "I" (VP6), 27 "G" (VP7), 16 "A" (NSP1), 10 "N" (NSP2), 12 "T" (NSP3), 7

19 15 "E" (NSP4) ve 11 "H" (NSP5/6) harfleriyle belirtilen çok sayıda genotipik varyasyonlara ayrılmaktadır. 31 İnsanların hayvanlarla ortak yaşam alanlarını paylaşması ve çiftçilik faaliyetlerinin yürütülmesi gibi nedenlerle hayvanlardan insanlara geçen RV tipleri ve buna bağlı olarak farklı G-P tiplerinin ortaya çıkışı kaçınılmaz olmaktadır. Hatta son araştırmalara göre yaygın bilinenlerin dışında G ve P genotiplerin de bulunduğuna dair kanıtlardan bahsedilmektedir. 33 Miks enfeksiyon sırasında, genomunun segmentli yapısı nedeniyle yüksek sıklıkta genetik reassortment geçirmesiyle genetik yapısı değişen RV'nin bununla ilişkili olarak farklı G-P kombinasyonlarının ileri de daha da artacağını söyleyebiliriz Rotavirus Yapısı ve Antijenik Bileşenleri Rotavirus zarfsız, 11 segmentten oluşan çift zincirli genoma (dsrna) sahip; ve bu genomu çevreleyen üç katmanlı 600 ila 1000 angström çapında ikozahedral kapsitten oluşan bir RNA virusudur. 11 Genomunu oluşturan segmentler VP1, VP2, VP3, VP4 (VP5*, VP8*), VP6 ve VP7 den oluşan altısı yapısal ve NSP1, NSP2, NSP3, NSP4, NSP5 ve NSP6 dan oluşan altısı yapısal olmayan toplam 12 viral proteini kodlamaktadır 34. Her segment bir protein kodlamakla görevliyken, 11. segment hem 35, 36 NSP5 hem de NSP6 proteinlerini kodlar. Her bir segmentin farklı görevleri bulunmaktadır, bunlardan VP1 proteininin RNA ya bağlı RNA polimeraz enzimi olduğu ve hem viral transkriptaz hem de replikaz olarak görev yaptığı gösterilmiştir. 37 VP1, genomik segmentler ve guanilil transferaz enzimi (mrna capping enzyme) olarak görev yapan VP3 proteini ile birlikte en içteki katmanı oluşturan VP2 içerisinde paketlenmiş olarak bulunur.vp3 virusun genetik materyalini eksprese etmesi için gerekli ribozomal bağlanma sürecinde katalizör görevi yapar. Hem VP1 hem de VP3 enzimleri genom segmentleri ile ilişkili durumdadırlar. İç katmanın dış yüzeyi 8

20 boyunca RV gruplarının tanımlanmasını sağlayan VP6 proteinlerinin dizilmesiyle orta katman oluşur. En dışta ise nötralizan antijenlere sahip VP4 ve VP7 proteinlerinin oluşturduğu, virusun konak hücreye tutunma ve hücre içerisine gönderilmesinde görev alan dış katman (kapsit) bulunmaktadır. 38 Bu iki protein yüksek antijenik özelliği sayesinde konak antikor üretimini tetiklemektedirler. VP4 proteolitik (P) özelliğe sahiptir ve virus dış kapsitini kaplayan glikoprotein (G) yapıdaki VP7 proteinlerine gömülü halde bulunan yaklaşık 60 civarında çıkıntıdan ibarettir. Hedef hücre reseptörlerine affinite göstererek virusun konak hücrelerine penetrasyonunda görev alır. Bu özelliğinin yanında virulans, nötralizasyon ve hemaglutinasyon yeteneğini de içerisinde barındırır Endoplazmik retikulum (ER) un transmembran glikoproteini olarak sentezlenen VP4 proteini RV'nin konak hücre içinde gerçekleştirdiği replikasyon, transkripsiyon ve morfogenez gibi önemli görevlerde yer almaktadır. 35 VP4,VP7 ve VP6 tarafından oluşturulan dış ve orta kapsit boyunca uzanan 132 adet özelleşmiş kanal yapıları bulunmaktadır. Bu yapılar biyolojik ve kimyasal maddelerin içeriye ve dışarıya geçişine olanak sağlamaktadır. 34 RV penetrasyon ile hücre içine girdikten sonra, replikasyonunu gerçekleştirdiği sitoplâzma içerisinde yapısal olmayan proteinlere ihtiyaç duymaktadır. Yapısal olmayan proteinler genom replikasyonu, partikül birleşmesi, interferon indüksiyonu gibi konakçı yanıtında ve viral gen ekspresyonunun uyarılması da dâhil olmak üzere çeşitli işlevlerde görev alırlar. 36 Bu proteinlerden olan NSP1 ve NSP6'nın fonksiyonu hakkında yeteri kadar çalışma bulunmamakla birlikte NSP6 nın her RV türünde bulunmadığı ve RNA bağlayıcı protein olan NSP1 in ise viral olgunlaşmada, antiviral cevap antagonizmasında ve erken apoptozun (programlı hücre ölümü) engellenmesinde görev aldığı bildirilmiştir. 35 Yapısal olmayan tüm rotaviral proteinlerin aksine NSP1 in hücre kültüründe RV replikasyonu için mutlaka gerekli olmadığı ifade edilmektedir. 42 9

21 NSP2; yapısal proteinler ve NSP5 ile işbirliği içerisinde hareket ederek virusun replikasyonunda, viroplazmanın şekillendirilmesinde ve kapsitle kaplanmasında çok fonksiyonlu enzim işlevi görmektedir. NSP5 ve NSP2 virüsle enfekte hücrelerin sitoplazmasında virüsün replike olduğu viroplazma ya da "virüs fabrikaları" olarak adlandırılan multiprotein komplekslerinde lokalize olmuşlardır. 43 NSP2, çift zincirli helikal yapılı viral RNA nın birbirine bağlanması, bu yapının bütünlüğünün bozulması ve birçok viral aktivitede nükleozid trifosfataz, RNA trifosfataz ve nükleozid difosfat kinaz aktiviteleri sergileyen bir katalizör olarak işlev yapar. 35 NSP2 ile viral RNA arasındaki ilişkiyi düzenleme görevini NSP5 yerine getirmektedir. NSP2 nin görev yaptığı hemen her aşamada NSP5 ile birlikteliği bulunmaktadır ve genellikle bağlayıcı özelik gösteren NSP5 birçok rotaviral proteinlerle birlikte koordinasyon halindedir. Enfekte olmuş hücrelerde aminoterminal ucu ile viral mrna'ların 3' ucu konsensüs sekansına bağlandığı gösterilen NSP3, konak hücrenin protein sentezini baskılayarak hücrede rotaviral translasyonu kolaylaştırmakta ve viral mrna yı yıkımlanmaktan korumaktadır. Ancak, NSP3'ün ne viral mrna'nın translasyonunda ne de hücre kültüründe virüs replikasyonu için gerekli olmadığı bildirilmiştir. 44 Yapısal olmayan proteinlerden NSP4 bağırsak salgısında artış ve toksin benzeri etki oluşturarak ishal oluşumunda etki gösterir. İnce bağırsak hücre sitoplâzması içerisindeki Ca iyon dengesini bozarak enfeksiyona katkıda bulunmaktadır. 45 Şekil 2.1'de RV yapısı şematik olarak gösterilmiştir. Şeklin çizilmesinde Angel ve ark yılında yayınlanan makalesinden yararlanılmış ve makalede yer alan şekil model alınarak tarafımızca hazırlanmıştır. 10

22 Şekil 2.1. RV yapısının şematik gösterimi. Virüs 11 segmentten oluşan çift zincirli RNA'yı saran üç protein tabakasından oluşur. En dışta viriyonun dış kısmını kaplayan VP7 ve çivi benzeri çıkıntılar şeklinde gözlenen VP4 antijenleri içeren dış kapsit bulunur. Onun altında yer alan ve VP6 olarak isimlendirilen orta kapsit virusun subgrup antijenlerini içerir. İç kapsiti oluşturan VP2 viriyonun kor tabakasını oluşturur ve RNA genomunu bağlar. VP1 virus partikülünün kor tabakasında bulunan bir RNA polimeraz enzimidir. Yine kor tabakasının bir kısmını oluşturan VP3; mrna'nın transkripsiyon sonrası modifikasyonunda 5' cap'ın oluşumunu katalizleyen guanilil transferaz adı verilen enzimdir. (Şekil, 46. sıradaki kaynaktan modifiye edilmiştir.) 2.4. Viral Replikasyon Virusun hücreye giriş, replikasyon ve patogenez sürecinin bilinmesi enfeksiyonun ve yayılımının kontrol altına alınmasında, aşı çalışmaları ve tedavide büyük önem arz etmektedir. Virusun konak hücre içine girmesi için ilk olarak uygun reseptörü taşıyan hücreye ihtiyacı vardır. Bu reseptörler genellikle bağırsak villuslarının uç kısımlarında yer alan olgun enterositlerdeki glikoprotein yapısındaki siyalik asitlerdir. RV'nin 11

23 penetrasyon ve reseptör bağlayan proteini olan ve proteolizize duyarlı olduğu ifade edilen VP4 intrasellüler tripsin ile ikiye bölünerek VP8 (26 kda) ve VP5 (60 kda) proteinlerine ayrılır. 47 Bu iki protein virusun hücre içerisine giriş işlevlerine yardımcı olur. Virus hücre yüzeyindeki α2β1, α4β1, α4β7, hsc70, αxβ2, αvβ3 veya siyalik asit reseptörleriyle iletişime girdikten sonra konak hücre membranından direkt olarak hücreye girer veya endositoz yolunu kullanır. Bazı görüşler, siyalik asit reseptörüne bağımlı hücre içi girişinin VP5 eşliğinde gerçekleştiğini; siyalik asit reseptöründen bağımsız hücre içine girişte ise VP8 in eşlik ettiğini savunmaktadır. Virusun konak hücreye bağlanması hücre transmembran reseptörleri olan integrinlerden α2β1, α4β1, α4β7 ve hsc70 in VP5 aracılığıyla; αxβ2 ve αvβ3 ün ise VP7 aracılığı ile 48, 49 gerçekleşmektedir. Hücreye giren virusun kendi proteinlerini sentezlemesi ve genom expresyonu için konak hücre fonksiyonunu kendi lehine bozması gerekir. Hücre dışından hücre içine madde girişini ve hücreden dışarıya madde çıkışını (influks ve effluks olaylarını) düzenleyen Ca 2+ iyonlarının sitoplâzma içi dengesindeki bozulma virus patolojisinde en önemli basamağı oluşturur. Ca 2+ iyonu seviyesindeki düşüş virüsün dış kapsit proteinlerini (VP4 ve VP7) çözündürerek üç katmanlı yapıya sahip RV'nin transkripsiyon açısından aktif olan çift katman haline dönüşmesine ve bu şekilde hücre içerisine girmesine olanak sağlar. Dış katmandan kurtularak hücre içine giren RV sitoplazma içerisinde düşen Ca 2+ dengesi sonucunda transkripsiyon için aktif hale gelmiş olur 49 Çift katmanlı kapsit içerisinde guanililtransferaz-methiltransferaz etkinliği gösteren VP3 ve RNA bağımlı RNA polimeraz enzimi olan VP1 vasıtasıyla çift zincirli 11 segment transkripte olur. 50 Transkripsiyon ardından oluşan mrna lar çift katmanlı kapsit yüzeyindeki kanallar aracılığıyla translasyon için konak hücre ribozomuna 12

24 gelerek yapısal ve yapısal olmayan proteinlerini sentez ettirir. Sentezlenen viral proteinler bir araya gelerek viroplazma içerisinde toplanır ve replikasyon gerçekleşir ardından çift tabakalı kapsit içerisinde paketlenerek üçüncü katmanı almak üzere hazır hale gelir. Viroplazmanın şekillenmesinde yine Ca 2+ iyonlarının büyük önemi bulunmaktadır. RV'nin morfogenezini tamamlayacak son bileşen olan dış kapsit, konak hücrenin ER sine viroplazmanın bağlanmasıyla ER nin membran proteinleri olan VP4 ve VP7'yi tomurcuklanma yoluyla edinir. Ardından bu proteinler dönüşüm geçirerek virüse has proteinlere çevrilir. Bu aşama sonunda olgun RV partikülü meydana gelmiş olur ve hücreden dışarı salınır. Her bir viral protein sentezlendikten sonraki aşamalarda 49, 51 aktif görev alarak olgun viral partikülün morfogenezine yardımcı olurlar. Şekil 2.2'de RV'nin konak hücreye girişi ve viral replikasyonunun gelişim aşamaları özetlenmeye çalışılmıştır. Bu Şekil; Matthijnssens ve Van Ranst 33 ; Hu ve ark. 35 ve Trask ve ark. 52 tarafından yayınlanan makaleden ve şekillerden yararlanılarak tarafımızca modifiye edilmiştir. 13

25 Şekil 2.2. RV replikasyonu. RV viriyonu ilk olarak hedef hücre reseptörlerine bağlanır. Hücre sitoplazmasına kendini çevreleyen hücre zarı içinde (endositoz yoluyla) penetre olan 3 tabakalı virus endozomda dış kapsitlerini bırakarak iki tabakalı partiküle dönüşür ve bu RNA içeren kor partikülü sitoplazmaya geçer. Etkinleşen Viral RNA polimeraz enzimi, virus RNA'sını mrna ya transkribe eder. Oluşan mrna'lar (+ssrna) kalıp olarak kullanılarak yapısal ve yapısal olmayan viral proteinler ve negatif zincirler sentezlenir. Sentezlenen proteinler ve tüm RNA parçaları viroplazmada paketlenir ve bu paket içinde çift zincirli RNA'lar oluşur. Oluşan partiküllerin etrafını VP6 proteinleri çevreler ve virus çift tabakalı kor partikülüne dönüşür. Daha sonra endoplazmik ER nin NSP4 reseptörlerine bağlanır, burada dış kapsit proteinleri olan VP7 ve VP4 proteinlerini kazanır. Olgunlaşan üç tabakalı zarfsız viral partiküller hücrede tomurcuklanma yapar ve onu lizize uğratarak hücreden çıkar. (Şekil, 33, 35 ve 52. sıradaki kaynaklardan yararlanılarak çizilmiştir.) 14

26 2.5. RV Enfeksiyonlarının Patogenezi ve Önlenimi RV enfeksiyonları dünyanın her yerinde görülen ve tüm sosyo-ekonomik gruplardaki 5 yaşından küçük çocuklarda ciddi dehidrasyona neden olan en önemli gastroenterit etkenidir. Tüm sosyo-ekonomik grupları etkilemesine rağmen dünyadaki ölüm olgularının öncelikle gelişmekte olan ülkelerde çok daha fazla görüldüğü bilinmektedir. RV sodyum, glikoz ve suyun bağırsaktaki emiliminin azalmasıyla ortaya çıkan bir enfeksiyona neden olur. Ayrıca, bağırsak laktaz, alkalin fosfataz ve sükroz düzeylerinde de azalmaya neden olarak orta şiddetten giderek ağırlaşan bir ishal ortaya çıkar. Küçük çocuklarda, genç memeli hayvanlarda ve kanatlı hayvanlarda şiddetli gastroenterite yol açan RV, insanlarda 1974 yılında tespit edilmesine rağmen ilk olarak 1969 yılında Amerika daki sığırcılık işletmelerinde ciddi ekonomik kayıplara neden olan reo-like virus olarak tespit edildiği bildirilmiştir. İnsan RV enfeksiyonlarının en virulanı ciddi dehidratasyona neden olan ishal, elektrolit dengesizliği, ve hatta metabolik asidozla sonuçlanabilmektedir. Kusma ve ishal 3-7 gün boyunca sürebilmekte ve gelişen iştahsızlıkla birlikte vücutları ciddi sıvı kaybıyla karşı karşıya kalan çocukların yaşamı risk altına girebilmektedir. Farklı RV gruplarından sadece A, B ve C insanlarda görülenleri olup bunlar içinde de Grup A en virulan olanıdır. RV'ler içerisinde Grup A; insanlarda ve çiftlik hayvanlarında en sık rastlanan rotaviral enfeksiyon etkeni olarak dünya genelinde varlık göstermektedir. 53 RV enfeksiyonlarının ılıman iklimlerde yoğun olduğu; bu virus nedeniyle hastaneye yatan çocuk sayısının yılın soğuk aylarında zirveye ulaştığı belirtilmektedir. 54 Çoğu bakteri ve parazit üzerinde etkili olan standart hijyen tedbirleri RV kontrolünde etkisizdir ve virusun düşük sayıları ( partikül) enfeksiyona neden olabilmektedir. Bütün bu nedenlerden dolayı ne yazık ki iyi hijyen uygulamaları bile RV bulaşmasını engelleyememektedir

27 RV kaynaklı gastroenteritleri vibrio (kolera), salmonella gibi diğer patojenlerin gastroenteritleriyle karşılaştırarak anlamaya çalışmak yeterli değildir. RV ishalleri; enterosit yıkımıyla sonuçlanan sekonder emilim bozukluğu; viral toksin; enterik sinir sisteminin uyarılması ve villus iskemisi dâhil olmak üzere birçok farklı mekanizmalara dayandırılmaktadır. Önceleri RV enfeksiyonlarının sadece bağırsakla ilgili olduğu zannedilirken, 2000 li yılların başlarında hücresel ve doku düzeyinde ishal indüksiyon mekanizmalarını ele alan çok sayıda çalışma yapılmış ve ishal mekanizmaları hakkında yeni görüşler ortaya çıkmaya başlamıştır. Sporadik olguların bildirimlerinin yapıldığı çalışmalar RV enfeksiyonlarının genel olarak kabul edildiği gibi sadece bağırsakla ilgili olmadığını doğrular niteliktedir. RV enfeksiyonunda sistemik sekeller nadir olmasına rağmen, literatürde virusun ekstraintestinal bölgelere nasıl yayıldığına ışık tutacak hayvan modeller ile çok sayıda çalışmaların yapıldığı bilinmektedir. 14 RV'ler ince bağırsaktaki olgun emici villus epitel hücrelerini enfekte eder. Üst ince bağırsakta gerçekleşen replikasyonunun ardından enfeksiyöz viral partiküller bağırsak lümenine geçer ve ince bağırsağın distal kısımlarına ulaşır. Enfeksiyon bölgesi genellikle bağırsak mukozası ile sınırlıdır. RV ishal patogenezi karmaşıktır ve viral enterotoksin, mukozal hasar ve disakkaridaz depresyonu ile ilişkili emilim bozukluğu ve bağırsak sinir sistemi aracılığıyla sekresyonun mekanizması tam olarak anlaşılabilmiş değildir. 54 İnce bağırsak yüzeyi boyunca dizili halde bulunan enterositler genellikle enterosit ve kript hücreleri olmak üzere iki tipe ayrılır. Bu hücreler sindirim ve emilim görevi yapmaktadırlar. Villus enterositleri sindirim ve emilim fonksiyonlarına farklılaşan villusları çevreleyen ve proliferasyon göstermeyen olgun hücrelerdir. Emici enterositler; sindirim fonksiyonlarının görüldüğü apikal yüzeyden salgılanan çok sayıda disakkaridaz, peptidaz ve diğer enzimlerin sentezini yapar. 14 Enterosit bariyeri boyunca 16

28 emilim fonksiyonu eriyiklerin hem elektrokimyasal hem de ozmotik olarak pasif difüzyonu ile ve aktif taşıma ile gerçekleşir. Villus enterositlerinin enfeksiyonu Ca 2+ iyonlarını içeren bir olaylar zincirinin başlamasına neden olur. Enterositler içerisinde replike olan RV bağırsak villuslarını kaplayan bu hücrelerde vakuolleşme, enterosit kaybı, kript hiperplazisine yol açar ve genellikle hafif bir yangı süreci oluşturur. Enfeksiyon tarafından uyarılan ince bağırsak epitelinde emilim bozukluğu, enterosit yıkımı ve ishal şekillenir. Oluşturduğu patolojik bulgular ince bağırsakla sınırlı olan RV infeksiyonu, ince bağırsak epitelyumunun fonksiyonunu bozarak bağırsak enzimlerinde düşüş, mineral, su, karbonhidrat, şeker, yağ ve protein emilimi oranını düşürmektedir. Çok nadirde olsa karaciğer, böbrek ve kalp gibi organları da etkileyerek sistemik enfeksiyon oluşturduğu bildirilmiştir. 14 RV'nin yapısal olmayan toksijenik proteini NSP4 klasik olmayan bir salgı yoluyla serbest kalarak konak hücre ER den kalsiyum iyonu salınımını artırır. Bu iyonların artışı hücresel geçirgenliği ve iyonik dengeyi (sodyum artışı - potasyum azalışı) bozarak bağırsağın emilim yeteneğini engeller, hatta NSP4 ün enfekte olmamış bağırsak kısımlarını da etkileyerek ishal oluşumunda önemli rol oynadığı fareler üzerinde yapılan çalışmalarla gösterilmiştir. Başlangıç hücreden virusun serbest kalmasından sonra bu virus ikinci hücreyi enfekte eder. Enfeksiyonla ortaya çıkan NSP4 hücre bağlarını bozarak suyun ve elektrolitlerin paraselüler akışına neden olur. Villus enterositlerinde gerçekleşen bu Ca +2 iyon dengesizliği hücresel ölümle sonuçlanmaktadır. Ancak rotaviral infeksiyonlar bazen herhangi bir belirti göstermeden atlatılabilmektedir. Bunun nedeni olarak da konağın immun yanıtı ve virusla ilişkili faktörler gösterilmektedir. Özellikle spike proteinleri olan VP4 allelleri virusla ilişkili 14, 45 enfeksiyonun şiddetini etkileyen faktörlerdendir. 17

29 RV enfeksiyonu 6-24 aylık çocuklarda predominant olup, yaklaşık iki günlük bir kuluçka döneminden sonra genellikle ateş (39.4 C ya da daha yüksek olabilir) ve kusma ile başlar 3-8 gün süren sulu ishale neden olur. 56 Enfeksiyon karın ağrısına da neden olabilmektedir. Dehidratasyon, ağız kuruluğu, aşırı susama, gözyaşı olmadan ağlama, çok az veya hiç idrara çıkmama, alışılmadık uyuklama veya yanıtsızlık hastalığın semptomlarındandır. Rotavirüs ile enfekte olan birey, RV enfeksiyonlarına karşı kalıcı bir bağışıklık kazanamaz. İlk enfeksiyondan sonra çocukların % 40'ının bir sonraki enfeksiyondan; % 75'inin RV gastroenteritinden ve % 88'inin de şiddetli RV ishallerden korunabildiğini göstermektedir. 57 Herhangi bir yaşta ortaya çıkabilen yinelenen enfeksiyonlar asemptomatik olabilir ya da enfekte kişilerde sadece hafif ishal şeklinde ortaya çıkar. Sonraki enfeksiyonların ortaya çıkışı genellikle enfekte kişinin bağışıklık sistemi sayesinde engellenir. Rotavirüs enfeksiyonuna ve hastalığa karşı korumada serum ve mukozal antikorların koruma ile ilişkili olduğu ancak, aşı çalışmaları da dâhil olmak üzere yapılan diğer çalışmalarda, serum antikorları ve koruma arasındaki korelasyonun zayıf olduğu ifade edilmektedir. 57 Sağlıklı yetişkinlerde ise RV enfeksiyonu herhangi bir belirti vermez ya da sadece hafif belirti ve bulgular görülebilmektedir. Belirtiler ortaya çıkmadan bir kaç gün öncesinden başlayarak 10 gün kadar bir süreyle enfekte bir kişinin dışkısında RV bulunur. Enfekte kişide herhangi bir belirti olmasa bile bu süre boyunca virus, el-ağız teması yoluyla kolayca yayılır. Bu enfeksiyondan korunmak için tuvalet sonrası ellerin yıkanması; çocuk bezlerinin hijyenik koşullarda değiştirilmesi; gıda, oyuncak ve mutfak eşyaları da dâhil olmak üzere hiçbir şeye elleri yıkamadan dokunulmaması; tokalaşmamak ya da tokalaşma sonrasında ellerin ağıza sürülmemesi ve yıkanması uyulması gereken başlıca krallardır. Unutmamak gerekir ki RV'nin birçok türü 18

30 olduğundan aşılı olmak bile bu hastalığa yakalanmada her zaman koruyucu olmayabilir. RV enfeksiyonu yönünden öncelikli olarak 4-24 aylık çocuklar riskli grubu oluşturmaktadır. Ayrıca çocuk bakımının yapıldığı ortamlarda çalışan; küçük çocuk bakımı ile uğraşan yetişkin ve yaşlı insanlar da hastalık riski altındadır RV Enfeksiyonlarında Tanı RV enfeksiyonları genellikle hastalık belirtileri ve fizik muayene bulgularına göre tanımlanmaktadır. RV gastroenteriti yalnız klinik gerekçelere dayandırılarak diğer akut gastroenteritlerden ayırt edilmez. RV için standart tedavi rehidrasyon ve destekleyici tedavi olduğundan, özgün bir mikrobiyolojik tanı çoğu durumda gerekli değildir. Ancak, uzun süren ishal durumunda, komplike vakalarda, immun sistemi baskılanmış konaklarda, epidemiyolojik veya enfeksiyon kontrol verilerine gerek duyulduğunda etiyolojik ajan olarak RV'nin tespiti istenebilir. Kesin tanı, RV gastroenteritinde gereksiz ve potansiyel olarak zararlı antibiyotiklerin kullanılmasını da engelleyebilir. 54 RV tanısı virusun hücre kültüründe izolasyonu, viral antijenin aranması ve viral nükleik asitin gösterilmesi esaslarına dayanır. RV çeşitli ticari antijenik deneyler, RT- PCR, elektron mikroskopisi, immun elektron mikroskobu, enzim immunoassay, lateks aglütinasyonu, flüoresan antikor testi, agar-jel immunodifüzyon, viral RNA yönünden poliakrilamid jel elektroforezi (PAGE) ve hücre kültürü dâhil çeşitli tekniklerle tespit edilebilir. Bu yöntemlerin çoğu enfekte çocukların gaitasında virus miktarları çok yüksek miktarda olduğu için RV aranmasında verimli olmaktadır. 58 Dışkı ya da rektal sürüntülerde viral antijenin tespiti en yaygın olarak kullanan yöntemlerdir. Dışkıda RV antijenlerin gösterilmesine dayanan lateks aglütinasyonu ve Enzyme Linked İmmunosorbent Assay (ELISA) gibi testler maliyeti düşük ve hızlı sonuç alınması nedeniyle daha sık olarak kullanılmaktadır. RV gastroenteritine en sık olarak neden olan 19

31 grup A antijeninin dışkıda saptandığı ve RV ve adenovirus (serogrup 40 ve 41) un birlikte arandığı hızlı testlerin duyarlılığının % , özgüllüğünün ise % arasında değiştiği ifade edilmektedir. Viral atılımın yüksek olması nedeniyle semptomların başlamasından sonraki ilk beş gün içerisinde bu testlerin yapılması önerilirken, sekizinci günden sonra bu testlerin yapılması önerilmemektedir RV Enfeksiyonlarının Tedavisi ve Aşılama RV enfeksiyonlarının tedavisine Centers for Disease Control and Prevention (CDC) nin güncel bilgilerinin takip edilmesi yararlı olacaktır. RV gastroenteriti genellikle kendini sınırlayan bir hastalıktır ancak immun sistemi henüz gelişmemiş olan küçük yaş gruplarında etkili olmaktadır. Küçük çocuklarda enfeksiyonla ortaya çıkan dehidratasyon, morbidite ve mortalitenin başlıca nedeni olduğu için elektrolit dengesinin kurulması ve rehidrasyon primer tedavi yoludur. Oral rehidrasyon solüsyonları RV gastroenteritleriyle ilişkili dehidratasyon tedavisinde etkilidir ve hafif veya orta dehidratasyon durumlarında bile intravenöz rehidratasyon tercih edilmektedir. Tedavide kullanılan etkili eriyikler glikoz, amino asitler ve oligopeptitleri içerir. DSÖ, 2002 yılında, az kusması, az dışkı çıkışı olan ve bu nedenle damar içi infüzyona az ihtiyacı olan gastroenterit olgularında 75 mm Na+, 20 mm K+, 65 mm Cl, 10 mm sitrat, and 75 mm glikoz içeren düşük osmolariteli (245 mosm / L) standart bir oral rehidratasyon formülü önermiştir. Şiddetli kusma, bilinç kaybı ya da ileus vücut ağırlığının % 9'dan fazla kaybına neden olan şiddetli dehidratasyon gibi oral hidratasyonun koruyucu olmadığı durumlarda laktatlı Ringer solüsyonu, normal tuzlu su ya da benzer bir solüsyonun ile IV hidratasyon tavsiye edilmektedir. 54 Oral rehidratasyon tuzlarının (ORT) kullanılmaya başlaması ile ölüm olgularının dünya çapında % 50 oranında azaldığı; düşük ozmolariteli ORT kullanımıyla hastanede uzun süreli yatışların önüne geçildiği ifade edilmektedir. 60 Çinko yetersizliğinin ağır 20

32 akut ishallerle ilişkili olduğun ve gelişmekte olan ülkelerde çinko takviyesinin ishal şiddetini, süresini ve insidans ve prevalansını azalttığı belirtilmektedir. Önceleri asetorfan olarak bilinen ve bir enkefalinaz inhibitörü olan "racecadotril" bağırsak hipersekresyonunu engelleyen bir madde olduğu için çocuklarda ORT'ye ilave olarak kullanımının önerildiği ifade edilmektedir. 61 Guarino ve ark. 62 çinko uygulaması ile RV'nin sitotoksik etkisinin inhibe olduğunu; racecadotril'in RV diyaresinin ilk döneminde özellikle etkili olduğunu ve aktif sekresyonu güçlü bir şekilde inhibe ettiğini rapor etmişlerdir. İmmunoglobulinlerin oral uygulaması rutin kullanım için önerilmiş olmamakla birlikte aşılamanın henüz yapılmadığı yüksek riskli yerlerde kronik RV ishal tedavisinde yararlı olabileceği belirtilmektedir. Oral human gamma globulinin düşük doğum ağırlıklı bebekleri RV'nin neden olduğu ishallerden koruduğu görülmüştür. 63 Kapsit proteinleri Grup A RV'lerin serolojik özelliklerinin çoğundan sorumludur. VP6 proteinine karşı konakta gelişen antikorlar RV grup antijenlerinin; VP4 ve VP7 ye karşı gelişen antikorlar ise sırasıyla P ve G serotiplerin tanımlanmasını sağlar. VP4 ve VP7 karşı oluşan antikorlar aynı zamanda koruyucu bağışıklık sağladığı için, bu iki protein aşılarda kullanılmaktadır. Hayvan modeli çalışmalarından elde edilen sonuçlar yapısal protein VP6 ve yapısal olmayan protein NSP4 antikorlarının da koruyucu bağışıklık sağlayabildiğini desteklemektedir. Günümüzde aşı geliştirme stratejileri ciddi hastalıkları önlemek için tasarlanmış serotipe özgü ve en yaygın RV serotiplerini içeren heterotipik, ya da bu ikisinin bir kombinasyonunu içeren, zayıflatılmış canlı RV suşlarıyla oral bağışıklama temeline dayanmaktadır. 58 Özgün bir tedavisinin olmadığı RV enfeksiyonlarından korunmanın bu hastalık nedeniyle ortaya çıkan ölümlerin önlenmesi için küresel bazda aşılama uygulamalarına geçilmesi gerekir. Günümüzde, monovalan human RV aşısı olan RV1 (Rotarix, GlaxoSmithKline) ve pentavalan human-bovine reassortant RV aşısı olan RV5 21

33 (RotaTeq, Merck) yaygın olarak kullanılan RV aşılarıdır. 62 İlk insan RV aşısı olan RotaShield (Wyeth Lederle Vaccines) 1998 yılında "U.S. Food and Drug Administration (FDA) tarafından onaylanmış ve Advisory Committee on Immunization Practices (ACIP) tarafından bebeklere uygulanması önerilmiştir. 54 RotaShield insanda patojenliği en yüksek olan serotip G1 ve G2 ve insan serotip G3 özgünlüğüne sahip maymun suşu MMU tiplerini içeren bir attenüe tetravalan aşıdır. 65 Bu aşı 1999 Ekim ayında kullanımdan çekilmiştir. 66 G1 taşıyan ve G1 taşımayan suşların neden olduğu orta-ciddi gastroenteritlere karşı %85-96 koruyucu olduğu bildirilen "Rotarix aşısı, doğal enfeksiyonu olan bir çocuktan izole edilen G1P[8] suşunun attenüe edilmesiyle elde edilen parenteral suşunu içermektedir. RV enfeksiyonlarına karşı koruyuculuğunun mükemmel olduğu klinik çalışmalarla gösterilen parenteral suşu Afrika yeşil maymun hücrelerinde 43 kez pasajlanarak liyofilize edilmiştir. 67 Bu aşı 6-24 aylık çocuklara oral olarak biri bebek 6 haftalıkken diğeri de en az 4 hafta sonra tercihen bebeğin 16 haftalık olduğu yaşta olmak üzere iki doz şeklinde uygulanması önerilmiştir. RotaTeq, Canlı pentavalan RV aşısı olup her biri insan RV G1, G2, G3, G4 ve P[8] serotiplerine tekabül eden viral yüzey proteinli WC3 sığır suşundan oluşan beş insan-sığır reassortant rotavirusu içermektedir. 68 Rotarix 'in ciddi RV gastroenteritlerini önlemede Asya'da % 100, Avrupa'da % 98.5 ve Latin Amerika'da % 84.7 oranında etkili olduğu ifade edilmektedir RV Enfeksiyonlarının Epidemiyolojisi Rotaviral gastroenteritler her yıl dünya çapında 100 milyondan fazla olguyu etkileyen; yaklaşık 24 milyon kişinin hastaneye başvurmasına ve bu hastaların da %10'unun hastaneye yatışına ve çoğu Afrika ve Asya'da görülen yılda yaklaşık yarım milyon insanın ölümüne neden olan önemli bir sağlık sorunudur. 54 RV enfeksiyonu 22

34 evrensel karakterde olup hemen hemen çocukların tümü yaşamlarının ilk iki ya da üç yılı içinde virüse karşı antikor kazanmaktadır. Gastrointestinal sistemin olgunlaşmasını sürdürdüğü ve immun sisteminin en zayıf olduğu dönem olan ilk altı ay içinde bebek anneden kazandığı pasif bağışıklık sayesinde enfeksiyona karşı dirençlidir. Ancak anne tarafından transfer edilen pasif bağışıklığın azalmasıyla duyarlı hale gelir. Çocukluğun ileri dönemlerinde geçireceği bir enfeksiyon onun aktif bir bağışıklık kazanmasına neden olur. Bu nedenle RV'nin neden olduğu ciddi gastroenteritler en yaygın olarak 6 ay ve 2 yaş arası bebek ve çocukluk döneminde daha sık olmaktadır. Beş yaşın altındaki çocukların RV enfeksiyonu insidansı, bu çocukların % 80-95'inin rotaviral gastroenteritlerin en az bir epizotuyla karşılaştığı için gelişmiş ve gelişmekte olan ülkelerde aynıdır. 70 RV'nin rezervuarı gastrointestinal bölge ve enfekte kişilerin gaitasıdır. RV enfeksiyonu insan dışında pek çok memelide meydana gelmesine rağmen, RV'lerin hayvanlardan insana bulaşının nadir olduğu ve olasılıkla klinik hastalığa neden olmadığı düşünülmektedir. Gastroenteritlere çok sayıda bakteri, virus ve paraziter etkenler neden olmaktadır. RV tek başına gastroenterit olgularının % 5-10 kadarını tutmaktadır. 70 Tablo 2.1'de Avrupa ülkelerinde yaşayan 0-5 yaş arası çocuklarda tespit edilen çeşitli enteropatojenlerin görülme sıklığı verilmiştir. Guarino ve ark. 71 tespit ettiği bu sonuçlara göre % oranıyla Avrupa'da en fazla görülen enteropatojen RV olmuştur. 23

35 Tablo 2.1. Avrupa Çocuklarında (0-5 yaş) Enteropatojenlerin Sıklığı Patojen Sıklık (%) Rotavirus Norovirus 2 20 Campylobacter 4 13 Adenovirus 2 10 Salmonella 5 8 EPEC Yersinia Giardia Cryptosporidium 0 3 Enteroaggregatif E coli (EAggEC) 0 2 Shigella Shiga toksin üreten E coli (STEC) 0 3 ETEC Entamoeba 0 4 Etkeni tespit edilemeyen RV'ler enfekte kişilerin dışkısında yüksek konsantrasyonda bulunmakta ve dışkılama ile saçılmaktadır. Enfekte kişiler diyarenin başlamasından iki gün öncesinden başlayarak semptomların başlamasından sonra yaklaşık 1 hafta süresince gün boyunca gaitaları ile büyük miktarlarda virus çıkarırlar. Rotavirüs, son derece bulaşıcıdır. Bulaşması insandan-insana yakın temas yoluyla ve oyuncaklar ve dışkı ile kontamine olmuş diğer çevresel yüzeyler gibi fomitler aracılığıyla fekal-oral yolla olmaktadır. 70 RV'ler olasılıkla dışkıyla kontamine yiyecek ve sularla ve solunum damlacıkları gibi diğer yollarla da insanlara bulaşabilmektedir. 24

36 Küçük çocuklarda etken olarak RV'nin tespit edilmesinden önce "Kış gastroenteriti" ve "kış kusma hastalığı isimleriyle anılan RV gastroenteritinin sıcak yaz aylarında çok nadiren görüldüğü hastalığın görülme insidansının genellikle kış aylarında arttığı belirtilmektedir. 72, 73 Ilıman iklimlerde RV enfeksiyonları yaz sonlarında, kış ve ilkbaharda daha yüksek görülürken yıllık sıcaklık değerleri C arasında olan, kar yağışı ve don olaylarının nadir görüldüğü subtopikal bölgelerde ve ekvatoral kuşak ile çöller arasında bir geçiş iklimi olan ve ortalama sıcaklığın 20 C dolayında olduğu tropikal bölgelerde daha eşit bir dağılım gösterdiğini söylemek mümkündür. İnsan RV'lerinin çoğu A grubu içinde yer alırlar ve bunlar 1973 yılından beri pek çok ülkede tespit edilmiştir. 74 İlk kez yıllarında Çin'de ortaya çıkan ve 1 milyondan fazla kişiyi etkileyen bir salgında ciddi gastroenterit etkeni olarak bulunan ve insanlarda kolera benzeri ishale neden olan Grup B RV'ler baskın bir şekilde yetişkin yaşlarda görülmektedir. 74, 75 B grubu ilk kez sadece Çin'de gösterilmiş olsa da yapılan seroepidemiyolojik çalışmalarla Hong Kong, Avustralya, Amerika Birleşik Devletleri ve İngiltere gibi diğer pek çok ülkede de tespit edilmiştir. 74 B grubundaki RV'lere "yetişkin ishali rotavirüsleri" anlamına gelen "Adult Diarrhoea RV (ADRV) adı verilmektedir

37 3. MATERYAL VE METOT 3.1. Örneklerin Toplanması ve Ön Hazırlık Doğu Anadolu bölgesinin en fazla hasta potansiyeline sahip hastanelerinden Erzurum Atatürk Üniversitesi Araştırma Hastanesi ve Bölge Eğitim Araştırma Hastanesi ne ve tarihleri arasında 2 yıllık süreçte kusma ve ishal şikâyetiyle başvuran 0-5 yaş arası 329 çocuk gaitası RV yönünden değerlendirilmek üzere toplandı. Her bir gaita örneği U/ml Penisilin ve 20 mg/ml Streptomisin içeren PBS (Phosphate Buffer Saline) ile 1/10 oranında karıştırılarak, 3000 rpm de, +4 o C de 20 dakika santrifüj edildikten sonra süpernatant steril tüpe alındı ve laboratuvar işlemlerine tabi tutulana kadar -80 ºC de ki derin dondurucuda muhafaza edildi Nükleik Asit İzolasyonu Nükleik asit izolasyonu amacıyla QIAsymphony DSP Virus/Pathogen Midi Kit, QIAsymphony extraksiyon (Qiagen, Almanya) cihazı ve sarf malzemeleri kullanıldı. Cihazın ve kitin kullanımında üretici firmanın önerileri takip edilerek gaita örneklerinden RNA izolasyonu gerçekleştirildi. Ekstraksiyon sonucunda toplam 85μl hacminde nükleik asit örnekleri reverz transkriptaz polimeraz zincir reaksiyonu (RT- PCR) gerçekleştirilinceye kadar- 20C de muhafaza edildi Pozitif Kontrol Ön çalışma olarak hastane rutin laboratuvarında kullanılan RV immünokromatografik test (CerTestBiotec S.L. İspanya) pozitif bulunan 20 hasta örneği jenerik primer kullanılarak RT-PCR reaksiyonu gerçekleştirildi. RT-PCR pozitif örnekler sekansa reaksiyonuna tabi tutuldu ve reaksiyon sonucunda pozitifliği doğrulanan örnekler tüm PCR reaksiyonlarında kontrol olarak kullanıldı. 26

38 3.4. RT-PCR (cdna eldesi) RV nükleik asit (RNA) izolasyonu sonrası, komplementer DNA (cdna) eldesi işlemine geçildi. Bu amaçla RT-PCR yapıldı. Bu işlem First strand cdna synthesis (Thermo Fisher Scientific Inc, ABD) kiti ile firmanın öngördüğü şekilde iki adımda gerçekleştirildi. Birinci adımda, örnek başına 1 μl random hekzamer (0,2μg/μl), 6 μl RNaz içermeyen su (Thermo Fisher Scientific Inc., ABD) kullanılarak random hekzamer çözeltisi hazırlandı ve 0.2 ml lik reaksiyon tüplerine dağıtıldı. Son olarak her bir tüpe 6 μl izole edilen RNA örneklerinden konularak PCR cihazında 5 dk 65 C de işleme tabi tutuldu ve ardından reaksiyon tüpleri hızlı soğumaları için buz üzerine alındı. İkinci adımda ise örnek başına: 4 μl 5x reaksiyon tamponu, 2 μl (10mM) dntp mix ve 1 μl (200U/μl) RevertAid revers transkriptaz enzimi (Thermo Fisher Scientific Inc., ABD) ilavesiyle miks hazırlanarak buz üzerindeki örnekler üzerine dağıtıldı ve ardından ısı döngü cihazında bir seri ısı reaksiyona tabi tutularak cdna lar elde edildi. Çalışmada tek döngü olarak sırasıyla uygulanan sıcaklık dereceleri ve süreleri aşağıdaki gibidir: 25 C de 10 dakika 37 C de 60 dakika 70 C de 5 dakika 4 C de 5 dakika cdna sı oluşturulan RNA örneklerinin RV'ye ait olup olmadığını belirlemek için RV türleri için ortak (mutasyonel açıdan korunaklı) bölge olan VP6 gen bölgesi yönünden PCR reaksiyonu gerçekleştirildi. RV pozitif bulunan örnekler virüse ait P ve G genotiplerini belirleyen VP4 ve VP7 gen bölgeleri yönünden PCR ve Nested-PCR 27

39 reaksiyonuna tabi tutuldu. Bu reaksiyonlarda kullanılan karışımlar (Taq PCR Master Mix, Qiagen, Almanya) ve ısı döngüleri tablo 3.1 de görülmektedir. Tablo 3.1. Nested-PCR'de Kullanılan Ürünler ve Gerçekleştirilen Isı Döngüleri İçerik Konsantrasyon Isı döngüsü Taq PCR Master Miks * Primer F Primer R RNaz içermeyen su cdna (5u/ μl) 50 μl (10pmol) 2 μl (10pmol) 2 μl 34 μl 12 μl 95 C de 3 dk 94 C de 1 dk (**) C de ** dk 72 C de 1 dk 72 C de 10 dk 40 döngü * 2.5 ünite Taq DNA Polimeraz, 1x QIAGEN PCR Buffer, 200 μm of dntp, 1,5 mm MgCl 2 içerir. ** VP6 yönünden yapılan PCR de annealing 50 C de 1dk, VP4 ve VP4 nested için 50 C de 1dk, VP7 için 42 C de 2dk, VP7 nested için 52 C de 1dk olarak uygulanmıştır. Reaksiyon sonunda oluşan amplifikasyon ürünleri jel elektroforez ile moleküler ağırlıklarına göre ayrıştırıldı ve UV ışık altında pozitif örnekler belirlendi. Jenerik ve nested primerler ile VP4 ve VP7 gen bölgeleri pozitif olarak belirlenen örnekler, P ve G genotiplerinin belirlenmesi amacıyla multipleks PCR reaksiyonuna geçildi Multipleks-PCR ile G Genotiplerinin belirlenmesi Multipleks-PCR işleminde G genotiplerinin belirlenmesinde kullanılan reaksiyon karışımları ve ısı döngüleri aşağıdaki tablo 3.2 de verilmiştir. 28

40 Tablo 3.2. G Genotipleri Yönünden Multipleks-PCR de Kullanılan Reaksiyon Karışımları ve Isı Döngüleri İçerik Konsantrasyon Isı döngüsü Taq PCR Master Mix Primer VP7R (5u/ μl) 50 μl (10pmol) 2μl G1 G2 G3 G4 G9 (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl 94 C de 4 dk 94 C de 1 dk 42 C de 2 dk 72 C de 1 dk 72 C de 7 dk G10 (10pmol) 2μl G12 (10pmol) 2μl RNase-free water 22 μl Template DNA 12 μl 30 döngü 3.6. Multipleks-PCR ile P Genotiplerinin belirlenmesi Multipleks-PCR işleminde P genotiplerinin belirlenmesinde kullanılan reaksiyon karışımları ve ısı döngüleri aşağıdaki tablo 3.3 de verilmiştir. Tablo 3.3. P Genotipleri Yönünden Multipleks-PCR de Kullanılan Reaksiyon Karışımları ve Isı Döngüleri İçerik Konsantrasyon Isı döngüsü Taq PCR Master Mix Primer VP4F Primer P[4] Primer P[6] Primer P[8] Primer P[9] Primer P[10] Primer P[11] RNase-free water Template DNA (5u/ μl) 50 μl (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl (10pmol) 2μl 24μl 12 μl 94 C de 4 dk 94 C de 1 dk 45 C de 2 dk 72 C de 1 dk 72 C de 7 dk 30 döngü 29

41 Uzunluk ( bp) Annealing Referans Çalışmamızda multipleks-pcr de kullanılan primer dizilimleri ise Tablo3.4 te görülmektedir. Referans olarak alınan kaynaklar bu tabloda verilmiştir. Tablo 3.4. Kullanılan Primer Dizileri, Gen Bölgeleri ve Ürün Büyüklükleri Gen Bölgesi VP6 VP7 Hedef ve Primer Primer sekans F/R (5-3 ) Jenerik F: GACGGVGCRACTACATGGT VP6F VP6R R: GTCCAATTCATNCCTGGTGG Jenerik F: GGCTTTAAAAGAGAGAATTTCCGTCTGG Beg9-End9 R: GGTCACATCATACAATTCTAATCTAAG C (77) C (78) Nested F: ATGTATGGTATTGAATATACCAC VP7F-VP7R R: AACTTGCCACCATTTTTTCC C (79) VP4 Jenerik F: TGGCTTCGCTCATTTATAGACA C (80) Con3-Con2 R: ATTTCGGACCATTTATAACC Nested F: TATGCTCCAGTNAATTGG C (80) VP4F-VP4R R: ATTGCATTTCTTTCCATAATG VP7R R: AACTTGCCACCATTTTTTCC 42 C (81) G1 (abt1) F: CAA GTA CTC AAA TCA ATG ATG G 618 G2 (act2) F: CAA TGA TAT TAA CAC ATT TTC TGT G 521 G Genotip G3 or mg3 F: ACG AAC TCA ACA CGA GAG G 682 G4 (adt4) F: CGT TTC TGG TGA GGA GTT G 452 G9 or mg9 F: CTT GAT GTG ACT AYA AAT AC 179 G10 or mg10 F: ATG TCA GAC TAC ARA TAC TGG 266 G12 F: GGT TAT GTA ATC CGA TGG ACG 396 VP4F F: TAT GCT CCA GTN AAT TGG 45 C (81) P[4] 2T-1 R: CTA TTG TTA GAG GTT AGA GTC 483 P Genotip P[6] 3T-1 R: TGT TGA TTA GTT GGA TTC AA 267 P[8] 1T-1D R: TCT ACT GGR TTR ACN TGC 345 P[9] 4T-1 R: TGA GAC ATG CAA TTG GAC 391 P[10] 5T-1 R: ATC ATA GTT AGT AGT CGG 583 P[11] mp[11] R: GTA AAC ATC CAG AAT GTG

42 3.7. Jel Elektroforez ve Görüntüleme Elektroforez işlemi ve DNA bantlarının görüntülenmesi aşağıda belirtilen sıraya göre gerçekleştirilmiştir: 1. Amplifikasyon ürünlerinin moleküler ağırlıklarına göre ayrıştırılması ve görüntülenmesi amacıyla, 0,5X'lik Tris Acetate Ethylene Diamine Tetra Acetic acid [Tris-asetat-EDTA (TAE)] tamponu içinde %1 lik agaroz (Prona, EU) ısı yardımıyla eritilerek homojen hale getirilmesi sağlandı. 2. Homojenizasyonunun ardından agarın yaklaşık C ye kadar soğutulmasından sonra üzerine ethidium bromide (10 μg/ml, Sigma, ABD) konuldu. 3. Elde edilen bu karışım jel taşıyıcısına (Thermo Scientific Inc. ABD) dökülerek yükleme kuyucuklarını oluşturacak olan taraklar taşıyıcı üzerine yerleştirildi. 4. Yarım saat sonra soğuyan agarozdaki taraklar çıkarılıp, taşıyıcı elektroforez işlemi için örneklerin elektriksel alanda yürütüleceği tanka (Thermo Scientific Inc. ABD) yerleştirildi ve tankın içerisi TAE tamponu ile dolduruldu. 5. PCR ürünleri yükleme boyası (6x Loading Dye, Vivantis, Malezya) ile 1 kısım boyaya 5 kısım PCR ürünü olacak şekilde karıştırılarak tarakların çıkarılmasıyla oluşan kuyucuklara dikkatlice yüklendi. Amplikonların ürün büyüklüğünün belirlenebilmesi için 100 bp lik marker (Vivantis, Malezya) solüsyonundan (1kısım stok marker + 1 kısım yükleme boyası + 4 kısım su) ilk ve son kuyucuğa 2 μl yüklendi. 6. Ürünlerin ve DNA markerin kuyucuklara yüklenmesinin ardından elektrik akımına (8 volt/cm) tabi tutularak yaklaşık 20 dk sonra sistem durduruldu ve PCR ürünleri içeren jel tank içerisinden çıkarılarak jel görüntüleme sistemi (TFX 20M Vilber Lourmat, Fransa) kullanılarak PCR sonucu oluşan DNA bantları görüntülendi ve kaydedildi. 31

43 Çalışmamızda kullanılan agaroz jel elektroforez sistemi Şekil 3.1 de; UV görüntüleme sistemi ise Şekil 3.2 de görülmektedir. Şekil 3.1. Çalışmada kullanılan jel elektroforez sistemi. Şekil 3.2. Çalışmada kullanılan UV görüntüleme sistemi. Çalışmamızda VP6 pozitif iki örneğin agaroz jel üzerindeki görüntüsü Şekil 3.3 te görülmektedir. 32

44 Şekil 3.3. Agaroz jel üzerinde VP6 pozitif sonuç görüntüsü (M: merdiven, 1: Pozitif kontrol; 2: hasta örneği; N: negatif kontrol). Şekil 3.4 te VP4 genotiplendirmesiyle agaroz jel üzerindeki P genotiplerinin görüntüsü; Şekil 3.5 te ise VP4 pozitif sonuç görüntülenmiştir. Şekil 3.4. Agaroz jel üzerinde P genotipleri 33

45 Şekil 3.5. Agaroz jel üzerinde VP4 pozitif sonuç (M: merdiven, 1: Pozitif kontrol; 2: hasta örneği; N: negatif kontrol) Şekil 3.6 da VP7 G genotiplendirmesiyle agaroz jel üzerindeki bazı G genotiplerinin görüntüsü; Şekil 3.7 de VP7 pozitif sonuç görüntülenmiştir. Şekil 3.6. Agaroz jel üzerinde G genotipleri 34

46 Şekil 3.7. Agaroz jel üzerinde VP7 pozitif sonuç (M: merdiven, 1: Pozitif kontrol; 2: hasta örneği; N: negatif kontrol) 3.8. İstatistiksel Analizler İstatistiksel analizler cinsiyet, yaş grupları ve mevsimsel değişkenler arası ilişkiyi belirlemek amacıyla yapılmıştır. Analizlerde SPSS yazılımı (sürüm 20.0, SPSS Inc) kullanılmış; X 2 (Ki-kare) testi sonuçlarına göre p<0.05 değerleri önemli kabul edilmiştir. 35

47 4. BULGULAR Çalışmamız, Erzurum da hizmet veren Atatürk Üniversitesi Araştırma Hastanesi ve Bölge Eğitim Araştırma Hastanesi ne Ocak 2012 ve Aralık 2013 tarihlerini kapsayan 2 yıllık süreçte başvuran 0-5 yaşındaki 329 çocuğun dışkı örneği üzerinden yürütülmüştür. RV pozitifliği ve genotiplerinin belirlenmesi amacıyla izole edilen viral RNA örneklerinde VP6, VP4 ve VP7 gen bölgeleri revers transkripsiyon polimeraz zincir reaksiyonu (RT-PCR) ile tespit edilip analizleri yapılmış ve genotipleri belirlenmiştir. Sonuçta olguların 109 (%33.1)'u çeşitli rotaviral genotipler yönünden pozitif bulunmuştur. RV pozitif ve negatif olguların dağılımı Şekil 4'te görülmektedir. Şekil 4.1. Erzurum'da RV enfeksiyonlarının moleküler prevalansı. Hastaneye başvuran 329 gastroenteritli çocuğun 109 (%33.1)'unda moleküler yöntemlerle RV pozitifliği tespit edilmiştir. Çok sayıda bakteriyel, paraziter ve diğer viral etkenlerin gastroenteritlerde rol oynadığı düşünüldüğünde RV'nin neden olduğu enfeksiyon neredeyse olguların 1/3'ü kadar yüksek bir oranı teşkil etmiştir. 36

GASTROENTERİT YAPAN VİRUSLAR VE ENFEKSİYON OLUŞTURMA MEKANİZMALARI

GASTROENTERİT YAPAN VİRUSLAR VE ENFEKSİYON OLUŞTURMA MEKANİZMALARI GASTROENTERİT YAPAN VİRUSLAR VE ENFEKSİYON OLUŞTURMA MEKANİZMALARI GASTROENTERİT YAPAN VİRÜSLER Viral gastroenteritler fekal oral yolla bulaşmaları nedeniyle, alt yapı yetersizliği bulunan gelişmekte olan

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ

VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Viroloji Ünitesi Viral Enfeksiyonlar... Klinik

Detaylı

Viral gastroenteritlere bağlı salgınlar Türkiye ve Dünyada Güncel Durum

Viral gastroenteritlere bağlı salgınlar Türkiye ve Dünyada Güncel Durum Viral gastroenteritlere bağlı salgınlar Türkiye ve Dünyada Güncel Durum Dr.Gülay KORUKLUOĞLU Türkiye Halk Sağlığı Kurumu Tanımlar Salgın Belirli bir yer (veya populasyonda) ve zamanda, beklenenin üzerinde

Detaylı

VİROLOJİYE GİRİŞ. Dr. Sibel AK

VİROLOJİYE GİRİŞ. Dr. Sibel AK VİROLOJİYE GİRİŞ Dr. Sibel AK Bugün; Virüs nedir? Virüslerin sınıflandırılması Virüsler nasıl çoğalır? Solunum yoluyla bulaşan viral enfeksiyonlar Gıda ve su kaynaklı viral enfeksiyonlar Cinsel temas yoluyla

Detaylı

Özel Formülasyon DAHA İYİ DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA YUMURTA IÇIN AGRALYX!

Özel Formülasyon DAHA İYİ DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA YUMURTA IÇIN AGRALYX! Özel Formülasyon DAHA İYİ Yumurta Verimi Kabuk Kalitesi Yemden Yararlanma Karaciğer Sağlığı Bağırsak Sağlığı Bağışıklık Karlılık DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA YUMURTA IÇIN AGRALYX!

Detaylı

SOLİT ORGAN TRANSPLANTASYONU ve BK VİRUS ENFEKSİYONLARI Doç. Dr. Derya Mutlu Güçlü immunsupresifler Akut, Kronik rejeksiyon Graft yaşam süresi? Eskiden bilinen veya yeni tanımlanan enfeksiyon etkenleri:

Detaylı

Isırıkla İlgili Literatür İncelemesi

Isırıkla İlgili Literatür İncelemesi Isırıkla İlgili Literatür İncelemesi Prof. Dr. Tuna DEMİRDAL İzmir Katip Çelebi Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları AD, SB Atatürk Eğitim Araştırma Hastanesi Enfeksiyon Kliniği, İzmir Avcılarda

Detaylı

TLERDE SEROLOJİK/MOLEK HANGİ İNCELEME?) SAPTANMASI

TLERDE SEROLOJİK/MOLEK HANGİ İNCELEME?) SAPTANMASI * VİRAL V HEPATİTLERDE TLERDE SEROLOJİK/MOLEK K/MOLEKÜLER LER TESTLER (NE ZAMANHANG HANGİ İNCELEME?) *VİRAL HEPATİTLERDE TLERDE İLAÇ DİRENCİNİN SAPTANMASI *DİAL ALİZ Z HASTALARININ HEPATİT T AÇISINDAN

Detaylı

Çocukta Kusma ve İshal

Çocukta Kusma ve İshal Tanım Çocukta Kusma ve İshal Dr. Hasan Kaya Acil Tıp AD Akut gastroenterit 24 saat içinde 3 ten fazla ya da anne sütü ile beslenen bebeklerde her zamankinden daha sık ve daha sulu dışkılamadır. Yenidoğan

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi

Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi Doç Dr Ayşen BAYRAM Gaziantep Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D. GİRİŞ İnsan Papilloma Virus

Detaylı

HIV ENFEKSİYONUNUN PATOFİZYOLOJİSİ VE DOĞAL SEYRİ

HIV ENFEKSİYONUNUN PATOFİZYOLOJİSİ VE DOĞAL SEYRİ HIV ENFEKSİYONUNUN PATOFİZYOLOJİSİ VE DOĞAL SEYRİ Dr. Hayat Kumbasar Karaosmanoğlu Haseki Eğitim ve Araştırma Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Sunum Planı HIV in morfolojik ve

Detaylı

Viral gastroenteritler

Viral gastroenteritler Viral gastroenteritler Prof Dr Gülden Çelik Yeditepe Üniversitesi Tıp Fakültesi Olgu 1.5 yaşında çocuk hasta Ateş, kusma,ishal Mukuslu,sulu sık dışkılama ile geliyor Dışkıda gram boyama Kış Mevsim Test

Detaylı

BASİLLİ DİZANTERİ (SHİGELLOZİS) (KANLI İSHAL)

BASİLLİ DİZANTERİ (SHİGELLOZİS) (KANLI İSHAL) BASİLLİ DİZANTERİ (SHİGELLOZİS) (KANLI İSHAL) TANIMI Shigella türü bakterilerde meydana gelen;karekteristik belirti ve bulguları olan,ilium ve kolonun akut enfeksiyonudur.basilli ve amipli dizanteri olmak

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

BLACK QUEEN CELL VİRUS. Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı

BLACK QUEEN CELL VİRUS. Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı BLACK QUEEN CELL VİRUS Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı Giriş Bal arısı(apis Mellifera) yetiştiriciliği Bakteriyel ve paraziter arı hastalıkları İzole edilen 18 arı virusu Black Queen Cell

Detaylı

Anti-HIV Pozitif Bulunan Hastada Kesin Tanı Algoritması. Doç. Dr. Kenan Midilli İ.Ü. Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Anti-HIV Pozitif Bulunan Hastada Kesin Tanı Algoritması. Doç. Dr. Kenan Midilli İ.Ü. Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Anti-HIV Pozitif Bulunan Hastada Kesin Tanı Algoritması Doç. Dr. Kenan Midilli İ.Ü. Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Testler farklı amaçlarla uygulanabilir: - Tanı, tarama, doğrulama,

Detaylı

Buzağı İshalleri ve Koruma Yöntemleri. Dengeli ve Ekonomik Besleme

Buzağı İshalleri ve Koruma Yöntemleri. Dengeli ve Ekonomik Besleme Buzağı İshalleri ve Koruma Yöntemleri Buzağılar Sürünün Geleceğidir. Buzağı yetiştiriciliğinde anahtar noktalar! Doğum Kolostrum (Ağız Sütü) Besleme Sistemi Sindirim Sağlık Doğum ile ilgili anahtar noktalar

Detaylı

Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER

Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Virüslere Giriş Virüsler genellikle ökaryotlardan ve prokaryotlardan çok daha küçük moleküllerdir. Genellikle enfeksiyon yeteneği olan

Detaylı

VİRAL TANI KİTLERİ (GFJ-480)

VİRAL TANI KİTLERİ (GFJ-480) VİRAL TANI KİTLERİ (GFJ-480) CMV PCR Tanı Kiti Cytomegalovirus un Konvensiyonel PCR yöntemiyle tanınması. HHV-5 olarak da bilinen Sitomegalovirüs, herpes virus ailesinin bir üyesidir. Oldukça sık görülen

Detaylı

Su Çiçeği. Suçiçeği Nedir?

Su Çiçeği. Suçiçeği Nedir? Suçiçeği Nedir? Su çiçeği varisella zoster adı verilen bir virüs tarafından meydana getirilen ateşli bir enfeksiyon hastalığıdır. Varisella zoster virüsü havada 1-2 saat canlı kalan ve çok hızlı çoğalan

Detaylı

DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel

Detaylı

Hepatit B ile Yaşamak

Hepatit B ile Yaşamak Hepatit B ile Yaşamak NEDİR? Hepatit B, karaciğerin iltihaplanmasına sebep olan, kan yolu ve cinsel ilişkiyle bulaşan bir virüs hastalığıdır. Zaman içerisinde karaciğer hasarlarına ve karaciğer kanseri

Detaylı

BRUSELLOZUN İNSANLARDA ÖNLENMESİ VE KONTROLÜ

BRUSELLOZUN İNSANLARDA ÖNLENMESİ VE KONTROLÜ BRUSELLOZUN İNSANLARDA ÖNLENMESİ VE KONTROLÜ Prof. Dr. Fatma Ulutan Gazi Üniversitesi Tıp T p Fakültesi Klinik Mikrobiyoloji ve Enfeksiyon Hastalıklar kları Anabilim Dalı BRUSELLOZ KONTROLÜ VE ERADİKASYONU

Detaylı

Haftalık İnfluenza (Grip) Sürveyans Raporu

Haftalık İnfluenza (Grip) Sürveyans Raporu Bulaşıcı Hastalıklar Daire Başkanlığı Haftalık İnfluenza (Grip) Sürveyans Raporu 20 Mayıs 2015 20. Hafta (11-17 Mayıs 2015) ÖZET Ülkemiz de 2015 yılı 20. hafta itibariyle çalışılan sentinel numunelerdeki

Detaylı

CANDİDA İLE UYARILMIŞ VAJİNAL VE BUKKAL EPİTEL HÜCRELERİNİN SİTOKİN ÜRETİMİ

CANDİDA İLE UYARILMIŞ VAJİNAL VE BUKKAL EPİTEL HÜCRELERİNİN SİTOKİN ÜRETİMİ CANDİDA İLE UYARILMIŞ VAJİNAL VE BUKKAL EPİTEL HÜCRELERİNİN SİTOKİN ÜRETİMİ Emine Yeşilyurt, Sevgi Özyeğen Aslan, Ayşe Kalkancı, Işıl Fidan, Semra Kuştimur Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji

Detaylı

SANKO ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS KURULU 102: HÜCRE VE DOKU SİSTEMLERİ

SANKO ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS KURULU 102: HÜCRE VE DOKU SİSTEMLERİ 05-06 EĞİTİM-ÖĞRETİM YILI DERS KURULU 0: HÜCRE VE DOKU SİSTEMLERİ Ders Kurulu Başkanı: / Başkan Yardımcıları: / Histoloji Embriyoloji Yrd. Doç. Dr. Bahadır Murat Demirel / Üyeler: / Tıbbi / Dersin AKTS

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral

Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral Uludağ Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik

Detaylı

Viral Diyare Etkenleri ve Tanı. Doç. Dr. Sevin KIRDAR Adnan Menderes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD.

Viral Diyare Etkenleri ve Tanı. Doç. Dr. Sevin KIRDAR Adnan Menderes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD. Viral Diyare Etkenleri ve Tanı Doç. Dr. Sevin KIRDAR Adnan Menderes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD. Diyare ile seyreden gastroenteritler, az gelişmiş ve gelişmekte olan ülkelerde özellikle

Detaylı

Haftalık İnfluenza (Grip) Sürveyans Raporu

Haftalık İnfluenza (Grip) Sürveyans Raporu Bulaşıcı Hastalıklar Daire Başkanlığı Haftalık İnfluenza (Grip) Sürveyans Raporu 11 Mart 2015 10. Hafta (02-08 Mart 2015) ÖZET Ülkemiz de 2015 yılı 10. hafta itibariyle çalışılan numunelerdeki İnfluenza

Detaylı

Prof Dr Davut Albayrak. Ondokuz mayıs Üniversitesi Tıp Fakültesi KAN MERKEZİ VE ÇOCUK HEMATOLOJİ BÖLÜMÜ SAMSUN KMTD KURS-2012

Prof Dr Davut Albayrak. Ondokuz mayıs Üniversitesi Tıp Fakültesi KAN MERKEZİ VE ÇOCUK HEMATOLOJİ BÖLÜMÜ SAMSUN KMTD KURS-2012 Prof Dr Davut Albayrak Ondokuz mayıs Üniversitesi Tıp Fakültesi KAN MERKEZİ VE ÇOCUK HEMATOLOJİ BÖLÜMÜ SAMSUN KMTD KURS-2012 KAN GRUBU ANTİJENLERİ Kan grubu kırmızı kan hücrelerinin üzerinde bulunan ve

Detaylı

AŞI ve SERUMLAR. Dr. Sibel AK

AŞI ve SERUMLAR. Dr. Sibel AK AŞI ve SERUMLAR Dr. Sibel AK Bugün; Ak#f İmmünizasyon Bakteriyel Aşılar Viral Aşılar Aşı Takvimi Pasif İmmünizasyon Aşı Etkileşimleri Tanımlar İmmünite (Bağışıklık): Konağın, kendisinden farklı yapıya

Detaylı

Tdap Aşıları (Difteri, Toksoid ve Cansız Boğmaca)

Tdap Aşıları (Difteri, Toksoid ve Cansız Boğmaca) Tdap Aşıları (Difteri, Toksoid ve Cansız Boğmaca) Erişkin ve büyük çocuklarla kıyaslandığında, 12 ay altındaki infantlar gerçek anlamda yüksek boğmaca oranlarına ve boğmaca ile ilişkili ölümlerin geniş

Detaylı

Haftalık İnfluenza (Grip) Sürveyans Raporu

Haftalık İnfluenza (Grip) Sürveyans Raporu Bulaşıcı Hastalıklar Daire Başkanlığı Haftalık İnfluenza (Grip) Sürveyans Raporu 29 Nisan 2015 17. Hafta (20-26 Nisan 2015) ÖZET Ülkemiz de 2015 yılı 17. hafta itibariyle çalışılan sentinel numunelerdeki

Detaylı

ÇOCUKLARDA VİRAL GASTROENTERİTLER. Dr. Hasan Tezer Gazi Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları ABD Çocuk Enfeksiyon Bilim Dalı

ÇOCUKLARDA VİRAL GASTROENTERİTLER. Dr. Hasan Tezer Gazi Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları ABD Çocuk Enfeksiyon Bilim Dalı ÇOCUKLARDA VİRAL GASTROENTERİTLER Dr. Hasan Tezer Gazi Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları ABD Çocuk Enfeksiyon Bilim Dalı 21. Yüzyılda ishal Her yıl dünyada yaklaşık 2 milyar ishal

Detaylı

Haftalık İnfluenza (Grip) Sürveyans Raporu

Haftalık İnfluenza (Grip) Sürveyans Raporu Bulaşıcı Hastalıklar Daire Başkanlığı Haftalık İnfluenza (Grip) Sürveyans Raporu 8 Nisan 2015 14. Hafta (30 Mart 5 Nisan 2015) ÖZET Ülkemiz de 2015 yılı 14. hafta itibariyle çalışılan sentinel numunelerdeki

Detaylı

* Madde bilgisi elektromanyetik sinyaller aracılığı ile hücre çekirdeğindeki DNA sarmalına taşınır ve hafızalanır.

* Madde bilgisi elektromanyetik sinyaller aracılığı ile hücre çekirdeğindeki DNA sarmalına taşınır ve hafızalanır. Sayın meslektaşlarım, Kişisel çalışmalarım sonucu elde ettiğim bazı bilgileri, yararlı olacağını düşünerek sizlerle paylaşmak istiyorum. Çalışmalarımı iki ana başlık halinde sunacağım. MADDE BAĞIMLILIĞI

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 Eğitim Yılı Dönem II 3. Ders Kurulu GASTROİNTESTİNAL SİSTEM VE METABOLİZMA Eğitim Programı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 Eğitim Yılı Dönem II 3. Ders Kurulu GASTROİNTESTİNAL SİSTEM VE METABOLİZMA Eğitim Programı 2015-2016 Eğitim Yılı Dönem II 3. Ders Kurulu GASTROİNTESTİNAL SİSTEM VE METABOLİZMA Eğitim Programı Eğitim Başkoordinatörü Dönem II Koordinatörü Koordinatör Yardımcısı : Doç. Dr. Erkan Melih ŞAHİN : Doç.

Detaylı

Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen

Detaylı

Hücreler arası Bağlantılar ve Sıkı bağlantı. İlhan Onaran

Hücreler arası Bağlantılar ve Sıkı bağlantı. İlhan Onaran Hücreler arası Bağlantılar ve Sıkı bağlantı İlhan Onaran Doku organisazyonu: Hücrelerin bağlanması 1- Hücre-matriks bağlantıları: ekstraselüler matriks tarafından hücrelerin bir arada tutulması 2- Hücre-hücre

Detaylı

III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya.

İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. Bakterilerin tanımlanması Bakterilerin tanımlanması Bakterilerin

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

Tatarcık Ateşi Doç. Dr. Üner Kayabaş İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Malatya

Tatarcık Ateşi Doç. Dr. Üner Kayabaş İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Malatya Tatarcık Ateşi Doç. Dr. Üner Kayabaş İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Malatya uner.kayabas@inonu.edu.tr Tatarcık-Yakarca (Filebotom) Takım:

Detaylı

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D 1. DNA replikasyonu.. için gereklidir A) sadece mitoz B) sadece mayoz C) mitoz ve mayoz D) sadece gamet oluşumu E) sadece protein sentezi 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki

Detaylı

SAĞLIK ÇALIŞANLARI MESLEKİ RİSKİ TALİMATI

SAĞLIK ÇALIŞANLARI MESLEKİ RİSKİ TALİMATI Dok No: ENF.TL.15 Yayın tarihi: NİSAN 2013 Rev.Tar/no: -/0 Sayfa No: 1 / 6 1.0 AMAÇ:Sağlık çalışanlarının iş yerinde karşılaştıkları tehlikeler ve meslek risklerine karşı korumak. 2.0 KAPSAM:Hastanede

Detaylı

Rumen Kondisyoneri DAHA İYİ BY-PASS PROTEİN ÜRETİMİNİ VE ENERJİ ÇEVRİMİNİ ARTTIRMAK, RUMEN METABOLİZMASINI DÜZENLEMEK İÇİN PRONEL

Rumen Kondisyoneri DAHA İYİ BY-PASS PROTEİN ÜRETİMİNİ VE ENERJİ ÇEVRİMİNİ ARTTIRMAK, RUMEN METABOLİZMASINI DÜZENLEMEK İÇİN PRONEL Rumen Kondisyoneri DAHA İYİ Protein Değerlendirilmesi Enerji Kullanımı Süt Kalitesi Karaciğer Fonksiyonları Döl Verimi Karlılık BY-PASS PROTEİN ÜRETİMİNİ VE ENERJİ ÇEVRİMİNİ ARTTIRMAK, RUMEN METABOLİZMASINI

Detaylı

RİBOZOM YAPI, FONKSİYON BİYOSENTEZİ

RİBOZOM YAPI, FONKSİYON BİYOSENTEZİ RİBOZOM YAPI, FONKSİYON VE BİYOSENTEZİ Ribozom Palade adlı araştırıcı tarafından elektron mikroskop ile tanımlanmıştır. Viruslar hariç tüm canlılarda bulunan bir membranla çevrili olmayan organellerdir.

Detaylı

HEPATİT A MİKROBİYOLOJİ EPİDEMİYOLOJİ. Dr. Asım ÜLÇAY

HEPATİT A MİKROBİYOLOJİ EPİDEMİYOLOJİ. Dr. Asım ÜLÇAY HEPATİT A MİKROBİYOLOJİ EPİDEMİYOLOJİ Dr. Asım ÜLÇAY SUNUM PLANI Genel bilgi Mikrobiyoloji Genom yapısı Direnç-duyarlılık Risk faktörleri Epidemiyoloji HEPATİT A Primer hepatotrop virüsler Hepatit A virüs

Detaylı

MENENJİTLİ OLGULARIN KLİNİK VE LABORATUAR ÖZELLİKLERİNİN RETROSPEKTİF OLARAK DEĞERLENDİRİLMESİ

MENENJİTLİ OLGULARIN KLİNİK VE LABORATUAR ÖZELLİKLERİNİN RETROSPEKTİF OLARAK DEĞERLENDİRİLMESİ MENENJİTLİ OLGULARIN KLİNİK VE LABORATUAR ÖZELLİKLERİNİN RETROSPEKTİF OLARAK DEĞERLENDİRİLMESİ Mine SERİN 1, Ali CANSU 1, Serpil ÇELEBİ 2, Nezir ÖZGÜN 1, Sibel KUL 3, F.Müjgan SÖNMEZ 1, Ayşe AKSOY 4, Ayşegül

Detaylı

HEPATİT A TANI, TEDAVİ, KORUNMA

HEPATİT A TANI, TEDAVİ, KORUNMA HEPATİT A TANI, TEDAVİ, KORUNMA Dr. Hüseyin TURGUT Pamukkale Ünv. Tıp Fakültesi Klinik Mikrobiyoloji ve İnfeksiyon Hastalıkları AD, Denizli 1 Sunum Planı I. TANI Klinik Tanı Biyokimyasal Tanı Serolojik

Detaylı

Dr. İsmail Yaşar AVCI GATA İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı

Dr. İsmail Yaşar AVCI GATA İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı KLİNİK BELİRTİ ve BULGULAR KOLERA Dr. İsmail Yaşar AVCI GATA İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı 1 Koleranın temel kliniği yoğun ishal ve kusma ile seyreden ve sonucunda gelişen

Detaylı

Özel Formülasyon DAHA İYİ DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA CIVCIV IÇIN OVOLYX!

Özel Formülasyon DAHA İYİ DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA CIVCIV IÇIN OVOLYX! Özel Formülasyon DAHA İYİ Yumurta verimi Kabuk kalitesi Civciv kalitesi Döllülük Çıkım oranı Karaciğer sağlığı Bağırsak sağlığı Bağışıklık Karlılık DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA

Detaylı

TOKSOPLAZMA İNFEKSİYONUNUN LABORATUVAR TANISI UZM.DR.CENGİZ UZUN ALMAN HASTANESİ

TOKSOPLAZMA İNFEKSİYONUNUN LABORATUVAR TANISI UZM.DR.CENGİZ UZUN ALMAN HASTANESİ TOKSOPLAZMA İNFEKSİYONUNUN LABORATUVAR TANISI UZM.DR.CENGİZ UZUN ALMAN HASTANESİ KLİNİK Bağışıklık sistemi sağlam kişilerde akut infeksiyon Bağışıklık sistemi baskılanmış kişilerde akut infeksiyon veya

Detaylı

MİDE KANSERİNDE APOPİTOZİSİN BİYOLOJİK BELİRTEÇLERİNİN PROGNOSTİK ÖNEMİ

MİDE KANSERİNDE APOPİTOZİSİN BİYOLOJİK BELİRTEÇLERİNİN PROGNOSTİK ÖNEMİ MİDE KANSERİNDE APOPİTOZİSİN BİYOLOJİK BELİRTEÇLERİNİN PROGNOSTİK ÖNEMİ Cem Sezer 1, Mustafa Yıldırım 2, Mustafa Yıldız 2, Arsenal Sezgin Alikanoğlu 1,Utku Dönem Dilli 1, Sevil Göktaş 1, Nurullah Bülbüller

Detaylı

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Spesifik tanı yöntemleri: 1. Direk (kült ltür r ve bakterinin gösterilmesi) g 2. Antikorların n gösterilmesig 1.Standart tüp aglütinasyonu 2.Rose Bengal

Detaylı

Tarım ve hayvancılıkta doğru analiz ve doğru yönlendirme verimi birebir etkiler!

Tarım ve hayvancılıkta doğru analiz ve doğru yönlendirme verimi birebir etkiler! Tarım ve hayvancılıkta doğru analiz ve doğru yönlendirme verimi birebir etkiler! VETERİNER TEŞHİS HİZMETLERİ Hassas ölçümler... Sağlıklı sonuçlar... Akılcı öneriler! 2011 yılında hayata geçirdiğimiz Veteriner

Detaylı

Domuz Gribi (H1N1v) Dr. A.Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji AD

Domuz Gribi (H1N1v) Dr. A.Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji AD Domuz Gribi (H1N1v) Dr. A.Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji AD Şanslıyız! Pandemik suş Amerika da çıktı. Güneydoğu Asya olabilirdi Virusla ilgili

Detaylı

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri

Detaylı

Yapay Bağışık Sistemler ve Klonal Seçim. Bmü-579 Meta Sezgisel Yöntemler Yrd. Doç. Dr. İlhan AYDIN

Yapay Bağışık Sistemler ve Klonal Seçim. Bmü-579 Meta Sezgisel Yöntemler Yrd. Doç. Dr. İlhan AYDIN Yapay Bağışık Sistemler ve Klonal Seçim Bmü-579 Meta Sezgisel Yöntemler Yrd. Doç. Dr. İlhan AYDIN Bağışık Sistemler Bağışıklık sistemi insan vücudunun hastalıklara karşı savunma mekanizmasını oluşturan

Detaylı

Gebelik ve Enfeksiyonlar. Prof.Dr. Levent GÖRENEK

Gebelik ve Enfeksiyonlar. Prof.Dr. Levent GÖRENEK Gebelik ve Enfeksiyonlar Prof.Dr. Levent GÖRENEK Olgulara Yaklaşım 2 1. TORCH grubu enfeksiyon etkenleri nelerdir? Toxoplasmosis Other (Sifiliz, Varicella zoster ) Rubella Cytomegalovirus Herpes simplex

Detaylı

Klinik Çalışanlarına Önerilen Sağlık Girişimleri

Klinik Çalışanlarına Önerilen Sağlık Girişimleri Klinik Çalışanlarına Önerilen Sağlık Girişimleri Sağlık kuruluşları hizmet, eğitim, araştırma faaliyetlerinin yürütüldüğü kompleks yapılardır. Bu nedenle, sağlık çalışanlarının iş yerinde karşılaştıkları

Detaylı

Mikotoksin nedir? En sık karşılaşılan mikotoksinler; Aspergillus Penicillium Fusarium Alternaria

Mikotoksin nedir? En sık karşılaşılan mikotoksinler; Aspergillus Penicillium Fusarium Alternaria Mikotoksin nedir? Aspergillus Penicillium Fusarium Alternaria belirli nem ve ısı koşullarında oluşturdukları fungal metabolitler En sık karşılaşılan mikotoksinler; o aflatoksinler, o okratoksin, o trikotesen,

Detaylı

İshallerin En Yaygın 6 Nedeni

İshallerin En Yaygın 6 Nedeni 21 Günden Küçük ük Buzağılarda ğ Meydana Gelen İshallerin En Yaygın 6 Nedeni Enterotoksijenik E. coli (< 4 gün), Rotavirus (4-21 gün), Coronavirus (4-21 gün), Cryptosporidium parvum (5-28 gün) Salmonella

Detaylı

TRANSFÜZYONLA BULAŞAN HASTALIKLAR TARAMA TESTİYAPILANLAR: HEPATİTLER VE HIV

TRANSFÜZYONLA BULAŞAN HASTALIKLAR TARAMA TESTİYAPILANLAR: HEPATİTLER VE HIV TRANSFÜZYONLA BULAŞAN HASTALIKLAR TARAMA TESTİYAPILANLAR: HEPATİTLER VE HIV Doç. Dr. Mustafa GÜL Kahramanmaraş Sütçü İmam Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 1 Sunum Planı Transfüzyonla

Detaylı

Viral Gastroenteritlerin Laboratuvar Tanısında Güncel Durum Dr. Gülendam Bozdayı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD

Viral Gastroenteritlerin Laboratuvar Tanısında Güncel Durum Dr. Gülendam Bozdayı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viral Gastroenteritlerin Laboratuvar Tanısında Güncel Durum Dr. Gülendam Bozdayı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD 8. Ulusal Moleküler ve Tanısal Mikrobiyoloji Kongresi 4-7 Haziran

Detaylı

Hepatit C ile Yaşamak

Hepatit C ile Yaşamak Hepatit C ile Yaşamak NEDİR? Hepatit C kan yoluyla bulaşan Hepatit C virüsünün(hcv) neden olduğu bir karaciğer hastalığıdır. 1 NEDİR? Hepatit C virüsünün birçok türü (genotipi ) bulunmaktadır. Ülkemizde

Detaylı

Protein Ekstraksiyonu

Protein Ekstraksiyonu Protein Ekstraksiyonu Dr.Gaye Güler Tezel Hacettepe Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Proteinler tüm canlı organizmalar için en önemli makromoleküllerden biridir. Bazıları yapısal komponentleri

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

KANSER İSTATİSTİKLERİ

KANSER İSTATİSTİKLERİ 1 KANSER İSTATİSTİKLERİ Kanser, günümüzün en önemli sağlık sorunlarından biridir. Sık görülmesi ve öldürücülüğünün yüksek olması nedeniyle de bir halk sağlığı sorunudur. Tanı olanaklarının gelişmesi ve

Detaylı

T.C. ÜSKÜDAR ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ HEMŞİRELİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMLARI DERS İÇERİKLERİ I. YARIYIL ZORUNLU DERSLER

T.C. ÜSKÜDAR ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ HEMŞİRELİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMLARI DERS İÇERİKLERİ I. YARIYIL ZORUNLU DERSLER T.C. ÜSKÜDAR ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ HEMŞİRELİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMLARI DERS İÇERİKLERİ I. YARIYIL ZORUNLU DERSLER PSH 501 - Ruh Sağlığı ve Psikiyatri Hemşireliği Temelleri

Detaylı

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir.

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. METABOLİZMA ve ENZİMLER METABOLİZMA Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. A. ÖZÜMLEME (ANABOLİZMA) Metabolizmanın yapım reaksiyonlarıdır. Bu tür olaylara

Detaylı

TOPRAK TOPRAK TEKSTÜRÜ (BÜNYESİ)

TOPRAK TOPRAK TEKSTÜRÜ (BÜNYESİ) TOPRAK Toprak esas itibarı ile uzun yılların ürünü olan, kayaların ve organik maddelerin türlü çaptaki ayrışma ürünlerinden meydana gelen, içinde geniş bir canlılar âlemini barındırarak bitkilere durak

Detaylı

Çekirdek 4 bölümden oluşur Çekirdek zarı: karyolemma Kromatin: Chromatin Çekirdekcik: Nucleolus Çekirdek sıvısı: karyolymph

Çekirdek 4 bölümden oluşur Çekirdek zarı: karyolemma Kromatin: Chromatin Çekirdekcik: Nucleolus Çekirdek sıvısı: karyolymph NUKLEUS Bir hücrenin tüm yapılarının ve etkinliklerinin kodlandığı kromozomu Ayrıca, DNA sını dublike edecek ve 3 tip RNA yı ribozomal (rrna), haberci (mrna) ve transfer (trna)-sentezleyecek ve işleyecek

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

HIV/AIDS epidemisinde neler değişti?

HIV/AIDS epidemisinde neler değişti? HIV/AIDS epidemisinde neler değişti? Dr. Gülşen Mermut Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji ABD EKMUD İzmir Toplantıları - 29.12.2015 Sunum Planı Dünya epidemiyolojisi

Detaylı

SIĞIRLARIN NODÜLER EKZANTEMİ LUMPY SKIN DISEASE (LSD) Hastalık Kartı. Hazırlayan. Dr. M. Fatih BARUT Vet. Hekim

SIĞIRLARIN NODÜLER EKZANTEMİ LUMPY SKIN DISEASE (LSD) Hastalık Kartı. Hazırlayan. Dr. M. Fatih BARUT Vet. Hekim SIĞIRLARIN NODÜLER EKZANTEMİ LUMPY SKIN DISEASE (LSD) Hastalık Kartı Hazırlayan Dr. M. Fatih BARUT Vet. Hekim Etlik Veteriner Kontrol Merkez Araştırma Enstitüsü Virolojik Teşhis Laboratuvarı Etken: Etken,

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

I. YARIYIL TEMEL BİYOKİMYA I (B 601 TEORİK 3, 3 KREDİ)

I. YARIYIL TEMEL BİYOKİMYA I (B 601 TEORİK 3, 3 KREDİ) T.C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ BİYOKİMYA ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2014-2015 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL TEMEL BİYOKİMYA I (B 601 TEORİK 3, 3

Detaylı

BİRİNCİ BASAMAKTA PRİMER İMMÜN YETMEZLİK

BİRİNCİ BASAMAKTA PRİMER İMMÜN YETMEZLİK 1 AŞILAMADA AMAÇ Aşı ile korunulabilir hastalıkları engellemek Enfeksiyon kaynaklı mortaliteyi azaltmak Enfeksiyon kaynaklı morbiditeyi azaltmak HİÇBİR AŞININ HERKES İÇİN TAMAMEN ETKİN VE GÜVENİLİR OLMASI

Detaylı

Haftalık İnfluenza (Grip) Sürveyans Raporu

Haftalık İnfluenza (Grip) Sürveyans Raporu Bulaşıcı Hastalıklar Daire Başkanlığı Haftalık İnfluenza (Grip) Sürveyans Raporu 6 Mayıs 2015 18. Hafta (27 Nisan 3 Mayıs 2015) ÖZET Ülkemiz de 2015 yılı 18. hafta itibariyle çalışılan sentinel numunelerdeki

Detaylı

Bruselloz. Muhammet TEKİN. Bulaşıcı Hastalıklar Çevre ve Çalışan Sağlığı Şube Müdürü

Bruselloz. Muhammet TEKİN. Bulaşıcı Hastalıklar Çevre ve Çalışan Sağlığı Şube Müdürü Bruselloz Muhammet TEKİN Bulaşıcı Hastalıklar Çevre ve Çalışan Sağlığı Şube Müdürü Bruselloz Esas olarak hayvanların hastalığı olan bulaşıcı bakteriyel bir enfeksiyon hastalığı Hayvanlardan insanlara mikroplu

Detaylı

NORMAL ÖĞRETİM DERS PROGRAMI

NORMAL ÖĞRETİM DERS PROGRAMI NORMAL ÖĞRETİM DERS PROGRAMI 1. Yarıyıl 1. Hafta ( 19.09.2011-23.09.2011 ) Gıda maddelerinin kalite kriterleri Beslenmeyle ilgili genel bilgilerin verilmesi Gıda güvenliği Halk Sağlığı Zoonoz enfeksiyonlarla

Detaylı

YAZILI SINAV CEVAP ANAHTARI BİYOLOJİ

YAZILI SINAV CEVAP ANAHTARI BİYOLOJİ YAZILI SINAV CEVAP ANAHTARI BİYOLOJİ CEVAP 1: (TOPLAM 9 PUAN) 1.1: Eğer terleme ve su emilimi arasındaki ilişkide ortam sıcaklığının etkisini öğrenmek istiyorsa; deneyi aynı sayıda yaprağa sahip aynı tür

Detaylı

FİBRİNOJEN DEPO HASTALIĞI. Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara

FİBRİNOJEN DEPO HASTALIĞI. Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara FİBRİNOJEN DEPO HASTALIĞI Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara H. K., 5 yaşında, Kız çocuğu Şikayet: Karında şişlik Özgeçmiş: 8 aylıkken karında

Detaylı

Hastanelerde Su Kullanımı. M.Ali SÜNGÜ Amerikan Hastanesi Bakım ve Onarım Müdürü alis@amerikanhastanesi.org

Hastanelerde Su Kullanımı. M.Ali SÜNGÜ Amerikan Hastanesi Bakım ve Onarım Müdürü alis@amerikanhastanesi.org Hastanelerde Su Kullanımı M.Ali SÜNGÜ Amerikan Hastanesi Bakım ve Onarım Müdürü alis@amerikanhastanesi.org Bir Çin atasözü der ki; Suyu içmeden önce, kaynağını öğren Hastanelerde infeksiyon kaynaklarını

Detaylı

Erişkin İmmunizasyonu. Dr. Hilal Sipahi Mayıs 2006

Erişkin İmmunizasyonu. Dr. Hilal Sipahi Mayıs 2006 Erişkin İmmunizasyonu Dr. Hilal Sipahi Mayıs 2006 Günümüzde erişkinler halen aşı ile önlenebilir hastalıklardan ölebilmekte : Aşılamanın çocuklardaki gibi erişkin bakımının bir parçası olarak algılanmıyor

Detaylı

Ebola virüsü İstanbul'a geldi!

Ebola virüsü İstanbul'a geldi! On5yirmi5.com Ebola virüsü İstanbul'a geldi! Ebola Virüsü İstanbul'a Geldi! Ebola Nedir? Afrika'da birçok insanın ölmesine sebep olan Ebola virüsünün İstanbul'a gelmiş olduğundan şüpheleniliyor. Yayın

Detaylı

Bakteriler, virüsler, parazitler, mantarlar gibi pek çok patojen hastalığın oluşmasına neden olur.

Bakteriler, virüsler, parazitler, mantarlar gibi pek çok patojen hastalığın oluşmasına neden olur. Dr.Armağan HAZAR ZATÜRRE (PNÖMONİ) Zatürre yada tıbbi tanımla pnömoni nedir? Halk arasında zatürre olarak bilinmekte olan hastalık akciğer dokusunun iltihaplanmasıdır. Tedavi edilmediği takdirde ölümcül

Detaylı

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden

Detaylı

T.C SÜLEYMAN DEMİREL ÜNİVERSİTESİ TIP FAKÜLTESİ. ENFEKSİYON HASTALIKLARI ve KLİNİK MİKROBİYOLOJİ ANABİLİM DALI 2014-2015 YILI DÖNEM V DERS PROGRAMI

T.C SÜLEYMAN DEMİREL ÜNİVERSİTESİ TIP FAKÜLTESİ. ENFEKSİYON HASTALIKLARI ve KLİNİK MİKROBİYOLOJİ ANABİLİM DALI 2014-2015 YILI DÖNEM V DERS PROGRAMI T.C SÜLEYMAN DEMİREL ÜNİVERSİTESİ TIP FAKÜLTESİ ENFEKSİYON HASTALIKLARI ve KLİNİK MİKROBİYOLOJİ ANABİLİM DALI 2014-2015 YILI DÖNEM V DERS PROGRAMI Prof.Dr. Füsun Zeynep AKÇAM Doç.Dr. Onur KAYA Yrd.Doç.Dr.

Detaylı

Dünya da ve Türkiye de. İnfluenza Salgınları. Dr. Alpay Azap Ankara Üniversitesi Tıp Fakültesi Klinik Bakteriyoloji ve Enfeksiyon Hst AD

Dünya da ve Türkiye de. İnfluenza Salgınları. Dr. Alpay Azap Ankara Üniversitesi Tıp Fakültesi Klinik Bakteriyoloji ve Enfeksiyon Hst AD Dünya da ve Türkiye de İnfluenza Salgınları Dr. Alpay Azap Ankara Üniversitesi Tıp Fakültesi Klinik Bakteriyoloji ve Enfeksiyon Hst AD İnfluenza virüsü: Orthomyxovirus ailesinden, zarflı RNA virüsü. NP,

Detaylı

KRONİK OBSTRÜKTİF AKCİĞER HASTALIĞI (KOAH) TANIMI SINIFLAMASI RİSK FAKTÖRLERİ PATOFİZYOLOJİSİ EPİDEMİYOLOJİSİ

KRONİK OBSTRÜKTİF AKCİĞER HASTALIĞI (KOAH) TANIMI SINIFLAMASI RİSK FAKTÖRLERİ PATOFİZYOLOJİSİ EPİDEMİYOLOJİSİ KRONİK OBSTRÜKTİF AKCİĞER HASTALIĞI (KOAH) TANIMI SINIFLAMASI RİSK FAKTÖRLERİ PATOFİZYOLOJİSİ EPİDEMİYOLOJİSİ ÖĞRENİM HEDEFLERİ KOAH tanımını söyleyebilmeli, KOAH risk faktörlerini sayabilmeli, KOAH patofizyolojisinin

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

Biyoterörizm ve Besin Güvenliğine Diyetisyen Yaklaşımı: Mevcut Hızlı Teşhis Yöntemleri

Biyoterörizm ve Besin Güvenliğine Diyetisyen Yaklaşımı: Mevcut Hızlı Teşhis Yöntemleri Biyoterörizm ve Besin Güvenliğine Diyetisyen Yaklaşımı: Mevcut Hızlı Teşhis Yöntemleri Hacettepe Beslenme ve Diyetetik Günleri V. Mezuniyet Sonrası Eğitim Kursu Hacettepe Üniversitesi Kongre Merkezi 26.06.2015

Detaylı