Kan Donörlerinde Gerçek Zamanlı RT-PCR ile Batı Nil Virusu RNA sının Araştırılması*

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Kan Donörlerinde Gerçek Zamanlı RT-PCR ile Batı Nil Virusu RNA sının Araştırılması*"


1 Kısa Bildiri/Short Communication Mikrobiyol Bul 2012; 46(3): Kan Donörlerinde Gerçek Zamanlı RT-PCR ile Batı Nil Virusu RNA sının Araştırılması* Investigation of West Nile Virus RNA in Blood Donors by Real-Time RT-PCR Fatih ŞAHİNER 1, İsmail Yaşar AVCI 2, Orhan BEDİR 1, Özgür KORU 1, Kenan ŞENER 1, Mehmet YAPAR 1, Ayhan KUBAR 1 1 Gülhane Askeri Tıp Akademisi, Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara. 1 Gulhane Military Medical Academy, Department of Medical Microbiology, Ankara, Turkey. 2 Gülhane Askeri Tıp Akademisi, Kan Eğitim Merkezi ve Kan Bankası Müdürlüğü, Ankara. 2 Gulhane Military Medical Academy, Blood Training and Donation Center, Ankara, Turkey. * Bu çalışma, American Society of Tropical Medicine and Hygiene, 60 th Annual Meeting (December 4-8, 2011, Philadelphia, Pennsylvania USA) de poster olarak sunulmuştur. Geliş Tarihi (Received): Kabul Ediliş Tarihi (Accepted): ÖZET Batı Nil virusu (BNV) Flaviviridae ailesinde yer alan zarflı, ikozahedral simetrili bir RNA virusudur. Ana rezervuarı kuşlar olmasına karşın virus insan ve diğer memelilerde de çeşitli enfeksiyonlara neden olmaktadır. BNV enfeksiyonlarının insanlara en sık ve doğal bulaşma yolu sivrisinek ısırmasıdır. Bununla beraber insanlara farklı yollarla da bulaşabilmektedir. Sivrisinek aracılı olmayan bulaşma yollarından en önemlisi virus ile kontamine kan ve kan ürünleridir. Bu çalışmada, kan ve kan ürünleri ile BNV bulaş olasılığının değerlendirilmesi amacıyla, Ankara bölgesindeki sağlıklı kan donörlerinde in house gerçek zamanlı revers transkriptaz-polimeraz zincir reaksiyonu (RT-PCR) ile BNV RNA varlığının araştırılması planlanmıştır. Çalışmaya 729 gönüllü kan donörü (yaş ortalaması: 27.7 yıl; 711 i erkek) dahil edilmiştir. Önceki çalışmalarda serokonversiyonun henüz oluşmadığı erken enfeksiyon dönemlerinde virusun kan transfüzyonuyla bulaşabileceği gösterildiğinden, donörlerin seropozitiflik durumu dikkate alınmamıştır. BNV enfeksiyonları sivrisineklerin çoğaldığı yaz ve yaz sonu dönemlerinde daha sık görüldüğünden çalışmamız Ağustos-Eylül 2009 döneminde gerçekleştirilmiştir. Katılımcıların 702 (%96.3) si Ankara ve ilçelerinde ikamet etmekte olup, 569 (%78) u arboviral enfeksiyon riski olan (açık alanda bulunma, sivrisinek ve kene ile temas) kişilerden oluşmaktadır. Gerçek zamanlı RT-PCR analizleri sonucunda, çalışmaya dahil edilen serum örneklerinin hiçbirisinde BNV RNA varlığı saptanmamıştır. Çalışmamızın sonuçlarına göre özellikle Ankara bölgesi için kan ve kan ürünleri ile BNV bulaş riskinin düşük olduğu söylenebilir. Ancak bölgemizde yapılan çalışmalarda; kan donörlerinde BNV seropozitifliğinin % oranları arasında saptanmış olması, İletişim (Correspondence): Uzm. Dr. Fatih Şahiner, Gülhane Askeri Tıp Akademisi, Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara, Türkiye. Tel (Phone): , E-posta ( ):

2 fiahiner F, Avc Y, Bedir O, Koru Ö, fiener K, Yapar M, Kubar A. bölgemizde muhtemel ve doğrulanmış BNV enfeksiyonlarının bildirilmiş olması ve ayrıca yakın zamanda çevremizdeki bazı ülkelerde BNV salgınlarının görülmesi nedeniyle BNV bulaş riski göz ardı edilmemelidir. Anahtar sözcükler: Batı Nil virusu; kan donörü; gerçek zamanlı RT-PCR. ABSTRACT West Nile virus (WNV), a member of Flaviviridae family, is an enveloped, icosahedral symmetric RNA virus. Primary reservoir hosts of WNV are birds, but the virus can cause various infections in humans and other mammals. The most common and natural transmission way of WNV infections is mosquito bites, however, humans can be infected by different routes. The most important non-mosquito transmission route is contaminated blood and blood products. In this study, we aimed to investigate the risk of WNV transmission through blood and blood products in Ankara, Turkey. The presence of WNV RNA was investigated by in house real-time reverse transcriptase-polymerase chain reaction (RT-PCR) in serum samples obtained from 729 healthy blood donors (mean age: 27.7 years; 711 were male), regardless of the donor's seropositivity status since the virus can be transmitted at the early stages of infection when seroconversion has not yet developed. Serum samples were collected in August-September 2009, the period when these infections are more frequent due to mosquito activity. The vast majority of donors (n= 702, 96.3%) have been inhabiting in Ankara and 569 (78%) of donors have had risk factors for arboviral infections (e.g. outdoor activity, mosquito and tick bites). WNV RNA was not detected by real-time RT-PCR analysis in any serum sample included in this study. According to the results of our study, it can be said that the risk of WNV transmission through blood and blood products is low in Ankara. However, WNV seropositivity was detected within the range of 0.56 to 2.4% among blood donors in previous studies and probable and confirmed WNV infections have been reported in our region. In addition, WNV outbreaks have emerged in some countries neighbouring Turkey recently. Thus, the risk of WNV transmission through blood and blood products should not be ignored and blood donor questionnaires should be evaluated in detail. Key words: West Nile virus; blood donor; real-time RT-PCR. GİRİŞ Batı Nil virusu (BNV) Flaviviridae ailesi, Flavivirus cinsi içinde sınıflandırılan, yaklaşık 45 nm büyüklüğünde, zarflı, ikozahedral simetrili ve tek zincirli, pozitif polariteli RNA genomu içeren bir arbovirustur 1. BNV nin doğal yaşam döngüsünde kuşlar ana rezervuar konaklardır; insan, at ve diğer omurgalılar ise vireminin düşük düzeylerde olması nedeniyle viral döngüde minimal etkileri olan rastlantısal konaklardır 1. BNV nin temel bulaşı özellikle Culex cinsi sivrisinek ısırığı ile olur; ancak enfeksiyonun insanlara sivrisinek aracılı olmayan yollar (kan/kan ürünlerinin transfüzyonu, organ nakli, diyaliz, intrauterin veya anne sütü, perkütan ve aerosol yol) ile de bulaşabildiği gösterilmiştir 1-6. BNV enfeksiyonları genellikle asemptomatik olarak geçirilmekle beraber, enfeksiyonun seyri sırasında Batı Nil ateşi veya hastaların %1 inden azında nörodejeneratif değişikliklerle karakterize ciddi hastalıklar da gelişebilmektedir 1,2. BNV enfeksiyonlarının tanısı; hasta serumu veya beyin omurilik sıvısı (BOS) nda virusa özgül IgM ve IgG antikorlarının saptanması, hasta örneklerinde viral RNA nın gösterilmesi veya virus izolasyonuyla yapılır

3 Kan Donörlerinde Gerçek Zamanl RT-PCR ile Bat Nil Virusu RNA s n n Araflt r lmas Dünyanın birçok bölgesinde görülmekle beraber, son zamanlarda yakın coğrafyamızdaki ülkelerde BNV enfeksiyonlarında bir artış izlenmiş ve yıllarında bazı ülkelerde (Yunanistan, Romanya, Macaristan, Rusya, İsrail, İtalya) salgın boyutunda enfeksiyonlar bildirilmiştir 2,7,8. Ülkemizde BNV seroprevalansını belirlemeye yönelik çalışmaların geçmişi 30 yıldan daha uzun sürelidir ve BNV seropozitifliği bölgelere göre değişmek üzere %1-57 arasında bulunmuştur 9. Yine ülkemizde yapılan çalışmalarda sağlıklı kan donörlerinde % oranlarında BNV seropozitifliği saptanmıştır 2,10,11. Ayrıca 2009 yılında Ankara da, etyolojisi laboratuvar olarak doğrulanan semptomatik BNV enfeksiyonu olguları da tespit edilmiştir Ülkemizde doğrulanmış ilk BNV olguları olan bu hastalar uygulanan tedavilerle klinik olarak düzelirken; Ağustos 2010 tarihinde Manisa, Sakarya, İzmir, Aydın ve Isparta da toplam yedi olguya Batı Nil ateşi tanısı konulmuş ve bunların üçü ölümle sonlanmıştır 8. Bu olgular ülkemizde ölümle sonuçlanan laboratuvar olarak kanıtlanmış ilk enfeksiyonlar olması nedeniyle önem taşımaktadır. Bu çalışmada, kan ve kan ürünleriyle BNV bulaş olasılığının değerlendirilmesi amacıyla, gerçek zamanlı revers transkriptaz polimeraz zincir reaksiyonu (RT-PCR) ile sağlıklı kan donörlerinde BNV RNA sı araştırılmıştır. GEREÇ ve YÖNTEM Çalışmaya, etik kurul onayı ile, 3 Ağustos-23 Eylül 2009 tarihleri arasında Gülhane Askeri Tıp Akademisi Kan Bankası laboratuvarına kan bağışında bulunan sağlıklı gönüllülere ait 729 serum örneği dahil edildi. Serum örneklerinden RNA izolasyonu asit fenol-kloroform-izoamil alkol yöntemine göre yapıldı 16. Çalışmada kullanılan primerlerin ve probun dizaynı, OligoYap 4.0 isimli bilgisayar yazılımıyla gerçekleştirildi 17. Virusun NSP-5 geni üzerinde yaklaşık 159 baz çift(bç) lik bir bölgeyi hedefleyen oligoların özgünlükleri internet yardımıyla GenBank ın BLAST özelliği kullanılarak kontrol edildi ve MWG-Biotech (Almanya) firmasına sentez ettirildi. Primer olarak P1 (ileri): 5 gccaccggaagttgagtaga3 ve P2 (ters): 5 gccgtagcgtggtctgacatt3 ; prob olarak (5 3 ): FAM-tgcgrctcaaccccaggaggac-BHQ kullanıldı. Probdaki r kodu dejeneratif baz yapısını göstermekte olup (A/G), probların dizaynında floresan boya olarak FAM (6-carboxy fluorescein), nonfloresan boya olarak da BHQ (black hole quencher) kullanıldı. TaqMan temelli gerçek zamanlı RT-PCR işlemi için ince duvarlı ve real-time PCR cihazının optik okuyucusu için uygun olan 0.2 ml lik tüpler içinde her bir örnek için üniversal PCR Master Miks (1X) 12.5 µl, her bir primerden 10 pmol, TaqMan prob 4 pmol, 2 U hot start taq DNA polimeraz, 2.5 U revers transkriptaz eklendi ve karışımın hacmi distile su ile 20 µl ye tamamlandı. Karışıma son olarak 5 µl ekstrakte RNA ilave edildi ve PCR reaksiyonları 25 µl toplam hacimde gerçekleştirildi. PCR döngüleri, Kubar ve arkadaşlarının 18 çalışmasına göre uygulandı. Amplifikasyon döngüleri; (i) cdna sentezi için 50 C de 30 dakika başlangıç döngüsü, (ii) 95 C 10 dakika 1 döngü [Hot Start Taq DNA Polimeraz (Bioron GmBH, Germany) aktivasyonu için], (iii) 95 C 15 saniye ve 60 C 1 dakika olmak üzere toplam 40 döngü şeklinde gerçekleştirildi. Tüm işlemler ve analizler ABI PRISM 7500 Sequence Detector (Applied Biosystems, ABD) cihazıyla yapıldı. Çalışmada pozitif kontrol olarak, Ankara Üniversitesi Veteriner Fakültesinden temin edilen NY-99 suşunun plak oluşturan ünite (PFU)/ml lik stok solüsyonundan dilüe 466

4 fiahiner F, Avc Y, Bedir O, Koru Ö, fiener K, Yapar M, Kubar A. edilerek hazırlanan örnekler kullanıldı. Optimizasyon çalışmaları sırasında, amplifiye edilen pozitif kontrolün farklı dilüsyonlarına (3162, 316, 31.6, 3.16, 0.31 ve 0.03 PFU/ml) ait PCR ürünleri agaroz jel elektroforezi ile de görüntülendi (Resim 1). Elektroforez için %1.8 lik agaroz jel hazırlandı. Amplikonlar 0.5X TAE buffer içinde 160 voltta 25 dakika sabit akımda yürütüldü ve GelDoc 2000 jel görüntüleme cihazı (BioRad, ABD) ile görüntülenip fotoğraflandı. Amplikon büyüklüklerini belirleyebilmek için GeneRuler 50 bp DNA Ladder (Fermentas, Litvanya) kullanıldı. BULGULAR Çalışmamızda, pozitif kontrolün 3162, 316, 31.6, 3.16, 0.31 ve 0.03 PFU/ml konsantrasyon içeren örneklerinden RNA ekstraksiyonunu takiben gerçekleştirilen PCR reaksiyonlarında sırasıyla 29.9, 31.8, 35.9 ve 38.1 C T değerlerinde pozitiflik belirlenirken, son iki dilüsyon negatif bulunmuştur (Resim 1). Çalışmaya alınan 729 donörün 711 i erkek, 18 i kadın olup, yaşları (yaş ortalaması: 27.7) yıl arasında değişmektedir. Kan donörlerinin 702 si Ankara ve ilçelerinde, 27 si ise Ankara dışındaki çeşitli şehirlerde ikamet etmektedir. Donörlerin 569 (%78) u, arboviral enfeksiyon riski olan (açık alanda bulunma, sivrisinek ve kene ile temas) kişilerden oluşmaktadır. Çalışmamızda, kan donörlerine ait örneklerin hiçbirisinde RT-PCR yöntemiyle BNV RNA varlığı saptanmamıştır. TARTIŞMA Amerika Birleşik Devletleri nde 2002 yılında ortaya çıkan BNV salgını sırasında, 16 viremik kan donöründen trombosit süspansiyonu, eritrosit süspansiyonu veya plazma alan 23 kişide transfüzyon sonrası bulaş olduğu gösterilmiştir 3,4. Transfüzyonu takip eden 2-21 gün içinde alıcıların 15 inde BNV ile ilişkili hastalık gelişmiş ve bu donörlerde titresi PFU/ml olan düşük seviyeli viremi varlığı saptanmıştır 3,4. Dikkat çekici olan diğer nokta ise, bu donörlerin hiçbirisinde kan bağışı sırasında saptanabilir düzeyde BNV Resim 1. Jel kuyucuklarında 1'den 6'ya sırasıyla 3162, 316, 31.6, 3.16, 0.31 ve 0.03 PFU/ml konsantrasyonlarda hedef genom içeren pozitif kontrol örnekleri ile yapılan gerçek zamanlı RT-PCR reaksiyon ürünleri (7 no lu kuyucukta DNA ağırlık belirteci bulunmaktadır). 467

5 Kan Donörlerinde Gerçek Zamanl RT-PCR ile Bat Nil Virusu RNA s n n Araflt r lmas IgM bulunmamış olmasıdır. Bu veriler, kısa süreli ve düşük düzeyli vireminin görüldüğü asemptomatik enfeksiyonlarda BNV nin kan ve kan ürünleriyle bulaşabildiğini göstermekte ve BNV seropozitifliğinin araştırılmasının bulaşı önlemede yetersiz kaldığını ortaya koymaktadır. Organ nakli ile BNV nin bulaşabildiği ise 2003 yılında rapor edilmiş; organ donörü olan kişinin organları alınmadan bir gün önce kontamine kan transfüzyonu sonucu enfekte olduğu ve bu donörün organlarının nakledildiği hastalarda klinik BNV enfeksiyonları geliştiği bildirilmiştir 5. Yine doğum yaptıktan bir gün sonra BNV ile kontamine kan transfüzyonu nedeniyle enfekte olan bir annede, 11 gün sonra BNV menenjiti gelişmiş ve doğumdan bir gün sonra anne sütü ile beslenmeye başlayan ve asemptomatik kalan bebekte 25 gün sonra BNV IgM varlığı gösterilmiştir 6. Tüm bu olgular, kan transfüzyonunun BNV bulaşındaki önemine dikkat çekmektedir. Rabel ve arkadaşlarının 19 Mart 2011 tarihinde yayınlanan çalışmalarında, bazı orta Avrupa ülkelerinde yılları arasında kan donörlerinde BNV seroprevalansının arttığı bildirilmiştir. Ülkemizde ise yıllarında laboratuvar olarak doğrulanmış ve ölümle sonuçlanan BNV enfeksiyonları bildirilmiştir 8, Tüm bu veriler ve BNV virülansının arttığına dair bulgular, bu enfeksiyonun ilerleyen yıllarda dünyada ve ülkemizde daha da önem kazanacağını göstermektedir 20. Sivrisinek aktivitesindeki artışa bağlı olarak BNV enfeksiyonları insanlar arasında yaz ve yaz sonu dönemlerinde daha sık görülür 1,9. Bunu dikkate alarak çalışmamıza, Ağustos- Eylül 2009 döneminde bağışta bulunan kan donörlerinin örnekleri dahil edilmiştir. Donörlerin %78 inde açık alanda bulunma ve sivrisinek-kene teması hikayesi bulunduğundan, çalışılan grubun arbovirus enfeksiyonları için risk taşıyan bir örneklem olduğu düşünülebilir. Transfüzyonla ilişkili BNV bulaşında donörlerde düşük seviyeli ( PFU/ml) viremi görüldüğünden dolayı hastalardan alınan serum örneklerinde BNV varlığını araştıracak yöntemin saptama duyarlılığı kritik önem arz etmektedir 3,4. Bu çalışmada kullandığımız yöntemin saptama duyarlılığı 35.9 C T ve 38.1 C T değerleri baz alınmak koşuluyla minimum PFU/ml ve üzeri olarak belirlenmiştir. Bununla beraber düşük titreli değerleri saptayabilmek için analizlerin dikkatli olarak yapılması önem arz etmekte olup, gerektiğinde döngü sayısı artırılmalıdır. Her ne kadar çalışmamızda kan donörlerinde BNV RNA varlığı saptanmamış olsa da; BNV enfeksiyonlarında vireminin kısa süreli ve düşük düzeyde olması, bölgemizde yapılan çalışmalarda kan donörlerinde BNV seropozitifliğinin saptanmış olması, yine bulunduğumuz bölge de dahil olmak üzere ülkemizde doğrulanmış BNV enfeksiyonlarının bildirilmesi ve komşu ülkelerde BNV salgınlarının görülmesi gibi nedenlerle, ülkemizde kan/kan ürünleriyle BNV bulaş riski göz ardı edilmemelidir 2,10,11, Ülkemizde bölgelere göre seropozitiflik oranlarının farklı olması nedeniyle bu riskin her bölge için değişebileceği ve ayrıca salgın durumlarında kan transfüzyonuyla bulaş riskinin arttığı unutulmamalıdır 9,21. TEŞEKKÜR Pozitif kontrol olarak kullandığımız virus suşunun teminindeki destekleri dolayısıyla Ankara Üniversitesi Veteriner Fakültesi, Viroloji Anabilim Dalı Öğretim Üyesi Sayın Prof. Dr. Aykut Özkul a teşekkür ederiz. 468

6 fiahiner F, Avc Y, Bedir O, Koru Ö, fiener K, Yapar M, Kubar A. KAYNAKLAR 1. Petersen LR, Roehrig JT, Sejvar JJ. West Nile virus in the Americas, pp: In: Fong IW, Alibek K (eds), New and Evolving Infections of the 21 st Century. 2007, Springer Science, New York. 2. Ayturan Ş, Aydoğan S, Ergünay K, Özcebe OI, Us D. Hacettepe Üniversitesi Hastanesi kan donörlerinde Batı Nil virusu seroprevalansının araştırılması ve pozitif sonuçların plak redüksiyon nötralizasyon testi ile doğrulanması. Mikrobiyol Bul 2011; 45(1): Harrington T, Kuehnert MJ, Kamel H, et al. West Nile virus infection transmitted by blood transfusion. Transfusion 2003; 43(8): Pealer LN, Marfin AA, Petersen LR, et al. Transmission of West Nile virus through blood transfusion in the United States in N Engl J Med 2003; 349(13): Iwamoto M, Jernigan DB, Guasch A, et al. Transmission of West Nile virus from an organ donor to four transplant recipients. N Engl J Med 2003; 348(22): Centers for Disease Control and Prevention. Possible West Nile virus transmission to an infant through breast-feeding-michigan, MMWR 2002; 51(39): European Centre for Disease Control and Prevention. West Nile virus transmission in Europe. Epidemiological Updates, 10 September T.C. Sağlık Bakanlığı. Basın Açıklaması. 9. Azap A, Meço O. Batı Nil virusu ansefaliti. Klinik Gelişim Dergisi 2010; 23(3): Hızel K, Yenicesu I, Erdal B ve ark. Sağlıklı kan vericilerinde Batı Nil virusu seroprevalansının araştırılması. Mikrobiyol Bul 2010; 44(3): Ergünay K, Saygan MB, Aydoğan S, et al. West Nile virus seroprevalence in blood donors from Central Anatolia, Turkey. Vector Borne Zoonotic Dis 2010; 10(8): Arpaci F, Cetin T, Kubar A, et al. West Nile virus infection in a patient with acute graft-versus-host disease. Haematologica 2009; 94(Suppl 2): Sener K, Yapar M, Koru O, Kubar A. Detection of West Nile virus in a patient with acute graft-versus-host disease by using a new developed one-step real time RT-PCR. J Clin Virol 2009; 46(Suppl 1): Ergünay K, Özkul A. Ankara bölgesinde nedeni bilinmeyen santral sinir sistemi enfeksiyonu olgularında saptanan Batı Nil virusu seropozitifliğinin doğrulanması. Mikrobiyol Bul 2011; 45(2): Ergünay K, Aydoğan S, Menemenlioğlu D, et al. Ankara bölgesinde nedeni bilinmeyen merkezi sinir sistemi enfeksiyonlarında Batı Nil virusunun araştırılması. Mikrobiyol Bul 2010; 44(2): Sambrook J, Fritsch EF, Maniatis T. Appendices B16. Molecular Cloning. 1998, 2 nd ed. Cold Spring Harbor Laboratory Press, New York. 17. Yapar M, Aydogan H, Pahsa A, et al. Rapid and quantitative detection of Crimean-Congo haemorrhagic fever virus by one-step real-time reverse transcriptase-pcr. Japanese J Infect Dis 2005; 58(6): Kubar A, Yapar M, Besirbellioglu B, Avcı IY, Guney C. Rapid and quantitative detection of mumps virus RNA by one-step real-time RT-PCR. Diagn Microbiol Infect Dis 2004; 49(2): Rabel PO, Planitzer CB, Farcet MR, et al. Increasing West Nile virus antibody titres in central European plasma donors from 2006 to Euro Surveill 2011; 16(10): pii: Murray KO, Mertens E, Despres P. West Nile virus and its emergence in the United States of America. Vet Res 2010; 41(6): Biggerstaff BJ, Petersen LR. Estimated risk of transmission of the West Nile virus through blood transfusion in the US, Transfusion 2003; 43(8):




Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya


Batı Nil Virusu: Viroloji, Epidemiyoloji ve Mikrobiyolojik Tanı

Batı Nil Virusu: Viroloji, Epidemiyoloji ve Mikrobiyolojik Tanı Viroloji, Epidemiyoloji ve Mikrobiyolojik Tanı Yrd. Doç.Dr. Koray Ergünay Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD. Viroloji Ünitesi Yapı ve Sınıflandırma Zarflı RNA virusu 40-60 nm


Geliş Tarihi (Received): 05.08.2010 Kabul Ediliş Tarihi (Accepted): 21.10.2010

Geliş Tarihi (Received): 05.08.2010 Kabul Ediliş Tarihi (Accepted): 21.10.2010 Özgün Çalışma/Original Article Mikrobiyol Bul 2011; 45(1): 113-124 Hacettepe Üniversitesi Hastanesi Kan Donörlerinde Batı Nil Virusu Seroprevalansının Araştırılması ve Pozitif Sonuçların Plak Redüksiyon



VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Viroloji Ünitesi Viral Enfeksiyonlar... Klinik


Vektör kaynaklı Viral Enfeksiyonlar. Koray Ergünay

Vektör kaynaklı Viral Enfeksiyonlar. Koray Ergünay Vektör kaynaklı Viral Enfeksiyonlar Koray Ergünay Arbovirus... (arthopod-borne virus) Artropod vektörler ile vertebralılar arasında nakledilen viruslar Robovirus... (rodent-borne virus) Kemirici (rodent)


Konjenital CMV Enfeksiyonu: Türkiye deki Durum

Konjenital CMV Enfeksiyonu: Türkiye deki Durum Konjenital CMV Enfeksiyonu: Türkiye deki Durum Dr. Dilek Çolak Akdeniz Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Viroloji Bilim Dalı Türkiye de Konjenital CMV Enfeksiyonu Prevalansı


Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi

Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi Aylin Altay Koçak 1, İpek Tüney 2, Koray Ergünay 2, Alp Usubütün 3, Kunter Yüce 4, Ahmet


Batı Nil Virüsü Ansefaliti

Batı Nil Virüsü Ansefaliti Batı Nil Virüsü Ansefaliti Alpay AZAP, Oktay MEÇO Ankara Üniversitesi, Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı, Ankara Etken ve Epidemiyoloji Batı Nil Virüsü (BNV)


BATI NİL ATEŞİ. Yrd. Doç. Dr. Sema ALP ÇAVUŞ. Dokuz Eylül Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD.

BATI NİL ATEŞİ. Yrd. Doç. Dr. Sema ALP ÇAVUŞ. Dokuz Eylül Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. BATI NİL ATEŞİ Yrd. Doç. Dr. Sema ALP ÇAVUŞ Dokuz Eylül Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. 25 Nisan 2013 İçerik Tarihçe Epidemiyoloji Mikrobiyoloji Patogenez



HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik


Yrd. Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD. Viroloji Ünitesi

Yrd. Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD. Viroloji Ünitesi Hepatit C enfeksiyonlarında yeni bir laboratuvar testi: HCV kor (özyapı) antijeni Yrd. Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD. Viroloji Ünitesi Hepatit


Isırıkla İlgili Literatür İncelemesi

Isırıkla İlgili Literatür İncelemesi Isırıkla İlgili Literatür İncelemesi Prof. Dr. Tuna DEMİRDAL İzmir Katip Çelebi Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları AD, SB Atatürk Eğitim Araştırma Hastanesi Enfeksiyon Kliniği, İzmir Avcılarda


Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi

Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi Bakır M¹, Engin A¹, Kuşkucu MA², Bakır S³, Gündağ Ö¹, Midilli K² Cumhuriyet Üniversitesi


Artropod Kaynaklı Önemli Bir Sağlık Sorunu: Batı Nil Virüsü +

Artropod Kaynaklı Önemli Bir Sağlık Sorunu: Batı Nil Virüsü + DERLEME / REVIEW İnönü Üniversitesi Tıp Fakültesi Dergisi 2011;18(2):132-6. Artropod Kaynaklı Önemli Bir Sağlık Sorunu: Batı Nil Virüsü + Ekrem Kireçci*, Ali Özer**, Hasan Uçmak*** * Sütçü İmam Üniversitesi


Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral

Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral Uludağ Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik


Anti-HIV Pozitif Bulunan Hastada Kesin Tanı Algoritması. Doç. Dr. Kenan Midilli İ.Ü. Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Anti-HIV Pozitif Bulunan Hastada Kesin Tanı Algoritması. Doç. Dr. Kenan Midilli İ.Ü. Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Anti-HIV Pozitif Bulunan Hastada Kesin Tanı Algoritması Doç. Dr. Kenan Midilli İ.Ü. Cerrahpaşa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Testler farklı amaçlarla uygulanabilir: - Tanı, tarama, doğrulama,



TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM Doç. Dr. Alpaslan Alp Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Dünya Sağlık Örgütü 2009 Yılı Raporu Aktif tüberkülozlu hasta



SANTRAL SİNİR SİSTEMİ ENFEKSİYONU ETKENİ ARBOVİRÜSLER Toplantı sunumları Dr.Mehmet Ali Öktem SANTRAL SİNİR SİSTEMİ ENFEKSİYONU ETKENİ ARBOVİRÜSLER Dr. İ. Mehmet Ali ÖKTEM Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı ali.oktem@deu.edu.t








Mersin İli Kan Donörlerinde Flavivirus Seroepidemiyolojisi

Mersin İli Kan Donörlerinde Flavivirus Seroepidemiyolojisi Özgün Çalışma/Original Article Mikrobiyol Bul 2014; 48(4): 606617 Mersin İli Kan Donörlerinde Flavivirus Seroepidemiyolojisi Flavivirus Seroepidemiology in Blood Donors in Mersin Province, Turkey Seda


Servikal Sürüntü Örneklerinde İki Farklı Yöntemle HPV-DNA Varlığının Araştırılması: MY09/11 Konsensus PCR ve Tipe Özgül Gerçek Zamanlı PCR

Servikal Sürüntü Örneklerinde İki Farklı Yöntemle HPV-DNA Varlığının Araştırılması: MY09/11 Konsensus PCR ve Tipe Özgül Gerçek Zamanlı PCR Özgün Çalışma/Original Article Mikrobiyol Bul 2012; 46(4): 624-636 Servikal Sürüntü Örneklerinde İki Farklı Yöntemle HPV-DNA Varlığının Araştırılması: MY09/11 Konsensus PCR ve Tipe Özgül Gerçek Zamanlı


Gebede HSV İnfeksiyonu. Dr. Süda TEKİN KORUK Koç Üniversitesi Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Bölümü

Gebede HSV İnfeksiyonu. Dr. Süda TEKİN KORUK Koç Üniversitesi Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Bölümü Gebede HSV İnfeksiyonu Dr. Süda TEKİN KORUK Koç Üniversitesi Hastanesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Bölümü Olgu 14 günlük, erkek bebek Şikayeti: Sol kol ve bacakta kasılma, emmeme Hikaye:


ENFEKSİYON RİSKİNİ AZALTMA YÖNTEMLERİ. Prof.Dr.Halis Akalın Uludağ Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Enfeksiyon Hastalıkları AD

ENFEKSİYON RİSKİNİ AZALTMA YÖNTEMLERİ. Prof.Dr.Halis Akalın Uludağ Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Enfeksiyon Hastalıkları AD ENFEKSİYON RİSKİNİ AZALTMA YÖNTEMLERİ Prof.Dr.Halis Akalın Uludağ Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Enfeksiyon Hastalıkları AD Yıllık Bireysel Riskler Yüksek(>1:100): Suçiçeği bulaşı, anneden


Kan vericilerde HBsAg, anti-hcv, anti-hiv ve Sifilis seroprevalansı

Kan vericilerde HBsAg, anti-hcv, anti-hiv ve Sifilis seroprevalansı 22 Orjinal Makaleler doi:10.5505/sakaryamj.2011.35744 Original Articles Sakarya Medical Journal Kan vericilerde HBsAg, anti-hcv, anti-hiv ve Sifilis seroprevalansı HBsAg, anti-hcv, anti-hiv and syphilis








Sekiz Aylık Dönemde Laboratuvarımızda Saptanan Hepatit B ve Hepatit D Seroprevalansı*

Sekiz Aylık Dönemde Laboratuvarımızda Saptanan Hepatit B ve Hepatit D Seroprevalansı* Araştırma Sekiz Aylık Dönemde Laboratuvarımızda Saptanan Hepatit B ve Hepatit D Seroprevalansı* Kadriye KART YAŞAR, Filiz PEHLİVANOĞLU, Gönül ŞENGÖZ Haseki Eğitim ve Araştırma Hastanesi, Enfeksiyon Hastalıkları


Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE


Kırklareli Devlet Hastanesi Kan Merkezine Başvuran Donörlerde HBV, HCV ve HIV Seroprevalansı: Retrospektif Bir Çalışma

Kırklareli Devlet Hastanesi Kan Merkezine Başvuran Donörlerde HBV, HCV ve HIV Seroprevalansı: Retrospektif Bir Çalışma Araştırma Kırklareli Devlet Hastanesi Kan Merkezine Başvuran Donörlerde HBV, HCV ve HIV Seroprevalansı: Retrospektif Bir Çalışma 1 2 2 2 Derya ŞAHİN, İbrahim ŞAHİN, Faruk SÖZERİ, Kürşad ÖNDER 1 2 Kırklareli


SOLİT ORGAN TRANSPLANTASYONU ve BK VİRUS ENFEKSİYONLARI Doç. Dr. Derya Mutlu Güçlü immunsupresifler Akut, Kronik rejeksiyon Graft yaşam süresi? Eskiden bilinen veya yeni tanımlanan enfeksiyon etkenleri:


Klinik Mikrobiyoloji de Enzimli İmmün Deney Enzyme Immuno Assay. Dr. Dilek Çolak

Klinik Mikrobiyoloji de Enzimli İmmün Deney Enzyme Immuno Assay. Dr. Dilek Çolak Klinik Mikrobiyoloji de Enzimli İmmün Deney Enzyme Immuno Assay Dr. Dilek Çolak İmmün Yanıt C. Macrophage A. Pathogen B. B cells D. Macrophage E. Macrophage F. T cell G. B cell H. Memory B cells I. Plasma


Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans



HIV TANISINDA YENİLİKLER HIV TANISINDA YENİLİKLER Uzm.Dr. Tülin DEMİR Ülkemizde güncel durum 1985 yılı-mayıs 2016 tarihi itibari ile; Doğrulama testi (+) tespit edilerek bildirimi yapılan toplam vaka sayısı= 12 542 2015 yılı


İklim ve vektör bağımlı güncel viral enfeksiyonlar

İklim ve vektör bağımlı güncel viral enfeksiyonlar İklim ve vektör bağımlı güncel viral enfeksiyonlar Prof.Dr. Ayşen Gargılı Marmara Üniversitesi Enfeksiyon Hastalıkları ve Epidemiyoloji Araştırma Merkezi Ulusal Kan Merkezler ve Transfüzyon Tıbbı Kursu


Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL


Gebelerde Rubella (Kızamıkçık) Yrd.Doç.Dr.Çiğdem Kader

Gebelerde Rubella (Kızamıkçık) Yrd.Doç.Dr.Çiğdem Kader Gebelerde Rubella (Kızamıkçık) Yrd.Doç.Dr.Çiğdem Kader OLGU 1 İkinci çocuğuna hamile 35 yaşında kadın gebeliğinin 6. haftasında beş yaşındaki kız çocuğunun rubella infeksiyonu geçirdiğini öğreniyor. Küçük


KIRIM KONGO KANAMALI ATEŞİ (KKKA) Muğla Sıtkı Koçman Üniversitesi Tıp Fakültesi Eğitim ve Araştırma Hastanesi Enfeksiyon Kontrol Komitesi 2015

KIRIM KONGO KANAMALI ATEŞİ (KKKA) Muğla Sıtkı Koçman Üniversitesi Tıp Fakültesi Eğitim ve Araştırma Hastanesi Enfeksiyon Kontrol Komitesi 2015 KIRIM KONGO KANAMALI ATEŞİ (KKKA) Muğla Sıtkı Koçman Üniversitesi Tıp Fakültesi Eğitim ve Araştırma Hastanesi Enfeksiyon Kontrol Komitesi 2015 KKKA-Türkiye 2002 yılının ilkbahar ve yaz aylarında özellikle,


Ensefalitlerde Akılcı Antiviral Kullanımı

Ensefalitlerde Akılcı Antiviral Kullanımı Ensefalitlerde Akılcı Antiviral Kullanımı Prof. Dr. Hakan Erdem GATA Enf.Hast ve Kl.Mik.A.D. 1. Risk analizi 2. Klinik tablo 3. Mikrobiyolojik tanı 4. Radyolojik tanı 5. EEG 6. Sürecin yönetimi, akış şeması


Türkiye de Arboviral İnfeksiyonların Laboratuvar Tanısı. Uzm. Dr. Dilek Yağcı Çağlayık 28 Mart 2015, Antalya

Türkiye de Arboviral İnfeksiyonların Laboratuvar Tanısı. Uzm. Dr. Dilek Yağcı Çağlayık 28 Mart 2015, Antalya Türkiye de Arboviral İnfeksiyonların Laboratuvar Tanısı Uzm. Dr. Dilek Yağcı Çağlayık 28 Mart 2015, Antalya Genel Hatlar/ Öğrenim Hedefleri Ülkemizde tanı konulabilen Arboviruslar Arboviral infeksiyonlarda


RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod





GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60

GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60 Dr. Tolga BAŞKESEN GİRİŞ Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi ABD de yılda 200.000 KDE, mortalite % 35-60 Erken ve doğru tedavi ile mortaliteyi azaltmak mümkün GİRİŞ Kan


Olgu Sunumu (İmmünyetmezlikli hastada viral enfeksiyonlar) Dr. A. Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD

Olgu Sunumu (İmmünyetmezlikli hastada viral enfeksiyonlar) Dr. A. Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Olgu Sunumu (İmmünyetmezlikli hastada viral enfeksiyonlar) Dr. A. Arzu Sayıner Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Olgu Dört ay önce eşinden böbrek nakli yapılan 62 yaşındaki



PERSONEL YARALANMALARI İZLEM TALİMATI Hazırlayan Kontrol eden Onaylayan Enfeksiyon Kontrol Komitesi Kalite Yönetim Direktörü Hastane Yöneticisi 1.AMAÇ Hasta kanı ve/veya diğer vücut sıvıları ile parenteral veya mukoza yoluyla temas eden sağlık








REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Yrd. Doç. Dr. Umut Fahrioğlu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü



VİRAL TANI KİTLERİ (GFJ-480) VİRAL TANI KİTLERİ (GFJ-480) CMV PCR Tanı Kiti Cytomegalovirus un Konvensiyonel PCR yöntemiyle tanınması. HHV-5 olarak da bilinen Sitomegalovirüs, herpes virus ailesinin bir üyesidir. Oldukça sık görülen






İnfluenza A VİROLOJİ-EPİDEMİYOLOJİ. Prof. Dr. Tamer ŞANLIDAĞ VİROLOJİ-EPİDEMİYOLOJİ Prof. Dr. Tamer ŞANLIDAĞ İnfluenza pandemileri H2N2 H2N2 H1N1 H1N1 H3N8 H3N2 Pandemic H1N1 1895 1905 1915 1925 1955 1965 1975 1985 1995 2005 2010 2015 1889 Russian influenza H2N2


Ankara İlinde Batı Nil Virusu Köken-1 Kaynaklı Bir Merkezi Sinir Sistemi Enfeksiyonu Olgusu*

Ankara İlinde Batı Nil Virusu Köken-1 Kaynaklı Bir Merkezi Sinir Sistemi Enfeksiyonu Olgusu* Olgu Sunumu/Case Report Mikrobiyol Bul 2013; 47(1): 164-172 Ankara İlinde Batı Nil Virusu Köken-1 Kaynaklı Bir Merkezi Sinir Sistemi Enfeksiyonu Olgusu* A Case of Central Nervous System Infection Due to


Anti-HIV Pozitif Bir Hastada Saptanan Akut Toskana Virus Enfeksiyonu*

Anti-HIV Pozitif Bir Hastada Saptanan Akut Toskana Virus Enfeksiyonu* Olgu Sunumu/Case Report Mikrobiyol Bul 2014; 48(1): 168-173 173 Anti-HIV Pozitif Bir Hastada Saptanan Akut Toskana Virus Enfeksiyonu* Acute Toscana Virus Infection in an Anti-HIV Positive Patient Ferit


Gebelikte İnfeksiyonların Değerlendirilmesi

Gebelikte İnfeksiyonların Değerlendirilmesi Gebelikte İnfeksiyonların Değerlendirilmesi Ergin AYAŞLIOĞLU Kırıkkale Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D Gebelikte İnfeksiyonların Değerlendirilmesi Maternal


Doğrudan klinik örnekte hızlı tanı. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR

Doğrudan klinik örnekte hızlı tanı. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR Doğrudan klinik örnekte hızlı tanı Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR TİCARİ KONVANSİYONEL PCR SİTEMLERİ TİCARİ REAL-TIME PCR SİTEMLERİ IN-HOUSE















VİROLOJİYE GİRİŞ. Dr. Sibel AK VİROLOJİYE GİRİŞ Dr. Sibel AK Bugün; Virüs nedir? Virüslerin sınıflandırılması Virüsler nasıl çoğalır? Solunum yoluyla bulaşan viral enfeksiyonlar Gıda ve su kaynaklı viral enfeksiyonlar Cinsel temas yoluyla


İstanbul Bölgesi Kan Donörlerinde HBsAg, Anti-HCV ve Anti-HIV Seroprevalansı

İstanbul Bölgesi Kan Donörlerinde HBsAg, Anti-HCV ve Anti-HIV Seroprevalansı Araştırma İstanbul Bölgesi Kan Donörlerinde HBsAg, Anti-HCV ve Anti-HIV Seroprevalansı Özlem ALTUNTAŞ AYDIN, Hayat KUMBASAR KARAOSMANOĞLU, Asuman KÖKREK, M. Emirhan IŞIK, Özcan NAZLICAN Haseki Eğitim ve


Hepatit B Hasta Takibi Nasıl Yapılmalı?

Hepatit B Hasta Takibi Nasıl Yapılmalı? Hepatit B Hasta Takibi Nasıl Yapılmalı? Yrd. Doç. Dr. Kaya Süer Yakın Doğu Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Sunum Planı Giriş HBsAg Pozitifliği Kronik Hepatit



SIĞIRLARIN NODÜLER EKZANTEMİ LUMPY SKIN DISEASE (LSD) Hastalık Kartı. Hazırlayan. Dr. M. Fatih BARUT Vet. Hekim SIĞIRLARIN NODÜLER EKZANTEMİ LUMPY SKIN DISEASE (LSD) Hastalık Kartı Hazırlayan Dr. M. Fatih BARUT Vet. Hekim Etlik Veteriner Kontrol Merkez Araştırma Enstitüsü Virolojik Teşhis Laboratuvarı Etken: Etken,


RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500


Yrd.Doç.Dr. Özgür Günal Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

Yrd.Doç.Dr. Özgür Günal Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Yrd.Doç.Dr. Özgür Günal Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD HÇ, 28 yş, E, Memur 2010 yılı ocak ayında kan bağışı sırasında sarılık olduğu söyleniyor. Başvuru sırasında bazen halsizlik ve


Mersin Bölgesi Kan Donörlerinde Flebovirus Maruziyetinin Serolojik Olarak Araştırılması

Mersin Bölgesi Kan Donörlerinde Flebovirus Maruziyetinin Serolojik Olarak Araştırılması Özgün Çalışma/Original Article Mikrobiyol Bul 2015; 49(3): 403-413 Mersin Bölgesi Kan Donörlerinde Flebovirus Serological Investigation of Phlebovirus Exposure in Blood Donors from the Mediterranean Province






KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7



PERSONEL YARALANMALARI İZLEM TALİMATI Sayfa No 1 / 5 Hazırlayan İnceleyen Onaylayan Enfeksiyon Kontrol Komitesi Kalite Yönetim Temsilcisi Başhekim 1.AMAÇ Hasta kanı ve/veya diğer vücut sıvıları ile parenteral veya mukoza yoluyla temas eden


TİCK BORNE ENCEPHALİTİS. Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı

TİCK BORNE ENCEPHALİTİS. Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı TİCK BORNE ENCEPHALİTİS Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı ARBOVİRUS Giriş CCHF WEST NİLE VİRUS (Manisa vs) TBE Asya ve Avrupa Sinir sistemi enfeksiyonu Kırsal alan Sosyo-ekonomik durum Mevsimsel



HANTAVİRUSLAR VE TÜRKİYE DEKİ EPİDEMİYOLOJİK DURUM HANTAVİRUSLAR VE TÜRKİYE DEKİ EPİDEMİYOLOJİK DURUM Dr. İ. Mehmet Ali ÖKTEM Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı ali.oktem@deu.edu.tr BUNYAVIRIDAE Genus Bunyavirus Genus


HEPATİT DELTA Klinik Özellikler, Tanı ve Tedavi. Prof. Dr. Mustafa Kemal ÇELEN Diyarbakır

HEPATİT DELTA Klinik Özellikler, Tanı ve Tedavi. Prof. Dr. Mustafa Kemal ÇELEN Diyarbakır HEPATİT DELTA Klinik Özellikler, Tanı ve Tedavi Prof. Dr. Mustafa Kemal ÇELEN Diyarbakır HDV 1700 nükleotidden oluşmaktadır Delta Ag S (22 kda) 195 aminoasit L (24 kda) 214 aminoasit Delta Ag ni 4 ayrı


Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı?

Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı? Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı? Muharrem ÇİÇEK, Banu SANCAK, Burçin ŞENER Hacettepe Üniversitesi


J Popul Ther Clin Pharmacol 8:e257-e260;2011



Gebelik ve Enfeksiyonlar. Prof.Dr. Levent GÖRENEK

Gebelik ve Enfeksiyonlar. Prof.Dr. Levent GÖRENEK Gebelik ve Enfeksiyonlar Prof.Dr. Levent GÖRENEK Olgulara Yaklaşım 2 1. TORCH grubu enfeksiyon etkenleri nelerdir? Toxoplasmosis Other (Sifiliz, Varicella zoster ) Rubella Cytomegalovirus Herpes simplex






HIV ENFEKSİYONUNUN PATOFİZYOLOJİSİ VE DOĞAL SEYRİ HIV ENFEKSİYONUNUN PATOFİZYOLOJİSİ VE DOĞAL SEYRİ Dr. Hayat Kumbasar Karaosmanoğlu Haseki Eğitim ve Araştırma Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Sunum Planı HIV in morfolojik ve


Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri

Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Emel AZAK, Esra Ulukaya, Ayşe WILLKE Kocaeli Üniversitesi Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik





Mikrobiyolojide Kalite İndikatörü Örnekleri

Mikrobiyolojide Kalite İndikatörü Örnekleri Mikrobiyolojide Kalite İndikatörü Örnekleri Dr. Ü. Gül Erdem SB. DışkapıYıldırım Beyazıt Eğitim ve Araştırma Hastanesi Tıbbi Mikrobiyoloji Bölümü KLİMUD-2013 [idrar kültürü] * [lökosit/alan] * [CRP] [hastanın





Tatarcık Ateşi Doç. Dr. Üner Kayabaş İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Malatya

Tatarcık Ateşi Doç. Dr. Üner Kayabaş İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Malatya Tatarcık Ateşi Doç. Dr. Üner Kayabaş İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Malatya uner.kayabas@inonu.edu.tr Tatarcık-Yakarca (Filebotom) Takım:


CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı?

CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı? CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı? Maternal inf.tanısı Fetal inf.tanısı Yenidoğan inf.tanısı Bir test sonucunun doğru yorumlanabilmesi, testin tanı doğruluğunun bilinmesi


Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi

Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi Muhammet





HIV/AIDS Türkiye de Mevcut Durum. Dr. M. Arzu YETKİN Ankara Numune Eğitim ve Araştırma Hastanesi

HIV/AIDS Türkiye de Mevcut Durum. Dr. M. Arzu YETKİN Ankara Numune Eğitim ve Araştırma Hastanesi HIV/AIDS Türkiye de Mevcut Durum Dr. M. Arzu YETKİN Ankara Numune Eğitim ve Araştırma Hastanesi Mortality and Morbidity Weekly Report, 1981 Daha önceden sağlıklı beş hastada Pneumocystis carinii pnömonisi








Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak BİYOFİZİK 2015 1 Amaç Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak 2 Hedefler Bu pratiğin sonunda öğrenciler, polimeraz zincir






MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ Doç.Dr. Aynur KARADENİZLİ Kocaeli Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Francisella tularensis Küçük, aerobik, pleomorfik,


Gebelikte Viral Enfeksiyonlar

Gebelikte Viral Enfeksiyonlar Gebelikte Viral Enfeksiyonlar Prof. Dr. Sabahattin ALTUNYURT Dokuz Eylül Üniversitesi Tıp Fakültesi Kadın Hastalıkları ve Doğum ABD Perinatoloji BD 2016 İzmir Gebelikte Viral Enfeksiyonlar Gebelikte geçirilen


ÖZGEÇMĠġ A. KĠMLĠK BĠLGĠLERĠ. Doğum Yeri ve Tarihi Bayburt 28.04.1965. T.C.Kimlik No: 19840912374 Medeni Durum

ÖZGEÇMĠġ A. KĠMLĠK BĠLGĠLERĠ. Doğum Yeri ve Tarihi Bayburt 28.04.1965. T.C.Kimlik No: 19840912374 Medeni Durum ÖZGEÇMĠġ A. KĠMLĠK BĠLGĠLERĠ Adı Ziyacibali Soyadı Açıkgöz Doğum Yeri ve Tarihi Bayburt 28.04.1965 Cinsiyet Erkek Uyruk T.C. T.C.Kimlik No: 19840912374 Medeni Durum Evli Yabancı Dil İngilizce Adres YBU-Atatürk



EĞİTİM SONRASI BAŞARI ÖLÇME FORMU EĞİTİM SONRASI BAŞARI ÖLÇME FORMU KATILIMCI: GÖREV YERİ: 1. Transfüzyon tarihindeki önemli buluşu (ABO antijenleri tanımı) ile Nobel ödülü alan bilim adamı kimdir? a. Robert Cook b. Anthony Van Löwenhook





Malatya'da Bir Toplu Konut İnşaatı Alanındaki İşçilerde Tatarcık Ateşi Salgını: Epidemiyolojik, Klinik Özellikler ve Salgın Kontrolü Çalışmaları

Malatya'da Bir Toplu Konut İnşaatı Alanındaki İşçilerde Tatarcık Ateşi Salgını: Epidemiyolojik, Klinik Özellikler ve Salgın Kontrolü Çalışmaları [SS-03] Malatya'da Bir Toplu Konut İnşaatı Alanındaki İşçilerde Tatarcık Ateşi Salgını: Epidemiyolojik, Klinik Özellikler ve Salgın Kontrolü Çalışmaları Üner Kayabaş, Dilek Yağcı Çağlayık, Mahmut Sünnetçioğlu,



REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda


Dr. Funda Şimşek SB Okmeydanı EAH Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji

Dr. Funda Şimşek SB Okmeydanı EAH Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Dr. Funda Şimşek SB Okmeydanı EAH Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Sunum Kapsamı HCV tanımı HCV enfeksiyonunun seyri Epidemiyoloji HCV genotiplerinin önemi, dağılımı Laboratuvarımızdaki



VİRAL GASTROENTERİTLER. Dr. Fatma SIRMATEL 30.1.2013 VİRAL GASTROENTERİTLER Dr. Fatma SIRMATEL 30.1.2013 Viral gastroenteritler Her yıl yeni enterik viruslar izole edilmektedir. Her yıl 2.2. milyon insan AGE nedeni ile ölmektedir Rotaviruslar < 2 çocuklarda
