Genetic Characterization of Indigenous Anatolian Water Buffalo Breed Using Microsatellite DNA Markers

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Genetic Characterization of Indigenous Anatolian Water Buffalo Breed Using Microsatellite DNA Markers"


1 Genetic Characterization of Indigenous Anatolian Water Buffalo Breed Using Microsatellite DNA Markers M. İ. Soysal 1 E. Özkan 1 S. Kök 2 Y. T.Tuna 1 E. K.Gürcan 1 1 Trakya University, Agricultural Faculty of Tekirdağ Department of Animal Science, Tekirdağ 2 Trakya University, Keşan Vocational Higher Education School, Edirne One indigenous water buffalo population to Anatolia were characterised with 11 cattle autosomal microsatellite loci. A set of 4 cattle microsatellite loci was found to be polymorphic in the Anatolian buffalo genome. Genotyping of these polymorphic microsatellite loci revealed alleles ranging from 3 to 9. The observed heterozygosity ranged from to and the expected heterozygosity ranged from to The F IS value changed from to This result shown that, Anatolian water buffalo population samples seemed to be in Hardy- Weinberg expectation. Keywords: water buffalo, DNA, microsatellite DNA polimrphism Anadolu Mandalarının Mikrosatellit DNA İşaretleyicileri Kullanılarak Genetik Tanımlanması Anadolu manda populasyonunun karekterize edilmesi için 11 sığır mikrosatellit lokusu kullanılmıştır. Çalışmada bu lokusların dört tanesi Anadolu mandalarında polimorfik bulunmuştur. Gözlenen heterozigotluk aralığı 0,550 ile 0,775 arasında bulunmuştur. Beklenen heterozigotluk aralığı ise 0,494 ile 0,815 arasında hesaplanmıştır.. F is değeri ise -0,101 ile 0,205 arasında olmuştur. Bu sonuçlar incelenen Anadolu Mandaları populasyonunun Hardy Weinberg kuramına uyum gösterdiğini belirtmektedir. Anahtar kelimeler: anadolu mandası, DNA, mikrosatellit DNA polimorfizmi Introduction The number of water buffaloes in the world has decreased rapidly over the past three decades (Georgoudis et al., 1998). Most of world buffaloes live in Asia, Egypt, Southern and south-eastern Europe. Also buffaloes have played an important role in the rural economy of developing Asian country from ancient times. According to FAO (2000) data, there are about 166 million domesticated buffaloes raised in the five world continents. However, there are about 158 million buffaloes left in the world (FAO statistics, 2003). Roughly 97 percent of them or 153 million heads are water buffaloes essentially found in the Asian region. Also, in Turkey the buffaloes population have declined dramatically over the last decades. The total population according to FAO statistics is heads. Their breeding areas are especially middle of Black sea region in Turkey. These animals are mainly used for milk and meat production in these areas. The creamy part of milk fat of water buffaloes milk is popular accompanies to famous Turkish desert. Water buffaloes milk is preferably take place at least in some percentage in Turkish sausage making industry. It is estimated that, 4-5 % of total milk and meat production comes from buffaloes sources % percent of red meat production sources from buffaloes genotypes. Total % of buffaloes population are raised in Middle of Black Sea region. The largest number of buffalo population existed in Black sea region. Eastern Anatolian buffalo population has second biggest number of population. Third biggest number of population in the Marmara region existed in Istanbul and surroundings this city. Feeding is based on grazing, straw and concentrates. Their purpose of raising is firstly milk and secondly meat production. 240

2 Table 1 shown that several characteristics about Anatolian water buffalo raised in Turkey. This study was estimated to examine the within population genetic diversity using microsatellite markers. Materials and Methods The numbers of animals sampled from the Anatolian water buffalo were 40 individuals. Blood samples of unrelated animals were collected in slaughterhouse in Silivri of Marmara region. Bloods were collected in 10 ml tubes containing K 2 EDTA and stored at 20 0 C until the DNA was extracted by the standard Phenol Chloroform technique (Sambrook, J. et all, 1989). The microsatellite loci used in the study and their characteristics are given in Table 2. The PCR analyses were carried out using an Applied Biosystems GeneAmp PCR System 2700 thermal cycler. The reaction mixture was composed of genomic DNA (100 ng), 200μm dntps, 2.0 mm MgCl 2, 1X PCR buffer, 5 pmol forward and reversed primers and Taq DNA polymerase (0.5 u/sample) in a total volume of 20 μl. All samples were amplified in a reaction volume of 20 μl containing 11.7 μl of (dh 2 O) distilled water. The PCR reactions were carried out in 0.2 ml PCR plates with the following PCR conditions: 1 cycle of initial denaturation for 5 minutes at 94 0 C, 30 cycle of 45 seconds at 94 0 C, 45 seconds at annealing temperature, 1 minute at 72 0 C and 1 cycle of final extension for 10 minutes at 72 0 C. In order to minimize the artefacts caused during the amplification leading to false size estimations, one or more positive controls were used in each PCR reaction together with a negative control. The PCR product was checked on a 2% Agarose gel together with DNA size markers standards. For all microsatellites allele size was determined on all samples with a Perkin Elmer ABI Prism 310 Genetic Analyzer using the GeneScan Software (Perkin Elmer). Data Analysis For the population and for each locus number of alleles (n A ), observed heterozygosity (H 0 ) and unbiased expected heterozygosity (H e ) were calculated using Genetix 4.0 Programs. Also the averages of n A, H 0, H e based on four loci were also computed. The population F IS value of Wright s F statistics based on four loci were estimated and used to test the deviation from the Hardy Weinberg equilibrium. All of the above computations were performed by using Genetix 4.0 statistical programs. Results and Discussion Heterologous cattle microsatellite markers have been tested on Anatolian buffalo genome. A set of 11 (TGLA227, ILSTS005, CSSM66, BM1818, ETH10, ETH225, ETH3, HAUT24, HEL5, TGLA122, TGLA126) cattle microsatellite loci was analysed in Anatolian buffalo samples. Four cattle microsatellite loci were found to be polymorphic in the Anatolian buffalo genome. Allele frequencies for each of four microsatellite loci in each of the individuals are reported. The number of alleles Per locus varied from 3 (ILSTS005) to 9 (BM1818). The mean number of alleles Per locus is about Allele numbers distribution at the four analysed loci is given in Table 3. The observed heterozygosity ranged from to 0.775, and the expected heterozygosity ranged from to Arora et al, was studied physical and microsatellite characterization of Tarai Buffalo of India. The Tarai buffalo is river with 50 chromosomes, which is similar to Anatolian water buffalo population which is called as subgroup of Mediterrenean water buffaloes. Arora et al, had studyed on heterologous cattle microsatellite loci and were used them for molecular genetic characterization of Tarai genome. A set of 22 cattle microsatellite loci was found to be polymorphic in the Tarai genome. Genotyping of these polymorphic microsatellite loci revealed alleles ranging from two to seven. 241

3 Acknowledgements We would like to thank Prof. Dr. Donato Matasino, Dr. Tiziana Sarracco, Dr. Maria Consilia Occidente for helping to study the water buffalo microsatellite loci in ConsDABI. Table 1. Several Characteristics About Anatolian Water Buffalo Raised in Turkey Maximum Minimum Sources Lactation Yield (kg) ± ±23.0 Şekerden et al (2000b) Uslu, N.T. (1970b) Lactation Length (day) 269.2± ±44.2 Şekerden et al (2000a) Şekerden et al (2000b) Fat (%) 8.1± ±0.68 Kök, S., (1996) Şekerden et al (2000a) Adulty Body Weight 518.6± ±9.07 İlarslan et al (1983) Uslu N.T, (1970a) Calving Interval 434.3± ±17.5 Şekerden et al (2000a) İlarslan et al (1983) Ageat first Insemination(day) 679.7±210.9 Şekerden et al (2000a) Age at first calving (day) ± ±3.94 Şekerden et al (2000b) İlarslan et al (1983) Birth Weight (Male) 34.3± ±0.52 Alaçam et al. (1992) Uslu N.T; (1970b) Birth Weight (Female) 31.6± ±0.48 Alaçam et al. (1992) Uslu N.T., (1970b) Servis Periyodu İlarslan et al (1983) Şekerden et al (2000b) Gestation Lenght (day) 326.5±5.8 (artificial 317.0±51.5 (natural İzgi and Asker, (1989) İzgi and Asker, (1989) ınsemination) insemination) (Male) (Female) Şekerden et al. (2000c) Daily Live Weight Gaining (gr) (0-3 Month) Male Female Daily Live Weight Gaining (gr) (Male) (Female) Şekerden et al. (2000c) (3-6 Month) Male Female Daily Live Weight Gaining (gr) (Female) (Male) Şekerden et al. (2000c) (6-9 Month) Male Female Daily Live Weight Gaining (gr) (Male) (Female) Şekerden et al. (2000c) (9-12 Month) Male Female Fat Content of Milk Kök, S. (1996) (Soysal and Kök, 1997) Total Solid Matter of Milk 17.7 (3. Lactation) 15.3(1.Lactation) Şekerden et al.(2000b) Ash % of Milk Şekerden et al.(2000a) Şekerden et al.(2000b) Water of Milk 82.3 Kök, S.; (1996) Protein % of Milk Şekerden et al. (2000a) (Soysal and Kök, 1997)(Kök, S., 1996) Caseine % of Milk 3.4 (3. Lactation) 3.0 (1. Lactation) Şekerden et al.(2000b) Observed heterozygosity of changed from to Mean observed heterozygosity of 0.60 in the Tarai buffalo population. Expected heterozygosity of changed from to BM1818, CSSM66 and ILSTS005 microsatellite loci was found polymorphic in the Tarai buffalo population and also Anatolian water buffalo 242

4 population. Anatolian water buffalo population heretozygosity was found to similar in Tarai buffalo population. Moioli et al (2001) was studied genetic diversity between Greek, Italian and Egyptian buffalo populations with using 13 polymorphic microsatellite loci. The number of alleles Per locus varied from two (ILSTS005) to 19 (ETH03). Only for two loci (CSSM33 and ILSTS005), all detected alleles were found in all three country populations (Italian, Greek and Egyptian). ILSTS005 loci was shown 3 alleles in Anatolian water buffalo population. Observed average heterozygosity was 0.135, and in the Italian Greek and Egyptian populations, respectively. It was lower, although not significantly different from the expected heterozygosity (0.173, and respectively for the Italian, Greek and Egyptian). But Anatolian water buffalo population observed and expected heterozygosity was found very high. The Anatolian water buffalo population F IS value changed from to This result shown that, Anatolian water buffalo population samples seemed to be in Hardy Weinberg expectation. As a conclusion, it can be said that the present study revealed the presence of high degree of genetic diversity within the water buffalo populations of Turkey. Table 2. The table shows the name of the microsatellite loci used in the study, their primer sequences, Polymorphism information contents (PIC), annealing temperature, the chromosome number the belong to, and the references articles. Locus Primer Sequence PIC Annealing Chromosome Reference Name Temp. ( 0 C) Number TGLA227 CGAATTCCAAATCTGTTAATTTGCT ACAGACAGAAACTCAATGAAAGCA Steigleder et al, (2004) ILSTS005 GGAAGCAATGAAATCTATAGCC TGTTCTGTGAGTTTGTAAGC Arora et al, CSSM66 ACACAAATCCTTTCTGCCAGCTGA Arora et al, BM1818 AATTTAATGCACTGAGGAGCTTGG AGCTGGGAATATAACCAAAGG AGTGCTTTCAAGGTCCATGC Arora et al, Table 3. Characteristics of Bovine Microsatellite Markers Tested on Anatolian Water Buffalo Population. LOCUS Number of Observed Expected H n.b. F IS alleles (n A ) Heterozygosity (H O ) Heterozygosity (He) TGLA ILSTS CSSM BM Mean References Arora, R., Lakhchaura B.D., Prosad R.B., Chauhan, A., Bais R.K.S., tantia M.S., Vijh R.K.,. Physical and Microsatellite Based Characterization of Tarai Buffalo of India. Buffalo Newsletter, Number 19, June FAO (2000), Food and Agricultural Organization of The United Nation (FAO). Rome, 2003 ( FAO, Food and Agricultural Organization of The United Nation (FAO). Rome, 2003 ( Georgoudis, A. G., V.P. Papanastasis and J.G. Boyazoğlu (1998). Use of Water Buffalo for Environmental Conservation of Waterland. Review. Symposium VIII. Entitled Role of Water Buffaloes in Producing Foods of the 8 th World Conference on June 30, 1998 at Seoul National University, Seoul, Korea. 243

5 İlarslan, M., Karabulut A.; Aşkın, A., İzgi N. (1983). Yerli Mandalarda Vücut Yapısı, Döl ve Süt Verimi Üzerine Araştırmalar. Zirai Araş. Enst. Yay. No:14 Afyon İzgi, A.N., Asker, R. (1989). Çeşitli Çevre Şartlarının Mandaların Doğum Ağırlığı Üzerine Etkisi. Mandacılık Araş. Enst. Yayın No:18 Afyon. Kök, S. (1996). Marmara ve Karadeniz Bölgesinin Çeşitli İllerindeki manda Populasyonlarının Kimi Morfolojik ve genetik Özellikleri Üzerinde Bir Araştırma. Trakya Üniv. Fen Bilimleri Enst. Doktora Tezi. Molioli, B., A. Georgoudis, F.Napolitano, G. Catillo, E. Giubilei, Ch. Ligda, M. Hassonane (2001). Genetic Diversity Between Italian, Greek and Egyptian Buffalo Populations. Livestock Production Science 70 (2001) Sambrook, J., Fritsch E. F., Manıatıs T., (1989). Molecular Closing: A laboratory Manual (2 nd ed.) 3 vol., Cold-Spring Horbar, NewYork (1989). Soysal, M.İ., S.Kök, Ergin Mandaların Bazı Vücut Özelliklerine İlişkin Korelasyon Matrixi Sonuçları. T.Ü.Tekirdağ Ziraat Fak. Zootekni Bölümü, Trakya Bölgesi II.Hayvancılık Sempozyumu Kitabı S Steigleder, C.S., E.A. Almeida and T.A. Weimer (2004). Genetic Diversity od a Brazilian Crerole cattle Based on Fourteen Microsatellite Loci. Arch. Zootec. 53: Şekerden Ö., Kebapçı, M., Kopar, A., (2000c).Kocatepe tarımsal Araştırma Enstitüsü Anadolu Manda Sürüsünün Kan Serumu Tf Tipleri, Tf tipleri için Genetik Yapısı ve Büyüme Performansı, Tf Tipleri ve Büyüme Özelliği Arasındaki İlişkiler. Atatürk Üniv. Ziraat Fakültesi Derg. (Basımda). Şekerden, Ö., Tapkı, İ. (2000a). Mustafa Kemal Üniversitesi Manda Sürüsü Süt ve Döl Verim Özellikleri. Atatürk Üniversitesi Zir. Fak. Dergisi (Basımda). Şekerden, Ö., Kebapçı, M.; (2000b) Afyon Kocatepe Tarımsal Araştırma Enstitüsü Anadolu Mandalarında Laktasyon Süt Verim Ve Bileşiminin Laktasyon Dönemlerine Göre Değişimi. Süt ve Döl Verim Özellikleri. Atatürk Üniversitesi Zir. Fak. Dergisi (Basımda). Uslu, N.T., (1970a) Afyon Bölgesi Mandalarının Çeşitli Özellikleri ve Köy şartlarında Süt Verimleri Üzerinde Mukayeseli Araştırmalar. (Doktora Tezi) Birlik Matbaası, Bornova (1970). Uslu, N.T., (1970b) Büyüme Döneminde Bulunan Mandaların Protein ve Nişasta Değeri İhtiyaçları Üzerinde Çalışmalar. Yem Bitkileri Deneme ve Üretme İst. Yayın No.5 Afyon. 244




Türkiye ve Dünya da Manda Yetiştiriciliği 1

Türkiye ve Dünya da Manda Yetiştiriciliği 1 ISSN: 2146-8168 Sayı: 8, Yıl: 2013, Sayfa: 65-70 Dergiye Geliş Tarihi: 04.08.2013 Yayına Kabul Tarihi: 31.12.2013 Baş Editör: Naim Çağman Alan Editörü: Yalçın Tahtalı Türkiye





Mandalarda Alyuvar Potasyum Polimorfizmi Üzerine Bir Araştırma

Mandalarda Alyuvar Potasyum Polimorfizmi Üzerine Bir Araştırma Mandalarda Alyuvar Potasyum Polimorfizmi Üzerine Bir Araştırma M. İ. Soysal 1 S.Kök 2 E. K.Gürcan 1 1 Trakya Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bölümü, Tekirdağ 2 Trakya Üniversitesi, Keşan








Özel Şekerden 1 Mustafa KÜÇÜKKEBAPÇI 2 Ahmet KOPAR 3



Anahtar Kelimeler: Anadolu Mandası, Süt Bileşimi, Laktasyon Dönemi, Süt ve Döl Verimi

Anahtar Kelimeler: Anadolu Mandası, Süt Bileşimi, Laktasyon Dönemi, Süt ve Döl Verimi Atatürk Üniv. Ziraat Fak. Derg. 30 (2), 151-159, 1999 AFYON KOCATEPE TARIMSAL ARAŞTIRMA ENSTİTÜSÜ ANADOLU MANDALARINDA SÜT VERİM VE BİLEŞİMİNİN LAKTASYON DÖNEMLERİNE GÖRE DEĞİŞİMİ, SÜT VE BAZI DÖL VERİM



ORGANIC FARMING IN TURKEY Republic of Turkey Ministry of Food Agriculture and Livestock General Directorate of Plant Production ORGANIC FARMING IN TURKEY By Vildan KARAARSLAN Head of Department Agronomist and Food Science Expert


Yüz Tanımaya Dayalı Uygulamalar. (Özet)

Yüz Tanımaya Dayalı Uygulamalar. (Özet) 4 Yüz Tanımaya Dayalı Uygulamalar (Özet) Günümüzde, teknolojinin gelişmesi ile yüz tanımaya dayalı bir çok yöntem artık uygulama alanı bulabilmekte ve gittikçe de önem kazanmaktadır. Bir çok farklı uygulama


daha çok göz önünde bulundurulabilir. Öğrencilerin dile karşı daha olumlu bir tutum geliştirmeleri ve daha homojen gruplar ile dersler yürütülebilir.

daha çok göz önünde bulundurulabilir. Öğrencilerin dile karşı daha olumlu bir tutum geliştirmeleri ve daha homojen gruplar ile dersler yürütülebilir. ÖZET Üniversite Öğrencilerinin Yabancı Dil Seviyelerinin ve Yabancı Dil Eğitim Programına Karşı Tutumlarının İncelenmesi (Aksaray Üniversitesi Örneği) Çağan YILDIRAN Niğde Üniversitesi, Sosyal Bilimler


10.7442 g Na2HPO4.12H2O alınır, 500mL lik balonjojede hacim tamamlanır.

10.7442 g Na2HPO4.12H2O alınır, 500mL lik balonjojede hacim tamamlanır. 1-0,12 N 500 ml Na2HPO4 çözeltisi, Na2HPO4.12H2O kullanılarak nasıl hazırlanır? Bu çözeltiden alınan 1 ml lik bir kısım saf su ile 1000 ml ye seyreltiliyor. Son çözelti kaç Normaldir? Kaç ppm dir? % kaçlıktır?



ÇEVRESEL TEST HİZMETLERİ 2.ENVIRONMENTAL TESTS ÇEVRESEL TEST HİZMETLERİ 2.ENVIRONMENTAL TESTS Çevresel testler askeri ve sivil amaçlı kullanılan alt sistem ve sistemlerin ömür devirleri boyunca karşı karşıya kalabilecekleri doğal çevre şartlarına dirençlerini





Ezgi KARA*, Murat ÇİMEN**, Servet KAYA*, Ümit GARİP*, Mehmet ŞAHİNSOY*

Ezgi KARA*, Murat ÇİMEN**, Servet KAYA*, Ümit GARİP*, Mehmet ŞAHİNSOY* ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Hakkari İlinde Yetiştirilen Yerli Kıl Keçilerden Elde Edilen Sütlerde Toplam Yağ ve Protein Seviyelerinin Türk Standartlarına Uygunluklarının



A UNIFIED APPROACH IN GPS ACCURACY DETERMINATION STUDIES A UNIFIED APPROACH IN GPS ACCURACY DETERMINATION STUDIES by Didem Öztürk B.S., Geodesy and Photogrammetry Department Yildiz Technical University, 2005 Submitted to the Kandilli Observatory and Earthquake



TÜRKÇE ÖRNEK-1 KARAALİ KÖYÜ NÜN MONOGRAFYASI ÖZET TÜRKÇE ÖRNEK-1 KARAALİ KÖYÜ NÜN MONOGRAFYASI ÖZET Bu çalışmada, Karaali Köyü nün fiziki, beşeri, ekonomik coğrafya özellikleri ve coğrafi yapısının orada yaşayan insanlarla olan etkileşimi incelenmiştir.








6. Seçilmiş 24 erkek tipte ağacın büyüme biçimi, ağacın büyüme gücü (cm), çiçeklenmenin çakışma süresi, bir salkımdaki çiçek tozu üretim miktarı,

6. Seçilmiş 24 erkek tipte ağacın büyüme biçimi, ağacın büyüme gücü (cm), çiçeklenmenin çakışma süresi, bir salkımdaki çiçek tozu üretim miktarı, ÖZET Bu çalışmada, Ceylanpınar Tarım İşletmesi'nde bulunan antepfıstığı parsellerinde yer alan bazı erkek tiplerin morfolojik ve biyolojik özelikleri araştırılmıştır. Çalışma, 1995 ve 1996 yıllarında hem


ANADOLU MANDASI. Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl.

ANADOLU MANDASI. Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl. ANADOLU MANDASI Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl.Biyometri Biyometri ve Genetik ABD Dombey,Gedek,Camış,Kömüş gibi


ÖZET Amaç: Yöntem: Bulgular: Sonuçlar: Anahtar Kelimeler: ABSTRACT Rational Drug Usage Behavior of University Students Objective: Method: Results:

ÖZET Amaç: Yöntem: Bulgular: Sonuçlar: Anahtar Kelimeler: ABSTRACT Rational Drug Usage Behavior of University Students Objective: Method: Results: ÖZET Amaç: Bu araştırma, üniversite öğrencilerinin akılcı ilaç kullanma davranışlarını belirlemek amacı ile yapılmıştır. Yöntem: Tanımlayıcı-kesitsel türde planlanan araştırmanın evrenini;; bir kız ve





Siyah Alaca Sığırlarda Kuruda Kalma Süresi, Servis Periyodu ve İlkine Buzağılama Yaşı ile Bazı Süt Verim Özellikleri Arasındaki İlişkiler

Siyah Alaca Sığırlarda Kuruda Kalma Süresi, Servis Periyodu ve İlkine Buzağılama Yaşı ile Bazı Süt Verim Özellikleri Arasındaki İlişkiler Ulud. Üniv. Zir. Fak. Derg., (2004) 18(1): 69-79 Siyah Alaca Sığırlarda Kuruda Kalma Süresi, Servis Periyodu ve İlkine Buzağılama Yaşı ile Bazı Süt Verim Özellikleri Arasındaki İlişkiler Serdar DURU *


Journal of Cell and Molecular Biology 12(1&2): 39-45, 2014 Research Article 39 Haliç University, Printed in Turkey.

Journal of Cell and Molecular Biology 12(1&2): 39-45, 2014 Research Article 39 Haliç University, Printed in Turkey. Journal of Cell and Molecular Biology 12(1&2): 39-45, 2014 Research Article 39 Haliç University, Printed in Turkey. Türkiye de bulunan bazı keçi ırklarında mikrosatellit DNA markörlerinin





A8. Kul, E., Erdem, H., 2008. Relationships Between Somatic Cell Count and Udder Traits in Jersey Cows. J. Appl. Anim. Res. 34 (2008):101-104.

A8. Kul, E., Erdem, H., 2008. Relationships Between Somatic Cell Count and Udder Traits in Jersey Cows. J. Appl. Anim. Res. 34 (2008):101-104. ESERLER A. ULUSLARARASI A1. Şekerden, Ö., Erdem, H., 1997. Various udder characteristics and their relationships with milk yield in Simmental cattle of Kazova State Farm. Tr. J. of Vet. and Anim. Sci.


Clarias gariepinus (Burchell, 1822) un İki Farklı Populasyonunda Genetik Polimorfizimin Araştırılması

Clarias gariepinus (Burchell, 1822) un İki Farklı Populasyonunda Genetik Polimorfizimin Araştırılması GÜ, Gazi Eğitim Fakültesi Dergisi, Cilt 31, Sayı 1 (2011) 261-271 Clarias gariepinus (Burchell, 1822) un İki Farklı Populasyonunda Genetik Polimorfizimin Araştırılması Two Different Population of Clarias


Dersin Kodu Dersin Adı Dersin Türü Yıl Yarıyıl AKTS

Dersin Kodu Dersin Adı Dersin Türü Yıl Yarıyıl AKTS Dersin Kodu Dersin Adı Dersin Türü Yıl Yarıyıl AKTS 507004832007 KALİTE KONTROLÜ Seçmeli 4 7 3 Dersin Amacı Günümüz sanayisinin rekabet ortamında kalite kontrol gittikçe önem kazanan alanlardan birisi


Doç. Dr. Ümit KOÇ (You can see his CV in English on the following pages)

Doç. Dr. Ümit KOÇ (You can see his CV in English on the following pages) Doç. Dr. Ümit KOÇ (You can see his CV in English on the following pages) Celal Bayar Üniversitesi Fen-Edebiyat Fakültesi, Tarih Bölümü, Yeniçağ Tarihi Anabilim Dalı,


Tarým Arazilerinin Amaç Dýþý Kullanýmý; Erzurum Örneði

Tarým Arazilerinin Amaç Dýþý Kullanýmý; Erzurum Örneði Tarým Arazilerinin Amaç Dýþý Kullanýmý; Erzurum Örneði Ekoloji 13, 52, 1-6 2004 Ali Kýlýç ÖZBEK Devlet Su Ýþleri 8. Bölge Müdürlüðü 25100, ERZURUM Taþkýn ÖZTAÞ Atatürk Üniversitesi, Ziraat Fakültesi, Toprak


Determining some heavy metal concentrations in water and sediments samples taken from Gediz River. Title Institution / University Year

Determining some heavy metal concentrations in water and sediments samples taken from Gediz River. Title Institution / University Year CV Name: Orkide MİNARECİ Date of Birth: 15.01.1972 Academic Title: Assist. Prof. Dr. Education Programme/Department University Bachelor Master Department of Biology (Fundamental and industrial microbiology)


Fertility and Milk Production Characteristics of Saanen Goats Raised in Muş Region [1]

Fertility and Milk Production Characteristics of Saanen Goats Raised in Muş Region [1] Kafkas Univ Vet Fak Derg 18 (3): 351-358, 2012 DOI:10.9775/kvfd.2011.4895 RESEARCH ARTICLE Fertility and Milk Production Characteristics of Saanen Goats Raised in Muş Region [1] Memiş BOLACALI * Mürsel



TEST RESULTS UFED, XRY and SIMCON TEST RESULTS UFED, XRY and SIMCON Test material : SIM card Tested software : UFED 3.6, XRY 6.5, SIMcon v1.2 Expected results : Proper extraction of SMS messages Date of the test : 02.04.2013 Note : The



ÖZGEÇMİŞ VE ESERLER LİSTESİ ÖZGEÇMİŞ VE LER LİSTESİ Adı Soyadı: Savaş Atasever Doğum Tarihi: 8 Ocak 970 Öğrenim Durumu: Derece Bölüm/Program Üniversite Yıl Lisans Zootekni Ondokuz Mayıs Üniversitesi 99 Y. Lisans Zootekni Ondokuz


Batı Anadolu İçin Bir Süt Keçisi: Bornova Keçisi

Batı Anadolu İçin Bir Süt Keçisi: Bornova Keçisi Hayvansal Üretim 43(2): 79-85 (2002) Batı Anadolu İçin Bir Süt Keçisi: Bornova Keçisi Metin Şengonca 1 Mustafa Kaymakçı 1 Nedim Koşum 1 Turgay Taşkın 1 Jörg Steinbach 2 1 Ege Üniversitesi Ziraat Fakültesi





Keçi Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı Çoklu-PZR (Multipleks PCR) Sistemleri*

Keçi Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı Çoklu-PZR (Multipleks PCR) Sistemleri* Keçi Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı Çoklu-PZR (Multipleks PCR) Sistemleri* Özgecan KORKMAZ AĞAOĞLU**, Bengi ÇINAR KUL***, Bilal AKYÜZ****, Emel ÖZKAN*****, Okan ERTUĞRUL******,


ELDAŞ Elektrik Elektronik Sanayi ve Tic.A.Ş.

ELDAŞ Elektrik Elektronik Sanayi ve Tic.A.Ş. Sayfa (Page): 2/9 LVD Deney Raporu LVD Testing Report İÇİNDEKİLER (Contents) 1 Dokümantasyon Sayfa (Documentation) 1.1 DGC, Çevre Koşulları ve Sembollerin Tanımları 3 (Conditions/Power Utilized,Description


Okul Öncesi (5-6 Yaş) Cimnastik Çalışmasının Esneklik, Denge Ve Koordinasyon Üzerine Etkisi

Okul Öncesi (5-6 Yaş) Cimnastik Çalışmasının Esneklik, Denge Ve Koordinasyon Üzerine Etkisi Okul Öncesi (5-6 Yaş) Cimnastik Çalışmasının Esneklik, Denge Ve Koordinasyon Üzerine Etkisi Kadir KOYUNCUOĞLU, Onsekiz Mart Üniversitesi, Beden Eğitimi ve Spor Yüksek Okulu, Çanakkale, Türkiye.





ATILIM UNIVERSITY Department of Computer Engineering

ATILIM UNIVERSITY Department of Computer Engineering ATILIM UNIVERSITY Department of Computer Engineering COMPE 350 Numerical Methods Fall, 2011 Instructor: Fügen Selbes Assistant: İsmail Onur Kaya Homework: 1 Due date: Nov 14, 2011 You are designing a spherical


Araziye Çıkmadan Önce Mutlaka Bizi Arayınız!

Araziye Çıkmadan Önce Mutlaka Bizi Arayınız! Monthly Magnetic Bulletin March 2014 z BOĞAZİÇİ UNIVERSITY KANDİLLİ OBSERVATORY and EARTHQUAKE RESEARCH INSTITUTE GEOMAGNETISM LABORATORY Magnetic Results


YÜKSEKÖĞRETİM KURULU YARDIMCI DOÇENT 01.12.2014. : Sinop Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Sinop

YÜKSEKÖĞRETİM KURULU YARDIMCI DOÇENT 01.12.2014. : Sinop Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Sinop HÜLYA SİPAHİ ÖZGEÇMİŞ YÜKSEKÖĞRETİM KURULU YARDIMCI DOÇENT 01.12.2014 Adres : Sinop Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Sinop Telefon : 3682715516-4206 E-posta Doğum Tarihi : Faks : Kadro


T.C. Hitit Üniversitesi. Sosyal Bilimler Enstitüsü. İşletme Anabilim Dalı

T.C. Hitit Üniversitesi. Sosyal Bilimler Enstitüsü. İşletme Anabilim Dalı T.C. Hitit Üniversitesi Sosyal Bilimler Enstitüsü İşletme Anabilim Dalı X, Y, Z KUŞAĞI TÜKETİCİLERİNİN YENİDEN SATIN ALMA KARARI ÜZERİNDE ALGILANAN MARKA DENKLİĞİ ÖĞELERİNİN ETKİ DÜZEYİ FARKLILIKLARININ


Profiling the Urban Social Classes in Turkey: Economic Occupations, Political Orientations, Social Life-Styles, Moral Values

Profiling the Urban Social Classes in Turkey: Economic Occupations, Political Orientations, Social Life-Styles, Moral Values Profiling the Urban Social Classes in Turkey: Economic Occupations, Political Orientations, Social Life-Styles, Moral Values Presentation of the Basic Findings of a Public Opinion Survey Supported with


Flue Cured Tütün Çeşidinde Farklı Potasyum Formlarının Kaliteye Etkisi

Flue Cured Tütün Çeşidinde Farklı Potasyum Formlarının Kaliteye Etkisi Flue Cured Tütün Çeşidinde Farklı Potasyum Formlarının Kaliteye Etkisi Mahmut Tepecik 1 M.Eşref İrget 2 ÖZET Düzce ili merkeze bağlı Otluoğlu köyünde çiftçi koşullarında yürütülen bu denemede K un farklı



ÖZGEÇMİŞ VE ESERLER LİSTESİ ÖZGEÇMİŞ VE ESERLER LİSTESİ ÖZGEÇMİŞ Adı Soyadı : Levent MERCAN Doğum Tarihi : 1 Ocak 1979 Öğrenim Durumu : Derece Bölüm/Program Üniversite Yıl Lisans Zootekni Ondokuz Mayıs Üniversitesi 2001 Y. Lisans



HIGH SCHOOL BASKETBALL SCHOOLS Bulletin No: 7 (08 December 21 December 2014 ) Page 1 BASKETBALL MIDDLESCHOOL STREETBALL 8B has won the match that it played against 8C and got 3rd place with a a score of 10-9. 8D became the champion


ÖZET. Yüksek Lisans Tezi. Đmge Đ. TOKBAY. Adnan Menderes Üniversitesi Fen Bilimleri Enstitüsü Tarla Bitkileri Anabilim Dalı

ÖZET. Yüksek Lisans Tezi. Đmge Đ. TOKBAY. Adnan Menderes Üniversitesi Fen Bilimleri Enstitüsü Tarla Bitkileri Anabilim Dalı iii ÖZET Yüksek Lisans Tezi AYDIN EKOLOJĐK KOŞULLARINDA FARKLI EKĐM ZAMANI VE SIRA ARALIĞININ ÇEMEN (Trigonella foenum-graecum L.) ĐN VERĐM VE KALĐTE ÖZELLĐKLERĐNE ETKĐSĐ Đmge Đ. TOKBAY Adnan Menderes



ARI ÜRÜNLERİ KATALOĞU ARI ÜRÜNLERİ KATALOĞU ORGANIC HAKKIMIZDA ABOUT US 1950'li yıllarda Sivas-Zara 'da öğretmen olan Mürteza Üstündağ'ın arzuladığı ve başlattığı, teknik arıcılık ile doğal bal üretimi, nesilden nesile aktarılarak


Siyah Alaca İneklerde Yağ, Protein, Toplam ve Yağsız Katı Madde Verimleri Üzerine Etkin Faktörler ve Bu Verimlere Ait Kalıtım Derecesi Tahminleri

Siyah Alaca İneklerde Yağ, Protein, Toplam ve Yağsız Katı Madde Verimleri Üzerine Etkin Faktörler ve Bu Verimlere Ait Kalıtım Derecesi Tahminleri Hayvansal Üretim 43(2): 54-60 (2002) Siyah Alaca İneklerde Yağ, Protein, Toplam ve Yağsız Katı Madde Verimleri Üzerine Etkin Faktörler ve Bu Verimlere Ait Kalıtım Derecesi Tahminleri Özel Şekerden Mustafa





Ankara keçilerinde süt verimi ve oğlaklarda büyümeye etkisi

Ankara keçilerinde süt verimi ve oğlaklarda büyümeye etkisi Ankara Üniv Vet Fak Derg, 59, 129-134, 2012 Ankara keçilerinde süt verimi ve oğlaklarda büyümeye etkisi Halil EROL 1, H. İbrahim AKÇADAĞ 1, Necmettin ÜNAL 2, Halil AKÇAPINAR 2 1 Lalahan Hayvancılık Merkez


TRAKYA DA VEJETASYON DEVRESİ VE BU DEVREDEKİ YAĞIŞLAR. Vegetation period and rainfalls during in this time in Trakya (Thrace)

TRAKYA DA VEJETASYON DEVRESİ VE BU DEVREDEKİ YAĞIŞLAR. Vegetation period and rainfalls during in this time in Trakya (Thrace) Ocak 2010 Cilt:18 No:1 Kastamonu Eğitim Dergisi 227-232 TRAKYA DA VEJETASYON DEVRESİ VE BU DEVREDEKİ YAĞIŞLAR Özet Duran AYDINÖZÜ Kastamonu Üniversitesi, Eğitim Fakültesi, İlköğretim Bölümü, Kastamonu





Fen Edebiyat Fak. Moleküler Biyoloji ve Genetik Bölümü Kütahya 1977

Fen Edebiyat Fak. Moleküler Biyoloji ve Genetik Bölümü Kütahya 1977 Adı Soyadı Ünvanı Birimi Doğum Yeri Doğum Tarihi BİLECİK ŞEYH EDEBALİ ÜNİVERSİTESİ İsmail POYRAZ Yrd.Doç.Dr. AKADEMİK ÖZGEÇMİŞ FORMU KİŞİSEL BİLGİLER Fen Edebiyat Fak. Moleküler Biyoloji ve Genetik Bölümü


Anadolu Mandalarının Çeşitli Vücut Ölçülerine Göre Morfometrik Karekterizasyonu

Anadolu Mandalarının Çeşitli Vücut Ölçülerine Göre Morfometrik Karekterizasyonu Anadolu Mandalarının Çeşitli Vücut Ölçülerine Göre Morfometrik Karekterizasyonu E. K. Gürcan Y. T. Tuna M.İ. Soysal Namık Kemal Üniversitesi Ziraat Fakültesi, Zootekni Bölümü,Tekirdağ Bu çalışmada Türkiye



LABORATUVAR MATEMATİĞİ LABORATUVAR MATEMATİĞİ Dr. Zafer KÜÇÜKODACI GATA HEH Patoloji Servisi 22. ULUSAL PATOLOJİ KONGRESİ 7 Kasım 2012 Manavgat AMAÇ 2.3. DNA extraction by boiling : Total DNA was extracted by a boiling method





CURRICULUM VITAE. Assistant Prof. Dr. Birim BALCI

CURRICULUM VITAE. Assistant Prof. Dr. Birim BALCI CURRICULUM VITAE Assistant Prof. Dr. Birim BALCI 1- Name and Surname : Birim BALCI 2- Date of Birth : 28.07.1975 3- Department : Computer Engineering 4- Education: Degree Department University Year Bachelor


Siyah Alaca Sığırlarda Kısmi Süt Verimlerinden Yararlanılarak 305 Günlük Süt Veriminin Tahmini

Siyah Alaca Sığırlarda Kısmi Süt Verimlerinden Yararlanılarak 305 Günlük Süt Veriminin Tahmini Siyah Alaca Sığırlarda Kısmi Süt Verimlerinden Yararlanılarak 305 Günlük Süt Veriminin Tahmini İ. Keskin S. Boztepe Selçuk Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, Konya Bu çalışmada, Konya nın


Iğdır İlinin Hayvansal Atık Kaynaklı Biyogaz Potansiyeli. Biogas Potential from Animal Waste of Iğdır Province

Iğdır İlinin Hayvansal Atık Kaynaklı Biyogaz Potansiyeli. Biogas Potential from Animal Waste of Iğdır Province Araştırma Makalesi / Research Article Iğdır Üni. Fen Bilimleri Enst. Der. / Iğdır Univ. J. Inst. Sci. & Tech. 2(1): 61-66, 2012 Iğdır İlinin Hayvansal Atık Kaynaklı Biyogaz Potansiyeli Iğdır Üniversitesi





Filiz AKDAĞ* The effect of slaughter age on slaughter and carcass characteristics in indigenous water. buffaloes

Filiz AKDAĞ* The effect of slaughter age on slaughter and carcass characteristics in indigenous water. buffaloes YERLİ IRK MANDALARDA KESİM YAŞININ KESİM VE KARKAS ÖZELLİKLERİ ÜZERİNE ETKİSİ Filiz AKDAĞ* The effect of slaughter age on slaughter and carcass characteristics in indigenous water buffaloes Summary: This



KULLANILAN MADDE TÜRÜNE GÖRE BAĞIMLILIK PROFİLİ DEĞİŞİKLİK GÖSTERİYOR MU? Kültegin Ögel, Figen Karadağ, Cüneyt Evren, Defne Tamar Gürol KULLANILAN MADDE TÜRÜNE GÖRE BAĞIMLILIK PROFİLİ DEĞİŞİKLİK GÖSTERİYOR MU? Kültegin Ögel, Figen Karadağ, Cüneyt Evren, Defne Tamar Gürol 1 Acibadem University Medical Faculty 2 Maltepe University Medical


Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu

Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu Fırat TOK*, Murat ÇİMEN**,








1 I S L U Y G U L A M A L I İ K T İ S A T _ U Y G U L A M A ( 5 ) _ 3 0 K a s ı m

1 I S L U Y G U L A M A L I İ K T İ S A T _ U Y G U L A M A ( 5 ) _ 3 0 K a s ı m 1 I S L 8 0 5 U Y G U L A M A L I İ K T İ S A T _ U Y G U L A M A ( 5 ) _ 3 0 K a s ı m 2 0 1 2 CEVAPLAR 1. Tekelci bir firmanın sabit bir ortalama ve marjinal maliyet ( = =$5) ile ürettiğini ve =53 şeklinde


Mustafa Kemal SOYLU. Yüksek Mühendis.

Mustafa Kemal SOYLU. Yüksek Mühendis. KİŞİSEL BİLGİLER Adı Soyadı Mustafa Kemal SOYLU Unvan Yüksek Mühendis Telefon 02268142520/1299 E-mail Doğum Tarihi - Yeri 28/03/1974- Çamardı (Niğde) Fotoğraf Doktora Yüksek Lisans


Yozgat İli Boğazlıyan İlçesinde Özel Bir İşletmede Yetiştirilen Siyah Alaca Sığırların Döl Verimi Özellikleri*

Yozgat İli Boğazlıyan İlçesinde Özel Bir İşletmede Yetiştirilen Siyah Alaca Sığırların Döl Verimi Özellikleri* YYU Veteriner Fakultesi Dergisi, 2012, 23 (2), 83-87 ISSN: 1017-8422; e-issn: 1308-3651 ORİJİNAL MAKALE Yozgat İli Boğazlıyan İlçesinde Özel Bir İşletmede Yetiştirilen Siyah Alaca Sığırların Döl Verimi


ÖNSÖZ. beni motive eden tez danışmanım sayın Doç. Dr. Zehra Özçınar a sonsuz

ÖNSÖZ. beni motive eden tez danışmanım sayın Doç. Dr. Zehra Özçınar a sonsuz i ÖNSÖZ Bu çalışma uzun ve zor, ancak bir o kadar da kazançlı bir sürecin ürünüdür. Öncelikle; bilgi ve deneyimleri ile bu süreçte bana yol gösteren, anlayışlı tutumuyla beni motive eden tez danışmanım


Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi

Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi Muhammet


1 9 1 4 1 0 1 6 1 9 1 1-2012

1 9 1 4 1 0 1 6 1 9 1 1-2012 1 3 1 4 1 9 1 1 1 2 1 9 1 4 1 1 1 2 1 9 1 7 1 4 1 9 1 4 1 7 1 1 1 8 1 9 1 0 1 4 1 9 1 7 1 1 1 7 1 9 1 8 1 7 1 8 1 2 1 9 1 9 1 8 1 2 1 9 1 0 1 2 1 4 1 1 1 6 1 1 1 9 1 9 1 8 1 8 1 8 1 1 1 9 1 8 1 7 1 9 1






MEVLANA DEĞİŞİM PROGRAMI PROTOKOLÜ m, MEVLANA DEĞİŞİM PROGRAMI PROTOKOLÜ MEVLANA EXCHANGE PROGRAMME PROTOCOL Bizler, aşağıda imzalan bulunan yükseköğretim kurumlan olarak, kurumlanmız arasında Mevlana Değişim Programı kapsamında işbirliği





ARAŞTIRMA. Anahtar Kelimeler: Saanen, Kıl keçisi, Melezleme, Büyüme, Yaşama Gücü

ARAŞTIRMA. Anahtar Kelimeler: Saanen, Kıl keçisi, Melezleme, Büyüme, Yaşama Gücü ARAŞTIRMA 2007: 21 (1): 21-26 Saanen X Kıl Keçisi F1 ve G1 Melezlerinde Büyüme ve Yaşama Gücü Özelliklerinin Araştırılması Ü. Gülcihan ŞİMŞEK Metin BAYRAKTAR Murad GÜRSES Fırat Üniversitesi











Araştırma Makalesi (Research Article)

Araştırma Makalesi (Research Article) Araştırma Makalesi (Research Article) Yaşar Tuncer KAVUT A. Esen ÇELEN Gülcan DEMİROĞLU TOPÇU Behçet KIR 1 Ege Üniversitesi, Ziraat Fakültesi, Tarla Bitkileri Bölümü, 35100 İzmir/Türkiye e-posta:



IDENTITY MANAGEMENT FOR EXTERNAL USERS 1/11 Sürüm Numarası Değişiklik Tarihi Değişikliği Yapan Erman Ulusoy Açıklama İlk Sürüm IDENTITY MANAGEMENT FOR EXTERNAL USERS You can connect EXTERNAL Identity Management System (IDM) with



RiTMiK CiMNASTiKÇiLERDE sıçrama Spor Bilimleri Dergisi Hacettepe 1. ofspor! Sciences 2003,14 (3),104-113 RiTMiK CiMNASTiKÇiLERDE sıçrama YÜKSEKLiKLERi, izokinetik KUWET VE EMG PROFiLLERiNiN KARŞILAŞTIRILMASI Pınar ARPINAR*, Gülbin R.






WEEK 4 BLM323 NUMERIC ANALYSIS. Okt. Yasin ORTAKCI. WEEK 4 BLM33 NUMERIC ANALYSIS Okt. Yasin ORTAKCI Karabük Üniversitesi Uzaktan Eğitim Uygulama ve Araştırma Merkezi BLM33 NONLINEAR EQUATION SYSTEM Two or more degree polinomial


Grundtvig Öğrenme Ortaklığı Projesi CRISTAL Common References in Sustainable Training in Adult Learning 2011-2013

Grundtvig Öğrenme Ortaklığı Projesi CRISTAL Common References in Sustainable Training in Adult Learning 2011-2013 Grundtvig Öğrenme Ortaklığı Projesi CRISTAL Common References in Sustainable Training in Adult Learning 2011-2013 Bu proje Avrupa Komisyonu tarafından finanse edilmektedir. İletişim: Afyonkarahisar İl





Yard. Doç. Dr. İrfan DELİ. Matematik

Yard. Doç. Dr. İrfan DELİ. Matematik Unvanı Yard. Doç. Dr. Adı Soyadı İrfan DELİ Doğum Yeri ve Tarihi: Çivril/Denizli -- 06.04.1986 Bölüm: E-Posta Matematik, AKADEMİK GELİŞİM ÜNİVERSİTE YIL Lisans




Detaylı / Ege Üniversitesi Fen Bilimleri Enstitüsü Bahçe Bitkileri Anabilim Dalı / 2010 / Ege Üniversitesi Fen Bilimleri Enstitüsü Bahçe Bitkileri Anabilim Dalı / 2010 KİŞİSEL BİLGİLER Adı Soyadı Dr. Arif ATAK Unvan Dr.Mühendis Telefon 0226 814 25 20 (1220) E-mail / Doğum Tarihi - Yeri 15.11.1972 Aksaray Fotoğraf Doktora Üniversite



ABSTRACT $WWLWXGHV 7RZDUGV )DPLO\ 3ODQQLQJ RI :RPHQ $QG $IIHFWLQJ )DFWRUV ÖZET Amaç: Araştırma, Aile Planlaması (AP) polikliniğine başvuran kadınların AP ye ilişkin tutumlarını ve bunu etkileyen faktörleri belirlemek amacıyla yapılmıştır. Yöntem: Tanımlayıcı tipteki bu araştırma



Multiplication/division Multiplication/division Oku H&P sections 4.6-4.8 Bir kac integer multiplication algorithm Bir integer division algorithms Floating point math 10/22/2004 Bilgisayar Mimarisi 6.1 10/22/2004 Bilgisayar Mimarisi



ASSESSMENT OF SUDAN-NYALA City s WATER HEALTH IN UNUSUAL LIFE ASSESSMENT OF SUDAN-NYALA City s WATER HEALTH IN UNUSUAL LIFE *Hasan Hüseyin EKER *Sanaa İSHAG **Eyup DEBİK **Ahmet DOGAN * Ceyda ACAR *** Ahmed Beraka *Bezmialem Vakİf University - School of Medicine


Turkish and Kurdish influences in the Arabic Dialects of Anatolia. Otto Jastrow (Tallinn)

Turkish and Kurdish influences in the Arabic Dialects of Anatolia. Otto Jastrow (Tallinn) Türk Dilleri Araştırmaları, 21.1 (2011): 83-94 Turkish and Kurdish influences in the Arabic Dialects of Anatolia Otto Jastrow (Tallinn) Özet: Anadolu Arapçası, ayrı lehçeler (Sprachinseln) biçiminde ortaya


MANDA YETİŞTİRİCİLİĞİ VE TÜRKİYE DEKİ GELECEĞİ. Savaş ATASEVER Hüseyin ERDEM Ondokuz Mayıs Üniversitesi Ziraat Fakültesi Zootekni Bölümü, Samsun

MANDA YETİŞTİRİCİLİĞİ VE TÜRKİYE DEKİ GELECEĞİ. Savaş ATASEVER Hüseyin ERDEM Ondokuz Mayıs Üniversitesi Ziraat Fakültesi Zootekni Bölümü, Samsun OMÜ Zir. Fak. Dergisi, 2008,23(1):59-64 J. of Fac. of Agric., OMU, 2008,23(1):59-64 MANDA YETİŞTİRİCİLİĞİ VE TÜRKİYE DEKİ GELECEĞİ Savaş ATASEVER Hüseyin ERDEM Ondokuz Mayıs Üniversitesi Ziraat Fakültesi


DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D.

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. DR. ONUR YILMAZ Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. Koç Katımı Çiftleşme mevsiminde kızgınlık gösteren koyunun koç ile birleştirilmesi olayına koç katımı



MEVLANA DEĞİŞİM PROGRAMI PROTOKOLÜ MEVLANA DEĞİŞİM PROGRAMI PROTOKOLÜ MEVLANA ECHANGE PROGRAMME PROTOCOL Bizler, aşağıda imzaları bulunan yükseköğretim kurumlan olarak, kurumlarımız arasında Mevlana Değişim Programı kapsamında işbirliği


Afyonkarahisar da Üretilen Hazır Beton Kalitelerinin Değerlendirilmesi

Afyonkarahisar da Üretilen Hazır Beton Kalitelerinin Değerlendirilmesi Afyonkarahisar da Üretilen Hazır Beton Kalitelerinin Değerlendirilmesi Ali Ergün a, Veli Başaran b a Afyon Kocatepe Üniversitesi, Teknik Eğitim Fakültesi,Yapı Eğitimi Böl., 03200, Afyonkarahisar b Afyon
