Myeloproliferatif Hastalıklar ve Genetik

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Myeloproliferatif Hastalıklar ve Genetik"


1 Myeloproliferatif Hastalıklar ve Genetik Ajlan Tükün 5 Ekim 2013

2 Myeloproliferatif Hastalıklar (MPDs) Klonal myeloid hastalık grubu Bir hematopoetik kök hücrede genetik değişiklik Periferik kanda WBC, RBC ve trombosit (herhangi bir kombinasyonda) artışı 2

3 Hematopoetik Öncüller ve MPDs Genetik Mutasyon 3

4 MPD Sınıflaması Genellikle birden fazla hücre serisi etkilendiği için predominant hücre tipine göre adlandırılır Majör tipler: Diğer MPNs: 1. Kronik Myelositer Lösemi (KML) 1. Sistemik Mastositozis 2. Polisitemia Vera (PV) 2. Hipereozinofilik Sendrom 3. Esansiyel Trombositozis (ET) 3. Kronik Myelomonositer Lösemi 4. Primer Myelofibrozis (PMF) 4. Kronik Nötrofilik Lösemi 5. Kronik Eozinofilik Lösemi 4

5 Kronik Myelositer Lösemi (KML) 5

6 KML Etyopatogenez: Philadelphia Kromozomu 6

7 Bcr-Abl ve KML 7

8 Çoklu Kırık Noktaları: Bcr-Abl füzyon geni tipleri 8

9 BCR-ABL Füzyon Geni Ekspresyonunun Patolojik Sonuçları Tek başına Bcr-Abl geninin çalışması KML gelişimi için gerekli ve yeterlidir Clinical Science (2005) 109 9

10 10

11 GTP GDP GRB2 GAB1/2 SOS SHC BRA F KRAS p110 p85 MAPK MEK Akt mtor p21 GSK3 FKH R casp9 IKK Bad Kinaz Transkripsiyon PI3-K Hücre büyümesi IκB RTKlar: KIT PDGFR FGFR P JNK AP-1 STATs STATs STATs STATs P P P NF-κB Hücre yaşaması ERK ALK PTE N RET ETS? PTPN11 (SHP2)

12 KML de Tanı 12

13 KML Tanısı Sitogenetik İnceleme t(9;22)(q34;q11.2) Philadelphia kromozomu 1) Tanısal değer taşır 2) Optimal sonuç için kemik iliği aspirasyon materyalinde yapılmalıdır 3) Klonal gelişimin takibine ve ek kromozom anomalilerinin tanınmasına olanak sağlar 4) Ender de olsa kriptik ya da varyant kromozomal değişiklikler varlığında Ph kromozomu atlanabilir 13

14 KML Tanısı FISH BCR/ABL füzyon geni 1) Tanısal değer taşır 2) Optimal sonuç için kemik iliği aspirasyon materyaline gerek yoktur 3) Ph duplikasyonunun ve anormal 9. kromozom kaybının saptanmasına olanak sağlar 4) Anormal 9. kromozom kaybının saptanmasına olanak sağlar 5) Kriptik translokasyon varlığında Ph kromozomunun saptanmasına olanak sağlar 14

15 FISH ABL BCR Ch 9 Ch 22 BCR-ABL Kırmızı BCR probu Yeşil ABL probu Sarı BCR /ABL füzyonu 15

16 KML Tanısı Kantitatif RT-PCR BCR/ABL geni ürünü 1) Tanısal değer taşır 2) Optimal sonuç için kemik iliği aspirasyon High Concentration materyaline gerek yoktur Amount of Moderate Fluorescence Concentration 3) Hastalığın ölçümüne olanak veriri 4) Kriptik translokasyon varlığında Ph Low Concentration kromozomunun saptanmasına olanak sağlar 5) Farklı tip translokasyonlar için farklı primer setlerinin kullanılmasına gereksinim duyar PCR Cycle Number C T (~ ) C T (~ 2 8) 16

17 Monitörizasyonda eşik değerler Hastalık miktarı Hematolojik Yanıt Tam 1) Normal hücre sayısı (WBC < 10 ve Plt < 450) 1X X ) Normal WBC dağılımı 3) Hastalık semptomlarının kaybolması 4) Karaciğer ve dalak boyutunun normalizasyonu Sitogenetik Yanıt: Ph pozitif hücre oranı 1) tam: 0% 2) kısmi: 1% - 35% 1X ) minör: 36% - 65% 4) minimal: 66% - 95% 5) yok: 96% - 100% Moleküler Yanıt: Bcr-Abl/Abl oranı Majör Moleküler Yanıt Başlangıç örneğinden 3-log 10 azalma (örn: ) 1X

18 Continuous Clinical Remission (CCR): Kemik iliği konvansiyonel morfolojik değerlendirmesinde blast oranının %5 altında olması Minimal Residual Disease (MRD): Kullanılan konvansiyonel metodların saptama sınırının altında transforme hücre bulunan CCR

19 KML Tanı ve Monitörizasyon Test Hedef Materyal Duyarlılık (%) Kullanım Sitogenetik Ph kromozomu Kİ 1-10 KML tanısının konfirmasyonu Ph kromozomu dışındaki değişikliklerin de saptanması FISH bcr ve abl genlerinin kırık noktaları PK/Kİ KML tanısının konfirmasyonu Klinik stabil hastalarda sitogenetik yanıtın rutin monitörizasyonu Rutin MRD ölçümü RT-PCR bcr-abl mrna PK/Kİ Rutin MRD ölçümü Füzyon geninin kırık noktalarının tanımlanması 19

20 20

21 İmatinib 21

22 Kronik fazda KML hastalarına uygulandığında %80 e varan oranda komplet sitogenetik cevap (CCR) alınır.

23 İmatinib Direnci Primer direnç Erken kronik fazda %2 hastada hematolojik yanıt alınamaz %8-13 hastada majör veya komplet sitogenetik yanıt alınamaz Sekonder direnç BCR-ABL füzyon geninde tek nükloeotid yer değişimi ile kinaz reaktivasyonu 23

24 Dirence Yol Açan Değişiklikler BCR-ABL bağımsız Klonal gelişim Farklı genlerin etkileri (FIP1L1-PDGFRA füzyonu, ckit ve PDGFRA geni mutasyonları, vb.) 128 gen (apopitoz, DNA tamiri, oksidatif stresi azaltan, sentrozom) BCR-ABL bağımlı BCR-ABL kinaz mutasyonları Gen amplifikasyonu İlaç Atılımı-düşük intra sellüler konsantrasyon Plazmada bağlayan protein artışı/polimorfizm: α1-asit glikoprotein (A <F1-S) P-glikoprotein (ABCB1) 24

25 c-bcr c-abl SH3 SH2 Tyr kinase NLS DNA BD actin BD cgcaacaagcccactgtctatggtgtgtcccccaactacgacaagtgggagatggaacgcacggac M244V L248V G250E Y253F atcaccatgaagcacaagctgggcgggggccagtacggggaggtgtacgagggcgtgtggaaga aatacagcctgacggtggccgtgaagaccttgaaggaggacaccatggaggtggaagagttcttga Q252H E255K aagaagctgcagtcatgaaagagatcaaacaccctaacctggtgcagctccttggggtctgcacccg F311L T315I F317L G321E ggagcccccgttctatatcatcactgagttcatgacctacgggaacctcctggactacctgagggagtg caaccggcaggaggtgaacgccgtggtgctgctgtacatggccactcagatctcgtcagccatggagt M351T E355G gcacctggagaagaaaacttcatccacagagatcttgctgcccgaaactgcctggtaggggagaacc F359V acttggtgaaggtagctgattttggcctgagcaggttgatgacaggggacacctacacagcccatgctg gagccaagttccccatcaaatggactgcacccgagagcctggcctacaacaagttctccatcaagtcc gacgtctgggcatttggagtattgctttgggaaattgctacctatggcatgtccccttacccgggaattgac S417Y ctgtcccaggtgtatgagctgctagagaaggactaccgcatggagcgcccagaaggctgcccagag E459K aaggtctatgaactcatgcgagcatgttggcagtggaatccctctgaccggccctcctttgctgaaatcc F486S accaagcctttgaaacaatgttccaggaatccagtatctcagacgaagtgga

26 İmatinib ile füzyon genin ilişkisini bozan 50 den fazla ABL mutasyonu bilinmektedir Dirençli hastaların %30-80 inde direnç nedenidir 26

27 Bcr-Abl imatinib Mut. Bcr-Abl imatinib 27

28 Dirençli Hastalıkta Tedavi Seçenekleri 1) İmatinib doz eskalasyonu 2) Yeni nesil tirozin kinaz inhibitörleri 3) Kİ transplantasyonu 4) Deneysel klinik araştırmalar 28

29 Bcr-Abl imatinib Mut. Bcr-Abl imatinib Mut. Bcr-Abl dasatinib 29

30 Yeni Nesil Tirozin Kinaz İnhibitörleri KML tanısı alan ve imatinib tedavisi altında iken; relaps tedaviye dirençli intolerans FDA onaylı TKİs oral multi-kinaz inhibitör BCR/ABL füzyonu olan çoğu kinaz domain mutasyonlarına karşı etkili Dasatinib, Nilotinib 30

31 J Clin Oncol. 2009;27(3):

32 Polsitemia Vera (PV) Hematokrit> %48( ), %52( ) Hemoglobin >16.5 g/dl ( ), 18.5 g/dl ( ) Polisitemi şüphesi Absolut: primer, hipoksi, karboksihemoglobinemi, cushing s veya kortikosteroid, eritropoietin-salan tümörler Relatif: Plazma volümünde azalma (dehidrasyon, stres) 32

33 2008 WHO Diagnostic Criteria for Primary Polycythemia Vera Major Criteria 1) Hgb > 18.5g/dl ( ) or 16.5g/dl ( ) or Hgb or Hct > 99% or Hgb > 17g/dl ( ) or 15 g/dl ( ) and a documented increase of 2 g/dl or RBC mass > 25% of mean normal 2) Presence of a JAK2 V617F or similar mutation Minor Criteria 1) Bone marrow trilineage expansion 2) Subnormal EPO level 3) Endogenous erytyhroid colony growth two major or first major and two minor criteria 33

34 Esansiyel Trombositemi (ET) Trombosit sayısı > hc/μl Trombositozis Primer - kanama/pıhtılaşma direnci, genellikle neoplazm Sekonder - reaktif, genellikle asemptomatik 34

35 2008 WHO Diagnostic Criteria for Essential Thrombocytosis 1. Platelet count > 450, Megakaryocytic proliferation with large, mature morphology and with little granulocytic or erythroid expansion 3. Not meeting WHO criteria for CML, PV, PMF, MDS or other myeloid neoplasm 4. Demonstration of the JAK2V617F or other clonal marker or lack of evidence of a secondary (reactive thrombocytosis) 35

36 Primary Myelofibrosis (PMF) anemi, lökoeritroblastozis, Kİ biyopsisinde artmış fibrozis (retikülin ya da kollajen) 36

37 2008 WHO Diagnostic Criteria for Primary Myelofibrosis Major: 1. Megakaryocytic proliferation and atypia with either reticulin or collagen fibrosis or If no fibrosis, mekakaryocytic expansion must be assn. w/ increased BM cellularity 2. Does not meet WHO criteria for CML, PV, MDS, or other myeloid neoplasm 3. Demonstration of the JAK2 V617F mutation or other clonal marker or no other evidence of a reactive marrow fibrosis Minor: 1. Leukoerythroblastosis (immature RBCs and WBCs in the PB) 2. Increased LDH 3. Anemia 4. Splenomegaly Diagnosis of primary myelofibrosis (PMF) requires meeting all three major criteria and two minor criteria 37

38 JAK2 Mutasyonu: Üç farklı MPN da Nature Reviews Cancer 2007;7:

39 JAK2 aracılı sinyal iletimi 39

40 9p de lokalize Reseptör tirozin kinaz JAK2 Mutasyonları Psödokinaz bölgesindeki 617. pozisyonda valinin fenilalanine dönüşümü (V617F) reseptörün sürekli aktivasyonuna yol açar Edinsel somatik mutasyon PCV: %95 ET: %50 PMF: %50 JAK2 mutasyonlarının MPD için başlatıcı ve yeterli etki olmadığı ve daha erken bir genetik değişikliğin fenotipe neden olduğu düşünülmektedir. 40

41 MPD de JAK2 İnhibitörleri Ruxolitinib JAK1/JAK2 U.S. FDA 2011 de myelofibrozis için kullanımını onayladı Deneysel klinik araştırmaları sürdürülen: CYT387: MPDs Lestaurtinib: AML Pacritinib: Kronik İdyopatik Myelofibrozis TG101348: Myelofibrozis 41

42 42

43 43

44 teşekkürler 44

Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar

Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar 1945 ANKARA ÜNİVERSİTESİ TIP FAKÜLTESİ ÇOCUK SAĞLIĞI VE HASTALIKLARI Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar Dr. Talia İleri Ankara Üniversitesi Tıp Fakültesi Pediatrik Hematoloji


* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde

* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde GENETİK HASTALIKLAR TANI MERKEZİ TEST LİSTESİ * Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde yapılmakta olup


Kocaeli Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı. Hematoloji Bilim Dalı Olgu Sunumu. 20 Kasım 2014 Perşembe

Kocaeli Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı. Hematoloji Bilim Dalı Olgu Sunumu. 20 Kasım 2014 Perşembe Kocaeli Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı Hematoloji Bilim Dalı Olgu Sunumu 20 Kasım 2014 Perşembe SABAH TOPLANTISI Çocuk Hematoloji Bilim Dalı Y.O ; 16 yaş erkek hasta,


Kanser Tedavisi: Günümüz

Kanser Tedavisi: Günümüz KANSER TEDAVİSİNDE MOLEKÜLER HEDEFLER Doç. Dr. Işık G. YULUĞ Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Kanser Tedavisi: Günümüz Geleneksel sitotoksik ilaçlar ve


Flow Sitometrinin Malign Hematolojide Kullanımı. Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya

Flow Sitometrinin Malign Hematolojide Kullanımı. Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya Flow Sitometrinin Malign Hematolojide Kullanımı Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya Neyi ölçer? Hücre çapı, hacmi, yüzey alanı ve granülaritesini


KHDAK da Güncel Hedef Tedaviler

KHDAK da Güncel Hedef Tedaviler KHDAK da Güncel Hedef Tedaviler Prof.Dr. Adnan Aydıner İstanbul Üniversitesi Onkoloji Enstitüsü İstanbul William, WN et al. Nature Reviews, 2009 a Güncel Hedef Tedaviler EGFR İnhibitörleri EGFR: transmembran



ÜNİTE 19 KANSER VE GENETİK ÜNİTE 19 KANSER VE GENETİK Prof. Dr. Gönül OĞUR 19.1. Normal Hücre-Kanser İlişkisi Vücut hücreleri, konsepsiyonu (spermin ovumu döllemesi) takiben oluşan zigotun ilk hücrelerinin defalarca tekrarlanan


Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış. Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD

Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış. Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD Metafaz fazında hücrelere uygulanan sitogenetik analiz altın standarttır


Hepatit C. olgu sunumu. Uz. Dr. Hüseyin ÜÇKARDEŞ Bilecik Devlet Hastanesi

Hepatit C. olgu sunumu. Uz. Dr. Hüseyin ÜÇKARDEŞ Bilecik Devlet Hastanesi Hepatit C olgu sunumu Uz. Dr. Hüseyin ÜÇKARDEŞ Bilecik Devlet Hastanesi BİLECİK DEVLET HASTANESİ 1957 2015 N.E. 36 yaşında, kadın hasta Kadın Doğum polikliniği 16.07.2013 Anti-HCV: pozitif ve lökositoz


2009 yılında Amerika Birleşik Devletlerinde yaklaşık 22.475 kişide KML vardır.

2009 yılında Amerika Birleşik Devletlerinde yaklaşık 22.475 kişide KML vardır. 1 GİRİŞ Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 18.10.2010 tarihinde çevirisi yapılan Kronik Miyelojenöz Lösemi (KML) kitapçığına yeniden basım izni verdiği için minnetle teşekkür


SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD

SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD SİNYAL İLETİMİ ve KANSER Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD Reseptör Tirozin Kinaz (RTK)= Protein Tirozin Kinaz RTK lar hücre membranında yerleşim gösterir. İnsan





En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı


Trombofiliye Genetik Yaklaşım

Trombofiliye Genetik Yaklaşım Trombofiliye Genetik Yaklaşım Ajlan Tükün DÜZEN LABORATUVARLAR GRUBU XIX. KLİNİK BİYOKİMYA GÜNLERİ Ankara, 18.10.2009 Trombofili sonuçlarının değerlendirilmesi Kanserde tedavi hedeflerini belirlemek için


J Popul Ther Clin Pharmacol 8:e257-e260;2011



KMML ve JMML monosit (bir tür kan hücresi) olarak adlandırılan tek bir hücre DNA sında bir veya daha fazla akkiz değişiklik (mutasyon) ile başlar.

KMML ve JMML monosit (bir tür kan hücresi) olarak adlandırılan tek bir hücre DNA sında bir veya daha fazla akkiz değişiklik (mutasyon) ile başlar. 1 Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 08.02.2011 tarihinde çevirisi yapılan bu kitapçığın yeniden basım izni verdiği için minnetle teşekkür eder. Konular Kronik miyelomonositik


JAK 2 V617F gen mutasyon sıklığı ve tam kan sayımı

JAK 2 V617F gen mutasyon sıklığı ve tam kan sayımı DERNEĞİ BİYOKİMYA DERGİSİ TÜRK TÜRK BİYOKİMYA DERNEĞİ DERGİSİ TÜRK BİYOKİMYA DERNEĞİ DERGİSİ ORJİNAL Türk Biyokimya Dergisi [Turkish Journal of Biochemistry Turk J Biochem] 2014; 39 (1) ; 93 98 doi: 10.5505/tjb.2014.39206


İÇİNDEKİLER. Kronik Miyelojenöz Lösemi Nedir?... Hata! Yer işareti tanımlanmamış.

İÇİNDEKİLER. Kronik Miyelojenöz Lösemi Nedir?... Hata! Yer işareti tanımlanmamış. 0 İÇİNDEKİLER Kronik Miyelojenöz Lösemi Nedir?... Hata! Yer işareti tanımlanmamış. Bcr-abl geni nasıl oluşur?... Hata! Yer işareti tanımlanmamış. Sebepler ve Risk Faktörleri... Hata! Yer işareti tanımlanmamış.


Çocukluk Çağında Akut Myeloid Lösemi

Çocukluk Çağında Akut Myeloid Lösemi 1945 ANKARA ÜNİVERSİTESİ TIP FAKÜLTESİ ÇOCUK SAĞLIĞI VE HASTALIKLARI Çocukluk Çağında Akut Myeloid Lösemi Dr. Mehmet ERTEM Ankara Üniversitesi Tıp Fakültesi Pediatrik Hematoloji Bilim Dalı ÇOCUKLUK ÇAĞI


LÖKOSİT. WBC; White Blood Cell,; Akyuvar. Lökosit için normal değer : Lökosit sayısını arttıran sebepler: Lökosit sayısını azaltan sebepler:

LÖKOSİT. WBC; White Blood Cell,; Akyuvar. Lökosit için normal değer : Lökosit sayısını arttıran sebepler: Lökosit sayısını azaltan sebepler: LÖKOSİT WBC; White Blood Cell,; Akyuvar Lökositler kanın beyaz hücreleridir ve vücudun savunmasında görev alırlar. Lökositler kemik iliğinde yapılır ve kan yoluyla bütün dokulara ulaşır vücudumuzu mikrop


Tam Kan; Hemogram; CBC; Complete blood count

Tam Kan; Hemogram; CBC; Complete blood count TAM KAN SAYIMI Tam Kan; Hemogram; CBC; Complete blood count Tam kan sayımı kanı oluşturan hücrelerin sayılmasıdır, bir çok hastalık için çok değerli bilgiler sunar. Test venöz kandan yapılır. Günümüzde



MİYELODİSPLASTİK SENDROM MİYELODİSPLASTİK SENDROM Türk Hematoloji Derneği Tanı ve Tedavi Kılavuzu 2013 30.01.2014 İnt. Dr. Ertunç ÖKSÜZOĞLU Miyelodisplastik sendrom (MDS) yetersiz eritropoez ve sitopenilerin varlığı ile ortaya



MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri



KRON K FAZ KRON K M YELO D LÖSEM DE K NC NES L T ROZ N K NAZ NH B TÖRÜ KULLANIMI TÜRK HEMATOLOJ DERNE 2012: 2 1 Dr. brahim C. Haznedaro lu Hacettepe Üniversitesi, Tıp Fakültesi, İç Hastalıkları Anabilim Dalı, Hematoloji Ünitesi, Ankara e-posta: Tel: 0312 305 15 42


Giriş. idiyopatik. 100.000 kişide 0.5. getiren. şekilde akamaz. edilmektedir.

Giriş. idiyopatik. 100.000 kişide 0.5. getiren. şekilde akamaz. edilmektedir. 1 Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 18.01.2011 tarihinde çevirisi yapılan bu kitapçığın yeniden basım izni verdiği için minnetle teşekkür eder. Konular Polisitemia vera


Hemoglobinopatilere Laboratuvar Yaklaşımı

Hemoglobinopatilere Laboratuvar Yaklaşımı Hemoglobinopatilere Laboratuvar Yaklaşımı Dr. Çağatay Kundak DÜZEN LABORATUVARLAR GRUBU 1949 yılında Orak Hücre Anemisi olan hastalarda elektroforetik olarak farklı bir hemoglobin tipi tanımlanmıştır.






KRONĐK MĐYELOPROLĐFERATĐF HASTALIKLARDA TANI VE TEDAVĐ KILAVUZU KRONĐK MĐYELOPROLĐFERATĐF HASTALIKLARDA TANI VE TEDAVĐ KILAVUZU Kronik Miyeloid Lösemi (KML) (1.Versiyon/Mayıs 2010) Miyeloid öncül hücrelerin anormal klonal çoğalması ile karakterize bir kök hücre hastalığı



HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik


Membranoproliferatif Glomerülonefriti Taklit Eden Trombotik Mikroanjiopatili Bir Olgu

Membranoproliferatif Glomerülonefriti Taklit Eden Trombotik Mikroanjiopatili Bir Olgu Membranoproliferatif Glomerülonefriti Taklit Eden Trombotik Mikroanjiopatili Bir Olgu Sevcan A. Bakkaloğlu, Yeşim Özdemir, İpek Işık Gönül, Figen Doğu, Fatih Özaltın, Sevgi Mir OLGU 9 yaş erkek İshal,


KML Hastaları için Tedavi Tavsiyeleri

KML Hastaları için Tedavi Tavsiyeleri KML Hastaları için Tedavi Tavsiyeleri Kronik Miyeloid Lösemi (KML) yönetimine yönelik European LeukemiaNet tavsiyelerinin (2013) hasta dostu bir özeti Yayınlayan: İçindekiler Çalışma grubundan önsöz...


Kan Kanserleri (Lösemiler)

Kan Kanserleri (Lösemiler) Lösemi Nedir? Lösemi bir kanser türüdür. Kanser, sayısı 100'den fazla olan bir hastalık grubunun ortak adıdır. Kanserde iki önemli özellik bulunur. İlk önce bedendeki bazı hücreler anormalleşir. İkinci


Hematopoetic Kök Hücre ve Hematopoez. Dr. Mustafa ÇETİN 2013-2014

Hematopoetic Kök Hücre ve Hematopoez. Dr. Mustafa ÇETİN 2013-2014 Hematopoetic Kök Hücre ve Hematopoez Dr. Mustafa ÇETİN 2013-2014 Konunun Başlıkları 1. Hematopoetik sistem 2. Hematopoez 3. Hematopoetik kök hücre Karekteristiği Klinik kullanımı Hematopoetik Sistem Hemato


Dr.Ceyhun Bozkurt Dr.Sami Ulus Kadın Doğum Çocuk Sağlığı ve Hastalıkları EAH Çocuk Onkoloji Bölümü 20.04.2013

Dr.Ceyhun Bozkurt Dr.Sami Ulus Kadın Doğum Çocuk Sağlığı ve Hastalıkları EAH Çocuk Onkoloji Bölümü 20.04.2013 Dr.Ceyhun Bozkurt Dr.Sami Ulus Kadın Doğum Çocuk Sağlığı ve Hastalıkları EAH Çocuk Onkoloji Bölümü 20.04.2013 S.T. 15 Yaş Kız Hasta Başvuru tarihi: 12.08.2010 Yakınması: Mide bulantısı Kusma İshal Kolunda



ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Dönem V Tıbbi Genetik Staj Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Baran GENCER Oğuz GÜÇLÜ Erkam KÖMÜRCÜ Staj Eğitim Sorumlusu: Genel





(İlk iki harfleri - TR)

(İlk iki harfleri - TR) VET-A Kayıt Tarihi:. /. /.. THD Veritabanları Kemik İliği Yetmezliği Veritabanı Hasta Kayıt Formu VET-A HEKİM BİLGİLERİ 1. Merkez 2. Hekim HASTA BİLGİLERİ 3. Hasta Kodu Sistem tarafından otomatik olarak





ı. BCR-ABL Mbcr Kiti(p210) 144 test

ı. BCR-ABL Mbcr Kiti(p210) 144 test C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Hematolojik Malignensi Translokasyon Testleri ve Cihaz Teknik Şartnamesi ı. BCR-ABL Mbcr Kiti(p210) 144 test 2. BCR-ABL mbcr Kiti(p190)


Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş

Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Sunum Akışı DNA replikasyonu Telomer Telomeraz Telomeraz eksikliğinde görülen hastalıklar


Fanconi Anemisinde Hematopoetik Kök Hücre Transplantasyonu

Fanconi Anemisinde Hematopoetik Kök Hücre Transplantasyonu 1945 K SAĞLIĞI VE HASTALIKLARI UANKARA ÜNİVERSİTESİ TIP FAKÜLTESİ ÇOC Fanconi Anemisinde Hematopoetik Kök Hücre Transplantasyonu Dr. Mehmet ERTEM Ankara Üniversitesi Tıp Fakültesi Pediatrik Hematoloji






BİRİNCİ BASAMAKTA PRİMER İMMÜN YETMEZLİK 1 LERDE LABORATUVAR İPUÇLARI GENEL TARAMA TESTLERİ Tam kan sayımı Periferik yayma İmmünglobulin düzeyleri (IgG, A, M, E) İzohemaglutinin titresi (Anti A, Anti B titresi) Aşıya karşı antikor yanıtı (Hepatit



MESANE TÜMÖRLERİNİN DOĞAL SEYRİ MESANE TÜMÖRLERİNİN DOĞAL SEYRİ ve MOLEKÜLER PROGNOSTİK FAKTÖRLER Prof. Dr. Levent Türkeri Üroloji Anabilim Dalı Marmara Üniversitesi Tıp Fakültesi Mesane Tümörü (Transizyonel Hücreli Karsinom) Yüzeyel


Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması

Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik nın Karşılaştırılması Dr.M.Çisel Aydın, Doç.Dr.Sevgen Önder, Prof.Dr.Gaye Güler Tezel Hacettepe





MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı

MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Malign Melanom (MM) Moleküler Çağ öncesi MM Moleküler Çağ da MM Moleküler





YENİ TESTLER. Düzen Laboratuvarlar Grubu

YENİ TESTLER. Düzen Laboratuvarlar Grubu YENİ TESTLER Düzen Laboratuvarlar Grubu METABOLİZMA İmmunoreaktif Tripsin (IRT) Total Galaktoz Lökosit Arylsülfataz A düzeyi Gama Aminobütirik Asit (GABA) Pristanik Asit-Fitanik Asit Immunoreaktif Tripsin








Giriş Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 15.09.2010 tarihinde çevirisi

Giriş Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 15.09.2010 tarihinde çevirisi 1 Giriş Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 15.09.2010 tarihinde çevirisi yapılan Lösemi kitapçığına yeniden basım izni verdiği için minnetle teşekkür eder. Bu kitapçık



BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ Celal Bayar Üniversitesi Deri ve Zührevi Hastalıklar Anabilim Dalı-MANİSA Bazal Hücreli Kanser (BCC) 1827 - Arthur Jacob En sık rastlanan deri kanseri (%70-80) Açık


Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/6) Tıbbi Laboratuar Akreditasyon No: Adresi :Cemal Sahir Sok. No:14 Mecidiyeköy 34387 İSTANBUL / TÜRKİYE Tel : 0 212 272 48 00 Faks : 0 212 272 48 04 E-Posta :


HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı

HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı HALK SAĞLIĞI ANABĠLĠM DALI Ders adı : Endokrin çevre bozucular ve tarama programı Öğretim Üyesi : Prof. Dr. A. Emel ÖNAL Endokrin sistemin çalışmasını değiştiren, sağlıklı insanda veya çocuklarında sağlık


RENCİ ve TEDAVİSİ. Doç. Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi

RENCİ ve TEDAVİSİ. Doç. Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi İMATİNİB B DİRENCD RENCİ ve TEDAVİSİ Doç. Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi KML Güncel Tanı ve Tedavi 10 Mayıs 2008, Konya SUNU AKIŞI BCR-ABL / SRC


Multiple Myelom Radyoterapi Uygulamaları. Prof.Dr. Serra KAMER

Multiple Myelom Radyoterapi Uygulamaları. Prof.Dr. Serra KAMER Multiple Myelom Radyoterapi Uygulamaları Prof.Dr. Serra KAMER Cevap Aranan Sorular Kemik Lezyonlarında Palyatif Radyoterapi Plazmositom tedavisinde küratif radyoterapi Kim ne zaman- tedavi sıralaması?





İÇİNDEKİLER. Önsöz... iii Ulusal Tanı ve Tedavi Kılavuzu Çalışma Grupları... iv Kısaltmalar... vii Tablolar Listesi... xiii Şekiller Listesi...

İÇİNDEKİLER. Önsöz... iii Ulusal Tanı ve Tedavi Kılavuzu Çalışma Grupları... iv Kısaltmalar... vii Tablolar Listesi... xiii Şekiller Listesi... HEMOFİLİ TANI VE TEDAVİ KILAVUZU İÇİNDEKİLER Önsöz... iii Ulusal Tanı ve Tedavi Kılavuzu Çalışma Grupları... iv Kısaltmalar... vii Tablolar Listesi... xiii Şekiller Listesi... xiii I. BÖLÜM HEMOFİLİ TANI



NONSOLİD TÜMÖRLERDE TEKRARLAYAN KROMOZOMAL TRANSLOKASYONLAR NONSOLİD TÜMÖRLERDE TEKRARLAYAN KROMOZOMAL TRANSLOKASYONLAR Kontrolsüz bırakılırsa hastayı genellikle ölüme götüren bir hastalık olan kanser, düzensiz hücre büyümesi ve diferansiyasyonunda ortak özellikler


Juvenil myelomonositer lösemi. Doç. Dr. Barış Kuşkonmaz Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Hematoloji

Juvenil myelomonositer lösemi. Doç. Dr. Barış Kuşkonmaz Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Hematoloji 10. Ulusal Pediatrik Hematoloji Kongresi 3 6 Haziran 2015, Ankara [Barış Kuşkonmaz] BEYANI Araştırma Destekleri/ Baş Araştırıcı Sunumum ile ilgili çıkar çatışmam yoktur. Çalıştığı Firma (lar) Sunumum ile


Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu


TKİ'ye Dirençli GİST Tedavisinin Zorlukları

TKİ'ye Dirençli GİST Tedavisinin Zorlukları Doktor Jean-Yves Blay, PhD: Merhaba ve programa hoşgeldiniz. Adım Jean-Yves Blay. Fransa'da Lyon'da çalışan bir Tıbbi Onkoloji Profesörüyüm. TKİ'ye Dirençli GİST Tedavisinin Zorlukları başlıklı bu programa



[HÜSEYİN ONAY] BEYANI Araştırma Destekleri/ Baş Araştırıcı 10. Ulusal Pediatrik Hematoloji Kongresi 3 6 Haziran 2015, Ankara [HÜSEYİN ONAY] BEYANI Sunumum ile ilgili çıkar çatışmam yoktur. Çalıştığı Firma (lar) Danışman Olduğu


Kan Sayımında Yeni Parametreler ve Teknik Sorunlar

Kan Sayımında Yeni Parametreler ve Teknik Sorunlar Kan Sayımında Yeni Parametreler ve Teknik Sorunlar Dr. Nurzen Sezgin Başkent Üniversitesi Adana Uygulama ve Araştırma Merkezi Yeni Parametreler Microcytic RBC - Macrocytic RBC Hypochromic RBC - Hyperchromic


Üroonkoloji Derneği. Prostat Spesifik Antijen. Günümüzdeki Gelişmeler. 2 Nisan 2005,Mudanya

Üroonkoloji Derneği. Prostat Spesifik Antijen. Günümüzdeki Gelişmeler. 2 Nisan 2005,Mudanya Prostat Spesifik Antijen ve Günümüzdeki Gelişmeler Prostat Kanseri 2004 yılı öngörüleri Yeni tanı 230.110 Ölüm 29.900 Jemal A, CA Cancer J Clin 2004 Kanserler arasında görülme sıklığı #1 Tümöre bağlı ölüm


Lafora hastalığı, Unverricht Lundborg hastalığı, Nöronal Seroid Lipofuksinoz ve Sialidozlar en sık izlenen PME'lerdir. Progresif miyoklonik

Lafora hastalığı, Unverricht Lundborg hastalığı, Nöronal Seroid Lipofuksinoz ve Sialidozlar en sık izlenen PME'lerdir. Progresif miyoklonik LAFORA HASTALIĞI Progressif Myoklonik Epilepsiler (PME) nadir olarak görülen, sıklıkla otozomal resessif olarak geçiş gösteren heterojen bir hastalık grubudur. Klinik olarak değişik tipte nöbetler ve progressif


BAŞKENT ÜNİVERSİTESİ TIP FAKÜLTESİ. İç Hastalıkları Anabilim Dalı Hematoloji Bilim Dalı






Prostat Kanseri Tanısında PSA yı Nasıl Kullanalım

Prostat Kanseri Tanısında PSA yı Nasıl Kullanalım Prostat Kanseri Tanısında PSA yı Nasıl Kullanalım Dr. Ö. Levent ÖZDAL Türkiye Yüksek İhtisas Hastanesi Üroloji Kliniği, Ankara Tarihçe 1979 da Wang ve ark. Prostat dokusunda PSA yı pürifiye ettiler Serumda


Kronik myeloproliferatif neoplazili hastalarda JAK2V617F mutasyon ve tromboemboli durumlarının değerlendirilmesi;tek Merkez deneyimi

Kronik myeloproliferatif neoplazili hastalarda JAK2V617F mutasyon ve tromboemboli durumlarının değerlendirilmesi;tek Merkez deneyimi Araştırma Makalesi Pamukkale Tıp Dergisi Pamukkale Medical Journal Kronik myeloproliferatif neoplazili hastalarda JAK2V617F mutasyon ve tromboemboli durumlarının değerlendirilmesi;tek Merkez deneyimi The





Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β


w w w. t i t c k. g o v. t r

w w w. t i t c k. g o v. t r w w w. t i t c k. g o v. t r ARAŞTIRMA İLACINA KLİNİK ARAŞTIRMA DIŞINDA ERİŞİM Uzm. Dr. Banu BAYAR Akılcı İlaç Kullanımı ve İlaç Tedarik Yönetimi Dairesi İlaç Tedarik ve Onay Birimi 1 2. Ulusal Klinik


LÖKOSİTOZLU ÇOCUĞA YAKLAŞIM. Doç.Dr.Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji Onkoloji BD Antalya

LÖKOSİTOZLU ÇOCUĞA YAKLAŞIM. Doç.Dr.Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji Onkoloji BD Antalya LÖKOSİTOZLU ÇOCUĞA YAKLAŞIM Doç.Dr.Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji Onkoloji BD Antalya Lökositoz gerçek mi? Trombosit kümeleri Çekirdekli eritrositler (normoblast) Eritrositlerin


Kronik Hepatit B Tedavisi Zor Olgular

Kronik Hepatit B Tedavisi Zor Olgular Kronik Hepatit B Tedavisi Zor Olgular Dr. Faruk KARAKEÇİLİ Erzincan Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı 22.01.2016 HATAY Tedavisi Zor Olgular! Zor hasta


Onkolojide Sık Kullanılan Terimler. Yrd.Doç.Dr.Ümmügül Üyetürk 2013

Onkolojide Sık Kullanılan Terimler. Yrd.Doç.Dr.Ümmügül Üyetürk 2013 Onkolojide Sık Kullanılan Terimler Yrd.Doç.Dr.Ümmügül Üyetürk 2013 Kanser Hücrelerin aşırı kontrolsüz üretiminin, bu üretime uygun hücre kaybıyla dengelenemediği, giderek artan hücre kütlelerinin birikimi..



AMELİYAT SONRASI TAKİP/ NÜKSTE NE YAPALIM? Dr. Meral Mert AMELİYAT SONRASI TAKİP/ NÜKSTE NE YAPALIM? Dr. Meral Mert AMELİYAT SONRASI TAKİP n Ameliyat sonrası evreleme; - TNM sınıflaması kullanılmakla beraber eksiklikleri var; post-op kalsitonin- CEA ölçümü, CEA





KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI. Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD

KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI. Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD Kanser Önemli Bir Sağlık Sorunudur Kanser milyonları etkileyen,


Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:


SOLİT ORGAN TRANSPLANTASYONU ve BK VİRUS ENFEKSİYONLARI Doç. Dr. Derya Mutlu Güçlü immunsupresifler Akut, Kronik rejeksiyon Graft yaşam süresi? Eskiden bilinen veya yeni tanımlanan enfeksiyon etkenleri:



HİPEREOZİNOFİLİK SENDROM Dr. Meltem Aylı HİPEREOZİNOFİLİK SENDROM Dr. Meltem Aylı Şafak Tanrıçası Eos Titanlar soyundan gelen Eos, ya da Şafak, insanlara sabah ışığını yayar, göklerde uçar, yeryüzüne ışık verir ve çiğ dağıtırdı. eozinofiller


Yeni Tanı Hipertansiyon Hastalarında Tiyol Disülfid Dengesi

Yeni Tanı Hipertansiyon Hastalarında Tiyol Disülfid Dengesi Yeni Tanı Hipertansiyon Hastalarında Tiyol Disülfid Dengesi İhsan Ateş 1, Nihal Özkayar 2,Bayram İnan 1, F. Meriç Yılmaz 3, Canan Topçuoğlu 3, Özcan Erel 4, Fatih Dede 2, Nisbet Yılmaz 1 1 Ankara Numune





Çocukluk Çağında Miyelodisplastik Sendrom

Çocukluk Çağında Miyelodisplastik Sendrom Çocukluk Çağında Miyelodisplastik Sendrom Miyelodisplastik sendrom (MDS) hematopoietik kök hücrelerin nadir görülen bir hastalığıdır. Klonal hücre büyümesi, bozuk farklılaşma ve artmış apopitozla ortaya





İnvaziv Aspergilloz da Tedavi Yaklaşımları

İnvaziv Aspergilloz da Tedavi Yaklaşımları İnvaziv Aspergilloz da Tedavi Yaklaşımları Dr. Murat Akova Hacettepe Üniversitesi Tıp Fakültesi İç Hastalıkları Anabilim Dalı, İnfeksiyon Hastalıkları Ünitesi, Ankara 1 2 3 İnvaziv aspergillozda mortalite



HER2 POZİTİF HASTALIĞA YAKLAŞIM HER2 POZİTİF HASTALIĞA YAKLAŞIM Dr.Merih Güray Durak DEÜTF Patoloji ABD 9.Ekim.2014 İzmir Meme Hastalıkları Derneği Bilimsel Toplantısı Meme Kanserinde HER2 HER2 (human epidermal growth factor receptor


Giriş. Bu broşürde ET tanısı, tedavisi, ilave bilgi kaynakları ve destek konusu tartışılmaktadır.

Giriş. Bu broşürde ET tanısı, tedavisi, ilave bilgi kaynakları ve destek konusu tartışılmaktadır. 1 Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 15.01.2011 tarihinde çevirisi yapılan bu kitapçığa yeniden basım izni verdiği için minnetle teşekkür eder. Konular Esansiyel trombositoz



FİLADELFİYA KROMOZOMU POZİTİF AKUT LENFOBLASTİK LEUKEMİADA TEDAVİ FİLADELFİYA KROMOZOMU POZİTİF AKUT LENFOBLASTİK LEUKEMİADA TEDAVİ Zahit Bolaman Adnan Menderes Üniversitesi Tıp Fakültesi AYDIN Filadelfiya kromozomu pozitif akut lenfoblastik leukemia da klinik özellikler


LÖSEMİ MORFOLOJİSİ. Dr. Namık ÖZBEK Ankara Çocuk Sağlığı ve Hastalıkları Hematoloji Onkoloji EAH

LÖSEMİ MORFOLOJİSİ. Dr. Namık ÖZBEK Ankara Çocuk Sağlığı ve Hastalıkları Hematoloji Onkoloji EAH LÖSEMİ MORFOLOJİSİ Dr. Namık ÖZBEK Ankara Çocuk Sağlığı ve Hastalıkları Hematoloji Onkoloji EAH UYGULAMA Posterior superior iliak krestten yapılır 18 ay altında tuberositas tibiadan yapılabilir YAYMA Önceden


HBV Reaktivasyonunda Rehber Önerileri

HBV Reaktivasyonunda Rehber Önerileri HBV Reaktivasyonunda Rehber Önerileri Dr. Orhan YILDIZ Erciyes Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D. e-mail: Lok AS, et al. Hepatology.


BRAF Mutant Metastatik Malign Melanom Hastalarında ilk Seçim? İpilimumab olmalıdır

BRAF Mutant Metastatik Malign Melanom Hastalarında ilk Seçim? İpilimumab olmalıdır BRAF Mutant Metastatik Malign Melanom Hastalarında ilk Seçim? İpilimumab olmalıdır Dr Umut VAROL İzmir Katip Çelebi Üniversitesi Atatürk Eğitim ve Araştırma Hastanesi Distribution of MELANOMA by Race





İmatinib: Etki Mekanizması ve Direnç Geliștirme Mekanizmaları

İmatinib: Etki Mekanizması ve Direnç Geliștirme Mekanizmaları TEMEL TIP BİLİMLERİ/BASIC SCIENCES Davetli Derleme / Invited Paper Ankara Üniversitesi Tıp Fakültesi Mecmuası 2012, 65 (2) DOI: 10.1501/Tıpfak_000000813 İmatinib: Etki Mekanizması ve Direnç Geliștirme








Gebelik ve Trombositopeni

Gebelik ve Trombositopeni Gebelik ve Trombositopeni Prof.Dr. Sermet Sağol EÜTF Kadın Hast. ve Doğum AD Gebelik ve Trombositopeni Kemik iliğinde megakaryosit hücrelerinde üretilir. Günde 35.000-50.000 /ml üretilir. Yaşam süresi
