Sunuş. Dr. M. Mehdi EKER Gıda, Tarım ve Hayvancılık Bakanı

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Sunuş. Dr. M. Mehdi EKER Gıda, Tarım ve Hayvancılık Bakanı"


1 Sunuş T.C. GIDA TARIM VE HAYVANCILIK BAKANLIĞI Hayvancılık sektörü bakımından büyük bir potansiyele sahip olan ülkemizde bazı hayvan hastalıklarının mevcudiyeti önemli ekonomik kayıplara neden olmaktadır. Hastalıklarla mücadelede veteriner teşhis ve analiz laboratuvarlarında hızlı ve güvenilir teşhis yapılması erken tedbir alınması açısından son derece önemlidir. Bu kapsamda veteriner teşhis ve analiz laboratuvarlarının alt yapıları bütçe imkanları doğrultusunda sürekli iyileştirilmeye çalışılmaktadır. Çalışmalar sonucunda, Avrupa Birliği entegrasyonu içerisinde ulusal referans laboratuvar oluşturulmuş ve Bakanlığımız Teşhis ve Analiz Laboratuvarlarının akreditasyonları gerçekleştirilmiştir. Son yıllarda dünyada ve ülkemizde yeni hastalıkların görülmeye başlaması ve teknolojik gelişmelere paralel olarak hastalıkların teşhisinde yeni metotlar kullanılmaya başlanmıştır. Gerek ülkemizde kullanılan mevcut metotların gerekse uluslararası kabul görmüş yeni teşhis metotlarının tekrar gözden geçirilerek standart operasyon prosedürlerin güncellenmesi amacıyla Bakanlığımız yetkilileri, Veteriner Fakültesi Öğretim Üyeleri ve Enstitü Uzmanlarının koordineli olarak çalışacakları altı adet komisyon oluşturulmuştur. Oluşturulan komite üyelerinin özverili çalışmaları sonucunda teşhis metodu standart operasyon prosedürlerine son hali verilmiş ve tüm komisyonların çalışmaları bir araya getirilerek Teşhiste Metot Birliği Kitabı oluşturulmuştur. Tüm Kamu ve Özel Veteriner Teşhis ve Analiz Labaratuvarları bu kitapta yer alan bilimsel komitenin onayını almış teşhis ve analiz metotlarını kullanacak ve bu suretle teşhiste metot birliği sağlanacaktır. Gerek Bakanlığımız Laboratuvarlarında ve gerekse Bakanlığımızdan ruhsatlı Veteriner Teşhis ve Analiz Laboratuvarlarda yayımlanmış olan bu metotlar uygulanacak olup, analiz sonuçları ulusal referans laboratuvarlar tarafından doğrulandıktan sonra geçerli olacaktır. Bilimsel komite üyeleri belli zamanlarda bir araya gelip, gelişmeleri takip ederek bünyelerinde çalışmalarına devam edecek ve yeni geliştirilen metotların mevcut kitaba ilavesiyle kitabın güncellenmesi temin edilecektir. Yeni geliştirilen veya ilk defa kullanılacak bir metodun Standart Operasyon Prosedürü oluşturulup bilimsel komitenin onayından geçtikten sonra kullanılmaya başlanacaktır. AB müktesebatına uyumlaştırma çalışmalarının aktif olarak yürütüldüğü bu günlerde, Genel Müdürlüğümüz, Veteriner Fakültesi Öğretim Üyeleri ve Enstitü Uzmanlarının gayretli çalışmaları sonucu hazırlanan Teşhiste Metot Birliği kitabının ülkemize yararlı olacağını umuyor ve bu konuda emeği geçenlere teşekkür ediyorum. Dr. M. Mehdi EKER Gıda, Tarım ve Hayvancılık Bakanı 3

2 4

3 Gıda, Tarım ve Hayvancılık Bakanı YÖNETİM KOMİTESİ PAKDİL Prof. Dr. İrfan EROL Habib CAN GÖREV ALANLAR VE KATKIDA BULUNANLAR (*) Dr. Funda ALTINÖZ Dr. Erhan AKÇAY Ayşe ATEŞOĞLU Zeynel ARSLAN Yusuf AKPINAR Hasan AYDIN Prof. Dr. Mehmet AKAN Özlem BAĞCI Dr. Ayşen BEYAZIT Dr. Aysel Ünsal BACA Mustafa COŞAR Dr. Ahmet DENİZ Prof. Dr. K. Serdar DİKER Dr. Seza ESKİİZMİRLİLER A.Turan ERDOĞDU Dr. Mehmet EKİK Prof. Dr. Ayhan FİLAZİ Prof. Dr. Bahadır GÖNENÇ İrem GÜLAÇTI Dr. Uğur KÜÇÜKAYAN Prof. Dr. Osman KUTSAL Doç. Dr. Taner KARAOĞLU Dr. Gülnur KALAYCI M. Levent KAYNAR Tülay KURT M. Murat MADEN Asuman SOYSAL NARIŞAHİN Dr. Taraneh ÖNCEL Ümit ÖZDEMİR Dr. Buket ÖZYER Ünal PARLAK Alper SEZGİN Dr. Beyhan SAREYYÜPOĞLU Doç. Dr. Barış SAREYYÜPOĞLU Dr. Serra TUNALIGİL Dr. Yavuz ULUSOY Prof. Dr. Sevil ATALAY VURAL Prof. Dr. Hakan YARDIMCI Dr. Öznur YAZICIOĞLU Dr. Funda YÜZBAŞIGİL Burak GÜNGÖR 5

4 6

5 : Dr. Funda ALTINÖZ Özlem BAĞCI : Dr. Seza ESKİİZMİRLİLER Dr. Serra TUNALIGİL : Dr. Öznur YAZICIOĞLU : Kanatlı Hastalıkları : Doç. Dr. Barış SAREYYÜPOĞLU : : Prof. Dr. K. Serdar DİKER : Prof. Dr. Sevil ATALAY VURAL Kanatlı Hastalıkları : Doç. Dr. Taner KARAOĞLU : Doç. Dr. Barış SAREYYÜPOĞLU 7







12 246 8


14 248 10

15 Çok Türde Görülen Viral Enfeksiyonlar

16 250 12

17 AŞILAMA VEYA HASTALIK SONRASI FOOT AND MOUTH DISEASE (FMD-ŞAP) VİRUSU NA KARŞI OLUŞAN ANTİKORLARIN LİKİT FAZ BLOKING ELISA (LPBE) İLE TESPİT EDİLMESİ 1. AMAÇ Şap virusunun yapısal proteinlerine (structural proteins, SP) karşı oluşan antikorların tespit edilmesi amacıyla kullanılmaktadır. 2. UYGULAMA ALANI Şap aşılamaları ve hastalığı sonrası virusun SP lerine karşı oluşan antikorların serumda tespiti ve titrasyonu yapılarak sahadaki antikor prevalansının tespiti, aşılama sonuçlarının değerlendirilmesi, epidemiyolojik amaçlı serosurveyler, enstitüde üretilen aşının potensinin tespiti amacıyla uygulanır. 3.TESTİN YAPILMASINDAKİ SORUMLULUKLAR Testin yapılmasından sorumlu yönetici ve uzman personel sorumludur. 4. TANIMLAR FMD: Foot and mouth disease (Şap hastalığı) FMDV: Şap virusu SP: Structural proteins, yapısal protein LPBE: Liquid Phase Blocking ELISA (Ag): Antijen, (Ab): Antikor Trapping (yakalayıcı) anti-serum:rabbit anti FMDV polyclonal serum, tavşan antiserumu Detecting (tespit edici) anti serum: Guine pig FMDV polyclonal serum, kobay antiserumu PBS: Phosphate Buffered Saline HRPO: Horse Radish Peroxidase H 2 O 2 : Hidrojen peroksit Konjugat: Polyclonal horse radish rabbit anti guinea pig immunoglobulins OPD: Orthophenilamine diamine

18 5. GÜVENLİK/UYARILAR/ÖNLEMLER Sağlığa zararlı biyolojik, kimyasallar ve infeksiyöz materyalle çalışılırken dikkatli olunmalı ve OIE Manual, Laboratory Biosafety Manual, Laboratuvar Güvenliği ve ilk Yardım, esas alınarak kurallara uyulması sağlanmalıdır. 6. TEST METODU NUN KISA TANIMI LPBE; indirekt, sıvı fazlı bloking esaslı bir ELISA olup şap virusu antijeninin sıvı ortamda, serum için de bulunan antikorlar tarafından spesifik olarak bloke edilmesi prensibiyle çalışır. Sıvı ortamda test serumları içerisinde bulunan şap virusuna karşı oluşmuş olan antikorlar, bu ortama optimal dilusyonunda ilave edilen şap viruslarını bloke eder ve oluşan (Ag)-(Ab) kompleksi, immunoabsorbans özelliğine sahip ELISA pleyt lerine kaplanmış tavşan antiserumları tarafından pleyte tutundurulur. Şap virusu üzerinde test serumları tarafından bloklanmayan boş kalmış reseptörler; bir sonraki aşamada ilave edilen kobay anti-serumları tarafından tanınır ve bağlanır. Konjugat pleyte ilave edildiğinde, virus reseptörlerini tanımış olan kobay antiserumlarını tanır. Oluşan bu reaksiyonun ortaya çıkarılmasını ise substrate - kromojen sağlar. 7. TEST METODU NUN TANIMI 7.1 Materyal FMDV ye karşı oluşan antikorların tespiti amacıyla aşılama veya hastalık sonrası gelen küçük ve büyük ruminant kan serumları Kullanılan ekipmanlar 96 gözlü mikropleytler; immunoabsorbans ELISA pleyti ve non absorbans taşıyıcı pleyt Shaker lı inkubatör ph metre vortex spektrofotometre pipetler (5,10,25,50ml) ve pipet uçları (5-50 μl, μl) buzdolabı, derin dondurucu su banyosu cam ve plastik malzeme

19 Kimyasal maddeler Kaplama Solüsyonu karbonat/bikarbonat, ph: 9.6 +/-0.05 Phosphate buffered saline (PBS) ph 7.4 +/- 0.2 ELISA diluent (Diluent buffer A, stok PBS ) 0.01 M PBS, ph 7.4 +/-0.20 ELISA diluent (Diluent buffer B) 0.01 M PBS, ph 7.4 +/-0.20 ve 0.05% Tween 20. Bloklama solüsyonları Alternatif bloklama solüsyonları Substrate Kromojen- OPD Stop solüsyonu Fenol red solüsyonu: (0.2 %) Kullanılan Biyolojik Maddeler ve Anti-serumlar Trapping antikorlar; Tavşan anti FMDV O, A, ASIA-1 Detecting antikorlar; Kobay anti FMDV O, A, ASIA-1 Antispecies konjugat Kontrol serumları -Anti-FMDV serotip O, A, ASIA-1. Kontrol antijenleri-fmdv serotip O, A, ASIA Numunenin Hazırlanması ve Testin Yapılması Numunenin Hazırlanması Laboratuvara gönderilen serumlar hemoliz açısından kontrol edilir, hemolize serumlar imha edilir. Şayet direkt kan gönderilmişse kandan serumun ayrılması amacıyla, tüplerin kenarları telle çizilir ve/veya serumun ayrışması için oda ısısında bekletilir. Serumları ayrılan kanlar ise serumun kan hücrelerinden arındırılması için, devirde 10 dk santrifüj edilir. Santrifüj işlemi sonrası kayıtları yapılan serumlar serum saklama raklarına aktarılır Analiz/Test/Muayene nin Yapılması Test 2 gün sürer. Birinci günde adsorbans özelliği olmayan taşıyıcı pleytte antijen (virus) ve antikor (serum) bir araya getirilir (bloklama) ve test edilecek serum dilusyonları yapılır. Serumların 1/32 final dilusyonunun elde edilmesi için önce ayrı bir taşıyıcı pleytte 1/16 başlangıç dilusyonu yapılır ve ardından testin diğer basamağında 50 µl virus (titresi önceden belirlenmiş, PBS-Tween için de sulandırılmış) konacağından 1/32 final dilusyon elde edilir. Test serumları 1 gece 4 o C de inkube edilir. Bu arada immunoadsorbans özellikte ELISA

20 pleyti hazırlanır. Kaplama solüsyonu için de 1/5000 dilusyonunda şap virusu tip spesifik rabbit antikor pleyte adsorbe edilir. Bu amaçla pleyt 1 gece 4 o C de inkube edilir. İkinci gün öncelikle antikor kaplı ELISA pleyti yıkanır ve yıkanan pleyte daha önceden dilusyonları yapılan test serumları aktarılır. 37 o C de 1 saat inkube edilir. Süre sonunda nonspesifik bağlanmaları gidermek için pleyt PBS ile yıkanır. Daha sonra ELISA pleytinin tüm gözlerine 50 µl düzeyinde 1/1000 dilusyonda detecting antikor eklenir. 37 o C de 1 saat inkube edilir. Süre sonunda pleyt yıkanır ve ardından pleytin tüm gözlerine 50 µl düzeyinde 1/2000 dilusyonda konjugat eklenir. 37 o C de 1 saat inkube edilir. Süre sonunda pleyt yıkanır. Son olarak pleytin tüm gözlerine hidrojen peroksitle aktive edilmiş 50 µl OPD (kromojen) eklenir. Pleyt 15 dk oda sıcaklığında inkube edilir. Oluşan enzim-substrat reaksiyonu pleytin tüm gözlerine 50 µl düzeyinde 1.25 M sülfürik asit eklenerek durdurulur. Ardından pleytler spektrofotometrede 492 nm dalga boyunda okutulur Sonuçların Değerlendirilmesi -Antikor titreleri % 50. endpoint titresi olarak ifade edilir. Testin kabul edilebilir kriterleri gözden geçirilmelidir. Bunun için ilk olarak OD değerleri incelenir. Antijen kontrol gözlerinde elde edilen OD ortalaması değerleri arası olmalıdır. -Bilgisayarda text dosyası olarak kaydedilen Optik Dansidite (OD) değerleri text formundan Excel formuna dönüştürülmelidir. Ardından serumların titrelerinin hesaplanabilmesi için, test sonucunda elde edilen OD değerlerinin % inhibisyon değerleri hesaplanmalıdır. Bu amaçla, % inhibisyon değeri =100-(Test Serumları OD/Ortalama Antijen Kontrol OD)X100 formülü kullanılır. - OD değerleri %inhibisyon değerlerine dönüştürüldükten sonra serum titreleri belirlenir. %50 ve üzeri inhibisyon veren değerleri pozitif olarak kabul edilir. Ancak aşılama sonrası serumlarda değerlendirme yaparken aşı koruyuculuk cut off değeri dikkate alınır. Bu değer 1/96 olup, 1/96 titre ve üzeri değerler, koruyucu antikor düzeyine sahiptir. 1/96 titre ve altındaki değerler ise koruyucu antikora sahip değildir

21 8. İLGİLİ DÖKÜMANLAR /KAYNAKLAR VE EKLER 1. OIE Manual of Standarts for Diagnostic Tests and Vaccines Chapter: ( 2. Liquid phase blocking ELISA protocol of antibodies Foot and Mouth Disease Virus Bench Protocol: N P Ferris June Hamblin, C., Barnett, I.T.R., Hedger, R.S., (1986 a,b) A new enzyme-linked immunoassay (ELISA) for the detection of antibodies against Foot and Mouth Disease Virus I. Development and method of ELISA. Journal of Immunological Methods, 93: REVİZYON Revizyon No Tarih Revizyon Yapılan Madde Revizyon Nedeni

22 ŞAP AŞILI VE ENFEKTE HAYVANLARIN NSP ELISA İLE BİRBİRİNDEN AYRILMASI 1. AMAÇ Şap virusunun yapısal olmayan proteinlerine (non structural proteins, NSPs) karşı oluşan antikorların tespit edilmesi amacıyla kullanılmaktadır. 2. UYGULAMA ALANI NSP ELISA lar, epidemiyolojik amaçlı serosurveyler, hastalık geçirmiş hayvanları aşılanmış hayvanlardan ayırt etmek ve sahadaki taşıyıcılık durumunun tespitine yönelik olarak eradikasyon ve kontrol çalışmalarında kullanılmaktadır. 3.TESTİN YAPILMASINDAKİ SORUMLULUKLAR Testin yapılmasından sorumlu yönetici ve uzman personel sorumludur. 4. GÜVENLİK/UYARILAR/ÖNLEMLER Sağlığa zararlı biyolojik, kimyasallar ve infeksiyöz materyalle çalışılırken dikkatli olunmalı ve OIE Manual, Laboratory Biosafety Manual, Laboratuvar Güvenliği ve ilk Yardım, esas alınarak kurallara uyulması sağlanmalıdır. 5. TANIMLAR FMD: Foot and mouth disease (Şap hastalığı) FMDV: Şap virusu NSP: Non structural, yapısal olmayan proteinler SP: Structural, yapısal proteinler 6. TEST METODU NUN KISA TANIMI Şap virusunun polipeptit zincirinde yapısal (VP1,2,3,4) ve yapısal olmayan proteinler (2A,B, 2C,2D; 3A,3B,3C,3D;3ABC) bulunmaktadır. NSP ler; şap aşılarının hazırlanması sırasında, purifikasyon prosesi yapılırken elimine olmaktadır. Bu nedenle aşı hayvanlara uygulandığı takdirde NSP proteinlerine karşı herhangi bir immun yanıt oluşmamaktadır. Ancak hayvan Şap virusu ile hastalandığı durumda, virusun tüm protein komponentlerine karşı antikor oluşacağından, NSP lere karşı da organizmada immun yanıt oluşmaktadır. Bu prensipten hareketle NSP lere karşı oluşan antikorları tespit eden NSP ELISA; hastalanmış

23 olan hayvanları, aşılanmış olanlardan ayırt etmek için kullanılmaktadır. Bu amaçla piyasada farklı isimlerde birkaç ticari kit satılmaktadır. Burada (Priocheck FMDV NS) kitinin anlatımı yapılmıştır. Test bloking esaslı bir ELISA dır. Pleytler kit içeriğinde hazır olarak Şap virusu NSP lerinden 3ABC ye spesifik monoklonal antikorlarla kaplanmış ve ardından 3ABC antijeni(3abc proteini) ile inkube edilmiştir. 7. TEST METODU NUN TANIMI 7.1 Materyal Trakya ve Anadolu için gerçekleştirilen serosurvey serumları, Kurban Bayramı öncesi Trakya ya hayvan sevkleri sırasında gönderilecek serumlar ve epidemiyolojik amaçlı toplanan saha serumlarında FMDV nin yapısal olmayan proteinlerine karşı oluşan antikorların tespiti amacıyla büyük ve küçük ruminant kan serumları Kullanılan ekipmanlar ph metre vortex spektrofotometre pleyt yıkama makinesi pipetler (5,10,25,50ml) pipet uçları (5-50 μl, μl) timer buzdolabı, derin dondurucu su banyosu cam ve plastik malzeme Kimyasal maddeler Priocheck kit içeriği ELISA diluent Konjugat (x30) Additive TMB - Kromojen Stop solüsyonu ELISA pleyt yıkama sıvısı (x60)

24 7.2. Numunenin Hazırlanması ve Testin Yapılması Numunenin Hazırlanması Laboratuvara gönderilen serumlar hemoliz açısından kontrol edilir, protokol numarası verilerek tüplerin üzeri cam kalemi ile numaralandırılır ve kayıtları yapılır. Şayet direkt kan gönderilmişse kandan serumun ayrılması amacıyla, tüplerin kenarları telle çizilir ve/veya serumun ayrışması için oda ısısında bekletilir. Serumları ayrılan kanlar ise serumun kan hücrelerinden ayrıştırılması için, devirde 10 dk santrifüj edilir. Santrifüj işlemi sonrası serumlar 96 gözlü serum saklama raklarına aktarılır ve çalışılana değin -20 o C de stoklanır. Çalışılacağı zaman -20 o C de stoklanan serumlar her gün teste çalışılacak miktarda çözdürülür Analiz/Test/Muayene nin Yapılması Şap virusu yapısal olmayan proteinlerine karşı oluşan antikorları tespit edici ELISA (PrioCheck FMDV NS) ticari firmanın bildirdiği prosedüre göre yapılır Sonuçların Değerlendirilmesi Kit prokolünde belirtildiği şekilde testin geçerliliği ve değerlendirmesi yapılır. 8. İLGİLİ DÖKÜMANLAR /KAYNAKLAR VE EKLER 1. OIE Manual of Standarts for Diagnostic Tests and Vaccines Chapter: (www.oie. int) 2. Sorensen, K.J., et al., differentation of infection from vaccination in FMD by the detection of antibodies to NSPs 3D,3AB and 3ABC in ELISA using antigens exspressed in baculovirus. Arch. Virol (1998), 143: Şap virusu yapısal olmayan proteinlerine karşı oluşan antikorları tespit edici ELISA (PrioCheck FMDV NS) test kiti kullanım kılavuzu (Türkiye de kullanım için izin veya ruhsatı alınmış kitler) 9. REVİZYON Revizyon No Tarih Revizyon Yapılan Madde Revizyon Nedeni

25 ŞAP HASTALIĞI NIN ANTİJEN ELISA İLE TEŞHİSİ VE TİP TAYİNİ (A, O, Asia 1 ve C tipleri için) 1.AMAÇ Şap hastalığının tanısı ve A, O, Asia 1 ve C tipi şap virusları için tip tayinidir. 2. UYGULAMA ALANI Test Şap Hastalığı etkeni olan şap virusularının A, O, Asia 1 ve C tiplerinin tip tayininde ve tip ayrımı yapmadan tüm serotiplerin tespitinde kullanılır. 3.TESTİN YAPILMASINDAKİ SORUMLULUKLAR Testin yapılmasından sorumlu yönetici ve uzman personel sorumludur. 4. GÜVENLİK/UYARILAR/ÖNLEMLER Enfeksiyöz materyalle ve sağlığa zararlı kimyasallarla çalışılırken dikkatli olunmalı ve OIE Manual, Laboratory Biosafety Manual, esas alınarak kurallara uyulması sağlanmalıdır. Testlerin başından sonuna kadar kullanılan bütün malzemeler dezenfektan solüsyonlar içine toplanmalı ve otoklav edildikten sonra imha edilmelidir. 5. KISALTMALAR/TANIMLAR Şap Hastalığı: Çift tırnaklı hayvanlarda verim kaybına neden olan uluslararası ticarete getirilen kısıtlamalar nedeniyle büyük ekonomik kayıplara yol açan çok bulaşıcı viral bir hastalıktır. Şap Virusu: Aphtoviridae ailesine mensup bir picornavirus tur. Şap virusu serotip: Şap virusunun O (Oise), A (Allemagne), C, Southern African Territories -SAT 1, SAT 2, SAT 3 and Asia 1 olmak üzere 7 serotipi vardır. ELISA: Enzyme Lynked Immuno Sorbent Assay HRPO: Horse Radish Peroxidase pan-fmdv: Tüm şap virusu serotipleri TMB : 3,3,5,5 -Tetramethylbenzidine

26 6. TEST METODU NUN KISA TANIMI Test şap virusu A, O, Asia 1 ve C tiplerine spesifik çeşitli anti-şap virusu monoklonal antikorları kombinasyonlarının kullanıldığı bir sandwich ELISA sistemidir. Test ayrıca tüm tiplere spesifik antikorlar kullandığından üniversal bir testtir. Şüpheli materyal (epiteliyal suspansiyon veya vezikül sıvısı) tip spesifik antikor ve şap virusu spesifik monoklonal antikor bağlanmış olan gözlere konulur. Ag-Ab kompleksinin oluşabilmesi için optimum şartlarda belirli bir süre tutulur. Ortama daha sonra HRPO ile konjuge edilmiş pan-fmdv antikoru ilave edilir. Test sonucunun görünür hale getirilebilmesi için konjugata uygun bir kromojen solusyon (TMB) ortama ilave edilerek renk oluşumu gözlenir. Sonuçlar ELISA okuyucusunda, OD değerlerine göre ölçülerek pozitif ve negatif olarak değerlendirilir. 7. TEST METODU NUN TANIMI 7.1 Materyal Kullanılan ekipman Şap Virusu Spesifik Antijen Tespit Edici ELISA (IZSLER-IAH) test kiti Değişik hacimlerde tek kanallı ve çok kanallı mikropipetler ( µl) İnkübatör (37 C etüv ve shaker veya 37 C ye ayarlanabilen Orbital Shaker) ELISA reader (Mikropleyt okuyucu) Tek kullanımlık pipet uçları ( µl) 7.2. Numunenin Hazırlanması ve Testin Yapılması Numunenin Hazırlanması Veziküler sıvılar direkt kullanılabilir. Epitel ve doku numuneleri aşağıda anlatıldığı gibi hazırlanır. Steril kabin içine steril havan, havan tokmağı, pens ve makas alınır. 1 tane 15 ml santrifüj tüpü alınır. Tüpün üzerine laboratuvar protokol numarası yazılır. Önceden 15 dakika UV ile steril edilmiş laminar kabin için de 1 gr. büyüklüğündeki epitelyum veya kalp numunesi steril havan içine alınır. Steril havan için de bulunan steril kum yardımıyla ezilir. Ezilen 1 gr. numune 9 ml PBS ile süspanse edilir. Süspansiyon 15 mllik santrifüj tüpüne aktarılır. +4 O C de 10 dakika, 3500 devirde santrifüj edilir. Süpernatant kısmından 250 µl test için ependorf tüplere, geri kalan kısmı 5 ml lik steril tüplere aktarılır. Test için alınan numuneler +4 O C de, geri kalan stok süspansiyonlar -20 O C de muhafaza edilir

27 Analiz/Test/Muayene nin Yapılması Şap Virusu Spesifik Antijen Tespit Edici ELISA (IZSLER-IAH) ticari firmanın bildirdiği prosedüre göre yapılır Testin Değerlendirilmesi Kit prokolünde belirtildiği şekilde testin geçerliliği ve değerlendirmesi yapılır. 8. İLGİLİ DÖKÜMANLAR /KAYNAKLAR VE EKLER 1. OIE Manual of Standarts for Diagnostic Tests and Vaccines Chapter: (www.oie. int) 2. Şap Virusu Spesifik Antijen Tespit Edici ELISA (IZSLER-IAH) Test kit kullanım kılavuzu (Türkiye de kullanım için izin veya ruhsatı alınmış kitler) 9. REVİZYON Revizyon No Tarih Revizyon Yapılan Madde Revizyon Nedeni

28 FOOT AND MOUTH DISEASE (FMD-ŞAP) Virusunun Tek Aşamalı Real time RT-PCR (qrt-pcr) ile Teşhisi 1. AMAÇ Şap hastalığının direkt tanısıdır. 2. UYGULAMA ALANI Test Şap Hastalığı etkeni olan şap virusunun serotip ayrımı olmaksızın tespitinde kullanılır. 3.TESTİN YAPILMASINDAKİ SORUMLULUKLAR Testin yapılmasından sorumlu yönetici ve uzman personel sorumludur. 4. GÜVENLİK/UYARILAR/ÖNLEMLER Enfeksiyöz materyalle ve sağlığa zararlı kimyasallarla çalışılırken dikkatli olunmalı ve OIE Manual, Laboratory Biosafety Manual, esas alınarak kurallara uyulması sağlanmalıdır. Testlerin başından sonuna kadar kullanılan bütün malzemeler dezenfektan solüsyonlar içine toplanmalı ve otoklav edildikten sonra imha edilmelidir. 5. TANIMLAR Şap Hastalığı: Çift tırnaklı hayvanlarda verim kaybına neden olan uluslararası ticarete getirilen kısıtlamalar nedeniyle büyük ekonomik kayıplara yol açan çok bulaşıcı viral bir hastalıktır. Şap virusu: Aphtoviridae ailesine mensup bir Picornavirus tur. qrt-pcr: Real time Reverse Transcription Polimerase Chain Reaction 6. TEST METODU NUN KISA TANIMI Epitelyum, salya, veziküler sıvı, doku kültürü sıvısı, organ parçası, gibi virus kaynaklarında bulunan virusa ait RNA nın tamamlayıcı DNA ya (cdna) dönüştürüldükten sonra Real Time PCR cihazı yardımı ile görüntülenerek tespit edilmesidir. 7. TEST METODU NUN TANIMI 7.1. Materyal Şap hastalığı teşhisi amacıyla gönderilen çift tırnaklı hayvanlara ait epitelyum, salya, veziküler sıvı, defibrine kan ve organ örnekleri ile doku kültürü sıvılarıdır

29 Kullanılan ekipman Değişik volümlerde tek kanallı ve çok kanallı mikropipetler ( µl) Tek kullanımlık pipet uçları ( µl) RNA ekstraksiyon robotu PCR tüpleri (0.2 ml lik) Thermal Cycler (PCR Cihazı) Real time Thermal Cycler (Real time PCR Cihazı) Spin santrifüj Masaüstü soğutmalı santrifüj Havan Steril kum Kullanılan Kimyasal ve Reagentlar Tek aşama qrt-pcr kiti Viral RNA izolasyon kiti Kullanılan primerler ve prob Adı Dizisi 3DF Primer ACTGGGTTTTACAAACCTGTGA 3DR Primer GCGAGTCCTGCCACGGA Taqman Prob TCCTTTGCACGCCGTGGGAC TAMRA işaretli 7.2. Numunenin Hazırlanması ve Testin Yapılması Numunenin Hazırlanması Veziküler sıvılar direkt kullanılabilir. Epitel ve doku numuneleri aşağıda anlatıldığı gibi hazırlanır. Steril kabin içine steril havan, havan tokmağı, pens ve makas alınır. 1 tane 15 ml santrifüj tüpü alınır. Tüpün üzerine laboratuvar protokol numarası yazılır. Önceden 15 dakika UV ile steril edilmiş laminar kabin için de 1 gr. büyüklüğündeki epitelyum veya kalp numunesi steril havan içine alınır. Steril havan için de bulunan steril kum yardımıyla ezilir. Ezilen 1 gr. numune 9 ml PBS ile süspanse edilir. Süspansiyon 15 ml lik santrifüj tüpüne aktarılır. +4 o C de 10 dakika, 3500 devirde santrifüj edilir. Süpernatant kısmından 250 µl test için ependorf tüplere, geri kalan kısmı 5 ml lik steril tüplere aktarılır. Test için alınan numuneler +4 o C de, geri kalan stok süspansiyonlar -20 o C de muhafaza edilir

30 RNA Ekstraksiyonu Kit prosedüründe belirtildiği şekilde yapılır. Elde edilen RNA test tarihine kadar kısa süreli beklemeler için -20 C de uzun süre beklemeler için -85 C de stoklanır Tek aşamalı Real time RT-PCR testi Primer ve problar laboratuvara ilk kez geldiğinde 100 pmol lük ana stoklar halinde sulandırılır ve -40 o C de saklanır. Kullanılacağı zaman 10 pmol lük çalışma solüsyonlarından, primer karışımları hazırlanır. Herbir örnek için aşağıdaki karışım hazırlanır. PCR master mix, μl 3DF primer, 10 pmol/μl 1 μl 3DR primer, 10 pmol/μl 1 μl TaqMan probe, 5 pmol/μl 1 μl Enzim mix 2.5 μl RNAse DNAse içermeyen su 4.5 μl RNA ekstraksiyon odasında hazırlanan RNA ve temiz odada hazırlanan reaksiyon karışımı PCR birleşim odasındaki laminar kabine buz için de getirilir. Her bir örnek için işaretlenmiş karışım içeren tüplere 2.5µl aktarılır (toplam hacim 25 μl. olur). Kısa bir santrifüj yapılarak, real time PCR cihazına konulur ve cihaz aşağıda belirtilen program seçilerek talimatına uygun olarak çalıştırılır. 40 o C 15 dk 1 döngü 95 C 10 dk 1 döngü 95 C 5 sn 40 döngü 55 C 20 sn Tarama 7.3. Sonuçların değerlendirilmesi Ct değeri 35 veya daha küçük bulunan örnekler pozitif olarak değerlendirilir. Ct değeri arasında olan örnekler için test tekrar edilir. 264


REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda


Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen


Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya


Protokolü PD S Reaksiyon

Protokolü PD S Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S00 0 50 Reaksiyon REŞİT GALİP CADDESİ 74-7 06700 ÇANKAYA, ANKARA, TÜRKİYE T +90 32 447 22 79 / 80 F +90 32 447 22 07 İnternal Pozitif





DİCLE ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I HÜCRE BİLİMLERİ 2 KOMİTESİ. İmmunohistokimya teknikleri ve Kullanım Alanları. Doç.Dr.

DİCLE ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I HÜCRE BİLİMLERİ 2 KOMİTESİ. İmmunohistokimya teknikleri ve Kullanım Alanları. Doç.Dr. DİCLE ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I HÜCRE BİLİMLERİ 2 KOMİTESİ İmmunohistokimya teknikleri ve Kullanım Alanları Doç.Dr. Engin DEVECİ İmmunohistokimya Hücre ve doku içinde bulunan bazı enzimlerin ya


RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500


Mitokondrial DNA Analiz Paneli

Mitokondrial DNA Analiz Paneli FAST-mtDNA Sequencing Kit Mitokondrial DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...


REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Yrd. Doç. Dr. Umut Fahrioğlu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü


MAIA Pesticide MultiTest

MAIA Pesticide MultiTest MAIA Pesticide MultiTest GIDALARDA PESTİSiT KALINTILARI İÇİN AB MAKSİMUM KALINTI LİMİTLERİ İLE UYUMLU ÇOKLU KALINTI TARAMA TESTİ Microplate Acetylcholinesterase Inhibition Assay (MAIA) katı veya sıvı gıda


RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050






VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Viroloji Ünitesi Viral Enfeksiyonlar... Klinik



KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7


Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Spesifik tanı yöntemleri: 1. Direk (kült ltür r ve bakterinin gösterilmesi) g 2. Antikorların n gösterilmesig 1.Standart tüp aglütinasyonu 2.Rose Bengal


Akreditasyon Sertifikası Eki (Sayfa 1/7) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/7) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/7) Deney Laboratuvarı Adresi : Erzene Mahallesi Ankara Caddesi No: 172/155 35010 İZMİR / TÜRKİYE Tel : 0232 388 00 10 Faks : 0232 388 50 52 E-Posta :


RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod


Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans



MOLEKÜLER MİKROBİYOLOJİ LABORATUVARI ÇALIŞMA PROSEDÜRÜ KOD.MİK.PR.02 YAYIN TRH. KASIM 2011 REV. TRH. EYLÜL 2012 REV. NO.1 SAYFA NO.1/14 1. AMAÇ: Moleküler mikrobiyoloji laboratuvarında yürütülen faaliyetleri tanımlamak. 2. KAPSAM: Bu talimat, Moleküler mikrobiyoloji


Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A


Genetik Tanı Merkezleri Ruhsat Başvuru Dosyasında Bulunması Gerekli Evraklar

Genetik Tanı Merkezleri Ruhsat Başvuru Dosyasında Bulunması Gerekli Evraklar Genetik Tanı Merkezleri Ruhsat Başvuru Dosyasında Bulunması Gerekli Evraklar Genetik tanı merkezi açacakların bir dilekçe ile mahallin en üst mülki amirliğine başvurmaları gereklidir. Bu dilekçede, genetik


Akreditasyon Sertifikası Eki (Sayfa 1/5) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/5) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/5) Patoloji Bölümü Yassı İstiridye (Ostrea Edulis) ve Midye (Mytilus galloprovincialis) Akivades (Ruditapes decussatus) Küçük Ruminantlara Ait Nekrotik-Erosiv ve/veya


RTA Kandan Genomik DNA İzolasyon Kiti

RTA Kandan Genomik DNA İzolasyon Kiti RTA Kandan Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-05 IVD İnsan kan örneklerinden in vitro tanı amaçlı genomik nükleik asit izolasyon ve saflaştırması için In vitro tanı amaçlı





Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml


Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION


Klinik Mikrobiyoloji de Enzimli İmmün Deney Enzyme Immuno Assay. Dr. Dilek Çolak

Klinik Mikrobiyoloji de Enzimli İmmün Deney Enzyme Immuno Assay. Dr. Dilek Çolak Klinik Mikrobiyoloji de Enzimli İmmün Deney Enzyme Immuno Assay Dr. Dilek Çolak İmmün Yanıt C. Macrophage A. Pathogen B. B cells D. Macrophage E. Macrophage F. T cell G. B cell H. Memory B cells I. Plasma



MİKROBİYOLOJİ LABORATUVARI CİHAZ KATALOĞU MİKROBİYOLOJİ LABORATUVARI CİHAZ KATALOĞU 1 Adana Bilim ve Teknoloji Üniversitesi Biyomühendislik Bölümü CİHAZLAR: Analitik Terazi (DENVER).3 Analitik Terazi (AND GX600)..3 Biyogüvenlik Kabini (NUAIRE)


Protein Ekstraksiyonu

Protein Ekstraksiyonu Protein Ekstraksiyonu Dr.Gaye Güler Tezel Hacettepe Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Proteinler tüm canlı organizmalar için en önemli makromoleküllerden biridir. Bazıları yapısal komponentleri


Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar

Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar İçerik Giriş...2 Western Blot Yöntemi...2 Protein Örneklerinin Hazırlanması...2 Dikey Jel Sistemi Kullanımı...3 Kuru Transfer Sistem Kullanımı...4 Bloklama...6 Protein Tespiti...6 Kemilüminesans Tanımlama


DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar.

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar. DNA Đzolasyonu Saflaştırılmak istenen DNA ya genomik DNA dır ya da genomik olmayan mtdna, chldna, plasmit DNAsıdır.DNA izolasyon kitleri, genomik ve genomik olmayan DNA izole etmemizi sağlayan standartlaştırılmış






SU ÜRÜNLERİ SAĞLIĞI BÖLÜM BAŞKANLIĞI SU ÜRÜNLERİ SAĞLIĞI BÖLÜM BAŞKANLIĞI Hacı SAVAŞ-SÜMAE, Su Ürünleri Sağlığı Bölüm Başkanı Su Ürünleri Sağlığı Bölüm Başkanlığı enstitümüz bünyesinde faaliyet gösteren bölümlerden birisidir. 2000 yılı başından



REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda



ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ YÖNTEM YÖNTEMİN ESASI VE PRENSİBİ Fenolik maddeler uçucu özellik göstermeyen safsızlıklardan distilasyon işlemiyle ayrılır ve ph 7.9 ± 0.1 de potasyum ferriksiyanür


Makale Kodu (Article Code): KVFD-2013-10661

Makale Kodu (Article Code): KVFD-2013-10661 Kafkas Univ Vet Fak Derg 0 (): 57758, 0 DOI: 0.9775/kvfd.0.066 Journal HomePage: Online Submission: RESEARCH ARTICLE Doğal Olarak Enfekte Olmuş Farklı


PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade


Adenovirüs serotip 5 ve adenovirüs serotip 36 nın Colo-320 hücre hattında adipojenik etkilerinin gösterilmesi

Adenovirüs serotip 5 ve adenovirüs serotip 36 nın Colo-320 hücre hattında adipojenik etkilerinin gösterilmesi Adenovirüs serotip 5 ve adenovirüs serotip 36 nın Colo-320 hücre hattında adipojenik etkilerinin gösterilmesi Tamer Şanlıdağ 1, Sinem Akçalı 1, Seda Vatansever 2, Candan Çiçek 3, Murat Sayan 4, Elçin Kal


ARAŞTIRMA. Anahtar kelimeler: Doğu ve Güneydoğu Anadolu, Epidemiyoloji, Hayvan Kuduzu, Türkiye.

ARAŞTIRMA. Anahtar kelimeler: Doğu ve Güneydoğu Anadolu, Epidemiyoloji, Hayvan Kuduzu, Türkiye. ARAŞTIRMA F.Ü.Sağ. Bil.Vet.Derg. 2010: 25 (2): 61-66 Türkiye nin Doğu ve Güneydoğu Anadolu Bölgelerinde Hayvan Kuduzunun Epidemiyolojisi Metin GÜRÇAY 1 Turhan TURAN 1 Mustafa ÖZKARACA


MAVİ DİL BLUETONGUE (BT) Hastalık Kartı. Hazırlayan. Dr. M. Fatih BARUT Vet. Hekim

MAVİ DİL BLUETONGUE (BT) Hastalık Kartı. Hazırlayan. Dr. M. Fatih BARUT Vet. Hekim MAVİ DİL BLUETONGUE (BT) Hastalık Kartı Hazırlayan Dr. M. Fatih BARUT Vet. Hekim Etlik Veteriner Kontrol Merkez Araştırma Enstitüsü Virolojik Teşhis Laboratuvarı Etken: Etken Reoviruslardan bir Orbivirus'tur.


α1-antitrypsin quicktype

α1-antitrypsin quicktype attomol α1-antitrypsin quicktype İnsan α-1 antitripsin gen inde M-, Z- and S-alellerin tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! Z-mutasyonun tespiti için 10 sipariş numarası:


Sunuş. Dr. M. Mehdi EKER Gıda, Tarım ve Hayvancılık Bakanı

Sunuş. Dr. M. Mehdi EKER Gıda, Tarım ve Hayvancılık Bakanı Sunuş T.C. GIDA TARIM VE HAYVANCILIK BAKANLIĞI Hayvancılık sektörü bakımından büyük bir potansiyele sahip olan ülkemizde bazı hayvan hastalıklarının mevcudiyeti önemli ekonomik kayıplara neden olmaktadır.


DEZENKON HNS (AgNPS) Antibakteriyel Yer ve Yüzey Dezenfektanı nın H1N1 Domuz Gribi Virüsüne karşı Virusidal Test Sonuç Raporu

DEZENKON HNS (AgNPS) Antibakteriyel Yer ve Yüzey Dezenfektanı nın H1N1 Domuz Gribi Virüsüne karşı Virusidal Test Sonuç Raporu DEZENKON HNS (AgNPS) Antibakteriyel Yer ve Yüzey Dezenfektanı nın H1N1 Domuz Gribi Virüsüne karşı Virusidal Test Sonuç Raporu ANTİMİKROBİYAL MADDELERİ ARAŞTIRMA GELİŞTİRME VE TEST LABORATUAR HİZMETLERİ


DEZENKON HNS (AgNPS) Antibakteriyel Yer ve Yüzey Dezenfektanı Sitotoksisite Testi Sonuç Raporu

DEZENKON HNS (AgNPS) Antibakteriyel Yer ve Yüzey Dezenfektanı Sitotoksisite Testi Sonuç Raporu DEZENKON HNS (AgNPS) Antibakteriyel Yer ve Yüzey Dezenfektanı Sitotoksisite Testi Sonuç Raporu ANTİMİKROBİYAL MADDELERİ ARAŞTIRMA GELİŞTİRME VE TEST LABORATUAR HİZMETLERİ TİC. LTD. ŞTİ. Karadeniz Teknik


RTA Dokudan ve Parafine-Gömülü Dokudan Genomik DNA İzolasyon Kiti

RTA Dokudan ve Parafine-Gömülü Dokudan Genomik DNA İzolasyon Kiti RTA Dokudan ve Parafine-Gömülü Dokudan Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-05 IVD İnsan dokusu ve parafine gömülü doku örneklerinden in vitro tanı amaçlı genomik nükleik asit


1. AFLATOXİN M1 LOW MATRİX ELISA TEKNİK ŞARTNAMESİ a. Kit süt,süt tozu, ve peynirde competitive enzyme immunoassay yöntemi ile kantitatif olarak

1. AFLATOXİN M1 LOW MATRİX ELISA TEKNİK ŞARTNAMESİ a. Kit süt,süt tozu, ve peynirde competitive enzyme immunoassay yöntemi ile kantitatif olarak 1. AFLATOXİN M1 LOW MATRİX ELISA TEKNİK ŞARTNAMESİ a. Kit süt,süt tozu, ve peynirde competitive enzyme immunoassay yöntemi ile kantitatif olarak Aflatoxin M1 ölçümü yapabilmelidir. b. Kit 96 testlik orijinal


REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Yrd. Doç. Dr. Kaya Süer, Yrd. Doç. Dr. Murat Uncu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü



BIONEER MARKA ACCUPOWER EBV QUANTATIVE PCR KİTİ PROTOKOLÜ BIONEER MARKA ACCUPOWER EBV QUANTATIVE PCR KİTİ PROTOKOLÜ Kullanılan Ekipmanlar : - Bioneer Marka ExiPrep16 Plus Model Tam Otomatik Nükleik Asit Ekstraksiyon Sistemi - Bioneer Marka ExiPrep Viral DNA/RNA


Rahim ağzı kanseri hücreleri doku kültürü mikroskopik görüntüsü.

Rahim ağzı kanseri hücreleri doku kültürü mikroskopik görüntüsü. Doç.Dr.Engin DEVECİ HÜCRE KÜLTÜRÜ Hücre Kültürü Araştırma Laboratuvarı, çeşitli hücrelerin invitro kültürlerini yaparak araştırmacılara kanser, kök hücre, hücre mekaniği çalışmaları gibi konularda hücre


REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Yrd. Doç. Dr. Umut Fahrioğlu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü





RTA Bakteriden Genomik DNA İzolasyon Kiti

RTA Bakteriden Genomik DNA İzolasyon Kiti RTA Bakteriden Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 IVD Bakteri örneklerinden genomik nükleik asit izolasyonu ve saflaştırılması için In vitro tanı amaçlı kullanım için Yalnızca


Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri

Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Biyoloji Bölümünde Merkezi Araştırma Laboratuarlarının Kurulumu Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü


Gıda ve Kontrol Genel Müdürlüğü Tarafından Yürütülen Su Ürünleri Hastalıkları ile Mücadele Faaliyetleri. Veteriner Hekim İlkay DEMİRHAN-2015

Gıda ve Kontrol Genel Müdürlüğü Tarafından Yürütülen Su Ürünleri Hastalıkları ile Mücadele Faaliyetleri. Veteriner Hekim İlkay DEMİRHAN-2015 Gıda ve Kontrol Genel Müdürlüğü Tarafından Yürütülen Su Ürünleri Hastalıkları ile Mücadele Faaliyetleri Veteriner Hekim İlkay DEMİRHAN-2015 Tüm canlılarda olduğu gibi balıklarında enfeksiyöz ve non enfeksiyöz


REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Adem Aköl Sinan Özyavaş Yrd. Doç. Dr. Umut Fahrioğlu Kalite Konseyi Başkanı Kalite Koordinatörü


T.C. SAĞLIK BAKANLIĞI Temel Sağlık Hizmetleri Genel Müdürlüğü. Sayı: B100TSH0120010 Konu: Halk Sağlığı Laboratuvarı 17.10.

T.C. SAĞLIK BAKANLIĞI Temel Sağlık Hizmetleri Genel Müdürlüğü. Sayı: B100TSH0120010 Konu: Halk Sağlığı Laboratuvarı 17.10. T.C. SAĞLIK BAKANLIĞI Temel Sağlık Hizmetleri Genel Müdürlüğü Sayı: B100TSH0120010 Konu: Halk Sağlığı Laboratuvarı ANKARA 17.10.2002 15702... VALİLİĞİNE (İl Sağlık Müdürlüğü) GENELGE 2002 / 111 Bakanlığımızın



ÇÖZÜNMÜŞ OKSİJEN TAYİNİ ÇEVRE KİMYASI LABORATUVARI ÇÖZÜNMÜŞ OKSİJEN TAYİNİ 1. GENEL BİLGİLER Doğal sular ve atıksulardaki çözünmüş oksijen (ÇO) seviyeleri su ortamındaki fiziksel, kimyasal ve biyokimyasal aktivitelere bağımlıdır.



KUDUZ HASTALIĞININ TEŞHİSİNDE POLİMERAZ ZİNCİR REAKSİYONU * Polymerase Chain Reaction in the Diagnosis of Rabies KUDUZ HASTALIĞININ TEŞHİSİNDE POLİMERAZ ZİNCİR REAKSİYONU * Polymerase Chain Reaction in the Diagnosis of Rabies Hikmet ÜN ** Feray ALKAN *** ÖZET Bu çalışmada, kuduz hastalığının teşhisinde Polimeraz





Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi

Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi Bakır M¹, Engin A¹, Kuşkucu MA², Bakır S³, Gündağ Ö¹, Midilli K² Cumhuriyet Üniversitesi


Bornova Vet.Kont.Arst.Enst.

Bornova Vet.Kont.Arst.Enst. Mikotoksinlerin Önemi ve Mikotoksin Test Metotları Dilek ÇİMEN TÜBİTAK ATAL 8-9 EKİM 2008 İZMİR MİKOTOKSİNLER Mikotoksinler, Mantarlar tarafından uygun ortam, ışık,sıcaklık ve nem şartlarında sentezlenen





Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03. Laboratuvar Tekniği Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.2014) 1 5. Haftanın Ders İçeriği DNA ekstraksiyonu DNA ekstraksiyonunun amacı


Moleküler Biyoloji ve Genetik Bölümü

Moleküler Biyoloji ve Genetik Bölümü Moleküler Biyoloji ve Genetik Bölümü Doç. Dr. Işın N. Geren Yrd. Doç. Dr. Turgay Çakmak Yrd. Doç. Dr. Filiz Kısaayak Çollak Uzman Zeynep N. Koytak Araş. Gör. Fatma Sağır Araş. Gör. Kuaybe Yücebilgili (ÖYP)


Tüberküloz laboratuvarında kalite kontrol

Tüberküloz laboratuvarında kalite kontrol Tüberküloz laboratuvarında kalite kontrol Prof. Dr. Aydan Özkütük Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Sunum planı Kalite gereklilikleri Yöntem geçerli kılma İç Kalite Kontrol


RTA Mayadan Genomik DNA İzolasyon Kiti

RTA Mayadan Genomik DNA İzolasyon Kiti RTA Mayadan Genomik DNA İzolasyon Kiti Kullanma Klavuzu Yayın Tarihi - 2011-12 Maya örneklerinden genomik nükleik asit izolasyonu ve saflaştırılması için Yalnızca profesyonel kullanım için REF 09002050


RTA Viral DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2010-05

RTA Viral DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2010-05 RTA Viral DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2010-05 IVD In vitro tanı amaçlı insan plazma ve serum örneklerinden viral nükleik asit izolasyon ve saflaştırılması için In vitro tanı amaçlı





RTA Viral Nükleik Asit İzolasyon Kiti

RTA Viral Nükleik Asit İzolasyon Kiti RTA Viral Nükleik Asit İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-10 IVD In vitro tanı amaçlı insan serum veya plazma (EDTA) örneklerinden viral DNA ve RNA izolasyon ve saflaştırılması amacıyla





1. AMAÇ VE KAPSAM Bu talimatın amaç ve kapsamı, Numune kabulü Dağıtımı ve muhafazası Prosedürü (VKMAE. Pr. 09) nde belirtilmiştir.

1. AMAÇ VE KAPSAM Bu talimatın amaç ve kapsamı, Numune kabulü Dağıtımı ve muhafazası Prosedürü (VKMAE. Pr. 09) nde belirtilmiştir. Sayfa/Tp.Sayfa: 1/5 1. AMAÇ VE KAPSAM Bu talimatın amaç ve kapsamı, Numune kabulü Dağıtımı ve muhafazası Prosedürü ( Pr. 09) nde belirtilmiştir. 2. SORUMLULUKLAR İlgili sorumluluklar Numune kabulü Dağıtımı



ELISA. Dr. Serkan SAYINER - ELISA Dr. Serkan SAYINER - ELISA nedir? Enzim bağlı konjugat ve enzim spesifik substrat kullanılarak, antijen-antikor reaksiyonlarının renk değişimi olarak elde edilmesi ve bunun


Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz.

Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz. 1 / 107 Malzeme Kodu : JENL1243 33893 BCR-ABL T(9;22) TRANSLOKASYON 2 SUBTIPIN BELIRLENMESI ICIN KANTITATIF PCR KITI.SUBTIPLER:P190 (MBCR), P210 (MBCR) (TEST/KUTU) SATINALMA BİLGİSİ (ŞARTNAME) (*) Düzenleme


attomol Parvovirus B19-DNA-LINA

attomol Parvovirus B19-DNA-LINA attomol Parvovirus B19-DNA-LINA Kan yada amniyotik sıvıda Parvovirus B19- genotiplerin 1-3 tespitine yönelik test Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1049 1.Giriş İnsan





Akreditasyon Sertifikası Eki (Sayfa 1/9) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/9) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/9) Deney Laboratuvarı Akreditasyon No: Adresi :Ahmet Şefik Kolaylı Caddesi No:23 ETLİK 06020 ANKARA / TÜRKİYE Tel : 0312 326 00 90 Faks : 0312 321 17 55 E-Posta :


XYLELLA FASTIDIOSA Gerekli Kimyasallar: - DNA izolasyon kiti (Qiagen Plant Minikit veya Invitrogen DNA purification kit ) - TaqMan Universal PCR

XYLELLA FASTIDIOSA Gerekli Kimyasallar: - DNA izolasyon kiti (Qiagen Plant Minikit veya Invitrogen DNA purification kit ) - TaqMan Universal PCR XYLELLA FASTIDIOSA Gerekli Kimyasallar: - DNA izolasyon kiti (Qiagen Plant Minikit veya Invitrogen DNA purification kit ) - TaqMan Universal PCR Master Mix (Applied Biosystems) Gerekli Sarf Malzemeleri





Tarım ve Köyişleri Bakanlığından: Aşı,Serum, Sulandırma Sıvısı ve Biyolojik Madde Gibi Veteriner Sağlık Ürünlerinden Numune Alma Esasları Hakkındaki

Tarım ve Köyişleri Bakanlığından: Aşı,Serum, Sulandırma Sıvısı ve Biyolojik Madde Gibi Veteriner Sağlık Ürünlerinden Numune Alma Esasları Hakkındaki Tarım ve Köyişleri Bakanlığından: Aşı,Serum, Sulandırma Sıvısı ve Biyolojik Madde Gibi Veteriner Sağlık Ürünlerinden Numune Alma Esasları Hakkındaki Tebliğ TebliğNo: 2000/44 BİRİNCİBÖLÜM Amaç, Kapsam,



TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM Doç. Dr. Alpaslan Alp Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Dünya Sağlık Örgütü 2009 Yılı Raporu Aktif tüberkülozlu hasta


RTA Plazmid DNA İzolasyon Kiti

RTA Plazmid DNA İzolasyon Kiti RTA Plazmid DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 Bakteri örneklerinden plazmid DNA izolasyonu ve saflaştırılması için Yalnızca profesyonel kullanım için REF 09007050 50 test 09007100





Laboratuvarda Tularemi Örnekleriyle Çalışma Rehberi

Laboratuvarda Tularemi Örnekleriyle Çalışma Rehberi Laboratuvarda Tularemi Örnekleriyle Çalışma Rehberi Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Bakteri ile çalışmaya uygun laboratuar



ÜRÜN KULLANIM KILAVUZU ÜRÜN KULLANIM KILAVUZU 1.0 Ürün bilgileri 1.1 Ürün adı : MGG Quick Boyama Seti 1.2 Ürün Kodu : 5024-100, 5024-500T, 5024-1000, 5024-2000T 1.3 Ürün Marka adı : GBL 1.4 Ürün Tanımı: Vücut sıvılarındaki hücrelerin


attomol HSV 1, 2 Screening-DNA-LINA

attomol HSV 1, 2 Screening-DNA-LINA attomol HSV 1, 2 Screening-DNA-LINA Beyin omurilik sıvısında ve swab numunelerinde HSV tip 1- ve tip 2- DNA yı tespit etmek için yapılan test Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş


KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A

KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A KULLANIM KILAVUZU LCD Array Kit Süt ID 2.0 Customized LCD-Array Kit Kod: A-850-12 1) Giriş: Bu dizi süt ve süt ürünlerinde hayvan DNA'sının hızlı, kolay ve güvenilir tanımlaması için geliştirilmiştir.



SEDİMANTASYON TESTİ : 1 SEDİMANTASYON TESTİ : AMAÇ ve PRENSİP: Sedimantasyon testi, buğday ve unun ekmeklik kalitesini belirlemede kullanılan çeşitli testlerin arasında en hızlı ve en kolay olanıdır. Bu test sonucunda elde



KLOR (Cl2) ANALİZ YÖNTEMİ S a y f a 1 KLOR (Cl2) ANALİZ YÖNTEMİ YÖNTEMİN ESASI VE PRENSİBİ Klor, ph 8 de veya daha düşük bir ph da potasyum iyodür çözeltisinden iyotu serbest bırakacaktır. Serbest iyot, indikatör olarak nişasta



LABORATUVAR DONANIMI LABORATUVAR DONANIMI «Tüberküloz laboratuvarlarında kullanılan donanımın takibi ve bakımı uygulamaları» Hülya ŞİMŞEK Ulusal Tüberküloz Referans Laboratuvarı 08-10 Mayıs 2015-Mersin Sunum İçeriği Laboratuvar



BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür





WESTERN BLOT. Yrd. Doç. Dr. Eda Becer. Yakın Doğu Üniversitesi Eczacılık Fakültesi Biyokimya Anabilim Dalı

WESTERN BLOT. Yrd. Doç. Dr. Eda Becer. Yakın Doğu Üniversitesi Eczacılık Fakültesi Biyokimya Anabilim Dalı WESTERN BLOT Yrd. Doç. Dr. Eda Becer Yakın Doğu Üniversitesi Eczacılık Fakültesi Biyokimya Anabilim Dalı Northern Blot (RNA) James Alwine George Stark Western Blot (Protein) Eastern Blot (??) George Stark


ı. BCR-ABL Mbcr Kiti(p210) 144 test

ı. BCR-ABL Mbcr Kiti(p210) 144 test C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Hematolojik Malignensi Translokasyon Testleri ve Cihaz Teknik Şartnamesi ı. BCR-ABL Mbcr Kiti(p210) 144 test 2. BCR-ABL mbcr Kiti(p190)






SIĞIRLARIN NODÜLER EKZANTEMİ LUMPY SKIN DISEASE (LSD) Hastalık Kartı. Hazırlayan. Dr. M. Fatih BARUT Vet. Hekim SIĞIRLARIN NODÜLER EKZANTEMİ LUMPY SKIN DISEASE (LSD) Hastalık Kartı Hazırlayan Dr. M. Fatih BARUT Vet. Hekim Etlik Veteriner Kontrol Merkez Araştırma Enstitüsü Virolojik Teşhis Laboratuvarı Etken: Etken,



ÜRÜN KULLANIM KILAVUZU ÜRÜN KULLANIM KILAVUZU 1.0 Ürün bilgileri 1.1 Ürün adı : Alkali Fosfataz Lökosit Boyama Seti 1.2 Ürün Kodu : 5057-100 1.3 Ürün Marka adı : GBL 1.4 Ürün Tanımı: Kan, kemik iliği veya doku numunelerinde





şeklinde ifade edilir.

şeklinde ifade edilir. MADEN MÜHENDİSLİĞİ BÖLÜMÜ 21 CEVHER HAZIRLAMA LAB. I ANDREASEN PIPETTE YÖNTEMİ İLE TANE BOYU DAĞILIMININ BELİRLENMESİ 1. AMAÇ Geleneksel labaratuvar elekleriyle elenemeyecek kadar küçük tane boylu malzemelerin






