HBV: Mikrobiyoloji ve Patogenez

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "HBV: Mikrobiyoloji ve Patogenez"


1 HBV: Mikrobiyoloji ve Patogenez Doç.Dr.Murat Sayan Kocaeli Üniversitesi Hepatit Akademisi: Temel Bilgiler Ocak 2013 Lefkoşe/Kıbrıs

2 Aile Cins Tür Konak Hepadnaviridae Orthohepadnavirus Hepatit B virusu Vertebralılar Avihepadnavirus Duck hepatit B virusu Vertebralılar Parsiyel (eksik) çift iplikli sirküler DNA taşır Genom 3200 nt (3.2 kb) büyüklüğünde. Revers transcriptase enzimi var. 4 ayrı ORF kodluyor (S, C, P ve X). HBV

3 HBV genotiplerinde filogenetik ağaç; tüm genom sekans uzunluğuna göre (A - H). Ülkemizde genotip D predominant, D1 en sık görülen subgenotiptir. HBV, muhtemelen ~ yıl önce insanlarla birlikte evrilmeye başladı. Zakim and Boyer's Hepatology (6th Ed.) 2012, P Ma Y, et al. Virol J 2011; 8: 315. Allain J-P, et al., Biologicals (2011); doi: /j

4 HBV genotip/subgenotiplerinin küresel dağılımı HBV genotiplerinin predominant olduğu bölgelerde (örn; Türkiye) epidemiyolojik ve/veya klinik surveyans subgenotipler ile yapılabilir.

5 HBV partiküllerinin elektron mikroskobik görüntüsü. (1) Dane partikülü (2) Flamentöz partikül (3) Sferik partikül Dane partikülü; "covalently closed circular " ccc DNA içerir. Universitats Klinikum Heidelberg moleküler biyoloji ders notlarından adapte edilmiştir.

6 cccdna ve pgrna, HBV yaşam döngüsünde stratejik merkezdedir. HBV nin yaşam döngüsü Dandri M, et al. Gut 2012;61(Suppl 1):i6ei17.

7 HBV replikasyonu Oral antiviraller HBV replikasyonunda farklı basamakları hedefler. Gish R, et al. Lancet Infect Dis 2012;12:

8 Mutasyon sıklığı: ökaryot/virus kıyaslama Subsitutsiyon/bölge/yıl Mutasyon/genom/ replikasyon siklusu Ökaryot Bakteriler ve DNA virusları RNA ve ssdna virusları Richman D. EASL HBV-HCV resistance monothematic meeting. February 14 16, Paris, France.

9 Neden HBV de varyantlar ve/veya türümsüler* oluşmaktadır. Bir kronik HBV taşıyıcısında hergün virion üretilip atılmaktadır. Dolaşımdaki HBV konsantrasyonu: virion/ml dir. Bayesian kestirimine göre HBV genomunda 1/ nükleotidlik (subsitutsiyon/bölge/yıl) değişim olmaktadır. Bu yüksek subsitutsiyon sıklığının anlamı HBV genomundaki her bir nükleotidin her gün değişebileceğidir. *quasispecies Doğal gelişen mutant varyantlar, ilaç direnci oluşturabilir. Locarnini S, et al. Clinics in Liver Diseases. 2010; 14(3):

10 Viral varyantlar KC de arşivlenir. KC Viral quasispecies (türümsüler) Ana populasyon Minör varyantlar Dirençli varyantlar cccdna varyantları cccdna: HBV nin normal replikasyon döngüsü ve üretimi Yeni virus üretiminde kalıp görevi Dirençli varyantların arşivlenmesi Kan dolaşımı Zoulim F & Perillo R. J Hepatol. 2008;48:S2-S19.

11 Hedeflenen HBV varyantlarına uygun analiz metodları seçilmelidir. HBV varyantlarında populasyon büyüklüğü; *major (>%10) *intermediate (>%5) *minor (<%1) farklı analiz metodları gerektirir. Chevaliez S, et al. Gastroeneterology 2012;142(6):

12 HBV genom organizasyonu ve ORF lerin çakışması. Kao JH. Korean J Intern Med 2011;26:255 HBV'nin genom organizasyonu adapte edilmiştir. pol/s geni çakışması oral antiviral tedavide sorun yaratırken analizlerde kolaylık sağlar.

13 HBV varyantlarının oluşturduğu mutasyonlar farklı klinik sonuçlar üretir. Gen bölgesi Mutasyon Moleküler sonuçları Klinik anlamı Pre-S + S Büyük S proteini promotor S çakışması Yetersiz viral toplanma B ve T lenfosit epitoplarında değişiklik Kolestatik fibrozis Kaçış mutasyonlarının oluşumu; Tanı testlerinden, Aşıdan, HBIg den Bağışık yanıttan kaçış. Pre-C Pre-C stop HBeAg kaybı HBeAg negatif şiddetli hepatit Kor RT/pol Fonksiyonel elementler Kor Pol Kor promotor T lenfosit epitoplarında değişiklik Yetersiz replikasyon Nükleoz(t)id analoglarına direnç Artmış replikasyon ve kor ekspresyonu Azalmış HBeAg sentezi Kronik şiddetli hepatit Viral latensi ve kronikleşme Tedavi başarısızlığı Şiddetli hepatit, ilaç direncinin modülasyonu HBeAg seronegatifliği En-1 Azalmış replikasyon Kronik hepatit Baumert TF, et al. World J Gastroenterol 2007; 13(1): 82-90

14 HBsAg kaçış mutasyonları; tanı testlerinden, aşıdan, HBIg den ve bağışık yanıttan kaçış. Mutant HBsAg yi yakalama çabaları gelişme göstermektedir. Lou SC. J Clin Virol 2011,15(1):59 63

15 Ülkemizde kronik B hepatitli hastalarda saptanan tipik HBsAg kaçış mutasyonları. Mutasyon kategorisi Mutasyon paterni Kombine paternler HBIg kaçağı mutasyon Aşı kaçağı mutasyon Hepatit B yanlış tanı mutasyonu İmmun sistem kaçağı mutasyon st118a/r, sp120k/q/t, st123a, sc124g, sq129r, sm133l, sy134n, sd144e, sg145e/k/r sp120s, st126i, sm133l, ss143l, sd144e, sg145r, ss193l sp120s/t, st123a, st131i, sm133l, sm133t, ss143l, sg145r sy100c/s, sq101h/r, sp105a/r, sl109r, si110l, ss114a/t, ss117g/n, sg119i/r/v, sp120t, st123a/d/n, sp127t, sa128v, sg130e/k/r, st131n, ss132c/p, sy134f, st140i, ss143t, sd144e, sg145r st118r + sg145e/k/r ss143l+ sg145r - sy100c + ss117g + sg119i/r/v + sp120k/q/t + st123a/d/n sp105a + sy134f sp127t + ss143t sy100s + sp105r + sa128v + sg130e/k/r sy100c + sq101h + si110l st131n + st140i ss114a/t + ss132c Sayan M, et al. Jap J Infect Dis 2012; 65(6):

16 Antiviral drug-associated potential vaccine-escape mutant: ADAPVEM Oral antiviral tedavilerle HBsAg yi kodlayan bölgenin tamamı ilgi alanımıza girdi. AASLD 2008

17 yıllarını kapsayan ve toplam 442 hastadan oluşan çalışma 7 tip ADAPVEM motifi saptandı Saptanan ADAPVEM ler lamivudin, telbivudin ve adefovir ile ilişkili. ADAPVEM prevalansı; %10 (46/442) Tedavi alanlarda; 24% (44/186) Tedavi naiflerde; 0.7% (2/256)

18 Sayan M., et al. Jap J Infect Dis 2012;65: ,

19 HBeAg negatif saptanan kronik hepatit B'li hastalar HBV DNA negatif hale gelir mi? Gen bölgesi Mutasyon Moleküler sonuçları Klinik anlamı Pre-C Pre-C stop HBeAg kaybı HBeAg negatif şiddetli hepatit Kor Kor T lenfosit epitoplarında değişiklik Kronik şiddetli hepatit Bu profildeki hastalar pre-kor/kor promotor mutasyonları taşıyabilir: -En sık karşılaşılan; A/T ve G/A mutasyonlarıdır. pre-c gen bölgesinin sonunda stop kodon oluşur ve HBeAg prekürsörü olan pre-c/c füzyon proteini sentezlenemez. Bu hastalarda anti-hbe serokonversiyonu gelişse bile viral replikasyon süregen bir halde devam eder. Pre-kor stop kodon mutantları sıklıkla; -Fulminan hepatit ve kronik aktif hepatit B de gözlenmektedir. -Asemptomatik taşıyıcılar ve akut -kendiliğinden sonlanan hepatitlerde de gözlenmiştir. Hepatology (www.hepatologytextbook.com). Baumert TF, et al. World J Gastroenterol 2007; 13(1): Kao JH. Korean J Intern Med 2011; 26:

20 Kronik hepatit B progresyonunda etkili olan faktörler vardır. HBV genotip E ve C daha enfeksiyözdür, bu genotiplerle kronikleşme ve KC kanseri riski daha fazladır.

21 Hepatit B nin patogenezinde esas yıkımı konağın bağışıklık sistemi yaratır. Baumert TF, et al. World J Gastroenterol 2007; 13(1): 82-90

22 Kronik HBV de antiviral tedavi, HCC ye gidişi kolaylaştırabilir mi? pol geninde rta181t mutasyonu (LAM ve ADV tedavisinde oluşur); S geninde sw172* (stop kodon) mutasyonunu ortaya çıkarır. S proteini bölünür, sekretuar defekt gelişir. Hücrede stres ve hasar başlar. Warner N, Locarnini S. Antiviral Therapy 2009; 14:

23 rta181t / sw172* mutantları hepatosit içerisinde birikir. Anti - S immunohistokimyasal boyama (kahverengi)/hücre nükleusları (mavi) Hepatosit içerisinde transaktivasyon Warner N, Locarnini S. Antiviral Therapy 2009; 14:

24 14002 no lu hasta Tedavi öncesinde Erkek/30y. HBeAg (+) ALT:308 U/L HBV DNA: IU/ml İ.Ü. Tıp Fakültesinde takip ediliyor. Direkt sekanslama A181T / sw172* pozitif (primer LAM ve ADV direnci) Klonlama A181T / sw172* pozitif (primer LAM ve ADV direnci)

25 Tenofovir tedavisi başladıktan sonra; 1.ay Identifier: AA no lu örnek Genotype: D Subgenotype: D1 (similarity to subgenotype profile = 98.68%) Included RT domain codons: Included SHB protein codons: Mutations RT domain: Mutations SHB protein: (similarity to reference = 97.84%) (similarity to reference = 98.82%) S116P, H124Y, Y135S, L217LP, N248H, Q267L T127P, L216*

26 3.ay Identifier: Genotype: AA no lu örnek D Subgenotype: D1 (similarity to subgenotype profile = 97.68%) Included RT domain codons: Included SHB protein codons: Mutations RT domain: Mutations SHB protein: (similarity to reference = 96.89%) (similarity to reference = 96.62%) L91I, L93V, S116P, H124Y, Y135S, A181T, N248H, Q267L T127P, S171FS, W172*, P188HP, L209*L

27 6.ay Identifier: Genotype: AA no lu örnek D Subgenotype: D1 (similarity to subgenotype profile = 98.34%) Included RT domain codons: Included SHB protein codons: Mutations RT domain: Mutations SHB protein: (similarity to reference = 97.3%) (similarity to reference = 98%) S116P, H124Y, Q130*Q, Y135S, A181T, N248H, Q267L T127P, S171F, W172*

28 12.ay Identifier: Genotype: AA no lu örnek D Subgenotype: D1 (similarity to subgenotype profile = 98.05%) Included RT domain codons: Included SHB protein codons: Mutations RT domain: Mutations SHB protein: (similarity to reference = 97.34%) (similarity to reference = 98.71%) L91I, N118D, N131D, Y135S, Q215S, N248H, M309K T127P, S207R

29 HBV ilaç direncinde In/del analizinin önemi H.Y. 22 yaş/kadın/istanbul LAM +TDF kombinasyon tedavisinde HBV viral yük: IU/ml HBeAg: pozitif ALT/AST: 124/85 U/L Biyopsi: HAİ: 3, Fibrozis:3 HBV genotip: D HBV subgenotip: D1 HBV rekombinasyon: yok In/del: pozitif Polimeraz geni mutasyonu: A194X HBsAg geni mutasyonu: yok Adapvem: negatif Hastanın HBV pol geni rt domaininde 24 bazlık bir delesyon saptandı. Delesyonlu virüs populasyonu tahminen % 20 civarında. Delesyona uğrayan nükleotid dizisi: TCTAATTCCAGGATCTTCAACCAC Silinen aminoasitler: STSRNINY Silinen aminoasitler, pol geni mutasyonlarını içermediği için in/del etkisiz.

30 In/del analizi Genom üzerinde insersiyonun tanımlanması ve klinik önemi

31 Soru Cevap

HBV de Direnç ve Türkiye Sonuçları. Doç. Dr. Murat Sayan Kocaeli Üniv. Araşt. ve Uyg. Hast., Merkez Lab., PCR Birim Sorumlusu Öğr. Üyesi.

HBV de Direnç ve Türkiye Sonuçları. Doç. Dr. Murat Sayan Kocaeli Üniv. Araşt. ve Uyg. Hast., Merkez Lab., PCR Birim Sorumlusu Öğr. Üyesi. HBV de Direnç ve Türkiye Sonuçları. Doç. Dr. Murat Sayan Kocaeli Üniv. Araşt. ve Uyg. Hast., Merkez Lab., PCR Birim Sorumlusu Öğr. Üyesi. 1. L-Nucleoside lamivudin (LAM) emtrisitabin (FTC) telbivudin (LdT)


Kronik Hepatit B li Hastanın Güncel Tedavisi

Kronik Hepatit B li Hastanın Güncel Tedavisi Kronik Hepatit B li Hastanın Güncel Tedavisi Prof. Dr. Reşat Özaras İstanbul Üniversitesi, Cerrahpaşa Tıp Fakültesi, Enfeksiyon AD. rozaras@yahoo.com Genel Bakış HBV Enfeksiyonunda Neredeyiz? Eradikasyon


KRONİK HEPATİT B (Olgu Sunumu) Dr. İlkay Karaoğlan Gaziantep Ün. Tıp Fakültesi Enfeksiyon Hst. Ve Kl. Mik. AD.

KRONİK HEPATİT B (Olgu Sunumu) Dr. İlkay Karaoğlan Gaziantep Ün. Tıp Fakültesi Enfeksiyon Hst. Ve Kl. Mik. AD. KRONİK HEPATİT B (Olgu Sunumu) Dr. İlkay Karaoğlan Gaziantep Ün. Tıp Fakültesi Enfeksiyon Hst. Ve Kl. Mik. AD. Kasım-1999 HK 41 yaş, erkek Öğretmen Gaziantep Yakınması: Yok Bir yıl önce tesadüfen HBsAg


Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi



KRONİK BÖBREK HASTASINDA (HBV) TEDAVİ PROTOKOLU NASIL OLMALIDIR? KRONİK BÖBREK HASTASINDA (HBV) TEDAVİ PROTOKOLU NASIL OLMALIDIR? Dr. Ziya Kuruüzüm DEÜTF Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD 07.09.2013, UVHS, Güral Sapanca Otel, Sakarya Kronik böbrek hastası


Kronik Hepatit B Tedavisinde Güncel Durum

Kronik Hepatit B Tedavisinde Güncel Durum Kronik Hepatit B Tedavisinde Güncel Durum Dr.Tansu Yamazhan Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji İZMİR İçerik Neden başaramıyoruz? Yeni etkili ilaç? Yeni tedavi


Kronik Hepatit B li Hastanın Güncel Tedavisi. Dr. Yaşar BAYINDIR Malatya-2013

Kronik Hepatit B li Hastanın Güncel Tedavisi. Dr. Yaşar BAYINDIR Malatya-2013 Kronik Hepatit B li Hastanın Güncel Tedavisi Dr. Yaşar BAYINDIR Malatya-2013 Hepatit B ve İnsan 16. yy, Kore de Joseon Hanedanlığı ndan bir çocuk mumyası HBV genotip C2 3.000-100.000 yıl öncesine ait,


Hepatit B Hasta Takibi Nasıl Yapılmalı?

Hepatit B Hasta Takibi Nasıl Yapılmalı? Hepatit B Hasta Takibi Nasıl Yapılmalı? Yrd. Doç. Dr. Kaya Süer Yakın Doğu Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Sunum Planı Giriş HBsAg Pozitifliği Kronik Hepatit





KRONİK HEPATİT B DE GÜNCEL TEDAVİ. Doç.Dr.Beytullah YILDIRIM Ondokuz Mayıs Üniversitesi Tıp Fakültesi Gastroenteroloji Bilim Dalı

KRONİK HEPATİT B DE GÜNCEL TEDAVİ. Doç.Dr.Beytullah YILDIRIM Ondokuz Mayıs Üniversitesi Tıp Fakültesi Gastroenteroloji Bilim Dalı KRONİK HEPATİT B DE GÜNCEL TEDAVİ Doç.Dr.Beytullah YILDIRIM Ondokuz Mayıs Üniversitesi Tıp Fakültesi Gastroenteroloji Bilim Dalı SUNUM PLANI: Genel Bilgiler Tedavide 2012 EASL Önerileri Tedavide kullanılan





Kronik Hepatit B Tedavisinde Zor Vakaların Yönetimi. Uz. Dr. Eyüp Arslan

Kronik Hepatit B Tedavisinde Zor Vakaların Yönetimi. Uz. Dr. Eyüp Arslan Kronik Hepatit B Tedavisinde Zor Vakaların Yönetimi Uz. Dr. Eyüp Arslan Vaka N.T, 68 Y, Erkek, Batman 10.11.1999 yılında HBs Ag pozitifliği DM ve diyabetik nefropati 15 yıldır DM, oral anti-diyabetik BUN;


Kronik Hepatitlerin serolojik ve moleküler tanısı Doç. Dr. Kenan Midilli

Kronik Hepatitlerin serolojik ve moleküler tanısı Doç. Dr. Kenan Midilli Kronik Hepatitlerin serolojik ve moleküler tanısı Doç. Dr. Kenan Midilli İÜ Cerrahpaşa Tıp Fakültei Tıbbi Mikrobiyoloji Anabilim Dalı Hepadnaviridae ailesi Orthohepadnavirus cinsi semisirküler (relaxed),


HBV Reaktivasyonunda Rehber Önerileri

HBV Reaktivasyonunda Rehber Önerileri HBV Reaktivasyonunda Rehber Önerileri Dr. Orhan YILDIZ Erciyes Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D. e-mail: oyildiz@erciyes.edu.tr Lok AS, et al. Hepatology.


Kronik Hepatit B Tedavisi Zor Olgular

Kronik Hepatit B Tedavisi Zor Olgular Kronik Hepatit B Tedavisi Zor Olgular Dr. Faruk KARAKEÇİLİ Erzincan Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı 22.01.2016 HATAY Tedavisi Zor Olgular! Zor hasta





Olgularla Hepatit B tedavisi. Uz.Dr. Alpay Arı İzmir Bozyaka Eğitim ve araştırma Hastanesi

Olgularla Hepatit B tedavisi. Uz.Dr. Alpay Arı İzmir Bozyaka Eğitim ve araştırma Hastanesi Olgularla Hepatit B tedavisi Uz.Dr. Alpay Arı İzmir Bozyaka Eğitim ve araştırma Hastanesi Sunum içeriği Hepatit B tedavisi Ulusal ve uluslar arası kılavuzlar S.U.T sorunları Olgular Sorunlu olgu gurubu


Yrd.Doç.Dr. Özgür Günal Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

Yrd.Doç.Dr. Özgür Günal Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Yrd.Doç.Dr. Özgür Günal Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD HÇ, 28 yş, E, Memur 2010 yılı ocak ayında kan bağışı sırasında sarılık olduğu söyleniyor. Başvuru sırasında bazen halsizlik ve


GEBELERDE KRONİK HEPATİT B TEDAVİSİ. Doç. Dr. Sabahattin Ocak Mustafa Kemal Üniversitesi Enfeksiyon Hastalıkları AD

GEBELERDE KRONİK HEPATİT B TEDAVİSİ. Doç. Dr. Sabahattin Ocak Mustafa Kemal Üniversitesi Enfeksiyon Hastalıkları AD GEBELERDE KRONİK HEPATİT B TEDAVİSİ Doç. Dr. Sabahattin Ocak Mustafa Kemal Üniversitesi Enfeksiyon Hastalıkları AD Dünyada 350-400 milyon insan hepatit B virüsü ile enfektedir Dünyadaki kadınların yaklaşık


Dünyada 350 milyonun üzerindeki hepatit B taşıyıcısının %50 sinden fazlasında infeksiyon perinatal yolla kazanılmıştır.

Dünyada 350 milyonun üzerindeki hepatit B taşıyıcısının %50 sinden fazlasında infeksiyon perinatal yolla kazanılmıştır. GİRİŞ Dünyada 350 milyonun üzerindeki hepatit B taşıyıcısının %50 sinden fazlasında infeksiyon perinatal yolla kazanılmıştır. HBeAg pozitif annelerden bebeğe bulaş oranı % 90 dır. Perinatal olarak kazanılan


Kronik Viral Enfeksiyonlarda Tanı ve Tedavi İzlemi

Kronik Viral Enfeksiyonlarda Tanı ve Tedavi İzlemi Kronik Viral Enfeksiyonlarda Tanı ve Tedavi İzlemi Viral hepatitler: Klinisyen gözüyle Ulus Akarca 2nci Ulusal Klinik Mikrobiyoloji Kongresi 12 Kasım 2013 Belek-ANTALYA Viral Hepatitler ve Laboratuvar


HBV-HCV TRANSPLANTASYON. Dr Sevgi Şahin Özel Gaziosmanpaşa Hastanesi

HBV-HCV TRANSPLANTASYON. Dr Sevgi Şahin Özel Gaziosmanpaşa Hastanesi HBV-HCV TRANSPLANTASYON Dr Sevgi Şahin Özel Gaziosmanpaşa Hastanesi HBV infeksiyonu ve HD HBV infeksiyonu insidansı agresif aşılama politikaları ile azalmıştır A.B.D: %1 seropozitif HBV TÜRKİYE: %3.9-4.8


Potent Antivirallere Kısmi Yanıtlı Olgular. Fatime Korkmaz Konya Eğitim Araştırma Hastanesi

Potent Antivirallere Kısmi Yanıtlı Olgular. Fatime Korkmaz Konya Eğitim Araştırma Hastanesi Potent Antivirallere Kısmi Yanıtlı Olgular Fatime Korkmaz Konya Eğitim Araştırma Hastanesi Kr Hepatit B de tedavi amacı Siroz, hepatosellüler kanser ve karaciğer yetmezliği gibi uzun dönem komplikasyonları


HBV ve HCV Moleküler Tanı. Dr. Cafer Eroğlu Ondokuz Mayıs Üniversitesi Tıp Fakültesi

HBV ve HCV Moleküler Tanı. Dr. Cafer Eroğlu Ondokuz Mayıs Üniversitesi Tıp Fakültesi HBV ve HCV Moleküler Tanı Dr. Cafer Eroğlu Ondokuz Mayıs Üniversitesi Tıp Fakültesi HBV ve HCV de Moleküler Tanı Kültür Ǿ, Hayvan modelleri, mutasyon oranı HBV DNA veya HCV RNA sının gösterilmesi için


OLGU. 8.FEN SİMPOZYUMU Ankara 22 Şubat 2008

OLGU. 8.FEN SİMPOZYUMU Ankara 22 Şubat 2008 OLGU 8.FEN SİMPOZYUMU Ankara 22 Şubat 2008 OLGU 35 yaşında erkek hasta 2002 yılında Non-Hodgkin Lenfoma ( Diffüz büyük B hücreli ) CHOP verilmiş ( Adana dışında) 2006 tekrar KT için Ç.Ü.T.F. Onkoloji geliyor.


Dirençli (Zor) Olgularda Hepatit B Tedavisi. Doç.Dr. Mustafa Kemal ÇELEN Dicle Üniversitesi

Dirençli (Zor) Olgularda Hepatit B Tedavisi. Doç.Dr. Mustafa Kemal ÇELEN Dicle Üniversitesi Dirençli (Zor) Olgularda Hepatit B Tedavisi Doç.Dr. Mustafa Kemal ÇELEN Dicle Üniversitesi ZOR VİRÜS Dirençli (HBV) Virüs Etkili Viral Baskılama Asıl Amaç Tam olmayan viral baskılama istenmeyen uzun-dönem


Uzm. Dr. Cahide Saçlıgil Kartal Yavuz Selim Devlet Hastanesi

Uzm. Dr. Cahide Saçlıgil Kartal Yavuz Selim Devlet Hastanesi Uzm. Dr. Cahide Saçlıgil Kartal Yavuz Selim Devlet Hastanesi Birçok hasta Hepatit B infeksiyonundan iyileşir ve Anti-HBs geliştirir gibi görünür. Kronik taşıyıcılarda HBsAg ( + ) fakat AntiHBs genellikle





Akut Hepatit C Tedavisi. Dr. Dilara İnan Akdeniz ÜTF, İnfeksiyon Hastalıkları ve Kl. Mikr AD, Antalya

Akut Hepatit C Tedavisi. Dr. Dilara İnan Akdeniz ÜTF, İnfeksiyon Hastalıkları ve Kl. Mikr AD, Antalya Akut Hepatit C Tedavisi Dr. Dilara İnan Akdeniz ÜTF, İnfeksiyon Hastalıkları ve Kl. Mikr AD, Antalya HCV DSÖ verilerine göre tüm dünya nüfusunun %3 ü (yaklaşık 170 milyon kişi) HCV ile infekte. İnsidans;


Gebelikte Tespit Edilen HBV İnfeksiyonunda Yaklaşım

Gebelikte Tespit Edilen HBV İnfeksiyonunda Yaklaşım Gebelikte Tespit Edilen HBV İnfeksiyonunda Yaklaşım Dr. Celal AYAZ Dicle üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı /DİYARBAKIR Annede kronik hepatit B mevcut


Uz. Dr. Ali ASAN Şevket Yılmaz Eğitim ve Araştırma Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Kliniği

Uz. Dr. Ali ASAN Şevket Yılmaz Eğitim ve Araştırma Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Kliniği Uz. Dr. Ali ASAN Şevket Yılmaz Eğitim ve Araştırma Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Kliniği HBV Tedavisinin Gelişimi LVD ADV ETV TDF 1992 2002 2007 1999 2003 2005 2008 IFN PegIFN



ÖZEL VAKALARDA KRONİK B HEPATİT TEDAVİSİ. Uzm.Dr. Saadet Yazıcı ÖZEL VAKALARDA KRONİK B HEPATİT TEDAVİSİ Uzm.Dr. Saadet Yazıcı SİROZ(KOMPANSE -DEKOMPANSE) OLGULARDA TEDAVİ Karaciğer sirozunun en önemli nedenlerinden biri HBV dır. Ölüm genellikle k.c yetmezliği, HCC,



KRONİK HEPATİT B TEDAVİSİNDE GÜNCEL DURUM ANKEM Derg 2011;25(Ek 2):234-237 KRONİK HEPATİT B TEDAVİSİNDE GÜNCEL DURUM Tansu YAMAZHAN Ege Üniversitesi Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı, İZMİR tansu.yamazhan@ege.edu.tr


Tedavi Naif Kronik Hepatit B Olgularında Bazal Antiviral Direncin Araştırılması*

Tedavi Naif Kronik Hepatit B Olgularında Bazal Antiviral Direncin Araştırılması* Özgün Çalışma/Original Article Mikrobiyol Bul 2013; 47(4): 628-635 Tedavi Naif Kronik Hepatit B Olgularında Bazal Antiviral Direncin Araştırılması* Investigation of Baseline Antiviral Resistance in Treatment-Naive



HEPATOTROPİK OLANLAR A, B, C, D, E, G F????? DİĞERLERİ HSV CMV EBV VZV HIV RUBELLA ADENOVİRÜS HEPATOTROPİK OLANLAR A, B, C, D, E, G F????? DİĞERLERİ HSV CMV EBV VZV HIV RUBELLA ADENOVİRÜS.. HGV hariç (hafif hastalık veya hastalık yok) diğerleri benzer klinik tablo oluşturur. HBV DNA virüsü, diğerleri


HBV ve Gebelik. Piratvisuth T. Optimal management of HBV during pregnancy. Liver International 2013; 188-194.

HBV ve Gebelik. Piratvisuth T. Optimal management of HBV during pregnancy. Liver International 2013; 188-194. Uz. Dr. Ali ASAN HBV ve Gebelik Dünyada 350-400 milyon kişi hepatit B ile kronik olarak infekte Bunların yaklaşık %50 si infeksiyonu perinatal yolla alıyor Doğurganlık yaşındaki kadınlar HBV bulaşı açısından





KRONİK HEPATİT B DE KİME TEDAVİ? Dr. Fatih ALBAYRAK Atatürk Üniversitesi Tıp Fakültesi Gastroenteroloji Bilim Dalı

KRONİK HEPATİT B DE KİME TEDAVİ? Dr. Fatih ALBAYRAK Atatürk Üniversitesi Tıp Fakültesi Gastroenteroloji Bilim Dalı KRONİK HEPATİT B DE KİME TEDAVİ? Dr. Fatih ALBAYRAK Atatürk Üniversitesi Tıp Fakültesi Gastroenteroloji Bilim Dalı HBV Epidemiyolojisi Dünya nüfusunun üçte biri (>2 milyar) seropozitif (geçirilmiş/kronik


Uzm. Dr. Burcu Uysal Ahi Evran Üniversitesi Eğitim ve Araştırma Hastanesi Kırşehir

Uzm. Dr. Burcu Uysal Ahi Evran Üniversitesi Eğitim ve Araştırma Hastanesi Kırşehir Uzm. Dr. Burcu Uysal Ahi Evran Üniversitesi Eğitim ve Araştırma Hastanesi Kırşehir Tanım Sadece anti-hbc IgG nin saptanması Virusla karşılaşmayı gösteren en duyarlı gösterge En çok görülen olağan dışı


Küresel koenfeksiyon durumu (milyon)

Küresel koenfeksiyon durumu (milyon) Küresel koenfeksiyon durumu (milyon) HIV + HCV HIV + HBV Soriano V. Antiviral Research 2010; 85(1): 303-315 Mutasyon sıklığı: ökaryot/virus kıyaslama Subsitutsiyon/bölge/yıl Mutasyon/genom/ replikasyon





Dr. Funda Şimşek SB Okmeydanı EAH Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji

Dr. Funda Şimşek SB Okmeydanı EAH Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Dr. Funda Şimşek SB Okmeydanı EAH Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Sunum Kapsamı HCV tanımı HCV enfeksiyonunun seyri Epidemiyoloji HCV genotiplerinin önemi, dağılımı Laboratuvarımızdaki



SUT HEPATİTLERİ NASIL TEDAVİ EDİYOR? SUT HEPATİTLERİ NASIL TEDAVİ EDİYOR? Dr. Bahar ÖRMEN İzmir Katip Çelebi Üniversitesi Atatürk Eğitim ve Araştırma Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Kliniği Kronik Hepatitlerde Tedavinin



HIV ENFEKSİYONUNUN PATOFİZYOLOJİSİ VE DOĞAL SEYRİ HIV ENFEKSİYONUNUN PATOFİZYOLOJİSİ VE DOĞAL SEYRİ Dr. Hayat Kumbasar Karaosmanoğlu Haseki Eğitim ve Araştırma Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Sunum Planı HIV in morfolojik ve


KRONİK HEPATİT B ve REAKTİVASYON. Dr.Hüsnü PULLUKÇU Ege ÜTF Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

KRONİK HEPATİT B ve REAKTİVASYON. Dr.Hüsnü PULLUKÇU Ege ÜTF Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD KRONİK HEPATİT B ve REAKTİVASYON Dr.Hüsnü PULLUKÇU Ege ÜTF Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD HEPATİT B DNA Virüsü Hepatit B enfeksiyonu dünyanın her bölgesinde görülen, özellikle kronik


Türkiye deki HIV Genotip Dağılımı ve İlaç Direnci Durumu

Türkiye deki HIV Genotip Dağılımı ve İlaç Direnci Durumu Türkiye deki HIV Genotip Dağılımı ve İlaç Direnci Durumu Doç.Dr.Murat Sayan Merkez Laboratuvarı PCR Birim Sorumlusu Öğretim Üyesi HIV/AIDS Sempozyumu 26-27 Kasım 2011 Antakya HIV genotipleme ve subtiplemede



HEPATİT B DE GÜNCEL LİTERATÜR HEPATİT B DE GÜNCEL LİTERATÜR Dr. Neşe DEMİRTÜRK Kocatepe Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. Afyonkarahisar. Çok merkezli; EUROSTAT bölgelerinden çift tabakalı



HEPATİT B İNFEKSİYONU. Dr. Bilgehan Aygen HEPATİT B İNFEKSİYONU Dr. Bilgehan Aygen Erciyes Üniversitesi, Tıp Fakültesi, Klinik Mikrobiyoloji ve İnfeksiyon y Hastalıkları Anabilim Dalı KAYSERİ Hepatit B virusu Kor protein HBc DNA DNA polimeraz


Hepatit B virusu Serolojik Tanı Yöntemleri ve Klinik Anlamları

Hepatit B virusu Serolojik Tanı Yöntemleri ve Klinik Anlamları Hepatit B virusu Serolojik Tanı Yöntemleri ve Klinik Anlamları Dr. Süda TEKİN KORUK Koç Üniversitesi Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Bölümü Neler konuşulacak? Hepatit B virusu





OLGU SUNUMU. Dr. Ziya Kuruüzüm. DEÜTF Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

OLGU SUNUMU. Dr. Ziya Kuruüzüm. DEÜTF Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD OLGU SUNUMU Dr. Ziya Kuruüzüm DEÜTF Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD VHÇG, Hepatit Kampı, Bolu, 01.03.2014 Olgu MŞ, 58 yaş, erkek, emekli Rutin yapılan tetkikler sırasında anti-hcv pozitif





Kronik Viral Hepatitler

Kronik Viral Hepatitler Kronik Viral Hepatitler Dr. M. Bülent Ertuğrul Adnan Menderes Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Kronik Viral Hepatitler HBV HDV HCV HEV?? Kronik HBV



VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Viroloji Ünitesi Viral Enfeksiyonlar... Klinik


Kronik Hepatit B: Tanı ve Tedavi

Kronik Hepatit B: Tanı ve Tedavi Kronik Hepatit B: Tanı ve Tedavi Dr. Orhan Yıldız Erciyes Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı, Kayseri Dünyada en sık ölüme neden olan 10 enfeksiyon



HEPATİT B İNFEKSİYONUNDA TANI VE TEDAVİ HEPATİT B İNFEKSİYONUNDA TANI VE TEDAVİ Kimler olası hepatit B enfeksiyonu yönünden incelenmelidir? Yüksek ve orta endemisiteye sahip bölgelerde doğan ve bu bölgelerden evlat edinilen kişiler, HBsAg pozitif



HEPATİT C TEDAVİSİNDE YENİLİKLER. Dr.Yunus Gürbüz HEPATİT C TEDAVİSİNDE YENİLİKLER Dr.Yunus Gürbüz Günümüzde hepatit C nin standart tedavisi pegileinterferon alfa 2A veya 2B ve ribavirin kombinasyonudur. Bu kombine tedaviyle elde edilen kalıcı viral yanıt(kvy)


Prof. Dr. Haluk ERAKSOY İstanbul Üniversitesi İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı

Prof. Dr. Haluk ERAKSOY İstanbul Üniversitesi İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Prof. Dr. Haluk ERAKSOY İstanbul Üniversitesi İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı HCV İnfeksiyonu Akut hepatit C Kronik hepatit C HCV İnfeksiyonu Akut Viral





Uzm. Dr. Altan GÖKGÖZ Mehmet Akif İnan Eğitim ve Araştırma Hastanesi Şanlıurfa

Uzm. Dr. Altan GÖKGÖZ Mehmet Akif İnan Eğitim ve Araştırma Hastanesi Şanlıurfa Uzm. Dr. Altan GÖKGÖZ Mehmet Akif İnan Eğitim ve Araştırma Hastanesi Şanlıurfa Olgunun asıl sahibi olan kişi Dr. Derya KETEN Necip Fazıl Şehir Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji



SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm


Bir Yıldan Uzun Süreli Antiviral İlaç Kullanan Kronik Hepatit B Hastalarında Direnç Mutasyonlarının Saptanması*

Bir Yıldan Uzun Süreli Antiviral İlaç Kullanan Kronik Hepatit B Hastalarında Direnç Mutasyonlarının Saptanması* Özgün Çalışma/Original Article Mikrobiyol Bul 2013; 47(3): 472-481 Bir Yıldan Uzun Süreli Antiviral İlaç Kullanan Kronik Hepatit B Hastalarında Direnç Mutasyonlarının Saptanması* Detection of Resistance


HEPATİT B EPİDEMİYOLOJİSİ. Prof. Dr. Tamer ŞANLIDAĞ Celal Bayar Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD MANİSA

HEPATİT B EPİDEMİYOLOJİSİ. Prof. Dr. Tamer ŞANLIDAĞ Celal Bayar Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD MANİSA HEPATİT B EPİDEMİYOLOJİSİ Prof. Dr. Tamer ŞANLIDAĞ Celal Bayar Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD MANİSA HBV ilk salgın Lurman (1885) 1883, Bremen Tersane işçileri (n=1289) Çiçek aşısı (vezikül


E. Ediz Tütüncü UVHS III 25 Mayıs 2013, Girne

E. Ediz Tütüncü UVHS III 25 Mayıs 2013, Girne E. Ediz Tütüncü UVHS III 25 Mayıs 2013, Girne - HBV immün sistem ilişkisi, - HCV immün sistem ilişkisi, - HBV-HCV ilişkisi, - HBV-HCV koinfekte hastaların yönetimi HBV - Hepadnaviridae, - 3.2 kb inkomplet


Tedavi Uyum. Alper Şener Onsekiz Mart Üniversitesi Tıp Fakültesi Çanakkale

Tedavi Uyum. Alper Şener Onsekiz Mart Üniversitesi Tıp Fakültesi Çanakkale Tedavi Uyum Alper Şener Onsekiz Mart Üniversitesi Tıp Fakültesi Çanakkale SGK SUT Güncellemeler ECZANE İlaç temini Sisteme kayıt Reçetenin muadille değişimi HASTA UYUM HEKİM Tedavi kararı Günlük aktivite


Kronik Hepatit B Hastalarının Beş Yıllık Tedavi Sonuçlarının Değerlendirilmesi

Kronik Hepatit B Hastalarının Beş Yıllık Tedavi Sonuçlarının Değerlendirilmesi 82 Özgün Araşt rma / Original Article Kronik Hepatit B Hastalarının Beş Yıllık Tedavi Sonuçlarının Değerlendirilmesi Evaluation of Treatment Results of Patients with Chronic Hepatitis B Followed for Five


Kronik Hepatit B de İnterferonlar

Kronik Hepatit B de İnterferonlar Kronik Hepatit B de İnterferonlar Dr.Saadet Yazıcı İstanbul Medeniyet Üniversitesi Göztepe Eğitim ve Araştırma Hastanesi Tedavinin başarısı Tedavinin Amacı Biyokimyasal iyileşme (ALT normalizasyonu) Virusun


Hepatit virüsleri. Hedef hücre: hepatositler

Hepatit virüsleri. Hedef hücre: hepatositler Hepatit virüsleri Hedef hücre: hepatositler Viral Hepatit Etkenleri 1. Dışkı-Ağız yoluyla bulaşan ve kronik hepatite yol açmayan HAV; HEV 2. Parenteral yoldan bulaşan ve kronik hepatite yol açan HBV; HCV;


Akut Ve Kronik HBV İnfeksiyonunda Doğal Seyir

Akut Ve Kronik HBV İnfeksiyonunda Doğal Seyir güncel gastroenteroloji 14/2 Akut Ve Kronik HBV İnfeksiyonunda Doğal Seyir Halil DEĞERTEKİN 1, Ali Kemal OĞUZ 2 Ufuk Üniversitesi Tıp Fakültesi, 1 Gastroenteroloji Bilim Dalı, 2 İç Hastalıkları Ana Bilim


T.C. Sağlık Bakanlığı. Haydarpaşa Numune Eğitim ve Araştırma Hastanesi. 2. İç Hastalıkları Kliniği. Şefi: Uzm. Dr. Refik DEMİRTUNÇ

T.C. Sağlık Bakanlığı. Haydarpaşa Numune Eğitim ve Araştırma Hastanesi. 2. İç Hastalıkları Kliniği. Şefi: Uzm. Dr. Refik DEMİRTUNÇ T.C. Sağlık Bakanlığı Haydarpaşa Numune Eğitim ve Araştırma Hastanesi 2. İç Hastalıkları Kliniği Şefi: Uzm. Dr. Refik DEMİRTUNÇ HEMODİYALİZ HASTALARINDA OKKULT HEPATİT B ENFEKSİYONU PREVELANSI İç Hastalıkları


J Popul Ther Clin Pharmacol 8:e257-e260;2011



Farklı Tedavilerle Başarısızlık Yaşanmış Kronik Hepatit B Olgusu. Dr. Deniz Özkaya Karşıyaka Devlet Hastanesi- İZMİR KLİMİK-2015

Farklı Tedavilerle Başarısızlık Yaşanmış Kronik Hepatit B Olgusu. Dr. Deniz Özkaya Karşıyaka Devlet Hastanesi- İZMİR KLİMİK-2015 Farklı Tedavilerle Başarısızlık Yaşanmış Kronik Hepatit B Olgusu Dr. Deniz Özkaya Karşıyaka Devlet Hastanesi- İZMİR KLİMİK-2015 Kronik Hepatit B Tedavisinde Tedavi Başarısını Etkileyen Faktörler Hasta



www.expasy.ch/viralzone/all_by_species/94.html Türkiye de hepatit virüslerinin moleküler epidemiyolojisi Dr Hakan Abacıoğlu XXXIV Türk Mikrobiyoloji Kongresi Kıbrıs Moleküler epidemiyoloji nedir? Hepatit virüslerinin moleküler epidemiyolojisi neden


Hepatit C Virusu (HCV) RNA Pozitif Olgularda Genotip Dağılımı

Hepatit C Virusu (HCV) RNA Pozitif Olgularda Genotip Dağılımı Kocatepe Tıp Dergisi The Medical Journal of Kocatepe 10: 21-24 / Ocak-Mayıs-Eylül 2009 Afyon Kocatepe Üniversitesi Hepatit C Virusu (HCV) RNA Pozitif Olgularda Genotip Dağılımı The Distribution Of Genotype


Kronik Hepatit B tedavisinde HBsAg klirensinin önemi

Kronik Hepatit B tedavisinde HBsAg klirensinin önemi Kronik Hepatit B tedavisinde HBsAg klirensinin önemi Prof. Dr. Hasan ÖZKAN Ankara Üniversitesi Tıp Fakültesi Gastroenteroloji Bilim Dalı HBV İmmun Cevabı Çift Tarafı Keskin Kılıç 2 1. Efektif immun cevap


Hepatit B tedavisinde uzun vade erekler. Prof. Dr. Hakan Bozkaya Liv Hospital Ankara Gastroenteroloji Bölümü

Hepatit B tedavisinde uzun vade erekler. Prof. Dr. Hakan Bozkaya Liv Hospital Ankara Gastroenteroloji Bölümü Hepatit B tedavisinde uzun vade erekler Prof. Dr. Hakan Bozkaya Liv Hospital Ankara Gastroenteroloji Bölümü SORUNUN BOYUTLARI 5 yıllık kümülatif siroz sıklığı %38 %17 Avrupa %8 Asya Avrupa %13 Asya HBeAg+



HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik





DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması


Kronik Hepatit C Tedavisinde Güncel Yaklaşımlar

Kronik Hepatit C Tedavisinde Güncel Yaklaşımlar Kronik Hepatit C Tedavisinde Güncel Yaklaşımlar Asıl Dr. Alpay alt başlık ARIstilini düzenlemek için tıklatın İzmir Bozyaka Eğitim ve Araştırma Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji


Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak


KRONİK B HEPATİTİ Elimizdeki Tedaviler ve Beklentiler

KRONİK B HEPATİTİ Elimizdeki Tedaviler ve Beklentiler 3. İstanbul Dahiliye Klinikleri buluşması 15-16 Kasım 2013 KRONİK B HEPATİTİ Elimizdeki Tedaviler ve Beklentiler Prof. Dr.Yılmaz Çakaloğlu Türk Karaciğer Vakfı Başkanı Memorial Hastanesi, Şişli İstanbul


Mersin İlinde Hepatit B Virus Genotip D ile Kronik Enfekte Hastalarda Bazal Kor Promotor/Prekor Gen Bölgesi Mutasyonlarının Karakterizasyonu*

Mersin İlinde Hepatit B Virus Genotip D ile Kronik Enfekte Hastalarda Bazal Kor Promotor/Prekor Gen Bölgesi Mutasyonlarının Karakterizasyonu* Özgün Çalışma/Original Article Mikrobiyol Bul 2015; 49(3): 377-392 Mersin İlinde Hepatit B Virus Genotip D ile Kronik Enfekte Hastalarda Bazal Kor Promotor/Prekor Gen Bölgesi Mutasyonlarının Karakterizasyonu*


SOLİT ORGAN TRANSPLANTASYONU ve BK VİRUS ENFEKSİYONLARI Doç. Dr. Derya Mutlu Güçlü immunsupresifler Akut, Kronik rejeksiyon Graft yaşam süresi? Eskiden bilinen veya yeni tanımlanan enfeksiyon etkenleri:



MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri


Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya


Olgu Sunumu (İmmünyetmezlikli hastada viral enfeksiyonlar) Dr. A. Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD

Olgu Sunumu (İmmünyetmezlikli hastada viral enfeksiyonlar) Dr. A. Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Olgu Sunumu (İmmünyetmezlikli hastada viral enfeksiyonlar) Dr. A. Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Olgu Dört ay önce eşinden böbrek nakli yapılan 62 yaşındaki


Hepatit Hastalığı Gebelikten Etkilenir mi?

Hepatit Hastalığı Gebelikten Etkilenir mi? GEBELİKTE HEPATİT Gebelik ve hepatit Gebelik ve hepatit iki ayrı durumu anlatır. Birincisi gebelik sırasında ortaya çıkan akut hepatit tablosu, ikincisi ise kronik hepatit hastasının gebe kalmasıdır. Her








Özet. Abstract. Erciyes Tıp Dergisi (Erciyes Medical Journal) 27 (1) 17-21, 2005 17

Özet. Abstract. Erciyes Tıp Dergisi (Erciyes Medical Journal) 27 (1) 17-21, 2005 17 Özbilge, ARAŞTIRMALAR Zeyrek, Uzala (Research Mızraklı, Reports) Tümkaya HEPATİT B VİRUS DNA POZİTİFLİĞİ VE SEROLOJİK TESTLER* DNA positivity of Hepatitis B virus and serological tests Hatice ÖZBİLGE 1,


HBV Reaktivasyonunda Güncel Durum. Dr. Süda TEKİN Koç Üniversitesi Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Bölümü

HBV Reaktivasyonunda Güncel Durum. Dr. Süda TEKİN Koç Üniversitesi Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Bölümü HBV Reaktivasyonunda Güncel Durum Dr. Süda TEKİN Koç Üniversitesi Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Bölümü Hepatit B: Gerçekler 350 milyon kronik hepatit B 2 milyar insan infekte








Kronik HCV İnfeksiyonlarında Güncel Tedavi Yaklaşımları Dr. Kaya Süer

Kronik HCV İnfeksiyonlarında Güncel Tedavi Yaklaşımları Dr. Kaya Süer Kronik HCV İnfeksiyonlarında Güncel Tedavi Yaklaşımları Dr. Kaya Süer Near East University Faculty of Medicine Infectious Diseases and Clinical Microbiology HCV tarihçesi 1989 Hepatitis C (HCV) genomu


Kronik Hepatitli Hastanın İzlemi ve Tedavi Kararı. Prof. Dr. Mustafa Sünbül OMU Tıp Fakültesi Samsun

Kronik Hepatitli Hastanın İzlemi ve Tedavi Kararı. Prof. Dr. Mustafa Sünbül OMU Tıp Fakültesi Samsun Kronik Hepatitli Hastanın İzlemi ve Tedavi Kararı Prof. Dr. Mustafa Sünbül OMU Tıp Fakültesi Samsun Sorular Kchastalığı tedaviden önce nasıl değerlendirilmelidir? Tedavide son hedef nedir? Yanıt nasıl





Kronik aktif hepatit B tanılı hastalarımızın tedavi yanıtlarının değerlendirilmesi

Kronik aktif hepatit B tanılı hastalarımızın tedavi yanıtlarının değerlendirilmesi ÖZGÜN ARAŞTIRMA Kronik aktif hepatit B tanılı hastalarımızın tedavi yanıtlarının değerlendirilmesi Assessment of treatment responses in patients with chronic active hepatitis B İbrahim BAŞARIR 1, Sevil


Onkolojide Sık Kullanılan Terimler. Yrd.Doç.Dr.Ümmügül Üyetürk 2013

Onkolojide Sık Kullanılan Terimler. Yrd.Doç.Dr.Ümmügül Üyetürk 2013 Onkolojide Sık Kullanılan Terimler Yrd.Doç.Dr.Ümmügül Üyetürk 2013 Kanser Hücrelerin aşırı kontrolsüz üretiminin, bu üretime uygun hücre kaybıyla dengelenemediği, giderek artan hücre kütlelerinin birikimi..


Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL
