Apis mellifera ALT TÜRLERĠNDE PROMELLĠTĠN GEN ĠFADESĠNĠN KARġILAġTIRILMASI

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Apis mellifera ALT TÜRLERĠNDE PROMELLĠTĠN GEN ĠFADESĠNĠN KARġILAġTIRILMASI"

Transkript

1 ÖZEL EGE LĠSESĠ Apis mellifera ALT TÜRLERĠNDE PROMELLĠTĠN GEN ĠFADESĠNĠN KARġILAġTIRILMASI HAZIRLAYAN ÖĞRENCĠLER: Defne ERÇETĠN & Bartu ĠNCE 2013 ĠZMĠR

2 ĠÇERĠK LĠSTESĠ PROJENĠN ADI PROJENĠN AMACI GĠRĠġ YÖNTEM SONUÇLAR ve TARTIġMA...9 ÖNERĠLER 11 TEġEKKÜR KAYNAKLAR

3 PROJENĠN AMACI Bu projede Türkiye de bal üretimi için kullanılan üç farklı bal arısı alt türünün (A. melliferae anatolica, A. melliferae italiana, A. melliferae caucasian) zehrinde bulunan mellitin proteininin üretimini kodlayan promellitin geninin ifadesinin karģılaģtırılması amaçlanmıģtır. GĠRĠġ 21. yüzyılda dünyamızın karģı karģıya kaldığı en önemli küresel sorunların baģında küresel iklim değiģimi (CO 2, kuraklık ve sıcaklık gibi), yetersiz enerji ve besin üretimi gelmektedir. Küresel iklim değiģikliklerine neden olan insan etkinlikleri aynı zamanda kirlenme ve toprak erozyonu gibi ikincil çevresel etkileri de Ģiddetlendirmektedir. Ayrıca atmosferdeki CO 2 ve diğer sera gazlarının insana bağlı artıģı sera etkisi olarak bilinen sıcaklık artıģına dolayısıyla kuraklığa da neden olmaktadır. Bu faktörlerin tümü her yıl besin üretiminde büyük kayıplara sebep olmaktadır. Bu nedenle günümüzde bilim adamlarının cevap bulmaya çalıģtığı en önemli sorulardan biri 21. Yüzyılda yeterli besin üretebilecek miyiz? sorusudur. Census Bureau nun 2008 yılında yayınlaģmıģ olduğu rapora göre dünya nüfusunun 2025 yılında 8 milyar, 2040 yılında ise 9 milyar olacağı tahmin edilmektedir [1]. Dolayısıyla önümüzdeki yılda 10 bin yılda ürettiğimiz kadar besin üretmek ve bunu giderek değiģen küresel iklim koģullarına karģı baģarmak zorundayız. USDA (2007) tarafından, dünyada insanların baģlıca gıda kaynağını oluģturan buğday, mısır ve soya fasulyesi stoklarının 2000 yılı ile karģılaģtırıldığında 2016 yılında yaklaģık %30 oranında azalacağı rapor edilmiģtir [2]. ġu an mevcut teknolojiler göz önüne alındığında, günümüzde tüm bu problemlere karģı, biyolojik önlemlerin çözüm olabileceği düģünülmektedir. Örneğin çiçeklenme baģta olmak üzere bitki büyümesinin tüm yönlerinin aydınlatılması gerekmektedir ki zorlu ortam koģullarına rağmen temel besin kaynağımızı oluģturan bitkilerin veriminde azalma meydana gelmesin. Bu nedenle, değiģen iklim koģullarının bir sonucu olarak azalan bitki tozlaģmasının bu olayda görev alan ve dünya ortamına iyi uyum sağladığı bilinen (arthropodlar gibi) canlılar aracılığıyla gerçekleģtirilmesine olanak sağlanmalıdır [3]. Ancak unutulmamalıdır ki tozlaģmada kullanılan bu canlıların sayısındaki artıģ, allerjik bünyeli insanların sağlık sorunlarında artıģa neden olacaktır. Bu amaçla insanlar, yaklaģık bir milyon tür ile temsil edilen arthropoda grubu üyelerinin çok azından (arı, ipek böceği, yengeç vb.) yararlanabilmektedir. Özellikle insanların ve besin olarak kullanılan evcil hayvanların ana besin kaynağını oluģturan çiçekli bitkilerin tozlaģmasında, bir arthropoda grubu üyesi olan Apis melliferae (bal arısı) dan yoğun olarak yararlanılmaktadır. Diğer yandan günümüzde insanların en iyi tanıdığı bal arıları çoğunlukla bal, polen, propolis, arı sütü ve arı zehri üretiminde kullanılmaktadır.

4 Çizelge 1 de görüldüğü gibi yılı verilerine göre kovan sayısı ve bal üretimi bakımından dünyada 2. sırada olan ülkemizin arı ürünlerinin çeģitliliğini arttırması (arı zehri gibi) daha rahat rekabet edebilmesini sağlayacaktır [4]. Çizelge 1: Dünya Kovan Sayısı ve Bal Üretimi Kovan Sayısı Bal Üretimi (Ton) Sıra Ülke Adı Sıra Ülke Adı Çin 8,777,150 8,777,150 1 Çin 407, ,000 2 Türkiye 5,339,220 5,602,670 2 Türkiye 82,003 81,115 3 Etyopya 4,598,230 4,598,230 3 ABD 66,413 79,789 4 Ġran 3,500,000 3,500,000 4 Ukrayna 74,000 70,800 5 Rusya 2,975,620 3,041,480 5 Arjantin 62,000 59,000 6 Arjantin 2,970,000 2,970,000 6 Meksika 56,071 55,684 7 Tanzanya 2,700,000 2,700,000 7 Rusya 53,598 54,000 8 Kenya 2,510,000 2,510,000 8 Ġran 46,000 47,000 9 ABD 2,498,000 2,684,000 9 Etyopya 40,688 45, Ġspanya 2,425,000 2,425, Brezilya 38,764 44, K. Kore 1,988,000 1,900, Hindistan 43,865 39,500 Dünya Toplamı 65,386,783 66,172,109 Dünya Toplamı 1,534,998 1,541,282 (FAOSTAT, 2012) Arı yetiģtiriciliği ve bal üretiminde temel etken olan iklim Ģartları, coğrafik koģullar ve ballı bitki örtüsünün uygun olması, ülkemiz açısından büyük bir Ģans olarak görülmekte ve dünyada mevcut ballı bitki tür ve çeģitlerin yüzde 75 inin Türkiye de bulunması büyük bir doğal zenginlik olarak ön plana çıkmaktadır. ÇeĢitli bölgelerimizin kır, ova, yayla ve meralarında farklı tarihlerde ballı bitkiler çiçek açmakta, bol ve kaliteli nektar salgılamaktadırlar. Bu bölgelerimiz yaz aylarında adeta bir nektar seline dönüģmektedir. Ayrıca mevcut nektar ve polen kaynaklarımızın yalnızca 1/10 unu kullanmakta olduğumuz sık sık öne sürülmektedir. Bu görüģ de, ülkemize ait bal verimi ortalamasını artırmaya yönelik çalıģmalarda materyal olarak kullanılacak ham maddenin ülke potansiyelinde mevcut olduğunu göstermektedir. Ülkemizde önemi henüz kavranmamıģ olmasına rağmen polen, propolis, bal mumu, arı zehiri ve arı sütü gibi ürünler de bal dıģında arıcılığın son derece değerli ürünleri arasında yer almaktadır. Bu ürünler de baģta ilaç, kozmetik olmak üzere önemli bazı sektörlerin vazgeçilmez hammaddeleridir.

5 Arılardan elde edilen bal, balmumu, arı sütü, polen, ana arı ve oğul gibi ürünlerin parasal değeri, arıların tozlanma dolayısıyla bitkisel üretime olan katkılarının yanında oldukça azdır. Yani arıcılık faaliyeti bitkilerde tozlaģmayı sağlayarak bitkisel üretimin nitelik ve niceliğinin artmasında da son derece önemli katkıda bulunmaktadır. Bunun parasal değeri rakamlarla ifade edilemeyecek kadar fazladır. Öyle ki tozlaģma olmadığı zaman bitkisel üretimde %30 gibi bir düģüģ olacağı gerçeği söz konusudur. Yapılan araģtırmalara göre, arıcılığın bitkisel üretime katkısının, bal ve balmumu üretiminden elde edilen gelirlerin toplamından 143 kat daha fazla olduğu bildirilmektedir [5]. Alerjik reaksiyon riski açısından en dikkatli olunması gereken madde, arı zehridir. Arı zehri: Apidiae familyasına mensup bal arılarının (Apis mellifera veya diğer bal arısı türleri ve varyeteleri) abdomeninde bulunan bezlerden salgılanır. Arı zehri iğnenin dip kısmındaki zehir kesesinde toplanır ve içeriğinde baģlıca mellitin, apamin, fosfolipaz A2 ve MCD (Mastcell Degranula-ting) peptid 401 bulunur. Keskin kokulu, acı tatda, sarımtırak renkte, Ģeffaf, hava ile teması hâlinde çabuk kuruyup kristallenen ve asidik özellik gösteren (ph 4,5 5,5) bir maddedir [6]. Bu zehir, günümüzde romatizma, bel ve adale ağrısı, eklem ve sinir iltihaplanması tedavisinde kullanılmaktadır. Kuvvetli bir antibiyotik olan Apitoksin adı verilen tabletler yapılmaktadır. Arı zehri, atardamarlardaki kan akıģının hızını değiģtirmekte, kanı sulandırmakta ve pıhtılaģmayı önlemektedir. Bu da kalp hastalığı ve yüksek tansiyon riskini azaltmaktadır. Buna ek olarak; yapılan araģtırmalarda, zehrin mikroenjeksiyon yardımıyla ağrılı bölgeye uygulanmasıyla (apiterapötik akupunktur) nörolojik lumbago ve siyatikte %88 baģarı sağlandığı belirtilmektedir. Arı zehri, yukarıda belirtilen tüm bu alanlarda kullanılmasına rağmen günümüzde hala arı zehrinin kalitesi için uluslararası bir standart henüz yoktur. Bu nedenle arı zehrinin içindeki allerjik maddelerin ayrıģtırılması farklı hastalık gruplarına etken maddelerin ayrı ayrı ve belirlenen dozlarda uygulanabilmesi için arı zehri içindeki mellitin, apamin, dopamin vb. maddelerin standardizasyonu yapılmalıdır. Bal arılarının ürettiği arı zehrinden dolayı günümüzde çok sayıda insan alerjik reaksiyonlardan dolayı zarar görmektedir [7]. Apitoksinin (arı zehiri) en aktif komponenti, Melittindir. Melittin, 26 amino asitten (GIGAVLKVLTTGLPALISWIKRKRQQ) oluģan bir peptiddir ve bu peptid arı zehrinin kuru ağırlığının %50 sini oluģturmaktadır [8]. Bu protein, zarların parçalanarak kan hücrelerinin yıkımında rol oynamaktadır. Aynı zamanda histamin salınmasına sebep olarak kan basıncının azalmasına sebep olmaktadır. Yine arı zehirinde ağrı oluģumuna sebep olan komponent, mellitindir. Hem mellitin hem de apamin, vücutta doğal bir steoid olan kortisol salımına sebep olurlar. Mellitin son zamanlarda anti-kanser ajanı olarak da araģtırılmaktadır.

6 Fakat alerjik reaksiyon oluģturduğu için son çalıģmalar bu olumsuzluğu gidermek üzere yapılmaktadır. Bu amaçla; araģtırmamızda üç farklı bal arısı alt türünün (A. melliferae anatolica, A.melliferae italiana, A.melliferae caucasian) zehrindeki ana bileģen olan mellitin proteinin kodlanmasından sorumlu olan promellitin gen ifadelerinin belirlenmesi hedeflenmiģtir. Arı zehrinde bulunan mellitin gibi maddelerin hangi bal arısı alt türünde az, hangi alt türünde çok salgılandığının bilinmesi bal üretimi ve polenizasyonda kullanılacak olan ya da apiterapide kullanılacak potansiyel bal arısı alt türünün belirlenmesine büyük fayda sağlayacaktır. ÇalıĢmamızda materyal olarak kullanılan üç bal arısı alt türünün özellikleri Çizelge 2 de görülmektedir [9]. Çizelge 2: Damızlık bal arısı ırklarına ait özellikler Özellik Anadolu (anatolica) Bal arısı ırklarına ait özellikler Ġtalyan (italiana) Vücut yapısı Orta irilikte Orta irilikte ince - uzun Renk 2. ve 3. karın halkaları turuncu Sarı 1. ve 3. karın halkaları üzeri sarı Kafkas (caucasian) Orta irilikte ince - uzun Koyu gümüģi gri karın halkalarının 3. ve 4. tergit üzeri koyu gri Dil Uzunluğu (mm) 6,3 6,7 6,3 6,6 6,7 7,2 Kubital Ġndeks 2,10 2,32 2,00 2,65 1,90 2,30 Tergit kıl zunluğu (mm) 0,18 0,23 0,20 0,40 0,30 0,40 Keçe kuģak geniģliği (mm) F (sık, gri) 0,80 1,01 F (sık, gri) 1,50 2,80 F (sık, gri) 180 2,90 Ana arının doğum kütlesi en az (mg) ÇiftleĢmemiĢ ana arı kütlesi en az (mg) ÇiftleĢmiĢ ana arı kütlesi en az (mg) Atıcı A, 2012

7 YÖNTEM Materyal temini: Bu çalıģmada, Anadolu bal arısı ekotipi, italyan bal arısı ekotipi ve kafkas bal arısı ekotipleri kullanılmıģtır. Apis melifera alt türlerinin tümüm Ġzmir ilinin bir birine çok yakın olan çiğli ve menenmen ilçelerinden ekim ayında toplanmıģtır. Bal arısı alttürlerinden Apis melliferae anatolica Ege Tarımsal AraĢrırma Enstitüsünden (Menemen- Ġzmir), Apis melliferae italian ve Apis melliferae caucasica ise Çiğli- Ġzmir civarındaki arıcılık yapan çiftçilerden sağlanmıģtır. Arı örnekleri alınmadan önce güvenlik önlemleri (maske, eldiven ve bot giyilerek) alınmıģtır. Arı örneklerinin alınması sırasında geniģ ağızlı cam kavanozlar kullanılmıģtır. Kovanın çıkıģına cam kavanozların ağızları gelecek Ģekilde yerleģtirilmiģ altı tane arı kavanozun içine girinceye kadar beklenmiģ ve daha sonra kavanozun ağzı kapağı ile hızlıca kapatılmıģtır. Arı örnekleri her bir alt tür için 3 ayrı rasgele kovanlardan alınmıģtır. Arıların metabolizmalarını düģürmek için bir süre soğukta bekletilmiģ ve daha sonra arılar kavanozdan özel taģıma kaplarına alınarak laboratuvara kadar canlı olarak gelmeleri sağlanmıģtır. TriPure Isolation kiti (Roche) içerisine atılan örnekler -80 o C de diğer örnekler gelinceye kadar bekletilmiģtir. Örneklerin bir birine yakın zamanlarda ve yakın habitatlardan alınmasına dikkat edilmeye çalıģılmıģtır. Gruplar belirlendikten sonra tüplerin üzerine grubun kodu yazıldı. Arı Örneklerinde Promellitin Gen Ġfade Profillerinin Belirlenmesi: I) Total RNA izolasyonu prosedürü: Toplanan arılar laboratuvara getirildikten sonra TriPure Isolation kiti (Roche) kullanılarak ve aģağıdaki protokol takip edilerek total RNA izolasyonu yapılmıģtır; 1. Her örnek için steril polipropilen santrifüj tüpüne 1 ml TriPure Isolation Reagent kondu ve tüp içine 1 adet arı eklendi 2. Cam-teflon homojenizatör yardımı ile arı dokuları homojenize edildi ve nükleoprotein kompleksinin ayrılması için homojenatlar 25 C de 5 dk inkübe edildi 3. Her örneğe 0.2 ml olacak Ģekilde kloroform eklendi. Tüplerin kapağı kapatıldı ve 15 sn güçlü bir Ģekilde çalkalandı. Daha sonra örnekler 25 C de 15 dk inkübe edildi 4. Faz ayırımı yapmak için +4 C de g de 15 dk santrifüj yapıldı

8 5. Santrifüj sonrasında 3 faz oluģtu (renksiz üst sulu faz RNA izolasyonu için kullanıldı) ve renksiz üst faz polipropilen santrifüj tüpüne aktarıldı 6. Bu fazdan RNA nın çöktürülmesi için 0.5 ml olacak Ģekilde izopropanol eklendi. Tüplerin kapağı kapatıldı ve birkaç kez ters-yüz edildi. Daha sonra örnekler 25 C de 10 dk inkübe edildi C de g de 10 dk santrifüj yapıldı ve süpernatant atıldı ve tüplere 1 ml %75 etanol eklendi ve örnekler vortekslenerek etanolde yıkandı C de 7500 g de 5 dk santrifüj yapıldı ve süpernatant atıldı ve hava akımı ile RNA dan etanol uzaklaģtırıldı 10. RNA pelleti 50 L RNaz-free su ile resüspande edildi. RNA bir pipet yardımı ile çözüldü, 10 dk C de inkübe edildi ve kullanılıncaya kadar -80 C de saklandı. ġekil 1. Arı Örneklerin Homojenizasyonu

9 ġekil 2. Örneklerin santrifüjlenmesi II) Total RNA dan cdna Sentezi: Real-Time PCR cihazında gen ekspresyon profilinin incelenebilmesi için elde edilen total RNA lardan cdna sentezlenmesi gerekmektedir. Bu nedenle cdna sentezi, cdna sentez kiti (Roche) kullanılarak aģağıdaki protokole göre gerçekleģtirilmiģtir; 1. Kullanılan tüm kitler çalıģma öncesinde çözüldü ve birkaç sn santrifüjledi 2. Steril PCR tüplerine Template primer karıģımı hazırlandı: 9.4 l Total RNA ve 2 l Random Hexamer primer (600 pmol/ l) 3. Template primer karıģımını denatüre etmek için tüpler 10 dk 65 C de bekletildi ve hemen buz üzerine alındı 4. Tüplere final hacim 20 l olacak Ģekilde; 4 l Reaksiyon tamponu, 0.5 l RNaz inhibitörü, 2 l Deoksinükleotid karıģımı (dntp), 1.1 l Revers Transkriptaz enzimi ve 1 l DDT eklendi 5. KarıĢım dikkatlice karıģtırıldı (birkaç sn santrifüjlendi) ve termal cycler a kondu

10 6. Revers transkriptaz reaksiyonu için 25 C de 10 dk yı takiben 55 C de 30 dk inkübasyon gerçekleģtirildi C de 5 dk bekletilerek Revers transkriptaz enzimi inaktive edildi ve tüpler soğuk buz üzerine alınarak reaksiyon durduruldu. cdna içeren tüpler kullanılıncaya kadar - 20 C de saklandı. III) Real-Time PCR ile Gen Ekspresyonunun Belirlenmesi: Real-Time PCR cihazında gen ekspresyon profilinin incelenebilmesi için LightCycler SYBR Green kiti (Roche) kullanılarak aģağıdaki protokol uygulanmıģtır; 1. Ġki gen (Beta actin ve promellitin) için 2 tüp hazırlandı 2. PCR karıģımı hazırlandı (1 tüp için): 11 l dh2o, 1.6 l Mg+2, 0.2 l F primer, 0.2 l R primer ve 2 l SYBR Green I enzim karıģımı 3. LightCycler kapiller tüpleri soğuk akü üzerine yerleģtirildi ve 18 l PCR karıģımı kapiller tüplere aktarıldı 4. Üzerine 2 l cdna ilave edildi ve kapakları kapatıldı 5. Kapiller tüpler 5 sn 700 g de santrifüjlendi. Kapiller tüpler Roche 1.5 LightCycler cihazına yerleģtirildi. LightCycler koģulları: Denatürasyon: 95 C 10 dk Amplifikasyon: 95 C 10 sn 60 C 10 sn 45 döngü 72 C 10 sn Melting: 95 C 15 sn 60 C 10 sn 1 döngü 95 C 10 sn Soğutma: 40 C 30 sn Kullanılan Primer Sekansları aģağıda verilmiģtir; Beta Actin Forward 5'TGCCAACACTGTCCTTTCTG Reverse 5'AGAATTGACCCACCAATCCA Promellitin Forward 5'GTCAACGTTGCCCTTGTTTTTA Reverse 5'AACCCTGTTGCCTCTTACGTTTA

11 IV) Veri Analizi: Analiz sonunda LightCycler cihazından Ct değerleri elde edilmiģ ve Ct Metodu kullanılarak elde edilen verilerden gen ekspresyon düzeyleri hesaplanmıģtır [10]. SONUÇLAR VE TARTIġMA Arılardan izole edilen total RNA lar, RNA izolasyon kontrolü için Nano-Drop spektrofotometre cihazında ölçüm yapılmıģtır. Elde edilen RNA miktarları Çizelge 3 de görülmektedir. Çizelge 3. Arı alttürlerinden elde edilen RNA konsantrasyonları Nükleik Asit Konsanrasyonu (ng/ L) Örnek No Anatolica Ġtaliana Caucasian ,6 1111,3 2290, ,6 1137,1 2271, ,8 1256,3 2433,7 Yapılan Real-Time PCR analizi sonucunda mellitin gen ekspresyon seviyeleri belirlenmiģtir ve sonuçlar ġekil 3 de görülmektedir. Bu değerlere göre mellitin geni, en fazla italiana alt türünde ifade olmuģtur. Gen ifade seviyesi bakımından daha sonra anatolica ve en son olarak da kafkas alt türü gelmektedir. D Ct Değerleri Mellitin Anatolica Ġtaliana Caucasian ġekil 3. A.mellifera alttürlerinde mellitin gen ekspresyon seviyeleri

12 ÇalıĢmamızda mellitin üretim aktivitesi yüksek olan Apis mellifera italiana arısının, apiterapide eczacılık ve tıp alanlarında mellitin maddesi bakımından potansiyel olduğu saptanmıģtır. Diğer yandan promellitin geni aktivitesinin arttırılması ilaç sanayine büyük katkılar sağlayabilir. Böylece gen aktivitesinin arttırılması ile apiterapik tedavi masraflarının azaltılması sağlanabilir. Dünyada ikinci sırada olduğumuz arıcılık sektörünün ülkemize ekonomik katkılarının artması da sağlanabilir. Bu araģtırmanın (i) insan sağlığını tehdit etmeyecek Ģekilde değiģen iklim koģullarına karģı bitki tozlaģmasını kolaylaģtıracak bal arısı çeģidinin belirleneceği çalıģmalara (ii) arılarda allerjen maddelerin üretimini sağlayan genlerin susturulması çalıģmalarına (iii) hastalık gruplarında kullanılan arı zehirlerinin standardizasyonunun yapılacağı çalıģmalara kaynak olacağı kanısındayız. Arıcılık, toprağa bağımlı bir tarım kolu olmadığı için özellikle ülkemizin kırsal kesimlerinde ve yetersiz veya verimsiz toprağa sahip çiftçilerin bilinçlendirilmesi ve arı ürünlerinin artırılması düģük maliyetli olan arı üretiminin desteklenmesi ülkemiz iģ gücünün ve biyolojik olanaklarının verimli kullanılması bakımından önemlidir. Arıcılığın desteklenmesi, ülkemiz endemik bitkilerinin korunması ve yayılıģ alanlarının daralmasını engelleyebilir. Bu durum, dolaylı olarak ülkemizde ekoturizmin geliģmesine de olanak sağlayacaktır. Koloni yönetimi, hastalıklar, zararlılarla mücadele ve genetik geliģtirme (ıslah) çalıģmaları arıcılığın önemli konularındandır. Genetik geliģtirme yöntemleri kullanılarak bal arılarının ekonomik açıdan önemli olan genetik özellikleri geliģtirilebilir. Bu konu özellikle kendi yerli ırklarına sahip olan ülkelerin gen kaynaklarını koruyup geliģtirmeleri için çok önemlidir. Ülkemiz bal arısı varlığı ve genetik çeģitliliği bakımından dünya üzerinde önemli bir konuma sahiptir. Türkiye nin sahip olduğu farklı ekolojik bölgelere adapte olmuģ genetik çeģitliği yüksek olan bal arısı ırkları diğer ülkelerin bilim adamlarının ve arıcılarının ilgisini çekmektedir. En ünlü örnek ise Brother Adam ın Buckfast bal arısı hattını oluģtururken Anadolu arısını (Apis mellifera anatolica) kullanmasıdır. Brother Adam 1987 yılında yayınladığı kitap da, bu arının birçok karakter yönünden diğer arılardan çok daha üstün olduğunu belirtmiģtir. Bununla beraber Anadolu arısı Türkiye de bulunan 5 arı ırkımızdan sadece birisidir [11].

13 ÖNERĠLER Ülkemizde yayılıģ gösteren bal arıları üzerinde yapılacak genetik çalıģmaların ve arı ürünleri üzerinde tıbbi, eczacılık ve kozmetik alanlarda yapılacak araģtırmaların yararlı olacağı kanısındayız. TEġEKKÜRLER ÇalıĢmalarımız sırasında laboratuvar desteği sağlayan, bilgi ve deneyimlerini paylaģan Ege Üniversitesi Fen Fakültesi Biyoloji Bölümü Öğretim Üyesi Doç. Dr. N. Ülkü KARABAY YAVAġOĞLU ve Yrd. Doç. Dr. A. Hediye SEKMEN ESEN e, arılar ile ilgili bilgilere ulaģmamıza yardımcı olan Ege Üniversitesi Zootekni Bölümünden Yrd. Doç. Dr. Banu YÜCEL e, arı örneklerinin temin edilmesinde yardımcı olan Tarım ve Köy ĠĢleri Bakanlığı Ege Tarımsal AraĢtırma Enstitüsü Müdürlüğü Uzmanı Üzeyir KARACA ve çiftçi Hüseyin ESEN e teģekkür ederiz. Projemiz boyunca bizi bilimsel çalıģmalara teģvik eden, bu konuda her türlü desteği veren Biyoloji öğretmenimiz Mesut Esen e ve okul yöneticilerimize teģekkür ederiz. KAYNAKLAR [1] USDA (Unites States Department of Agriculture) Census of Agriculture, (2007), Cilt 1. [2] USCB (United States Census Bureau), (2008), National population projections. [3] Akın, G., Koca Özer, B., Gültekin, T., (2004), Ġnsanın evrim sürecine ait bir hipotezin değerlendirilmesi, Ankara Üniversitesi Dil ve Tarih-Coğrafya Fakültesi Dergisi, Cilt 44, No 1, sayfa [4] FAO (BirleĢmiĢ Milletler Gıda ve Tarım Örgütü )Statistics Division, (2012), Subat. [5] Sıralı, R., (2010), Arıcılığın Türkiye için önemi, Arıcılık AraĢtırma Dergisi, Cilt 2, Sayı 4, sf:3. [6] Atayoğlu, T., (2012), Apiterapi açısından arı ürünlerinin kalite kriterleri ve stardizasyonu, TSE Standart Ekonomi ve Teknik Dergisi, Cilt 51, Sayı 601, sayfa 73. [7] Yücel, B., (2004), Apiterapi; arı ürünlerinin insan sağlığı üzerindeki önemi, Ege Üniversitesi, Tarımsal Uygulama ve AraĢtırma Merkezi Çiftçi BroĢürü, Kasım, sayfa 4. [8] Domitas, E.M., Hider, R.C., (1987), Honeybee Venom, Bee World, Cilt 68, No 2, sayfa [9] Atıcı, A., (2012), Arıcılık, bal sektörü, ve standartlar, Standart Ekonomik ve Teknik Dergisi, Cilt 51, Sayı 601, sayfa: 12

14 [10] Livak, K.J., Schmittgen, T.D., (2001), Analysis of relative gene expression data using real-time quantitative PCR and the 2(-DeltaDelta C(T) method, Methods,Cilt 25, sayfa [11] Oskay, D., (2003), Türkiye bal arısı ırklarının korunmasının önemi, hastalık ve zararlılar ile mücadelede yeni yaklaģımlar, kolonilerin yönetimi ve genetik yapılarının istenen yönde geliģtirilmesi üzerine model oluģturulması,

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

ARICILIĞA GENEL BAKIŞ

ARICILIĞA GENEL BAKIŞ ARICILIĞA GENEL BAKIŞ TÜRKİYE VE DÜNYADA ARICILIK Dünyada 65 milyon koloni ile 1.5 milyon ton bal üretimi yapılmaktadır. Türkiye ise 5 milyon koloni ile Çin in arkasından 2.,bal üretim miktarı 94.000 ton

Detaylı

Türkiye Arıcılığının Yapısı, Sorunları ve Sürdürülebilir Arıcılık Açısından Değerlendirilmesi. Yrd. Doç. Dr. Ayhan GÖSTERİT

Türkiye Arıcılığının Yapısı, Sorunları ve Sürdürülebilir Arıcılık Açısından Değerlendirilmesi. Yrd. Doç. Dr. Ayhan GÖSTERİT Türkiye Arıcılığının Yapısı, Sorunları ve Sürdürülebilir Arıcılık Açısından Değerlendirilmesi Yrd. Doç. Dr. Ayhan GÖSTERİT Amaç Türkiye arıcılığının yapısı ve sorunlarını ortaya koymak Doğal kaynaklardan

Detaylı

ARI ZEHİRİ BİLEŞİMİ, ÖZELLİKLERİ, ETKİ MEKANİZMASI. Dr. Bioch.Cristina Mateescu APİTERAPİ KOMİSYONU

ARI ZEHİRİ BİLEŞİMİ, ÖZELLİKLERİ, ETKİ MEKANİZMASI. Dr. Bioch.Cristina Mateescu APİTERAPİ KOMİSYONU ARI ZEHİRİ BİLEŞİMİ, ÖZELLİKLERİ, ETKİ MEKANİZMASI Dr. Bioch.Cristina Mateescu APİTERAPİ KOMİSYONU Arı Zehiri - Tanım Arı zehiri, bal arıları tarafından öncelikle memelilere ve diğer iri omurgalılara karşı

Detaylı

ARICILIĞA GİRİŞ İSMEK ARNAVUTKÖY AHMET ALİ YAĞCI VETERİNER HEKİM

ARICILIĞA GİRİŞ İSMEK ARNAVUTKÖY AHMET ALİ YAĞCI VETERİNER HEKİM ARICILIĞA GİRİŞ İSMEK ARNAVUTKÖY AHMET ALİ YAĞCI VETERİNER HEKİM 03.10.2013 G İ R İ Ş-1 ARICILIK; küçük sermaye ve az masrafla ve toprağa bağımlı olmaksızın yapılabilen, kısa sürede gelir getirebilen,

Detaylı

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG)

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) TANIM Canlı hücre içindeki malzemeleri (DNA, Protein, Enzim vb.), hücre yapısının işlevini ve hücreler arasındaki etkileşimi laboratuvar ortamında inceleyerek ortaya çıkaran kişidir. A- GÖREVLER - Canlıları

Detaylı

RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050

Detaylı

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG)

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) TANIM Canlı hücre içindeki malzemeleri (DNA, Protein, Enzim vb.), hücre yapısının işlevini ve hücreler arasındaki etkileşimi laboratuar ortamında inceleyerek

Detaylı

BĠR DEVLET HASTANESĠNDE ÇALIġANLARIN HASTA VE ÇALIġAN GÜVENLĠĞĠ ALGILARININ ĠNCELENMESĠ. Dilek OLUT

BĠR DEVLET HASTANESĠNDE ÇALIġANLARIN HASTA VE ÇALIġAN GÜVENLĠĞĠ ALGILARININ ĠNCELENMESĠ. Dilek OLUT BĠR DEVLET HASTANESĠNDE ÇALIġANLARIN HASTA VE ÇALIġAN GÜVENLĠĞĠ ALGILARININ ĠNCELENMESĠ Dilek OLUT Tıp biliminin ilk ve temel prensiplerinden biri Önce Zarar Verme ilkesidir. Bu doğrultuda kurgulanan sağlık

Detaylı

BULDAN HAYVAN YETİŞTİRİCİLİĞİ

BULDAN HAYVAN YETİŞTİRİCİLİĞİ BULDAN HAYVAN YETİŞTİRİCİLİĞİ Behiye AKSOY(DENGİZ), Nazif EKİCİ Buldan Tarım İlçe Müdürlüğü ÖZET Bu çalışma da Buldan merkez, belde köylerinde hayvan yetiştiriciliği ve yakın gelecekteki durumu incelenmiştir.

Detaylı

Türkiye de hayvancılık sektörünün önündeki sorunları iki ana başlık altında toplamak mümkündür. Bunlar;

Türkiye de hayvancılık sektörünün önündeki sorunları iki ana başlık altında toplamak mümkündür. Bunlar; Tarımı gelişmiş ülkelerin çoğunda hayvancılığın tarımsal üretim içerisindeki payı % 50 civarındadır. Türkiye de hayvansal üretim bitkisel üretimden sonra gelmekte olup, tarımsal üretim değerinin yaklaşık

Detaylı

Protein Ekstraksiyonu

Protein Ekstraksiyonu Protein Ekstraksiyonu Dr.Gaye Güler Tezel Hacettepe Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Proteinler tüm canlı organizmalar için en önemli makromoleküllerden biridir. Bazıları yapısal komponentleri

Detaylı

Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen

Detaylı

DÜNYADA VE TÜRKİYE DE ARICILIK

DÜNYADA VE TÜRKİYE DE ARICILIK A. ANAKARALARIN KOLONİ SAYILARI VE BAL ÜRETİMLERİ DÜNYADA VE TÜRKİYE DE ARICILIK H. Vasfi GENÇER Yasin KAHYA A. Ü. Ziraat Fakültesi Zootekni Bölümü Sayısı ve Bal Üretimi (2002) Gıda ve Tarım Örgütü (FAO)

Detaylı

kosoglumustafa@gthb.gov.tr mustafakosoglu@gmail.com

kosoglumustafa@gthb.gov.tr mustafakosoglu@gmail.com KİŞİSEL BİLGİLER Adı Soyadı Ünvan Uzm. Mustafa KÖSOĞLU Mühendis Dahili 281 E-mail Doğum Tarihi - Yeri kosoglumustafa@gthb.gov.tr mustafakosoglu@gmail.com 17.05.1970- İstanbul EĞİTİM BİLGİLERİ Doktora Üniversite

Detaylı

TÜRKİYE DE VE DÜNYADA YEM SEKTÖRÜNE GENEL BAKIŞ, BEKLENTİLER, FIRSATLAR. Prof. Dr. Nizamettin Şenköylü Genel Sekreter

TÜRKİYE DE VE DÜNYADA YEM SEKTÖRÜNE GENEL BAKIŞ, BEKLENTİLER, FIRSATLAR. Prof. Dr. Nizamettin Şenköylü Genel Sekreter TÜRKİYE DE VE DÜNYADA YEM SEKTÖRÜNE GENEL BAKIŞ, BEKLENTİLER, FIRSATLAR Prof. Dr. Nizamettin Şenköylü Genel Sekreter Gıda Üretimindeki Küresel Güçlükler Nüfus artışı İklim değişikliği Kuraklık Su kaynaklarının

Detaylı

BALIKÇILIK YÖNETİMİ ALGARVE ÜNİVERSİTESİ PORTEKİZ 20.12.2012 / 20.04.2013. Mehmet DİNGİL Su Ürünleri Mühendisi TAGEM

BALIKÇILIK YÖNETİMİ ALGARVE ÜNİVERSİTESİ PORTEKİZ 20.12.2012 / 20.04.2013. Mehmet DİNGİL Su Ürünleri Mühendisi TAGEM BALIKÇILIK YÖNETİMİ ALGARVE ÜNİVERSİTESİ PORTEKİZ 20.12.2012 / 20.04.2013 Mehmet DİNGİL Su Ürünleri Mühendisi TAGEM BALIKÇILIK YÖNETİMİ Portekiz, Faro da bulunan Algarve Üniversitesinin Deniz Bilimleri

Detaylı

Dünyada 3,2 milyon tona, ülkemizde ise 40 bin tona ulaşan pestisit tüketimi bunun en önemli göstergesidir. Pestisit kullanılmaksızın üretim yapılması

Dünyada 3,2 milyon tona, ülkemizde ise 40 bin tona ulaşan pestisit tüketimi bunun en önemli göstergesidir. Pestisit kullanılmaksızın üretim yapılması Pestisit; herhangi bir istenmeyen canlının (zararlı organizma), yayılmasını engelleyen, uzaklaştıran ya da ondan koruyan her türlü bileşik ya da bileşikler karışımıdır. Tarımda pestisitler, zararlı organizmaları

Detaylı

SEL KONTROLUNDA AĞAÇLANDIRMA VE EROZYON KONTROL ÇALIġMALARININ ÖNEMĠ

SEL KONTROLUNDA AĞAÇLANDIRMA VE EROZYON KONTROL ÇALIġMALARININ ÖNEMĠ T.C. ÇEVRE VE ORMAN BAKANLIĞI AĞAÇLANDIRMA VE EROZYON KONTROLU GENEL MÜDÜRLÜĞÜ SEL KONTROLUNDA AĞAÇLANDIRMA VE EROZYON KONTROL ÇALIġMALARININ ÖNEMĠ Hanifi AVCI Genel Müdür ġubat-2011 SEL AFETĠNĠN SEBEBĠ

Detaylı

Gıda Tarım ve Hayvancılık Bakanlığı 2012 YILI TARIMSAL DESTEKLER

Gıda Tarım ve Hayvancılık Bakanlığı 2012 YILI TARIMSAL DESTEKLER Gıda Tarım ve Hayvancılık Bakanlığı 2012 YILI TARIMSAL DESTEKLER A-HAYVANCILIK DESTEKLERİ HAYVANCILIK DESTEKLEMELERİ Hayvan Başı Ödeme Bakanlar Kurulu Kararı MADDE 4- (1) Birime Destek 1 Sütçü ve kombine

Detaylı

ARI ÜRÜNLERİ TÜKETİM DAVRANIŞLARI ÜZERİNE BİR ARAŞTIRMA

ARI ÜRÜNLERİ TÜKETİM DAVRANIŞLARI ÜZERİNE BİR ARAŞTIRMA ARI ÜRÜNLERİ TÜKETİM DAVRANIŞLARI ÜZERİNE BİR ARAŞTIRMA Ulviye KUMOVA (1) Ali KORKMAZ (2) (1) Çukurova Üniversitesi Ziraat Fakültesi Zootekni Bölümü Balcalı / ADANA (2) Alata Bahçe Kültürleri Araştırma

Detaylı

Ġnternet ve Harekât AraĢtırması Uygulamaları

Ġnternet ve Harekât AraĢtırması Uygulamaları Ġnternet ve Harekât AraĢtırması Uygulamaları Cihan Ercan Mustafa Kemal Topcu 1 GĠRĠġ Band İçerik e- Konu\ Mobil Uydu Ağ Genişliği\ e- e- VoIP IpV6 Dağıtma Altyapı QoS ticaret\ Prensip Haberleşme Haberleşme

Detaylı

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE VE GDO UYGULAMALARI GÜVENLİK VE GDO UYGULAMALARI Neslihan ATLIHAN Neslihan ATLIHAN Gıda Yüksek Mühendisi Gıda Yüksek Mühendisi Gıda ve Yem Kontrol

Detaylı

PROJENİN ADI VE KONUSU

PROJENİN ADI VE KONUSU 1 PROJENİN ADI VE KONUSU 100 ADET ARILI - 50 ADET BOŞ KOVANLIK ARICILIK PROJESİ Arıcılık tüm dünyada olduğu gibi ülkemizde de son yıllarda önemli gelişme kaydeden bir sektör haline gelmiştir. Ülke ekonomisine

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

Dünya nüfusunun hızla artması sonucu ortaya çıkan dünyanın artan besin ihtiyacını karşılamak ve birim alandan daha fazla ürün almak amacı ile

Dünya nüfusunun hızla artması sonucu ortaya çıkan dünyanın artan besin ihtiyacını karşılamak ve birim alandan daha fazla ürün almak amacı ile Dünya nüfusunun hızla artması sonucu ortaya çıkan dünyanın artan besin ihtiyacını karşılamak ve birim alandan daha fazla ürün almak amacı ile uygulanan kültürel önlemlerden biri de tarım ilacı uygulamalarıdır.

Detaylı

TOPRAK MAHSULLERİ OFİSİ GENEL MÜDÜRLÜĞÜ

TOPRAK MAHSULLERİ OFİSİ GENEL MÜDÜRLÜĞÜ 2-) T.M.O. İÇ TOPRAK MAHSULLERİ OFİSİ GENEL MÜDÜRLÜĞÜ SAYI: 2013/8 HUBUBAT BÜLTENİ 23.09.2013 1-) TMO HUBUBAT ALIMLARI VE FİYATLARI A- HUBUBAT TÜĠK verilerine göre 2012 yılında 20.100 bin ton buğday, 7.100

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

SULAMA VE ÇEVRE. Küresel Su Bütçesi. PDF created with pdffactory trial version www.pdffactory.com. Yrd. Doç. Dr. Hakan BÜYÜKCANGAZ

SULAMA VE ÇEVRE. Küresel Su Bütçesi. PDF created with pdffactory trial version www.pdffactory.com. Yrd. Doç. Dr. Hakan BÜYÜKCANGAZ Sulama? Çevre? SULAMA VE ÇEVRE Yrd. Doç. Dr. Hakan BÜYÜKCANGAZ SULAMA: Bitkinin gereksinimi olan ancak doğal yağışlarla karşılanamayan suyun toprağa yapay yollarla verilmesidir ÇEVRE: En kısa tanımıyla

Detaylı

2013 YILI DESTEKLEME BİRİM FİYATLARI

2013 YILI DESTEKLEME BİRİM FİYATLARI 013 YILI DESTEKLEME BİRİM FİYATLARI 1 3 MAZOT, GÜBRE VE TOPRAK ANALİZİ DESTEĞİ Mazot Gübre Destekleme Ürün Grupları Destekleme Tutarı Tutarı Peyzaj ve süs bitkileri, özel çayır, mera ve orman emvali alanları,9

Detaylı

"ARI ÜRÜNLERİNDE ÜRETİM ve TÜKETİMİNDE GIDA GÜVENLİĞİ "

ARI ÜRÜNLERİNDE ÜRETİM ve TÜKETİMİNDE GIDA GÜVENLİĞİ "ARI ÜRÜNLERİNDE ÜRETİM ve TÜKETİMİNDE GIDA GÜVENLİĞİ " 5 Temmuz 2012 İstanbul Prof. Dr. Muhsin DOĞAROĞLU Bal ve Diğer Arı Ürünleri ile Sağlık Yaşam Platformu Bal ve Diğer Arı Ürünleri ile Sağlıklı Yaşam

Detaylı

T.C. ÇEVRE VE ORMAN BAKANLIĞI Ağaçlandırma ve Erozyon Kontrolu Genel Müdürlüğü Planlama Dairesi BaĢkanlığı SAYI : B.18.0.AGM.0.01.

T.C. ÇEVRE VE ORMAN BAKANLIĞI Ağaçlandırma ve Erozyon Kontrolu Genel Müdürlüğü Planlama Dairesi BaĢkanlığı SAYI : B.18.0.AGM.0.01. T.C. ÇEVRE VE ORMAN BAKANLIĞI Ağaçlandırma ve Erozyon Kontrolu Genel Müdürlüğü Planlama Dairesi BaĢkanlığı SAYI : B.18.0.AGM.0.01.02- /03/2004 KONU: KardeĢ Ġl Projesi BAKANLIK MAKAMI NA Malumlarınız olduğu

Detaylı

PROJENĠN ÖZETĠ PROJENĠN HEDEFLERĠ PROJENĠN AMACI. GERÇEKLEġTĠRĠLEN FALĠYETLER PROJE TAKVĠMĠ. ULAġILAN SONUÇ KAYNAKÇA PROJE BÜTÇESĠ SEMĠH BAL

PROJENĠN ÖZETĠ PROJENĠN HEDEFLERĠ PROJENĠN AMACI. GERÇEKLEġTĠRĠLEN FALĠYETLER PROJE TAKVĠMĠ. ULAġILAN SONUÇ KAYNAKÇA PROJE BÜTÇESĠ SEMĠH BAL SEMĠH BAL TAYFUN ÖZTÜRK TEKNOLOJĠ VE TASARIM PROJENĠN ÖZETĠ Bu proje ile insanların hayatını kolaylaģtırmak bazı canlıların hayatta kalmasına yardımcı olmak için tasarlanmıģtır. ĠĢ yorgunluğu gündelik

Detaylı

Tarımsal Meteoroloji. Prof. Dr. F. Kemal SÖNMEZ 23 EKİM 2013

Tarımsal Meteoroloji. Prof. Dr. F. Kemal SÖNMEZ 23 EKİM 2013 Tarımsal Meteoroloji Prof. Dr. F. Kemal SÖNMEZ 2 EKİM 201 Prof. Dr. Mustafa Özgürel ve Öğr. Gör. Gülay Pamuk Mengü tarafından yazılan Tarımsal Meteoroloji kitabından faydalanılmıştır. Hava ve İklim ile

Detaylı

LAND DEGRADATİON. Hanifi AVCI AGM Genel Müdür Yardımcısı

LAND DEGRADATİON. Hanifi AVCI AGM Genel Müdür Yardımcısı ARAZİ BOZULUMU LAND DEGRADATİON Hanifi AVCI AGM Genel Müdür Yardımcısı LAND DEGRADATİON ( ARAZİ BOZULUMU) SOİL DEGRADATİON (TOPRAK BOZULUMU) DESERTİFİCATİON (ÇÖLLEŞME) Arazi Bozulumu Nedir - Su ve rüzgar

Detaylı

EGE MELEZÝ BAL ARILARININ ARI SÜTÜ VERÝMLERÝ ÜZERÝNE ETKÝLERÝ. Mete KARACAOÐLU, Mustafa KÖSOÐLU, Aytül UÇAK KOÇ

EGE MELEZÝ BAL ARILARININ ARI SÜTÜ VERÝMLERÝ ÜZERÝNE ETKÝLERÝ. Mete KARACAOÐLU, Mustafa KÖSOÐLU, Aytül UÇAK KOÇ ADÜ Ziraat Fakültesi Dergisi 2004; 1(1) : 29-33 FARKLI YÖNTEMLERÝN EGE EKOTÝPÝ ( A. m. anatolica ) ve KAFKAS (A. m. aucasica) x EGE MELEZÝ BAL ARILARININ ARI SÜTÜ VERÝMLERÝ ÜZERÝNE ETKÝLERÝ ÖZET 1 2 1

Detaylı

SAĞLIK ORTAMINDA ÇALIġANLARDA GÜVENLĠĞĠ TEHDĠT EDEN STRES ETKENLERĠ VE BAġ ETME YÖNTEMLERĠ. MANĠSA ĠL SAĞLIK MÜDÜRLÜĞÜ HEMġĠRE AYLĠN AY

SAĞLIK ORTAMINDA ÇALIġANLARDA GÜVENLĠĞĠ TEHDĠT EDEN STRES ETKENLERĠ VE BAġ ETME YÖNTEMLERĠ. MANĠSA ĠL SAĞLIK MÜDÜRLÜĞÜ HEMġĠRE AYLĠN AY SAĞLIK ORTAMINDA ÇALIġANLARDA GÜVENLĠĞĠ TEHDĠT EDEN STRES ETKENLERĠ VE BAġ ETME YÖNTEMLERĠ MANĠSA ĠL SAĞLIK MÜDÜRLÜĞÜ HEMġĠRE AYLĠN AY GİRİŞ ÇalıĢmak yaģamın bir parçasıdır. YaĢamak nasıl bir insan hakkı

Detaylı

AÇLIĞIN ÖNLENMESĠ ve GIDA GÜVENCESĠNĠN SAĞLANMASI

AÇLIĞIN ÖNLENMESĠ ve GIDA GÜVENCESĠNĠN SAĞLANMASI AÇLIĞIN ÖNLENMESĠ ve GIDA GÜVENCESĠNĠN SAĞLANMASI Yrd. Doç. Dr. Mustafa ERBAġ Sultan ARSLAN A. Nur DURAK Akdeniz Üniversitesi Mühendislik Fakültesi Gıda Mühendisliği Bölümü erbas@akdeniz.edu.tr Sunum Planı

Detaylı

HAYVANSAL KAYNAKLI AMİNO ASİT İÇEREN ORGANİK GÜBRE. Çabamız topraklarımız için. www.letafet.co

HAYVANSAL KAYNAKLI AMİNO ASİT İÇEREN ORGANİK GÜBRE. Çabamız topraklarımız için. www.letafet.co HAYVANSAL KAYNAKLI AMİNO ASİT İÇEREN ORGANİK GÜBRE Çabamız topraklarımız için www.letafet.co LETAMİN BASE HAYVANSAL KAYNAKLI AMİNO ASİT İÇEREN SIVI ORGANİK GÜBRE Letafet Uluslararası Pazarlama Gıda Satış

Detaylı

BAL TANIMI BALIN BİLEŞİMİNİ OLUŞTURAN MADDELER

BAL TANIMI BALIN BİLEŞİMİNİ OLUŞTURAN MADDELER BAL TANIMI Bal, Türk Gıda Kodeksi 2000/39 sayılı Bal Tebliğinde "Bal; bal arılarının çiçek nektarlarını, bitkilerin veya bitkiler üzerinde yaşayan bazı canlıların salgılarını topladıktan sonra, kendine

Detaylı

HEKTAŞ TİCARET T.A.Ş. Sayfa No: 1 SERİ:XI NO:29 SAYILI TEBLİĞE İSTİNADEN HAZIRLANMIŞ YÖNETİM KURULU FAALİYET RAPORU

HEKTAŞ TİCARET T.A.Ş. Sayfa No: 1 SERİ:XI NO:29 SAYILI TEBLİĞE İSTİNADEN HAZIRLANMIŞ YÖNETİM KURULU FAALİYET RAPORU Sayfa No: 1 1. Raporun Dönemi 01.01.2012-30.09.2012 2. Ortaklığın Unvanı HektaĢ Ticaret T.A.ġ. 3. Yönetim ve Denetleme Kurulu Üyeleri Türk Ticaret Kanunu ve ilgili düzenlemeler gereğince ġirketimiz Ana

Detaylı

Bitlis Arıcılık Raporu

Bitlis Arıcılık Raporu Bitlis Arıcılık Raporu Hizan/Bitlis Hazırlayanlar: Yunus ERTAN Kerem AKIN Teşekkür Ederiz Bu raporun hazırlanması sürecinde yardımlarını ve tecrübelerini esirgemeyen Bitlis Arı Yetiştiricileri Birliği

Detaylı

TARIMDA SUYUN ETKİN KULLANIMI. Prof. Dr. Yusuf Ersoy YILDIRIM Yrd. Doç. Dr. İsmail TAŞ

TARIMDA SUYUN ETKİN KULLANIMI. Prof. Dr. Yusuf Ersoy YILDIRIM Yrd. Doç. Dr. İsmail TAŞ TARIMDA SUYUN ETKİN KULLANIMI Prof. Dr. Yusuf Ersoy YILDIRIM Yrd. Doç. Dr. İsmail TAŞ Maksimum Verim Maksimum Gelir? ĠKLĠM YAĞIġ BUHARLAġMA ÇĠFTÇĠ SÜRDÜRÜLEBĠLĠRLĠK BĠTKĠ SU TARIM TEKNĠĞĠ ÜRETĠM GĠRDĠLERĠ

Detaylı

TEMEL ECZACILIK BİLİMLERİ ANABİLİM DALI Temel Eczacılık Bilimleri Programı

TEMEL ECZACILIK BİLİMLERİ ANABİLİM DALI Temel Eczacılık Bilimleri Programı Programa Kabul Koşulları: TEMEL ECZACILIK BİLİMLERİ ANABİLİM DALI Temel Eczacılık Bilimleri Programı Yüksek Lisans: Eczacılık Fakültesi, Fen Fakültesi Biyoloji Bölümü, Kimya Bölümü, Mühendislik Fakültesi

Detaylı

2014 YILI EGE BÖLGESĠ TURUNÇGĠL REKOLTE TAHMĠN RAPORU

2014 YILI EGE BÖLGESĠ TURUNÇGĠL REKOLTE TAHMĠN RAPORU 2014 YILI EGE BÖLGESĠ TURUNÇGĠL REKOLTE TAHMĠN RAPORU EGE TARIMSAL ARAġTIRMA ENSTĠTÜSÜ AĞUSTOS 2014 ĠÇĠNDEKĠLER 1. GĠRĠġ...1 1.1. Dünyada ve Türkiye de Turunçgil Üretim Trendleri...1 1.2. Uluslararası

Detaylı

EĞİTİM BİLGİLERİ. Fen Bilimleri Enstitüsü, Tarla Bitkileri Anabilim Dalı 2014. Ziraat Fakültesi, Tarla Bitkileri Bölümü 1992

EĞİTİM BİLGİLERİ. Fen Bilimleri Enstitüsü, Tarla Bitkileri Anabilim Dalı 2014. Ziraat Fakültesi, Tarla Bitkileri Bölümü 1992 KİŞİSEL BİLGİLER Adı Soyadı Şeref CINBIRTOĞLU Unvan Ziraat Yüksek Mühendisi Telefon 452-2562341 / 130 e-mail scinbirtoglu@gmail.com Doğum Tarihi-Yeri 1971- Almanya DOKTORA YÜKSEK LİSANS LİSANS EĞİTİM BİLGİLERİ

Detaylı

2013 YILI TARIMSAL DESTEKLEMELER

2013 YILI TARIMSAL DESTEKLEMELER 03 YILI TARIMSAL DESTEKLEMELER HAYVANCILIK DESTEKLEMELERİ Hayvan Başı Ödeme Suni Tohumlama 3 Hayvan Başı Ödeme 4 Tiftik Üretim 5 Süt Primi( TL/lt) 6 İpek Böceği Sütçü ve kombine ırklar ve melezleri ile

Detaylı

RTA Dokudan ve Parafine-Gömülü Dokudan Genomik DNA İzolasyon Kiti

RTA Dokudan ve Parafine-Gömülü Dokudan Genomik DNA İzolasyon Kiti RTA Dokudan ve Parafine-Gömülü Dokudan Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-05 IVD İnsan dokusu ve parafine gömülü doku örneklerinden in vitro tanı amaçlı genomik nükleik asit

Detaylı

RUS BUĞDAY AFİTLERİNE KARŞI BİYOLOJİK KORUMA

RUS BUĞDAY AFİTLERİNE KARŞI BİYOLOJİK KORUMA RUS BUĞDAY AFİTLERİNE KARŞI BİYOLOJİK KORUMA HAZIRLAYAN ÖĞRENCİLER 7-F Miray DAĞCI Ömür Mehmet KANDEMİR DANIŞMAN ÖĞRETMEN NİLÜFER DEMİR İZMİR - 2013 İÇİNDEKİLER 1. Projenin Amacı ve Hedefi.. 2 2. Afit

Detaylı

2014 YILI TARIMSAL DESTEKLEMELER

2014 YILI TARIMSAL DESTEKLEMELER 04 YILI TARIMSAL DESTEKLEMELER HAYVANCILIK DESTEKLEMELERİ Hayvan Başı Ödeme Suni Tohumlama Besilik Materyal Üretim Desteği(baş) 3 Hayvan Başı Ödeme 4 Tiftik Üretim 5 Süt Primi( TL/lt) 6 İpek Böceği Sütçü

Detaylı

Dünyada ve Türkiye'de A R I C I L I K

Dünyada ve Türkiye'de A R I C I L I K Dünyada ve Türkiye'de A R I C I L I K Arıcılık tüm dünyada olduğu gibi ülkemizde de son yıllarda önemli gelişme kaydeden bir sektör haline gelmiştir. Ülke ekonomisine önemli katkısı olan arıcılık dünyanın

Detaylı

ARI ÜRÜNLERİNİN ÜRETİMİ VE DEĞERLENDİRİLMESİ

ARI ÜRÜNLERİNİN ÜRETİMİ VE DEĞERLENDİRİLMESİ ARI ÜRÜNLERİNİN ÜRETİMİ VE DEĞERLENDİRİLMESİ Balmumu Balmumunun ana maddesi bal olup 12-18 günlük işçi arıların karın halkalarının alt yüzündeki balmumu salgı bezleri tarafından salgılanan maddedir. Saf

Detaylı

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri

Detaylı

TEBLİĞ. Tarım ve Köyişleri Bakanlığından: HAYVANCILIĞIN DESTEKLENMESĠ HAKKINDA UYGULAMA ESASLARI TEBLĠĞĠ (TEBLĠĞ NO: 2010/13)

TEBLİĞ. Tarım ve Köyişleri Bakanlığından: HAYVANCILIĞIN DESTEKLENMESĠ HAKKINDA UYGULAMA ESASLARI TEBLĠĞĠ (TEBLĠĞ NO: 2010/13) 10 Nisan 2010 CUMARTESİ Resmî Gazete Sayı : 27548 TEBLİĞ Tarım ve Köyişleri Bakanlığından: HAYVANCILIĞIN DESTEKLENMESĠ HAKKINDA UYGULAMA ESASLARI TEBLĠĞĠ (TEBLĠĞ NO: 2010/13) Arı YetiĢtiriciliği, Bombus

Detaylı

Ekonomik Açıdan En Avantajlı Teklifin Belirlenmesinde 2004/18/EC AB Kamu Ġhale Direktifi Ġle 4734 Sayılı Kamu Ġhale Kanununun KarĢılaĢtırılması

Ekonomik Açıdan En Avantajlı Teklifin Belirlenmesinde 2004/18/EC AB Kamu Ġhale Direktifi Ġle 4734 Sayılı Kamu Ġhale Kanununun KarĢılaĢtırılması 49 Ekonomik Açıdan En Avantajlı Teklifin Belirlenmesinde 2004/18/EC AB Kamu Ġhale Direktifi Ġle 4734 Sayılı Kamu Ġhale Kanununun KarĢılaĢtırılması Cemil Akçay 1, A.Sertaç KarakaĢ 2, BarıĢ Sayın 3, Ekrem

Detaylı

T.C. ÇEVRE VE ŞEHİRCİLİK BAKANLIĞI ÇEVRE YÖNETİMİ GENEL MÜDÜRLÜĞÜ YER SEVİYESİ OZON KİRLİLİĞİ BİLGİ NOTU

T.C. ÇEVRE VE ŞEHİRCİLİK BAKANLIĞI ÇEVRE YÖNETİMİ GENEL MÜDÜRLÜĞÜ YER SEVİYESİ OZON KİRLİLİĞİ BİLGİ NOTU T.C. ÇEVRE VE ŞEHİRCİLİK BAKANLIĞI ÇEVRE YÖNETİMİ GENEL MÜDÜRLÜĞÜ YER SEVİYESİ OZON KİRLİLİĞİ BİLGİ NOTU Temmuz 2014 OZON NEDİR Ozon (O 3 ) üç tane oksijen atomunun birleşmesi ile oluşmaktadır. Ozon, atmosferde

Detaylı

Patatesin Dünyadaki Açlığın ve Yoksulluğun Azaltılmasındaki Yeri ve Önemi

Patatesin Dünyadaki Açlığın ve Yoksulluğun Azaltılmasındaki Yeri ve Önemi Patatesin Dünyadaki Açlığın ve Yoksulluğun Azaltılmasındaki Yeri ve Önemi Prof. Dr. Necmi İŞLER M.K.Ü. Ziraat Fakültesi Tarla Bitkileri Bölümü Antakya/HATAY Güney Amerika kökenli bir bitki olan patates

Detaylı

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT gulden.haspolat@gthb.gov.tr

Detaylı

TÜBĠTAK-BĠDEB Y.ĠB.O ÖĞRETMENLERĠ FEN VE TEKNOLOJĠ (Kimya)PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI

TÜBĠTAK-BĠDEB Y.ĠB.O ÖĞRETMENLERĠ FEN VE TEKNOLOJĠ (Kimya)PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI TÜBĠTAK-BĠDEB Y.ĠB.O ÖĞRETMENLERĠ FEN VE TEKNOLOJĠ (Kimya)PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI AraĢtırma Projesi Eğitimi ÇalıĢtayı Y.Ġ.B.O -5 ÇALIġTAY 2011 ALAN: KĠMYA GRUP ÇIĞ PROJE ADI ASĠT YAĞMURLARININ

Detaylı

GIDA GÜVENLİĞİ VE YENİ TARIM POLİTİKASINA İLİŞKİN ÖNERİLER

GIDA GÜVENLİĞİ VE YENİ TARIM POLİTİKASINA İLİŞKİN ÖNERİLER GIDA GÜVENLİĞİ VE YENİ TARIM POLİTİKASINA İLİŞKİN ÖNERİLER 30 10 2013 topraksuenerji-ulusal güvenlik denince çoğu zaman zihnimizde sınırda nöbet tutan askerler, fırlatılmaya hazır füzeler, savaş uçakları

Detaylı

ARI ÇALIŞTAYI (VET-ARI) 17-18 Ekim 2014 - ANKARA. Sunuş

ARI ÇALIŞTAYI (VET-ARI) 17-18 Ekim 2014 - ANKARA. Sunuş Sunuş Veteriner Farmakoloji ve Toksikoloji Derneği öncülüğünde Ankara Üniversitesi Veteriner Fakültesi Öğrenci Topluluğu VetAnka ile birlikte 17-18 Ekim 2014 tarihlerinde Ankara Üniversitesi Veteriner

Detaylı

2015 YILI TARIMSAL DESTEKLEMELER

2015 YILI TARIMSAL DESTEKLEMELER 05 YILI TARIMSAL DESTEKLEMELER HAYVANCILIK DESTEKLEMELERİ Hayvan Başı Ödeme (TL/baş) Suni Tohumlama (TL/baş) Sütçü ve kombine ırklar ve melezleri ile etçi ırkların melezleri anaç sığır Etçi ırklar anaç

Detaylı

AR&GE BÜLTEN 2012 EYLÜL SEKTÖREL TARIM KENTİ İZMİR

AR&GE BÜLTEN 2012 EYLÜL SEKTÖREL TARIM KENTİ İZMİR TARIM KENTİ İZMİR Şebnem BORAN Gözde SEVİLMİŞ Küresel iklim değişikliği, gıda fiyatlarındaki yükseliş, dünya nüfusundaki hızlı artış gibi gelişmelerin etkisiyle tarım sektörünün son derece stratejik bir

Detaylı

RTA Kandan Genomik DNA İzolasyon Kiti

RTA Kandan Genomik DNA İzolasyon Kiti RTA Kandan Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-05 IVD İnsan kan örneklerinden in vitro tanı amaçlı genomik nükleik asit izolasyon ve saflaştırması için In vitro tanı amaçlı

Detaylı

Prof.Dr.İlkay DELLAL

Prof.Dr.İlkay DELLAL TUSAF 2013 Buğday, Un, İklim Değişikliği ve Yeni Trendler Kongresi İKLİM DEĞİŞİKLİĞİ ve ENERJİ KISKACINDA TARIM ve GIDA SEKTÖRÜ Prof.Dr.İlkay DELLAL 9 Mart 2013, Antalya GÜNDEM 9 Mart 2013 1. GÜNEŞ (%40)

Detaylı

Oklun Öğrenci Mevcudu

Oklun Öğrenci Mevcudu Oklun Öğrenci Mevcudu Sınıfların mevcutları 34 kiģiden oluģmaktadır. Pansiyon mevcudu 132 kiģiliktir. Okulumuzda 2015 2016 eğitim öğretim yılında Laboratuvar Hizmetleri alanında 96, Hayvan YetiĢtiriciliği

Detaylı

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7

Detaylı

UNIDO Eko-Verimlilik (Temiz Üretim) Programı

UNIDO Eko-Verimlilik (Temiz Üretim) Programı UNIDO Eko-Verimlilik (Temiz Üretim) Programı 27 Nisan 2011 KAYSERĠ OSB ġenol ATAMAN 7 Haziran 2011 NĠĞDE OSB 8 Haziran 2011 ADANA Ticaret Odası Kapsam İklim Değişikliği, Küresel Isınma Azaltım (Mitigasyon),

Detaylı

TARSUS TİCARET BORSASI

TARSUS TİCARET BORSASI TARIMDA ÖZET BÜLTEN 2015 2015 YILI TARIMIN ÖZETİ TARSUS TİCARET BORSASI TARIMDA 2015 YILI ÖZETİ İstatistik Kurumu nun 2015 bitkisel üretim verilerine göre;önceki yıla göre tahıllar ve diğer bitkisel ürünlerde

Detaylı

AKDENĠZ GENEL BALIKÇILIK TOPLANTISI

AKDENĠZ GENEL BALIKÇILIK TOPLANTISI AKDENĠZ GENEL BALIKÇILIK TOPLANTISI 13. Alt komisyon Toplantısı FAO Genel merkezi ROMA / ĠTALYA Katılımcı Filiz KĠġTĠN 27.3.2013 AMAÇ FAO tarafından desteklenmekte olan Doğu Akdenizde Sorumlu balıkçılığın

Detaylı

KULLANMA TALİMATI. VİTA B 250/250/1 mg enterik kaplı tablet Ağızdan alınır.

KULLANMA TALİMATI. VİTA B 250/250/1 mg enterik kaplı tablet Ağızdan alınır. KULLANMA TALİMATI VİTA B 250/250/1 mg enterik kaplı tablet Ağızdan alınır. Etkin madde: Her bir enterik kaplı tablet 250 mg B 1 vitamini, 250 mg B 6 vitamini ve 1 mg B 12 vitamini içerir. Yardımcı madde(ler):

Detaylı

Sürdürülebilir Pestisit Kullanımı

Sürdürülebilir Pestisit Kullanımı Sürdürülebilir Pestisit Kullanımı Doç. Dr. Seral YÜCEL Dr. Hale GÜNAÇTI Adana Biyolojik Mücadele Araştırma İstasyonu Dünyanın en önemli sorunlarından biri hızla artan nüfusudur. Dünya nüfusunun gittikçe

Detaylı

RTA Bakteriden Genomik DNA İzolasyon Kiti

RTA Bakteriden Genomik DNA İzolasyon Kiti RTA Bakteriden Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 IVD Bakteri örneklerinden genomik nükleik asit izolasyonu ve saflaştırılması için In vitro tanı amaçlı kullanım için Yalnızca

Detaylı

Rumen Kondisyoneri DAHA İYİ BY-PASS PROTEİN ÜRETİMİNİ VE ENERJİ ÇEVRİMİNİ ARTTIRMAK, RUMEN METABOLİZMASINI DÜZENLEMEK İÇİN PRONEL

Rumen Kondisyoneri DAHA İYİ BY-PASS PROTEİN ÜRETİMİNİ VE ENERJİ ÇEVRİMİNİ ARTTIRMAK, RUMEN METABOLİZMASINI DÜZENLEMEK İÇİN PRONEL Rumen Kondisyoneri DAHA İYİ Protein Değerlendirilmesi Enerji Kullanımı Süt Kalitesi Karaciğer Fonksiyonları Döl Verimi Karlılık BY-PASS PROTEİN ÜRETİMİNİ VE ENERJİ ÇEVRİMİNİ ARTTIRMAK, RUMEN METABOLİZMASINI

Detaylı

22.04.2015 MBG 112 BİYOLOJİ II BİTKİLERDE ÜREME VE BİYOTEKNOLOJİ YRD. DOÇ. DR. YELDA ÖZDEN. Döl almaşı

22.04.2015 MBG 112 BİYOLOJİ II BİTKİLERDE ÜREME VE BİYOTEKNOLOJİ YRD. DOÇ. DR. YELDA ÖZDEN. Döl almaşı MBG 112 BİYOLOJİ II BİTKİLERDE ÜREME VE BİYOTEKNOLOJİ YRD. DOÇ. DR. YELDA ÖZDEN Döl almaşı Angiospermlerde; Baskın döl sporofit, Gametofit indirgenmiş, Sporofit üreme yapısı olan çiçeği oluşturur. Ovaryum

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

MAIA Pesticide MultiTest

MAIA Pesticide MultiTest MAIA Pesticide MultiTest GIDALARDA PESTİSiT KALINTILARI İÇİN AB MAKSİMUM KALINTI LİMİTLERİ İLE UYUMLU ÇOKLU KALINTI TARAMA TESTİ Microplate Acetylcholinesterase Inhibition Assay (MAIA) katı veya sıvı gıda

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

1. İnsan vücudunun ölçülerini konu edinen bilim dalı aşağıdakilerden hangisidir?

1. İnsan vücudunun ölçülerini konu edinen bilim dalı aşağıdakilerden hangisidir? VÜCUT BAKIMI 1. İnsan vücudunun ölçülerini konu edinen bilim dalı aşağıdakilerden hangisidir? A) Anatomi B) Fizyoloji C) Antropometri D) Antropoloji 2. Kemik, diş, kas, organlar, sıvılar ve adipoz dokunun

Detaylı

Özel Formülasyon DAHA İYİ DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA YUMURTA IÇIN AGRALYX!

Özel Formülasyon DAHA İYİ DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA YUMURTA IÇIN AGRALYX! Özel Formülasyon DAHA İYİ Yumurta Verimi Kabuk Kalitesi Yemden Yararlanma Karaciğer Sağlığı Bağırsak Sağlığı Bağışıklık Karlılık DAHA DÜŞÜK MALIYETLE DAHA SAĞLIKLI SÜRÜLER VE DAHA FAZLA YUMURTA IÇIN AGRALYX!

Detaylı

ORMAN VE SU ĠġLERĠ BAKANLIĞI ÇÖLLEġME VE EROZYONLA MÜCADELE GENEL MÜDÜRLÜĞÜ ARAġTIRMA PROJESĠ

ORMAN VE SU ĠġLERĠ BAKANLIĞI ÇÖLLEġME VE EROZYONLA MÜCADELE GENEL MÜDÜRLÜĞÜ ARAġTIRMA PROJESĠ ORMAN VE SU ĠġLERĠ BAKANLIĞI ÇÖLLEġME VE EROZYONLA MÜCADELE GENEL MÜDÜRLÜĞÜ ARAġTIRMA PROJESĠ Kuraklık ve Ekstrem ġartlara Dayanıklı Türlerin Tespiti ve Adaptasyonu Projesi (Kavak Türleri Örneği) Teoman

Detaylı

SÜT SEKTÖRÜNDE MEVCUT DURUM. Yusuf GÜÇER Ziraat Mühendisi İzmir İl Gıda Tarım ve Hayvancılık Müdürlüğü

SÜT SEKTÖRÜNDE MEVCUT DURUM. Yusuf GÜÇER Ziraat Mühendisi İzmir İl Gıda Tarım ve Hayvancılık Müdürlüğü SÜT SEKTÖRÜNDE MEVCUT DURUM Yusuf GÜÇER Ziraat Mühendisi İzmir İl Gıda Tarım ve Hayvancılık Müdürlüğü TARIMSAL ÜRETİM DEĞERİ BİTKİSEL VE HAYVANSAL ÜRETİMDE İZMİR İN ÜLKE SIRALAMASINDAKİ YERİ (TUİK-2014)

Detaylı

ÇEV416 ENDÜSTRİYEL ATIKSULARIN ARITILMASI

ÇEV416 ENDÜSTRİYEL ATIKSULARIN ARITILMASI ÇEV416 ENDÜSTRİYEL ATIKSULARIN ARITILMASI 6.Endüstriyel Kirlenme Kontrolü - Nötralizasyon Yrd. Doç. Dr. Kadir GEDİK Birçok endüstrinin atıksuyu asidik veya bazik olduğundan alıcı ortama veya kimyasal ve/veya

Detaylı

GIDA GÜVENLĠĞĠ YÖNETĠM SĠSTEMĠ (GGYS) UYGULAYAN SOFRALIK ZEYTĠN ĠġLETMELERĠ ÜZERĠNE BĠR ARAġTIRMA

GIDA GÜVENLĠĞĠ YÖNETĠM SĠSTEMĠ (GGYS) UYGULAYAN SOFRALIK ZEYTĠN ĠġLETMELERĠ ÜZERĠNE BĠR ARAġTIRMA GIDA GÜVENLĠĞĠ YÖNETĠM SĠSTEMĠ (GGYS) UYGULAYAN SOFRALIK ZEYTĠN ĠġLETMELERĠ ÜZERĠNE BĠR ARAġTIRMA AyĢe Demet KARAMAN¹, Renan TUNALIOĞLU², Ferit ÇOBANOĞLU², Gülden OVA³, Ferhat AYDOĞDU 4 ¹Yrd. Doç.Dr. Adnan

Detaylı

HAZIR AMBALAJLI MAMULLERĠN AĞIRLIK VE HACĠM ESASINA GÖRE NET MĠKTAR TESPĠTĠNE DAĠR YÖNETMELĠK (76/211/AT)

HAZIR AMBALAJLI MAMULLERĠN AĞIRLIK VE HACĠM ESASINA GÖRE NET MĠKTAR TESPĠTĠNE DAĠR YÖNETMELĠK (76/211/AT) Resmi Gazete Tarihi: 10.04.2002 Resmi Gazete Sayısı: 24722 HAZIR AMBALAJLI MAMULLERĠN AĞIRLIK VE HACĠM ESASINA GÖRE NET MĠKTAR TESPĠTĠNE DAĠR YÖNETMELĠK (76/211/AT) BĠRĠNCĠ BÖLÜM Amaç, Kapsam, Hukuki Dayanak,

Detaylı

TOPRAK MAHSULLERĠ OFĠSĠ GENEL MÜDÜRLÜĞÜ

TOPRAK MAHSULLERĠ OFĠSĠ GENEL MÜDÜRLÜĞÜ TOPRAK MAHSULLERĠ OFĠSĠ GENEL MÜDÜRLÜĞÜ ANKARA 2014 ĠÇĠNDEKĠLER 1. DÜNYA DA DURUM... 2 1.1. Hububat........ 2 1.1.1. Buğday...... 3 1.1.2. Arpa........... 5 1.1.3. Çavdar.... 7 1.1.4. Yulaf...... 8 1.1.5.

Detaylı

BİYOLOJİ BÖLÜMÜ. http://fened.gop.edu.tr/bolumler/biyoloji/index.asp

BİYOLOJİ BÖLÜMÜ. http://fened.gop.edu.tr/bolumler/biyoloji/index.asp BİYOLOJİ BÖLÜMÜ http://fened.gop.edu.tr/bolumler/biyoloji/index.asp HAKKIMIZDA Bölümümüz, Yükseköğretim Kurulu Başkanlığı nın 26.02.1993 tarihli yazısında belirtilen yürütme kurulunun 25.02.1992 tarihli

Detaylı

SU ÜRÜNLERİ SAĞLIĞI BÖLÜM BAŞKANLIĞI

SU ÜRÜNLERİ SAĞLIĞI BÖLÜM BAŞKANLIĞI SU ÜRÜNLERİ SAĞLIĞI BÖLÜM BAŞKANLIĞI Hacı SAVAŞ-SÜMAE, Su Ürünleri Sağlığı Bölüm Başkanı Su Ürünleri Sağlığı Bölüm Başkanlığı enstitümüz bünyesinde faaliyet gösteren bölümlerden birisidir. 2000 yılı başından

Detaylı

ZİRAAT MÜHENDİSİ (TARIMSAL BİYOTEKNOLOJİ)

ZİRAAT MÜHENDİSİ (TARIMSAL BİYOTEKNOLOJİ) TANIM Tarımsal Biyoteknoloji, bitki, hayvan ve mikrobiyal organizmaların genleri, hücreleri, proteinleri, kültürleri ve dokuları üzerinde çalışarak, tarımsal üretimi, kaliteyi, verimi arttırmayı amaçlayan

Detaylı

T.C. KARACADAĞ KALKINMA AJANSI Ġzleme ve Değerlendirme Birimi 2013 YILI TEKNİK DESTEK PROGRAMI KAPANIŞ RAPORU

T.C. KARACADAĞ KALKINMA AJANSI Ġzleme ve Değerlendirme Birimi 2013 YILI TEKNİK DESTEK PROGRAMI KAPANIŞ RAPORU T.C. KARACADAĞ KALKINMA AJANSI Ġzleme ve Değerlendirme Birimi 2013 YILI TEKNİK DESTEK PROGRAMI KAPANIŞ RAPORU Haziran - 2014 1. GĠRĠġ 2013 YILI TEKNĠK DESTEK PROGRAMI Kalkınma Ajansları Proje ve Faaliyet

Detaylı

Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri

Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Biyoloji Bölümünde Merkezi Araştırma Laboratuarlarının Kurulumu Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü

Detaylı

SSP900 SOSYAL SORUMLULUK PROJESĠ DERS SUNUMU

SSP900 SOSYAL SORUMLULUK PROJESĠ DERS SUNUMU SSP900 SOSYAL SORUMLULUK PROJESĠ DERS SUNUMU Ders Sorumlusu: Prof. Dr. Mehmet DĠLMAÇ Yardımcı Öğretim Elemanı: ArĢ. Gör. Beytullah ERDOĞAN 1 DERS KONU BAġLIKLARI PROJENĠN BAġLATILMASI PROJENĠN EVRELERĠ

Detaylı

ÜRETĠM TESĠSLERĠ BÖLGESEL BAĞLANTI KAPASĠTE RAPORU 2020-2025

ÜRETĠM TESĠSLERĠ BÖLGESEL BAĞLANTI KAPASĠTE RAPORU 2020-2025 ÜRETĠM TESĠSLERĠ BÖLGESEL BAĞLANTI KAPASĠTE RAPORU 2020-2025 31.07.2015 İçindekiler Ġçindekiler... 2 Amaç ve Kapsam... 7 1. Yöntem... 8 2. Bölgelerin Değerlendirmeleri ve Sonuçlar... 10 2.1. Akdeniz...

Detaylı

BİTKİSEL YAĞ SEKTÖRÜNDE İTHALATA BAĞIMLILIK SÜRÜYOR

BİTKİSEL YAĞ SEKTÖRÜNDE İTHALATA BAĞIMLILIK SÜRÜYOR BİTKİSEL YAĞ SEKTÖRÜNDE İTHALATA BAĞIMLILIK SÜRÜYOR Gözde SEVİLMİŞ Giderek artan nüfusa paralel olarak gıda maddeleri tüketimi ve dolayısıyla bitkisel yağ tüketimi artmaktadır. Diğer yandan artan gıda

Detaylı

Rahim ağzı kanseri hücreleri doku kültürü mikroskopik görüntüsü.

Rahim ağzı kanseri hücreleri doku kültürü mikroskopik görüntüsü. Doç.Dr.Engin DEVECİ HÜCRE KÜLTÜRÜ Hücre Kültürü Araştırma Laboratuvarı, çeşitli hücrelerin invitro kültürlerini yaparak araştırmacılara kanser, kök hücre, hücre mekaniği çalışmaları gibi konularda hücre

Detaylı

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03. Laboratuvar Tekniği Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.2014) 1 5. Haftanın Ders İçeriği DNA ekstraksiyonu DNA ekstraksiyonunun amacı

Detaylı

AHMET ALİ YAĞCI VETERİNER HEKİM

AHMET ALİ YAĞCI VETERİNER HEKİM AHMET ALİ YAĞCI VETERİNER HEKİM ARILI KOVANLARININ KONULDUĞU VE ARICININ ÇALIŞTIĞI YERE ARILIK DENİR GEZGİNCİ? SABİT? Arıcılık büyük ölçüde doğa koşullarına bağlıdır! DOĞA KOŞULLARI? İKLİM BİTKİ ÖRTÜSÜ

Detaylı

Trakya Kalkınma Ajansı. www.trakyaka.org.tr. Edirne İlinde Yem Bitkileri Ekilişi Kaba Yem Üretiminin İhtiyacı Karşılama Oranı

Trakya Kalkınma Ajansı. www.trakyaka.org.tr. Edirne İlinde Yem Bitkileri Ekilişi Kaba Yem Üretiminin İhtiyacı Karşılama Oranı Trakya Kalkınma Ajansı www.trakyaka.org.tr Edirne İlinde Yem Bitkileri Ekilişi Kaba Yem Üretiminin İhtiyacı Karşılama Oranı EDİRNE YATIRIM DESTEK OFİSİ EDİRNE İLİNDE YEM BİTKİLERİ EKİLİŞİ, MERALARIN DURUMU

Detaylı

TEKSTİL MAKİNALARI. Hazırlayan Hasan KÖSE 2006. T.C. Başbakanlık Dış Ticaret Müsteşarlığı İhracatı Geliştirme Etüd Merkezi

TEKSTİL MAKİNALARI. Hazırlayan Hasan KÖSE 2006. T.C. Başbakanlık Dış Ticaret Müsteşarlığı İhracatı Geliştirme Etüd Merkezi TEKSTİL MAKİNALARI Hazırlayan Hasan KÖSE 2006 T.C. Başbakanlık Dış Ticaret Müsteşarlığı İhracatı Geliştirme Etüd Merkezi TEKSTİL MAKİNALARI TÜRKİYE DE ÜRETİM Tanımı Tekstil makinaları, tekstil sanayinin

Detaylı