Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması"

Transkript

1 Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE BUREAU REGIONAL DE L'EUROPE WELTGESUNDHEITSORGANISATION REGIONALBÜRO FÜR E UROPA ВСЕМИРНАЯ ОРГАНИЗАЦИЯ ЗДРАВООХРАНЕНИЯ ЕВРОПЕЙСКОЕ РЕГИОНАЛЬНОЕ БЮРО

2 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 2 İçindekiler Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Deneysel 3 Giriş 3 Bitki spesifik PCR : Soya - Lektin 6 Bitki spesifik PCR : Mısır - Zein 9 Genetik yapısı değiştirilmiş bitkilerin saptanması için Tarama metodu 12 35S Promotörün Saptanması 12 nos Terminatörün Saptanması 14 MON810 mısır, Bt-176 mısır ve Roundup Ready soyanın nested PCR ile spesifik saptanması 17 MON810 mısırın saptanması 17 Bt-176 Mısırın Saptanması 21 Roundup Ready Soyanın Saptanması 25

3 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 3 Deneysel Giriş Aşağıdaki protokoller, işlenmiş ve işlenmemiş materyalde genetiği değiştirilmiş (GDO) organizmaları, GDO olmayan örneklerle (soya ve mısır) karşılaştırarak, PCR a dayalı tarama (35S promotör ve nos terminatör kullanılarak) ve spesifik tanımlama (Roundup Ready soya, MON810 mısır ve Bt-176 mısır) yöntemlerini açıklamaktadır. Bu yöntemlerde sonuçlar, örnekte hedef dizinin varlığı/yokluğu şeklinde araştırılmakta ve yalnızca nitel sonuç vermektedir. Ekipmanlar Mikro pipetler Termal cycler Setüstü Santrifüj (Mikrosantrifüj) Vorteks karıştırıcı Reaksiyon tüpleri için taşıyıcı raf 0,2 ml lik PCR reaksiyon tüpleri 1,5 ml lik mikrosantrifüj tüpleri UV lambalı çeker ocak bulunan ayrı bir steril oda DİKKAT Bütün ekipmanlar DNA bulaşıksız olmalı ve kullanımdan önce sterilize edilmiş olmalıdır. Kontaminasyonu önlemek için, filtreli pipet uçları kullanılmalıdır. Çözeltiler datp CAS dctp CAS dgtp CAS dttp CAS x PCR tampon solusyonu (genellikle Taq Polimerazın satın alındığı firma tarafından sağlanır)

4 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 4 25 mm MgCl 2 Taq DNA Polimeraz 5 ve 3 primer solusyonları Mineral yağ (kapak ısıtmasız PCR kullanıldığında gereklidir) Nükleaz ari su 4mM dntp Stok çözeltisi dntpler eşit konsantrasyonlarda datp, dctp, dgtp, dttp içeren önceden karıştırılmış stok çözelti olarak veya her biri ayrı konsantre stoklarından sağlanabilir. Herbiri ayrı ayrı olan stoklar kullanıldığında, her dntp, son konsantrasyonda 4 mm dntp stok çözeltisi olacak şekilde steril deiyonize suda çözülür. Tüplere dağıtılır ve 20 C de saklanır. dntp ler bir kaç ay stabildir. 20 µm primer çözeltisi olarak kullanacak oligonükleotidler genelde liyofilize şekilde elde edilir ve son konsantrasyonu 20 µm olacak şekilde seyreltilir. 20 µm primer çözelti, sağlandığı firmanın açıklamaları doğrultusunda hazırlanır - 1 µm=1 pmol/µl ise 20 µm=20 pmol/µl - X nmol primer + 10X µl steril su = 100 pmol/µl = 100 µm - 65C de 5 dakika inkübe edilir, karıştırılır ve 65C de 3 dakika daha inkübe edilir. - Dilüsyon 1:5 Bir ependorf tübe 400 µl steril su hazırlanır ve primer çözeltisinden 100 µl eklenir (100 µm) Son konsantrasyon: 20 µm Küçük miktarlara bölünerek tüplere dağıtılır ve 20C de saklanır. Bu saklama koşulunda primerler en az 6 ay stabildir. Liyofilize primerler 20C da 3 yıl boyunca stabil olarak sakalnabilir. 10X PCR tamponu 500 mm KCl, 100 mm Tris HCl (25C de ph 9,0) ve %1 Triton X-100 içeren 10X PCR tampon solusyonu genelikle Taq DNA polimeraz ile birlikte temin edilir ve kullanıma hazırdır. Tampon her kullanımdan önce karıştırılmalı ve kısa süreli santrifüj edilmelidir. Tüplere dağıtılan tampon solusyonu 20C da saklanır ve bir kaç ay stabildir.

5 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 5 25 mm MgCl2 Çözeltisi PCR düzeyi MgCl 2 çözeltisi genellikle Taq DNA polimeraz ile temin edilir ve kullanıma hazırdır. Çözelti her kullanımdan önce vorteks ile karıştırılır ve kısa süreli santrifüjlenir ( uzu süreli saklama sonucu oluşabiliecek konsantrasyon değişimini önlemek için). 20C de saklanır. Nükleaz içermeyen su Master reaksiyon karışımı ve DNA nın seyreltilmesi için kullanılacak olan steril, nükleaz içermeyen, deiyonize su, küçük miktarlarda tüplere dağıtılarak kullanılır. Her analiz serisi için, yeni tüpler hazırlanmalıdır.

6 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 6 Bitki spesifik PCR : Soya - Lektin Soya DNA sının belirlenmesi lektin geni kullanılarak gerçekleştirilir. Eğer örnekte çoğaltılabilir soya DNA sı bulunuyorsa GMO3/GMO4 primerleri kullanılarak PCR ile belirlenir. GMO3 VE GMO4 lerin Özellikleri GMO3 GCCCTCTACTCCACCCCCATCC Uzunluk 22 Molekül Ağırlığı (g/mol) 6471,6 Erime Noktası* (G/C) 65,1 GMO4 GCCCATCTGCAAGCCTTTTTGTG Uzunluk 23 Molekül Ağırlığı (g/mol) 6981,1 Erime Noktası* (G/C) 59,6 *50 mm lık [Na+] varlığında Kontroller Her PCR analizi icin kontrol deneylerinin yapılması önemlidir. Negatif kontroller, PCR çözeltilerinde DNA ile kontaminasyonun varlığını kontrol etmek üzere düzenlenir. Karakterize edilecek örneklere ait pozitif kontroller PCR analizinin verimliliğini/etkinliğini ve spesifikliğini belirlemek için önemlidir. Aşağıdaki kontroller her PCR analiz performansı için tanımlanmak zorundadır. Pozitif kontrol: Geleneksel/genetik modifikasyona uğratılmamış soyadan izole edilmiş saf DNA Negatif kontrol : Lektin geni içermeyen diğer türlerden izole edilmiş saf DNA Hedef içermeyen kontrol: DNA yerine suyun kullanıldığı, master karışımın negatif kontrolü Master Karışım Hazırlama 10 örneklik bir seri için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 1 de verilen bilgilere göre karıştırılarak hazırlanır.

7 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 7 Takip eden prosedür, 48 µl GMO3/GMO4 master karışım ve 2 µl DNA çözeltisi içeren bir reaksiyon için uygundur. Çözeltilerin tümü master karışımın hazırlanması sırasında buz içinde muhafaza edilir. Tablo 1. GMO3-GMO4 master karışım Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 32,75 µl 327,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid GMO3 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid GMO4 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl TOPLAM 48 µl 480 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 1 deki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir GMO3-GMO4 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 48 er µl dağıtılır Üzerlerine 2 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir PCR Programı* (GMO3-GMO4) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 30 sn Bağlanması (Annealing) 63C 30 sn Uzaması (Extension) 72C 30 sn Döngü Sayısı 40 Son Uzaması (Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içine konur.

8 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 8 * NOT: Kurs sırasında, Perkin Elmer Gene Amp PCR System 9600, ABI 9700 thermocycler (PCR cihazı) kullanılacaktır. Farklı model ya da marka bir cihaz kullanıldığında PCR programlarının gerekli şekilde uyumlanması ve test edilmesi koşuluyla aynı sonuçlar elde edilecektir 1. PCR Ürünlerinin Analizi Hedef dizilimin çoğaltılmasından sonra, PCR ürünleri etidiyum bromidle boyanmış agarsz jel elektroferezi kullanılarak analiz edilir. 8 µl PCR ürünü, 2 µl yükleme tamponu ile karıştırıldıktan sonra örnekler agaroz jele (%1,5) yüklenir. Elektroforez yürütmesi 100 Volt da 1 saattir. Boyut markörleri (100 bp ladder, 15 µl) jelde amplikon bantların büyüklüğünü tam olarak ölçmek için kenardaki kuyucuklara yüklenerek yürütülür. Yürütmeden sonra UV transillüminatör ışığında jeldeki DNA lar görüntülenir. Deney sonuçlarını kalıcı olarak kaydetmek amacıyla jelin fotoğrafı çekilebilir. Sonuçların Yorumlanması GMO3 ve GMO4 primer dizisi doğal lektin geninin saptanmasında soyanın internal kontrolü olarak kullanılır. Amplifiye edilen DNAnın soyaya ait olduğu, 118 bp büyüklüğünde lektin spesifik bandı ile doğrulanır. Pozitif kontrol 118 bp büyüklüğünde bir bant verecektir.negatif kontrol ve hedef içermeyen kontrol görünür bir bant vermeyecektir. Eğer pozitif/negatif kontroller beklenen sonuçları vermiyorsa seçilen örneklerin PCR analizi doğru ve geçerli değildir. Kontroller beklenen sonuçları veriyor ve örnekler 118 bp büyüklüğünde bir bant vermiyorsa bu örnekte çoğaltılabilir soya DNA sı bulunmuyor demektir. Bu bölümün konusu olan protokoller nitel yöntemlerdir. Bu nedenle de sonuçlar var/yok şeklinde alınır. 1 JRC ve WHO bu el kitabında adı geçen yahut kurs esnasında kullanılan hiç bir cihazın kullanımını özel olarak telkin etmemektedir. Laboratuarlarımızda gerçekleştirilen analizler, alternatif ekipmanın s stem gereklilikleri göz önünde tutularak kolayca yinelenebilmelidir

9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 9 Bitki spesifik PCR : Mısır - Zein Mısır DNA sını tanımlamak için zein geni kullanılır. Eğer örnekte çoğaltılabilir mısır DNA sı bulunuyorsa ZEIN3/ZEIN4 primerleri kullanılarak PCR ile belirlenir. ZEIN3 ve ZEIN4 lerinin Özellikleri ZEIN 3 AGTGCGACCCATATTCCAG Uzunluk 19 Molekül Ağırlığı (g/mol) 5772,3 Erime Noktası* (G/C) 55,2 ZEIN 4 GACATTGTGGCATCATCATTT Uzunluk 21 Molekül Ağırlığı (g/mol) 6410,9 Erime Noktası* (G/C) 51,7 *50 mm lık [Na+] varlığında Kontroller Pozitif Kontrol : Geleneksel mısırdan izole edilmiş saf DNA Negatif Kontrol : Zein geni içermeyen diğer türlerden izole edilmiş saf DNA Hedef içermeyen kontrol: DNA yerine suyun kullanıldığı Master karışımın negatif kontrolü Master Karışım Hazırlama 10 örnek için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 2 de verilen bilgilere göre karıştırılarak hazırlanır. Takip eden prosedür, 48 µl ZEIN3/ZEIN4 master karışım ve 2 µl DNA çözeltisi içeren bir reaksiyon için uygundur. Çözeltilerin tümü master karışımın hazırlanması sırasında buz içinde muhafaza edilir.

10 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 10 Tablo 2. ZEIN3/ZEIN4 master karışımı Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 32,75 µl 327,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid ZEIN3 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid ZEIN4 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl TOPLAM 48 µl 480 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 2 deki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir ZEIN3/ZEIN4 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüj edilir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 48 er µl dağıtılır Üzerlerine 2 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir PCR Programı (ZEIN3/ZEIN4) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 96C 1 dk Bağlanması / Uzaması (Annealing / 60C 1 dk Extensıon) Döngü Sayısı 40 Son Uzaması (Final Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içine konur.

11 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 11 PCR Ürünlerinin Analizi Hedef dizilimin çoğaltılmasından sonra, PCR ürünleri etidiyum bromid ile boyanmış agaroz jel elektroferezi kullanılarak analiz edilir. 8 µl PCR ürünü, 2 µl yükleme tamponu ile karıştırıldıktan sonra örnekler agaroz jele (%1,5) yüklenir. Elektroforez yürütmesi 100 Volt da 1 saattir. Boyut markörleri (100 bp ladder, 15 µl) jelde amplikon bantların büyüklüğünü tam olarak ölçmek için kenardaki kuyucuklara yüklenerek yürütülür. Yürütmeden sonra UV transillüminatör ışığında jeldeki DNA lar görüntülenir. Deney sonuçlarını kalıcı olarak kaydetmek amacıyla jelin fotoğrafı çekilebilir. Sonuçların Yorumlanması ZEIN3 ve ZEIN4 primer dizisi doğal zein geninin saptanması suretiyle mısır için internal kontrol olarak kullanılır. Amplifiye edilen DNAnın mısıra ait olduğu, 227 bp büyüklüğünde zein spesifik bandı ile doğrulanır. Pozitif kontrol 227 bp büyüklüğünde bir bant vermelidir.negatif kontrol ve hedef olmayan kontrol görünür bir bant vermemelidir. Eğer pozitif/negatif kontroller beklenen sonuçları vermiyorsa bu deney için seçilen örneklerin PCR analizi doğru ve geçerli değildir. Kontroller beklenen sonuçları veriyor ve örnekler 227 bp büyüklüğünde bir bant vermiyorsa bu örnekte çoğaltılabilir mısır DNA sı bulunmuyor demektir. Bu bölümün konusu olan protokoller nitel yöntemlerdir. Bu nedenle de sonuçlar var/yok şeklinde alınır.

12 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 12 Genetik yapısı değiştirilmiş bitkilerin saptanması için Tarama metodu Genler promotör ve terminatörlerin düzenleyici etkileri ile kontrol edilir. 35S promotör (CaMV den elde edilen) ve nos terminatör (A. tumefaciens bakterisinden elde edilen) gen aktarımında en çok kullanılan düzenleyicilerdir. Araştırılan örneğin içeriğindeki soya ve/veya mısırda bu düzenleyivi dizinlerinden birinin tespit edilmesi GDO varlığını gösterir. Roundup Ready soyada 35S promotör ve nos terminatör dizinlerinin her ikisinin de tanımlanması mümkünken, Mon810 ve Bt-176 mısırda yalnızca 35S promotör bulunur. 35S Promotörün Saptanması p35s-cf3 ve p35s-cr4 lerin Özellikleri p 35S-cf3 CCACGTCTTCAAAGCAAGTGG Uzunluk 21 Molekül Ağırlığı (g/mol) 6414,5 Erime Noktası* (G/C) 57,4 p 35S-cr4 TCCTCTCCAAATGAAATGAACTTCC Uzunluk 25 Molekül Ağırlığı (g/mol) 7544,2 Erime Noktası* (G/C) 56,3 *50 mm lık [Na + ] varlığında Kontroller Pozitif kontrol : Referans materyal DNA sı (% 0,5 GD mısır) Negatif kontrol : %0 oranında GDO mısır içeren referans materyalden elde edilen DNA Hedef içermeyen kontrol : Master karışım negatif kontrolü, DNA yerine yalnızca su içerir. Master Karışım Hazırlama 10 örnek için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 3 de verilen bilgilere göre karıştırılarak hazırlanır.

13 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 13 Takip eden prosedür, 48 µl p35s-cf3/p35s-cf4 master karışım ve 2 µl DNA çözeltisi içeren bir örnek reaksiyon için geçerlidir. Çözeltilerin tümü master karışımın hazırlanması sırasında buz içinde muhafaza edilir. Tablo 3. p35s-cf3/p35s-cf4 master karışım Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 32,75 µl 327,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid p35s-cf3 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid p35s-cr4 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl TOPLAM 48 µl 480 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 3 deki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir p355-cf3/p355-cf4 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 48 er µl dağıtılır Üzerlerine 2 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir PCR Programı (p35s-cf3/p35s-cf4) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 25 sn Bağlanması (Annealing) 62C 30 sn Uzaması (Extension) 72C 45 sn Döngü Sayısı 50 Son Uzaması (Extension) 72C 7 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içine konur.

14 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 14 PCR Ürünlerinin Analizi Hedef dizilimin çoğaltılmasından sonra PCR ürünleri etidiyum bromidle boyanmış agaroz jel elektroferezi kullanılarak analiz edilir. 8 µl PCR ürünü, 2 µl yükleme tamponu ile karıştırıldıktan sonra örnekler agaroz jele (%1,5) yüklenir. Elektroforez yürütmesi 100 Volt da 1 saattir. Boyut markörleri (100 bp ladder, 15 µl) jelde amplikon bantların büyüklüğünü tam olarak ölçmek için kenardaki kuyucuklara yüklenerek yürütülür. Yürütmeden sonra UV transillüminatör ışığında jeldeki DNA lar görüntülenir. Deney sonuçlarını kalıcı olarak kaydetmek amacıyla jelin fotoğrafı çekilebilir. Sonuçların Değerlendirilmesi p355-cf3/p355-cr4 primer çifti CaMV 355 promotörü saptanmasında kullanılır, elde edilen ürün 123 bp büyüklüğünde bir bant verir. Bu promotör Roundup Ready soya ve Bt-176 mısır gibi bir çok transgenik bitkinin gen ekspresyonunu düzenler. Pozitif kontrol 123 bp büyüklüğünde bir bant vermelidir. Negatif kontrol ve hedef içermeyen kontrol görünen bir bant vermemelidir. Pozitif ve negatif kontroller beklenen sonuçları vermiyorsa seçilen örneklerin PCR analizi doğru ve geçerli değildir. Eğer kontroller beklenen sonuçları veriyor ve örnekte 123 bp büyüklüğünde bir bant gözlemleniyorsa örnekte modifiye DNA bulunuyor demektir. nos Terminatörün Saptanması HA-nos 118-f ve HA-nos 118-r lerinin Özellikleri HA-nos 118-f GCATGACGTTATTTATGAGATGGG Uzunluk 24 Molekül Ağırlığı (g/mol) 7462,8 Erime Noktası* (G/C) 56,2 HA-nos 118-r GACACCGCGCGCGATAATTTATCC Uzunluk 24 Molekül Ağırlığı (g/mol) 7296,9 Erime Noktası* (G/C) 61,2 *50 mm lık [Na] varlığında

15 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 15 Kontroller Pozitif Kontrol : Referans materyalden elde edilen DNA (%0,5 GD RR Soya) Negatif Kontrol: Referans materyalden elde edilen DNA (%0 GD soya) Hedef içermeyen kontrol: Master karışımın negatif kontrolü, DNA yerine yalnızca su içerir. Master Karışım Hazırlama 10 örneklik bir seri için (pozitif/negatif/hedef içermeyen kontrolleri içerir) gerekli çözeltiler Tablo 4 de verilen bilgilere göre karıştırılarak hazırlanır. Takip eden prosedür, 48 µl HA-nos 118-f ve HA-nos 118-r master karışımı ve 2 µl DNA çözeltisi içeren reaksiyon için geçerlidir. Çözeltilerin tümü master karışımın hazırlanması sırasında buz içinde muhafaza edilir. Tablo 4. HA-nos 118-f ve HA-nos 118-r master karışım Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 32,75 µl 327,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid HA-nos 118-f 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid HA-nos 118-r 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl TOPLAM 48 µl 480 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 4 deki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir HA-nos 118-f ve HA-nos 118-r master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 48 er µl dağıtılır Üzerlerine 2 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir PCR Programı (HA-nos 118-f/HA-nos 118-r)

16 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 16 Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 25 s Bağlanması (Annealing) 62C 30 s Uzaması (Extension) 72C 45 s Döngü Sayısı 50 Son Uzaması (Extension) 72C 7 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içine konur. PCR Ürünlerinin Analizi Hedef dizilimin çoğaltılmasından sonra PCR ürünleri etidiyum bromidle boyanmış agaroz jel elektroferezi kullanılarak analiz edilir. 8 µl PCR ürünü, 2 µl yükleme tamponu ile karıştırıldıktan sonra örnekler agaroz jele (%1,5) yüklenir. Elektroforez yürütmesi 100 Volt da 1 saattir. Boyut markörleri (100 bp ladder, 15 µl) jelde amplikon bantların büyüklüğünü tam olarak ölçmek için kenardaki kuyucuklara yüklenerek yürütülür. Yürütmeden sonra UV transillüminatör ışığında jeldeki DNA lar görüntülenir. Deney sonuçlarını kalıcı olarak kaydetmek amacıyla jelin fotoğrafı çekilebilir.. Sonuçların Değerlendirilmesi HA-nos 118-f/HA-nos 118-r primer çifti nos terminatörün saptanmasında kullanılır, elde edilen ürünler 118 bp büyüklüğünde bir bant verir. Bu terminatör, Roundup Ready soya, Bt-11 mısır gibi gibi birçok transgenik bitkide bulunur. Pozitif kontrol 118 bp büyüklüğünde bir bant vermelidir. Negatif kontrol ve hedef içermeyen kontrol görünen bir bant vermemelidir. Pozitif ve negatif kontroller beklenen sonuçları vermiyorsa seçilen örneklerin PCR analizi doğru ve geçerli değildir. Eğer kontroller beklenen sonuçları veriyor ve herhangi bir örnekte 118 bp büyüklüğünde bir amplifikasyon bandı gözlemleniyorsa bunun anlamı örneğin genetik modifiye DNA içerdiğidir.

17 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 17 MON810 mısır, Bt-176 mısır ve Roundup Ready soyanın nested PCR ile spesifik saptanması MON810 mısırın saptanması Bu saptama sistemi MON810 mısır için özeldir. Hedef elementler, yüksek veya arttırılmış transkripsiyon düzeyi için yapısal birer düzenleyici olan CaMV 35S promotör ve ısı şok protein geni hsp70 exon/intron1 bölgesi dizilimleridir. mg1, mg2, mg3, mg4 lerin Özellikleri mg1 TATCTCCACTGACGTAAGGGATGAC Uzunluk 25 Molekül Ağırlığı (g/mol) 7665,1 Erime Noktası* (G/C) 59,6 mg2 TGCCCTATAACACCAACATGTGCTT Uzunluk 25 Molekül Ağırlığı (g/mol) 7560,2 Erime Noktası* (G/C) 57,9 mg3 ACTATCCTTCGCAAGACCCTTCCTC Uzunluk 25 Molekül Ağırlığı (g/mol) 7472,2 Erime Noktası* (G/C) 61,2 mg4 GCATTCAGAGAAACGTGGCAGTAAC Uzunluk 25 Molekül Ağırlığı (g/mol) 7722,9 Erime Noktası* (G/C) 59,6 *50 mm lık [Na + ] varlığında

18 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 18 Kontroller Pozitif kontrol: Referans materyal DNA sı (%0,1 MON810 Mısır) Negatif kontrol : Referans materyalden elde edilen DNA (%0 GD mısır) Hedef içermeyen kontrol: DNA yerine suyun kullanıldığı master karışımın negatif kontrolü Master Karışım Hazırlama I 10 örneklik bir seri için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 5 de verilen bilgilere göre karıştırılarak hazırlanır. Bir örnek için mg1/mg2 içeren master karışım 48 µl ve DNA çözeltisi 2 µl olmak üzere toplam hacim 50 µl dir. Master karışım hazırlandığı sürede bütün çözeltiler buzda tutulmalıdır. Tablo 5. Master karışım I (mg1/mg2) Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 32,75 µl 327,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid mg1 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid mg2 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl Toplam 48 µl 480 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 5 deki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir mg1/mg2 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 48 er µl dağıtılır Üzerlerine 2 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir

19 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 19 PCR Programı (mg1/mg2) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 45 sn Bağlanması (Annealing) 60C 50 sn Uzaması (Extension) 72C 50 sn Döngü Sayısı 35 Son Uzaması (Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içine konur Master Karışım Hazırlama II 10 örneklik bir seri için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 6 da verilen bilgilere göre karıştırılarak hazırlanır. Bir örnek için 49 µl mg3/mg4 içeren master karışım ve 1 µl ön amplifiye edilmiş DNA çözeltisi olmak üzere toplam hacim 50 µl dir. Master karışım hazırlandığı sürede bütün çözeltiler buzda tutulmalıdır. Tablo 6. Master karışım I (mg3/mg4) Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 33,75 µl 337,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid mg3 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid mg4 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl Toplam 49 µl 490 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 6 daki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir mg3/mg4 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 49 ar µl dağıtılır Üzerlerine 1 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir

20 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 20 Reaksiyon tüpleri PCR cihazına yerleştirilir PCR Programı (mg3/mg4) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 45 sn Bağlanması (Annealing) 60C 50 sn Uzaması (Extension) 72C 50 sn Döngü Sayısı 40 Son Uzaması (Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içine konur. PCR Ürünlerinin Analizi Hedef dizilimin çoğaltılmasından sonra PCR ürünleri etidiyum bromidle boyanmış agaroz jel elektroferezi kullanılarak analiz edilir. 8 µl PCR ürünü, 2 µl yükleme tamponu ile karıştırıldıktan sonra örnekler agaroz jele (%1,5) yüklenir. Elektroforez yürütmesi 100 Volt da 1 saattir. Boyut markörleri (100 bp ladder, 15 µl) jelde amplikon bantların büyüklüğünü tam olarak ölçmek için kenardaki kuyucuklara yüklenerek yürütülür. Yürütmeden sonra UV transillüminatör ışığında jeldeki DNA lar görüntülenir. Deney sonuçlarını kalıcı olarak kaydetmek amacıyla jelin fotoğrafı çekilebilir. Sonuçların değerlendirilmesi mg1/mg2 ve mg3/mg4 primerleri MON810 içeren ürünlerin nested PCR ile spesifik saptanması amacıyla tasarlanmıştır. Amplifikasyon ürünü olarak gözlemlenecek son nested PCR bandı 149 bp büyüklüğündedir. Pozitif kontrol 149 bp büyüklüğünde bir bant vermelidir. Negatif kontrol ve hedef içermeyen kontrol görünür bir bant vermemelidir. Pozitif kontrol ve negatif kontrolde beklenen sonuçlar alınamıyorsa seçilen örneklerin PCR analizi doğru ve geçerli değildir. Kontroller ve örnekler 149 bp büyüklüğünde bir bant veriyorsa örnekler genetik modifiye DNA içermektedir.

21 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 21 Bt-176 Mısırın Saptanması Hedef gen bölgesi, bitkiyi European Corn Borer gibi zararlı böceklerden koruyan cryia(b) dir. CRYIA1, CRYIA2, CRYIA3, CRYIA4 lerin Özellikleri CRYIA 1 CGGCCCCGAGTTCACCTT Uzunluk 18 Molekül Ağırlığı (g/mol) 5394,6 Erime Noktası* (G/C) 59,5 CRYIA 2 CTGCTGGGGATGATGTTGTTG Uzunluk 21 Molekül Ağırlığı (g/mol) 6519,2 Erime Noktası* (G/C) 57,6 CRYIA 3 CCGCACCCTGAGCAGCAC Uzunluk 18 Molekül Ağırlığı (g/mol) 5397,6 Erime Noktası* (G/C) 61,7 CRYIA 4 GGTGGCACGTTGTTGTTCTGA Uzunluk 21 Molekül Ağırlığı (g/mol) 6479,2 Erime Noktası* (G/C) 57,6 *50 mm lık [Na + ] varlığında Kontroller Pozitif kontrol : Referans materyal DNA sı (%0,1 GD Mısır) Negatif kontrol : Referans materyal DNA sı (%0 GD mısır) Hedef içermeyen kontrol: DNA yerine suyun kullanıldığı master karışımın negatif kontrolü Master Karışım Hazırlama I 10 örneklik bir seri için için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 7 de verilen bilgilere göre karıştırılarak hazırlanır.

22 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 22 Bir örnek 48 µl CRYIA1/CRYIA2 içeren master karışım ve 2 µl DNA çözeltisi olmak üzere toplam hacim 50 µl dir. Master karışım hazırlandığı sürede bütün çözeltiler buzda tutulmalıdır. Tablo 7. CRYIA1/CRYIA2 master karışımı Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 32,75 µl 327,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid CRYIA1 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid CRYIA2 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl Toplam 48 µl 480 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 7 deki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir CRYIA1/CRYIA2 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 48 er µl dağıtılır Üzerlerine 2 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir PCR Programı (CRYIA1/CRYIA2) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 40 sn Bağlanması (Annealing) 60C 40 sn Uzaması (Extension) 72C 40 sn Döngü Sayısı 25 Son Uzaması (Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içine konur.

23 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 23 Master Karışım Hazırlama II 10 örnek için gerekli çözeltiler Tablo 8 de verilen bilgilere göre karıştırılarak hazırlanır. İkinci PCR da bir örnek için 49 µl CRYIA3/CRYIA4 içeren master karışım ve 1 µl ön amplifiye edilmiş DNA çözeltisi olmak üzere toplam hacim 50 µl dir. Master karışım hazırlandığı sürede bütün çözeltiler buzda tutulmalıdır. Tablo 8. CRYIA3/CRYIA4 Master karışımı Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 33,75 µl 337,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid CRYIA3 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid CRYIA4 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl Toplam 49 µl 490 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 8 deki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir CRYIA3/CRYIA4 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 49 ar µl dağıtılır Üzerlerine 1 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir

24 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 24 PCR Programı (CRYIA3/CRYIA4) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 40 sn Bağlanması (Annealing) 60C 40 sn Uzaması (Extension) 72C 40 sn Döngü Sayısı 35 Son Uzaması (Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içerisine konur. PCR Ürünlerinin Analizi Hedef dizilimin çoğaltılmasından sonra PCR ürünleri etidiyum bromidle boyanmış agaroz jel elektroferezi kullanılarak analiz edilir. 8 µl PCR ürünü, 2 µl yükleme tamponu ile karıştırıldıktan sonra örnekler agaroz jele (%1,5) yüklenir. Elektroforez yürütmesi 100 Volt da 1 saattir. Boyut markörleri (100 bp ladder, 15 µl) jelde amplikon bantların büyüklüğünü tam olarak ölçmek için kenardaki kuyucuklara yüklenerek yürütülür. Yürütmeden sonra UV transillüminatör ışığında jeldeki DNA lar görüntülenir. Deney sonuçlarını kalıcı olarak kaydetmek amacıyla jelin fotoğrafı çekilebilir. Sonuçların Değerlendirilmesi CRYIA1/CRYIA2 ve CRYIA3/CRYIA4 primer çiftleri nested PCR ile sentetik cryia(b) geninin spesifik saptanması için tasarlanmıştır. Bu primer çifti kullanılarak elde edilen amplifiye ürün 189 bp büyüklüğünde bir bant verir. Bu gen Bt-176 mısır, Bt-11 ve benzerleri gibi diğer GD organizmalarda bulunur. Pozitif kontrol 189 bp büyüklüğünde bir bant vermelidir. Negatif kontrol ve hedef içermeyen kontrol görünür bir bant vermemelidir. Pozitif kontrol ve negatif kontrolde beklenen sonuçlar alınamıyorsa seçilen örneklerin PCR analizi doğru ve geçerli değildir. Kontroller ve örnekler 189 bp büyüklüğünde bir bant veriyorsa örnekler genetik modifiye DNA içeriyordur.

25 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 25 Roundup Ready Soyanın Saptanması Hedef gen, Roundup herbisidine direnç sağlayan CP4 EPSPS dir. GMO9, GMO5, GMO8 ve GMO7 lerin Özellikleri GMO5 CCACTGACGTAAGGGATGACG Uzunluk 21 Molekül Ağırlığı (g/mol) 6479,4 Erime Noktası* (G/C) 59,5 GMO9 CATGAAGGACCGGTGGGAGAT Uzunluk 21 Molekül Ağırlığı (g/mol) 6559,4 Erime Noktası* (G/C) 59,5 GMO7 ATCCCACTATCCTTCGCAAGA Uzunluk 21 Molekül Ağırlığı (g/mol) 6309,6 Erime Noktası* (G/C) 55,8 GMO8 TGGGGTTTATGGAAATTGGAA Uzunluk 21 Molekül Ağırlığı (g/mol) 6579,8 Erime Noktası* (G/C) 51,7 *50 mm lık [Na] varlığında Kontroller Pozitif kontrol : Referans materyal DNA sı (%0,1 GD soya) Negatif kontrol : Referans materyal DNA sı (%0 GD soya) Hedef içermeyen kontrol: DNA yerine suyun kullanıldığı master karışımın negatif kontrolü

26 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 26 Master Karışım Hazırlama I GMO5/GMO9 10 örneklik bir seri için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 9 da verilen bilgilere göre karıştırılarak hazırlanır. İlk PCR da bir örnek için 48 µl GMO5/GMO9 içeren master karışım ve 2 µl DNA çözeltisi olmak üzere toplam hacim 50 µl dir. Master karışım hazırlandığı sürede bütün çözeltiler buzda tutulmalıdır. Tablo 9. Master karışım I (GMO5/GMO9) Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 32,75 µl 327,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid GMO5 0,5 µm 1,25 µl 12,5 µl 20 µm oligonükleotid GMO9 0,5 µm 1,25 µl 12,5 µl Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl Toplam 48 µl 480 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 9 daki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir GMO5/GMO9 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 48 er µl dağıtılır Üzerlerine 2 µl DNA solüsyonu eklenir Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir

27 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 27 PCR Programı (GMO5/GMO9) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 30 sn Bağlanması (Annealing) 60C 30 sn Uzaması (Extension) 72C 40 sn Döngü Sayısı 25 Son Uzaması (Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içerisine konur. Master Karışım Hazırlama II GMO7/GMO8 10 örnek için (pozitif/negatif/hedef içermeyen kontroller dahil) gerekli çözeltiler Tablo 10 da verilen bilgilere göre karıştırılarak hazırlanır. İkinci PCR da bir örnek için 49 µl GMO7/GMO8 içeren master karışım ve 1 µl ön amplifiye edilmiş DNA çözeltisi olmak üzere toplam hacim 50 µl dir. Master karışım hazırlandığı sürede bütün çözeltiler buzda tutulmalıdır. Tablo 10. Master karışım II GMO7/GMO8 Son Konsantrasyon Tek örnek için master karışım 10 örnek için master karışım Steril deiyonize su 33,75 µl 337,5 µl 10xPCR Tamponu 1x 5 µl 50 µl 25mM MgCl 2 2,5 mm 5 µl 50 µl 4mM dntps 0,2 mm 2,5 µl 25 µl 20 µm oligonükleotid 0,5 µm 1,25 µl 12,5 µl GMO7 20 µm oligonükleotid 0,5 µm 1,25 µl 12,5 µl GMO8 Taq DNA polimeraz 0,025 U/µl 0,25 µl 2,5 µl Toplam 49 µl 490 µl Bir adet 1,5 ml lik ependorf tüp hazırlanır Tablo 10 daki prosedür adımları takip edilerek sırasıyla bütün ayraçlar eklenir GMO7/GMO8 master karışımı pipetle yavaşça karıştırılır ve kısa süreli santrifüjlenir 0,2 ml lik PCR reaksiyon tüplerine karışımdan 49 ar µl dağıtılır Üzerlerine 1 µl DNA solüsyonu eklenir

28 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 28 Yavaşça çalkalanır ve kısa süreli santrifüj edilir Reaksiyon tüpleri PCR cihazına yerleştirilir PCR Programı (GMO7/GMO8) Sıcaklık Zaman İlk Denatürasyon 95C 3 dk Denatürasyon 95C 30 sn Bağlanması (Annealing) 60C 30 sn Uzaması (Extension) 72C 40 sn Döngü Sayısı 35 Son Uzaması (Extension) 72C 3 dk Soğutma 4C Amplifikasyondan sonra örnekler kısa süreli santrifüj edilir ve buz içerisine konur. PCR Ürünlerinin Analizi Hedef dizilimin çoğaltılmasından sonra PCR ürünleri etidiyum bromidle boyanmış agaroz jel elektroferezi kullanılarak analiz edilir. 8 µl PCR ürünü, 2 µl yükleme tamponu ile karıştırıldıktan sonra örnekler agaroz jele (%1,5) yüklenir. Elektroforez yürütmesi 100 Volt da 1 saattir. Boyut markörleri (100 bp ladder, 15 µl) jelde amplikon bantların büyüklüğünü tam olarak ölçmek için kenardaki kuyucuklara yüklenerek yürütülür. Yürütmeden sonra UV transillüminatör ışığında jeldeki DNA lar görüntülenir. Deney sonuçlarını kalıcı olarak kaydetmek amacıyla jelin fotoğrafı çekilebilir. Sonuçların Değerlendirilmesi GMO5/GMO9 ve GMO7/GMO8 primer çiftleri nested PCR ile Roundup Ready soyada bulunan modoıfıye gen kasetinin spesifik saptaması için kullanılır. Bu primer çifti kullanılarak elde edilen amplifiye ürün 169 bp büyüklüğünde bir bant verir. GMO5 ve GMO7 primerleri CaMV 35S promotör bölgesine komplementerdir. GMO9 primeri Agrobacterium sp CP4 suşuna ait CP4 EPSPS geni ile ve GMO8 primeri de CTP EPSPS geni ile komplementerdir. Pozitif kontrol 169 bp büyüklüğünde bir bant vermelidir. Negatif kontrol ve hedef içermeyen kontrol görünür bir bant vermemelidir.

29 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması 29 Pozitif kontrol ve negatif kontrolde beklenen sonuçlar alınamıyorsa seçilen örneklerin PCR analizi doğru ve geçerli değildir. Kontroller ve örnekler 169 bp büyüklüğünde bir bant veriyorsa örnekler genetik modifiye DNA içeriyordur.

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 8. El Kitabında tanımlanan Nitel PCR ın Özellikleri. M. Querci, M.

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 8. El Kitabında tanımlanan Nitel PCR ın Özellikleri. M. Querci, M. Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 8 El Kitabında tanımlanan Nitel PCR ın Özellikleri M. Querci, M. Mazzara WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 3. Kurs Sırasında Kullanılan Örnekler. M. Querci, N. Foti

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 3. Kurs Sırasında Kullanılan Örnekler. M. Querci, N. Foti Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 3 Kurs Sırasında Kullanılan Örnekler M. Querci, N. Foti WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 2. El Kitabının Sunumu, Çalışma Yöntemleri ve Kurs Bilgileri. M.

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 2. El Kitabının Sunumu, Çalışma Yöntemleri ve Kurs Bilgileri. M. Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 2 El Kitabının Sunumu, Çalışma Yöntemleri ve Kurs Bilgileri M.Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 5. Agaroz Jel Elektroforezi. M. Somma, M. Querci

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 5. Agaroz Jel Elektroforezi. M. Somma, M. Querci Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 5 Agaroz Jel Elektroforezi M. Somma, M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A

Detaylı

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7

Detaylı

KURS ELKİTABI. Editörler: Maddalena Querci, Marco Jermini ve Guy Van den Eede

KURS ELKİTABI. Editörler: Maddalena Querci, Marco Jermini ve Guy Van den Eede EĞİTİM KURSU GIDA ÖRNEKLERİNDE GENETİĞİ DEĞİŞTİRİLMİŞ ORGANİZMA ANALİZLERİ KURS ELKİTABI Editörler: Maddalena Querci, Marco Jermini ve Guy Van den Eede Bu yayına elektronik ortamda ulaşmak için: http://mbg.jrc.ec.europa.eu/capacitybuilding/documentation.htm

Detaylı

Protokolü PD S Reaksiyon

Protokolü PD S Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S00 0 50 Reaksiyon REŞİT GALİP CADDESİ 74-7 06700 ÇANKAYA, ANKARA, TÜRKİYE T +90 32 447 22 79 / 80 F +90 32 447 22 07 www.bmlabosis.com İnternal Pozitif

Detaylı

attomol apo B-100 quicktype

attomol apo B-100 quicktype attomol apo B-100 quicktype İnsan apolipoprotein B-100 (apo B-3500 mutasyonu) gen inde 10708G>A geçiş tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1015

Detaylı

Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı

Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı 4. Ha&a Polimeraz Zincir Reaksiyonu Mikrobiyoloji Anabilim Dalı Sunu içeriği PCR ın tanımı PCR ın kısa tarihçesi Hücre içi DNA replikasyonu PCR bileşenleri PCR temel prensipler PCR ın kullanım alanları

Detaylı

Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

attomol HLA-B*27 Sadece in vitro diagnostik kullanım içindir! 1.Giriş 2. Genel Açıklamalar

attomol HLA-B*27 Sadece in vitro diagnostik kullanım içindir! 1.Giriş   2. Genel Açıklamalar attomol HLA-B*27 HLA-B*27 in tespitine yönelik kit (Doku tiplemesi için kullanmayın!) Sadece in vitro diagnostik kullanım içindir! 40 tespit sipariş numarası: 1030 1.Giriş İnsan lökosit antijenleri(hla)

Detaylı

RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

SOYA VE MISIRDA GENETİĞİ DEĞİŞTİRİLMİŞ ÜRÜNLERİN BELİRLENMESİ * Detection of Genetically Modified Soybean and Maize

SOYA VE MISIRDA GENETİĞİ DEĞİŞTİRİLMİŞ ÜRÜNLERİN BELİRLENMESİ * Detection of Genetically Modified Soybean and Maize SOYA VE MISIRDA GENETİĞİ DEĞİŞTİRİLMİŞ ÜRÜNLERİN BELİRLENMESİ * Detection of Genetically Modified Soybean and Maize Aysun TURHAN Biyoteknoloji Anabilim Dalı Salih KAFKAS Biyoteknoloji Anabilim Dalı ÖZET

Detaylı

Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim

Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim PCR nedir? DNA Polimeraz enzimi kullanılarak DNA nın spesifik bir parçasının in vitro (bir tüp içerisinde)

Detaylı

RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500

Detaylı

attomol lactose intolerance C>T quicktype

attomol lactose intolerance C>T quicktype attomol lactose intolerance -13910C>T quicktype İnsan laktase-genine karşı -13910C>T geçiş tespitine yönelik mutasyon testi Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1045

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 11 Roundup Ready Soya nın Eş Zamanlı (Real-Time) PCR ile Nicel Saptanması N. Foti WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE

Detaylı

α1-antitrypsin quicktype

α1-antitrypsin quicktype attomol α1-antitrypsin quicktype İnsan α-1 antitripsin gen inde M-, Z- and S-alellerin tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! Z-mutasyonun tespiti için 10 sipariş numarası:

Detaylı

MAIA Pesticide MultiTest

MAIA Pesticide MultiTest MAIA Pesticide MultiTest GIDALARDA PESTİSiT KALINTILARI İÇİN AB MAKSİMUM KALINTI LİMİTLERİ İLE UYUMLU ÇOKLU KALINTI TARAMA TESTİ Microplate Acetylcholinesterase Inhibition Assay (MAIA) katı veya sıvı gıda

Detaylı

BRCA 1/2 DNA Analiz Paneli

BRCA 1/2 DNA Analiz Paneli FAST-BRCA Sequencing Kit BRCA 1/2 DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR... 3 5

Detaylı

ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ

ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ YÖNTEM YÖNTEMİN ESASI VE PRENSİBİ Fenolik maddeler uçucu özellik göstermeyen safsızlıklardan distilasyon işlemiyle ayrılır ve ph 7.9 ± 0.1 de potasyum ferriksiyanür

Detaylı

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar.

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar. DNA Đzolasyonu Saflaştırılmak istenen DNA ya genomik DNA dır ya da genomik olmayan mtdna, chldna, plasmit DNAsıdır.DNA izolasyon kitleri, genomik ve genomik olmayan DNA izole etmemizi sağlayan standartlaştırılmış

Detaylı

Moleküler Biyolojide Kullanılan Yöntemler-5

Moleküler Biyolojide Kullanılan Yöntemler-5 Moleküler Biyolojide Kullanılan Yöntemler-5 Polimeraz zincir reaksiyonu (PCR) (DNA nın in vitro çoğaltılması) 2 Hücrede doğal olarak (in vivo)gerçekleşen replikasyon, in vitro koşullarda da (hücre dışında)

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

FLORESAN İN SİTU HİBRİDİZASYON

FLORESAN İN SİTU HİBRİDİZASYON FLORESAN İN SİTU HİBRİDİZASYON Sağlık Teknikeri Hande ÇOLAKOĞLU Ege Üniversitesi Tıp Fakültesi Hastanesi Patoloji AD SIVI ve DOKULARIN FISH UYGULAMASI ÖNCESİ HAZIRLIK İŞLEMLERİ FISH Çalışmalarında Ön Uygulama

Detaylı

Kistik Fibrozis DNA Analiz Paneli

Kistik Fibrozis DNA Analiz Paneli FAST-CFTR Sequencing Kit Kistik Fibrozis DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara 24-25 Şubat 2011, İzmir Sunum Planı Teorik

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

ULUSAL BİYOÇEŞİTLİLİĞİNİN VE GEN KAYNAKLARININ KORUNMASI HEDEFLERİ DOĞRULTUSUNDA BÜYÜK MEMELİ TÜRLERİNİN ARAŞTIRILMASI, KORUNMASI VE YÖNETİMİ

ULUSAL BİYOÇEŞİTLİLİĞİNİN VE GEN KAYNAKLARININ KORUNMASI HEDEFLERİ DOĞRULTUSUNDA BÜYÜK MEMELİ TÜRLERİNİN ARAŞTIRILMASI, KORUNMASI VE YÖNETİMİ ULUSAL BİYOÇEŞİTLİLİĞİNİN VE GEN KAYNAKLARININ KORUNMASI HEDEFLERİ DOĞRULTUSUNDA BÜYÜK MEMELİ TÜRLERİNİN ARAŞTIRILMASI, KORUNMASI VE YÖNETİMİ Örnekleme Çalışmaları: Önemli Noktalar DNA ÇALIŞMASI Projenin

Detaylı

MOLEKÜLER MİKROBİYOLOJİ LABORATUVARI ÇALIŞMA PROSEDÜRÜ

MOLEKÜLER MİKROBİYOLOJİ LABORATUVARI ÇALIŞMA PROSEDÜRÜ KOD.MİK.PR.02 YAYIN TRH. KASIM 2011 REV. TRH. EYLÜL 2012 REV. NO.1 SAYFA NO.1/14 1. AMAÇ: Moleküler mikrobiyoloji laboratuvarında yürütülen faaliyetleri tanımlamak. 2. KAPSAM: Bu talimat, Moleküler mikrobiyoloji

Detaylı

LABORATUVAR MATEMATİĞİ

LABORATUVAR MATEMATİĞİ LABORATUVAR MATEMATİĞİ Dr. Zafer KÜÇÜKODACI GATA HEH Patoloji Servisi 22. ULUSAL PATOLOJİ KONGRESİ 7 Kasım 2012 Manavgat AMAÇ 2.3. DNA extraction by boiling : Total DNA was extracted by a boiling method

Detaylı

Avian Flu Screening&Typing H5, H7

Avian Flu Screening&Typing H5, H7 REF V-34-50R VER 04.03.08 Avian Flu Screening&Typing H5, H7 Kullanılan Semboller REF Liste Numarası 2-8 C/ -20 C de saklayın RUO Sadece Araştırma Kullanımı için Dikkat! LOT Lot Numarası VER Versiyon Son

Detaylı

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE VE GDO UYGULAMALARI GÜVENLİK VE GDO UYGULAMALARI Neslihan ATLIHAN Neslihan ATLIHAN Gıda Yüksek Mühendisi Gıda Yüksek Mühendisi Gıda ve Yem Kontrol

Detaylı

TEKNİK ŞARTNAME. 1) LC FS DNA Master Hy. Pb.,96 react

TEKNİK ŞARTNAME. 1) LC FS DNA Master Hy. Pb.,96 react 1) LC FS DNA Master Hy. Pb.,96 react TEKNİK ŞARTNAME 1) Kit hot-start PCR reaksiyonları, kantitasyon, SNP ve mutasyon çalışmaları için uygun 2) Kit ; primer, Prob ve template DNA haricind başka malzeme

Detaylı

Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri

Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Biyoloji Bölümünde Merkezi Araştırma Laboratuarlarının Kurulumu Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü

Detaylı

Mitokondrial DNA Analiz Paneli

Mitokondrial DNA Analiz Paneli FAST-mtDNA Sequencing Kit Mitokondrial DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

KURS ELKİTABI. Editörler: Maddalena Querci, Marco Jermini ve Guy Van den Eede

KURS ELKİTABI. Editörler: Maddalena Querci, Marco Jermini ve Guy Van den Eede EĞİTİM KURSU GIDA ÖRNEKLERİNDE GENETİĞİ DEĞİŞTİRİLMİŞ ORGANİZMA ANALİZLERİ KURS ELKİTABI Editörler: Maddalena Querci, Marco Jermini ve Guy Van den Eede Bu yayına elektronik ortamda ulaşmak için: http://mbg.jrc.ec.europa.eu/capacitybuilding/documentation.htm

Detaylı

Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar

Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar İçerik Giriş...2 Western Blot Yöntemi...2 Protein Örneklerinin Hazırlanması...2 Dikey Jel Sistemi Kullanımı...3 Kuru Transfer Sistem Kullanımı...4 Bloklama...6 Protein Tespiti...6 Kemilüminesans Tanımlama

Detaylı

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml

Detaylı

KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A

KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A KULLANIM KILAVUZU LCD Array Kit Süt ID 2.0 Customized LCD-Array Kit Kod: A-850-12 1) Giriş: Bu dizi süt ve süt ürünlerinde hayvan DNA'sının hızlı, kolay ve güvenilir tanımlaması için geliştirilmiştir.

Detaylı

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ Nükleik asitler Sıcaklıkla öldürülmüş S suşları Canlı R suşlarını canlı S suşuna dönüştürür a) Farelere virulan S suşu enjekte edildiğinde ölür b) R suşu enjekte edildiğinde yaşar c) Isıyla öldürülmüş

Detaylı

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler

Detaylı

Farmakogenetikte Kullanılan Temel Yöntemler

Farmakogenetikte Kullanılan Temel Yöntemler Farmakogenetikte Kullanılan Temel Yöntemler Dr. Melih Ö. Babaoğlu Hacettepe Üniversitesi Tıp Fakültesi Farmakoloji A.D. XIII. TFD Eğitim Sempozyumu Van 1 Hastalık derecesi Fizyolojik durum İlaç etkileşmeleri

Detaylı

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak BİYOFİZİK 2015 1 Amaç Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak 2 Hedefler Bu pratiğin sonunda öğrenciler, polimeraz zincir

Detaylı

KLOR (Cl2) ANALİZ YÖNTEMİ

KLOR (Cl2) ANALİZ YÖNTEMİ S a y f a 1 KLOR (Cl2) ANALİZ YÖNTEMİ YÖNTEMİN ESASI VE PRENSİBİ Klor, ph 8 de veya daha düşük bir ph da potasyum iyodür çözeltisinden iyotu serbest bırakacaktır. Serbest iyot, indikatör olarak nişasta

Detaylı

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden

Detaylı

MİKROBİYOLOJİDE BİYOTEKNOLOJİ

MİKROBİYOLOJİDE BİYOTEKNOLOJİ MİKROBİYOLOJİDE BİYOTEKNOLOJİ Biyoteknoloji; Genetik materyallerde moleküler düzeyde yapılan manipulasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde etmektir 1920 li yıllar...

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8)

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8) KONU-7. MOLEKÜLER BĠYOLOJĠDE TEMEL TEKNĠKLER BĠTKĠDEN GENOMĠK DNA ĠZOLASYONU Kullanılan Tamponlar: 1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol,

Detaylı

NÜKLEİK ASİTLERİN ELEKTROFOREZİ

NÜKLEİK ASİTLERİN ELEKTROFOREZİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ NÜKLEİK ASİTLERİN ELEKTROFOREZİ Yüksek Lisans Semineri Hazırlayan: Venhar ÇELİK Danışman: Yrd.Doç.Dr. Dilek Turgut-BALIK NÜKLEİK ASİTLERİN

Detaylı

RTA Bakteriden Genomik DNA İzolasyon Kiti

RTA Bakteriden Genomik DNA İzolasyon Kiti RTA Bakteriden Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 IVD Bakteri örneklerinden genomik nükleik asit izolasyonu ve saflaştırılması için In vitro tanı amaçlı kullanım için Yalnızca

Detaylı

GENETİK OLARAK DEĞİŞTİRİLMİŞ BİTKİ VE BİTKİ KÖKENLİ GIDALARIN TANIMLANMASINDA KULLANILAN YÖNTEMLER

GENETİK OLARAK DEĞİŞTİRİLMİŞ BİTKİ VE BİTKİ KÖKENLİ GIDALARIN TANIMLANMASINDA KULLANILAN YÖNTEMLER GENETİK OLARAK DEĞİŞTİRİLMİŞ BİTKİ VE BİTKİ KÖKENLİ GIDALARIN TANIMLANMASINDA KULLANILAN YÖNTEMLER Z.İpekçi 1, A. Altınkut 1, T. Oğraş 1, N. Gözükırmızı 1,2 1 TÜBİTAK, Gen Mühendisliği ve Biyoteknoloji

Detaylı

Biyolistik - Gen Silahı. İlker Gönülalp Yıldız Teknik Üniversitesi Biyoloji Bölümü

Biyolistik - Gen Silahı. İlker Gönülalp Yıldız Teknik Üniversitesi Biyoloji Bölümü Biyolistik - Gen Silahı İlker Gönülalp Yıldız Teknik Üniversitesi Biyoloji Bölümü Biyolistik Biyolistik, biyolojik ve balistik kelimelerinin kısaltmalarının birleştirilmesi şeklinde adlandırılan, hücrelerin

Detaylı

MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL

MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL MİKROBİYOLOJİDE BİYOTEKNOLOJİ Doç. Dr. Funda BAĞCIGİL Biyoteknoloji; Genetik materyallerde moleküler düzeyde yapılan manipulasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde etmektir

Detaylı

SODYUM DODESİL SÜLFAT POLİAKRİLAMİD JEL ELEKTROFOREZİ İLE PROTEİNLERİN ANALİZİ

SODYUM DODESİL SÜLFAT POLİAKRİLAMİD JEL ELEKTROFOREZİ İLE PROTEİNLERİN ANALİZİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ SODYUM DODESİL SÜLFAT POLİAKRİLAMİD JEL ELEKTROFOREZİ İLE PROTEİNLERİN ANALİZİ Yüksek Lisans Semineri Hazırlayan: Abdullah ASLAN Danışman:

Detaylı

MİKROBİYOLOJİ ANABİLİM DALI BİYOTEKNOLOJİ DERS NOTLARI

MİKROBİYOLOJİ ANABİLİM DALI BİYOTEKNOLOJİ DERS NOTLARI MİKROBİYOLOJİ ANABİLİM DALI BİYOTEKNOLOJİ DERS NOTLARI Biyoteknoloji, genetik materyallerde moleküler düzeyde yapılan manipülasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde

Detaylı

Protein Ekstraksiyonu

Protein Ekstraksiyonu Protein Ekstraksiyonu Dr.Gaye Güler Tezel Hacettepe Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Proteinler tüm canlı organizmalar için en önemli makromoleküllerden biridir. Bazıları yapısal komponentleri

Detaylı

M47 MICROGEN STREP MICROGEN

M47 MICROGEN STREP MICROGEN M47 MICROGEN STREP MICROGEN Strep; kültür ortamından Streptococcus Lancefield gruplarının (A, B, C, D, F ve G) tespitini hızlı bir şekilde gerçekleştiren latex slide aglütasyon testidir. İnsanda enfeksiyona

Detaylı

RTA Kandan Genomik DNA İzolasyon Kiti

RTA Kandan Genomik DNA İzolasyon Kiti RTA Kandan Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-05 IVD İnsan kan örneklerinden in vitro tanı amaçlı genomik nükleik asit izolasyon ve saflaştırması için In vitro tanı amaçlı

Detaylı

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Spesifik tanı yöntemleri: 1. Direk (kült ltür r ve bakterinin gösterilmesi) g 2. Antikorların n gösterilmesig 1.Standart tüp aglütinasyonu 2.Rose Bengal

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

PROTEİNLERİN SAFLAŞTIRILMASI

PROTEİNLERİN SAFLAŞTIRILMASI PROTEİNLERİN SAFLAŞTIRILMASI Bir hücre ve dokudan istenilen bir proteinin saf halde izole edilmesi oldukça güç bir olaydır. Bu proteinin konsantrasyonu düşük ise binlerce farklı protein arasından ayırmak

Detaylı

ı. BCR-ABL Mbcr Kiti(p210) 144 test

ı. BCR-ABL Mbcr Kiti(p210) 144 test C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Hematolojik Malignensi Translokasyon Testleri ve Cihaz Teknik Şartnamesi ı. BCR-ABL Mbcr Kiti(p210) 144 test 2. BCR-ABL mbcr Kiti(p190)

Detaylı

Elektoforez ENSTRÜMENTAL ANALİZ 10/12/2015. Elektroforez

Elektoforez ENSTRÜMENTAL ANALİZ 10/12/2015. Elektroforez Elektoforez ENSTRÜMENTAL ANALİZ Elektroforez Elektroforez yüklü moleküllerin bir elektriksel alandaki hareketlerinin izlendiği bir tekniktir. Bir örnekteki maddelerin tümü veya bazıları iyonlaşabiliyorsa

Detaylı

EK 1 TABLO 1 ZEHİRLİLİK SEYRELME FAKTÖRÜ (ZSF) TAYİNİ

EK 1 TABLO 1 ZEHİRLİLİK SEYRELME FAKTÖRÜ (ZSF) TAYİNİ EK 1 TABLO 1 ZEHİRLİLİK SEYRELME FAKTÖRÜ (ZSF) TAYİNİ Atıksu muhtevası, balığın yüzgeçlerine yapışarak solunum epitellerinin şişmesine ve parçalanmasına neden olur ve bu şekilde balıklara zarar verir.

Detaylı

HPLC ile Elma Suyunda HMF Analizi

HPLC ile Elma Suyunda HMF Analizi UYGULAMA NOTU Yüksek Performanslı Sıvı Kromatografi L019 HPLC ile Elma Suyunda HMF Analizi HAZIRLAYANLAR Kim. Akın Osanmaz ve Uzm. Kim. Ozan Halisçelik Ant Teknik Cihazlar Ltd. Şti. KONU: Elma suyu numunelerinde,

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

METAL ANALİZ YÖNTEMİ (ALEVLİ ATOMİK ABSORPSİYON SPEKTROMETRE CİHAZI İLE )

METAL ANALİZ YÖNTEMİ (ALEVLİ ATOMİK ABSORPSİYON SPEKTROMETRE CİHAZI İLE ) METAL ANALİZ YÖNTEMİ (ALEVLİ ATOMİK ABSORPSİYON SPEKTROMETRE CİHAZI İLE ) YÖNTEM YÖNTEMĐN ESASI VE PRENSĐBĐ Atomik absorpsiyon spektrometresi cihazında numune alevin içerisine püskürtülür ve atomize edilir.

Detaylı

INNO-LiPA HLA-A Multiplex 100

INNO-LiPA HLA-A Multiplex 100 Anahtar Kod: FRI74935 80689 INNO-LiPA HLA-A Multiplex 100 2014-01-16 28753 v0 P 1/7 Türkçe INNO-LiPA HLA-A Multiplex 100 Üretici: Fujirebio Europe N.V. Technologiepark 6 9052 Gent Belçika +32-9 329 13

Detaylı

GIDA BİYOTEKNOLOJİSİ-2

GIDA BİYOTEKNOLOJİSİ-2 DNA nın replikasyonu GIDA BİYOTEKNOLOJİSİ-2 1 2 DNA Replikasyonu (DNA çoğalması, DNA ikileşmesi, DNA sentezi) Bir hücrenin bölünebilmesi için DNA nın da çoğalması gerekir. DNA replikasyon mekanizmasının

Detaylı

BİYOKİMYASAL OKSİJEN İHTİYACI (BOİ) DENEYİN AMACI : Su örneklerinin biyolojik oksijen ihtiyacının hesaplanması TEORİ:

BİYOKİMYASAL OKSİJEN İHTİYACI (BOİ) DENEYİN AMACI : Su örneklerinin biyolojik oksijen ihtiyacının hesaplanması TEORİ: BİYOKİMYASAL OKSİJEN İHTİYACI (BOİ) DENEYİN AMACI : Su örneklerinin biyolojik oksijen ihtiyacının hesaplanması TEORİ: Atıksular organik maddeler içerdiğinden, bunların konsantrasyonları, yani sudaki miktarları,

Detaylı

KONU: MOLEKÜLER BİYOLOJİDE TEMEL TEKNİKLER; Çözeltiler ve Tamponlar

KONU: MOLEKÜLER BİYOLOJİDE TEMEL TEKNİKLER; Çözeltiler ve Tamponlar KONU: MOLEKÜLER BİYOLOJİDE TEMEL TEKNİKLER; Çözeltiler ve Tamponlar AMAÇ: - Moleküler Biyoloji laboratuvarında kullanılan çözeltileri ve hazırlanışlarını öğrenmek. - Biyolojik tamponların kullanım amaçlarını,

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

KANTİTATİF ANALİTİK KİMYA PRATİKLERİ

KANTİTATİF ANALİTİK KİMYA PRATİKLERİ KANTİTATİF ANALİTİK KİMYA PRATİKLERİ Kantitatif analiz yöntemleri, maddenin miktar tayinlerine dayalı analiz yöntemleridir. Günümüzde miktar tayinine yönelik birçok yöntem bilinmektedir. Pratik çalışmalarda

Detaylı

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA ET ÜRÜNLERİNDE TAĞŞİŞ Tağşiş; gıda maddesinin mevzuata veya izin verilen özelliklerine aykırı olarak üretilmesi hali olarak tanımlanmaktadır. Gıda ürünlerinde; tağşiş bir çok şekilde yapılabilmektedir.

Detaylı

INNO-LiPA MYCOBACTERIA v2 Amp

INNO-LiPA MYCOBACTERIA v2 Amp KEY-CODE: FRI44675 80347 INNO-LiPA MYCOBACTERIA v2 Amp 28725 v0 2014-02-04 p 1/7 INNO-LiPA MYCOBACTERIA v2 Amp Türkçe Üretici: Fujirebio Avrupa N.V. Technologiepark 6 9052 Gent Belçika +32 9 329 13 29

Detaylı

RTA Plazmid DNA İzolasyon Kiti

RTA Plazmid DNA İzolasyon Kiti RTA Plazmid DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 Bakteri örneklerinden plazmid DNA izolasyonu ve saflaştırılması için Yalnızca profesyonel kullanım için REF 09007050 50 test 09007100

Detaylı

MİKROBİYOLOJİ LABORATUARINDA SIK KULLANILAN BAZI BESİYERLERİNİN HAZIRLANMASI VE MUHAFAZASI

MİKROBİYOLOJİ LABORATUARINDA SIK KULLANILAN BAZI BESİYERLERİNİN HAZIRLANMASI VE MUHAFAZASI MİKROBİYOLOJİ LABORATUARINDA SIK KULLANILAN BAZI BESİYERLERİNİN HAZIRLANMASI VE MUHAFAZASI Çevre Mühendisliği Laboratuarlarında yaptığımız mikrobiyolojik deneylerde en çok buyyon ve jeloz besiyerlerini

Detaylı

Final Sınavı Soruları

Final Sınavı Soruları Final Sınavı Soruları Soru1: PCR döngüsünü kısaca anlatılınız. Cevap1: İlk adımda solüsyonun sıcaklığı artırılarak DNA zincirinin denatüre olması sağlanır. Bu sırada Bundan sonra primerlerin tekli DNA

Detaylı

Gıda Zincirindeki Genetiği Değiştirilmiş Organizmaların (GDO) Analizi

Gıda Zincirindeki Genetiği Değiştirilmiş Organizmaların (GDO) Analizi Gıda Zincirindeki Genetiği Değiştirilmiş Organizmaların (GDO) Analizi Hamide Şenyuva - John Gilbert, FoodLife International Edip Sincer, Sincer Dış Ticaret Gıda Zincirindeki Genetiği Değiştirilmiş Organizmaların

Detaylı

Tüberküloz laboratuvarında kalite kontrol

Tüberküloz laboratuvarında kalite kontrol Tüberküloz laboratuvarında kalite kontrol Prof. Dr. Aydan Özkütük Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Sunum planı Kalite gereklilikleri Yöntem geçerli kılma İç Kalite Kontrol

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

PCR ve RFLP YÖNTEMLERİ İLE MYCOBACTERIUM TÜRLERİNİN İDENTİFİKASYONU

PCR ve RFLP YÖNTEMLERİ İLE MYCOBACTERIUM TÜRLERİNİN İDENTİFİKASYONU 21. Yüzyılda Tüberküloz Sempozyumu ve II. Tüberküloz Laboratuvar Tanı Yöntemleri Kursu, Samsun PCR ve RFLP YÖNTEMLERİ İLE MYCOBACTERIUM TÜRLERİNİN İDENTİFİKASYONU Prof.Dr. Ahmet SANİÇ 1, Doç.Dr. Cafer

Detaylı

18- Teklif veren firma üretici firmadan aldığı yetki belgesini sunmalıdır.

18- Teklif veren firma üretici firmadan aldığı yetki belgesini sunmalıdır. 1- TOPLAM ANTİOKSİDAN KAPASİTE ÖLÇÜM (TAS) KİTİ TEKNİK ŞARTNAMESİ 1- Kitin reaktifleri ve standartları tamamen likit 2- Toplam Antioksidan Kapasite Direkt olarak ölçmelidir. 3- Kit kullanıma hazır 4- Kit

Detaylı

ANALĐZ ĐÇĐN GEREKLĐ EKĐPMANLAR. Mikro pipet (1000 µl) Ependorf tüpü (1.5 ml) Cam tüp (16X100 mm)

ANALĐZ ĐÇĐN GEREKLĐ EKĐPMANLAR. Mikro pipet (1000 µl) Ependorf tüpü (1.5 ml) Cam tüp (16X100 mm) 1 GĐRĐŞ Toplam lipid tayininde sülfo-fosfo-vanillin reaksiyonu takip edilmekte olup hızlı güvenilir ve kolay bir yöntem olduğu için tercih edilmiştir. Serum içerisindeki toplam lipid miktarının kantitatif

Detaylı

Gıda Analizlerinde Toksik Madde Tayini LC-GC Aplikasyonu Tanım:

Gıda Analizlerinde Toksik Madde Tayini LC-GC Aplikasyonu Tanım: Gıda Analizlerinde Toksik Madde Tayini LC-GC Aplikasyonu Tanım: İşlem görmüş gıda matrislerinde LC-MS/MS ve GC-MS ile Yüksek dozda toksik madde kalıntısı teşhis ve miktarlandırma analizleri için geliştirilmiş

Detaylı

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU DOKTORA DERS KATALOĞU ERCİYES ÜNİVERSİTESİ GDM 638 Lipid Kimyası Zorunlu DERS SAATİ: 3 Bahar Yrd. Doç. Dr. Hasan YALÇIN KREDİSİ :3 Tel:(352) 4374901 (32731), E-mail: hyalcin@erciyes.edu.tr, Web sayfası

Detaylı

T.C. SELÇUK ÜNİVERSİTESİ MÜHENDİSLİK MİMARLIK FAKÜLTESİ KİMYA MÜHENDİSLİĞİ BÖLÜMÜ

T.C. SELÇUK ÜNİVERSİTESİ MÜHENDİSLİK MİMARLIK FAKÜLTESİ KİMYA MÜHENDİSLİĞİ BÖLÜMÜ T.C. SELÇUK ÜNİVERSİTESİ MÜHENDİSLİK MİMARLIK FAKÜLTESİ KİMYA MÜHENDİSLİĞİ BÖLÜMÜ KİMYA MÜHENDİSLİĞİ LABORATUARI SÜREKLİ KARIŞTIRMALI REAKTÖR DENEYİ 2012 KONYA İÇİNDEKİLER İÇİNDEKİLER... ii SİMGELER VE

Detaylı

AA ile İnsan Tam Kan ve İdrar Örneklerinde Elektrotermal AA Yöntemi ile Nikel Analizi

AA ile İnsan Tam Kan ve İdrar Örneklerinde Elektrotermal AA Yöntemi ile Nikel Analizi UYGULAMA NOTU Atomik Absorpsiyon Spektrofotometre A003 AA ile İnsan Tam Kan ve İdrar Örneklerinde Elektrotermal AA Yöntemi ile Nikel Analizi HAZIRLAYAN Yük. Kimyager Hakan AKTAŞ Ant Teknik Cihazlar Ltd.

Detaylı

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite

Detaylı

EKMEK ÜRETİMİNDE DÜZENLEMELER DERSİ ÇALIŞMA SORULARI

EKMEK ÜRETİMİNDE DÜZENLEMELER DERSİ ÇALIŞMA SORULARI EKMEK ÜRETİMİNDE DÜZENLEMELER DERSİ ÇALIŞMA SORULARI 1. Ekmeğin besin değeri için aşağıdaki ifadelerden hangisi doğrudur? a. Ekmek tam bir besin kaynağıdır. b. Ekmekte sadece E vitamini ve mineral maddeler

Detaylı

Sebze Islahında Moleküler Markırların Kullanımı

Sebze Islahında Moleküler Markırların Kullanımı Sebze Islahında Moleküler Markırların Kullanımı Esra CEBECİ Ziraat Yüksek Mühendisi 28.12.2012-28.06.2013 Atatürk Bahçe Kültürleri Merkez Araştırma Enstitüsü YALOVA Sunu Planı Çalışmanın tanıtımı, Yapılan

Detaylı