TÜRKİYE ATOM ENERJİSİ KURUMU TEKNİK RAPOR COXIELLA BURNETII'NİN KENELERDEN POLİMERAZ ZİNCİR REAKSİYONU (PCR) VE PCR-RFLPİLE SAPTANMASI

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "TÜRKİYE ATOM ENERJİSİ KURUMU TEKNİK RAPOR COXIELLA BURNETII'NİN KENELERDEN POLİMERAZ ZİNCİR REAKSİYONU (PCR) VE PCR-RFLPİLE SAPTANMASI"

Transkript

1

2

3 TÜRKİYE ATOM ENERJİSİ KURUMU TEKNİK RAPOR COXIELLA BURNETII'NİN KENELERDEN POLİMERAZ ZİNCİR REAKSİYONU (PCR) VE PCRRFLPİLE SAPTANMASI 00

4 TÜRKİYE ATOM ENERJİSİ KURUMU 690 sayılı kanım ile kurulmuş olan Türkiye Atom Enerjisi Kurumu'nun ana görevi; atom enerjisinin barışçıl amaçlarla ülke yararına kullanılmasında izlenecek ulusal politikanın esaslarmı ve bu konudaki plan ve programları belirlemek; ülkenin bilimsel, teknik ve ekonomik kalkınmasında atom enerj isinden yararlanılmasını mümkün kılacak her türlü araştırma, geliştirme, inceleme ve çalışmayı yapmak ve yaptırmak, bu alanda yapılacak çalışmaları koordine ve teşvik etmektir. Bu çalışma TAEK personeli tarafından gerçekleştirilmiş araştırma, geliştirme ve inceleme sonuçlarmm paylaşımı amacıyla Teknik Rapor olarak hazırlanmış ve basılmıştır. Teknik Rapor 00/ Türkiye Atom Enerjisi Kurumu yayınıdır. /t: _. % İzin alınmaksızın çoğaltılabilir. >Si & Referans verilerek kullanılabilir. TÜRKİYE ATOM ENERJİSİ KURUMU Adres : Eskişehir Yolu 9. km 060 Ankara/Türkiye Tel :+90 () Fax :+90 () Web :

5 ONSOZ Co^iella 6umetü, Q humması hastalığının etiyolojik, etkeni olup, obligat intraselüler bir bakteridir. (Doğada yaygın olarak^ bulunur ve çeşitti hayvanlarda (sığır, koyun, kgçi) ve insanlarda (^humması enfeksiyonunu oluşturur, C. burnetii sütlerden, Senelerden ve akut veya kronik^ Q humması ile enfeste insanlardan izole edilmiştir, "Keneler, C burnetii'nin rezervuarı ve birincilvektörleridir. Kırktanfazla kgne türünün C burnetii ile enfeste olduğu saptandığından Seneler doğada enfeksiyonun belirleyicisi olarak^görülmektedirler, (Bu çalışmada, Türkiye'nin 8 ilinden toplam 47 (446 dişi, 0 erkekj, nymph) adet kene toplanmıştır, (Bu keneler toplandığı ile, tür ve cinsiyetine göre 7 adedi bir araya getirilerekgruplandırılmışve gruplar (DNA ekştrakşiyonu sonrasında C(B ve C(B primerleri kullanılarakjpc ( Rjle C. burnetii'nin varlığı yönünde incelenmiştir, (Bu teknik^ rapor, TA'EK stratejisi çerçevesinde 007/ nolu Çenelgede belirtilen formata uygun olarak^ V'E TübitakıOlfVKflÇ^lOO) "Coxjella. burnetii'nin "Kenelerden (polimeraz Zincir Reaksiyonu ((PC%) ve ( PC c Rz c RTL ( P ile Saptanması (projesi" sonucunda elde edilen bilgilerin ve çalışma metodunun gerek^yayın olarak^ gerek,çeşitli kuruluşlarda düzenlenen bilimsel toplantılarda yapılan sunular çerçevesinde bilim dünyasına sunulması hedeflenmektedir.

6

7 İÇİNDEKİLER Tablolar Dizini i Şekiller Dizini ii Yönetici Özeti iii Executive Summary iv Terimler ve Kısaltmalar. v. GİRİŞ. MATERYAL ve METOT. Kenelerin toplanması ve saklanması. Kenelerin tür ve cinsiyet tayini. Kenelerin gruplandırılması.4 Kenelerin DNA ekstraksiyonu için hazırlanması. Kenelerden DNA ekstraksiyonu.6 Pozitif kontrol DNA.7 Kullanılan primerler 6.8 Negatif kontrol 6.9 PCR için uygun primer seçimi 6.0 PCR amplinkasyonu 6. Ekstraksiyon kitinin kontrolü 7. Elektroforez ve görüntüleme 7. Restriction fragment length polymorrphism(rflp) 7. BULGULAR 8. Kenelerin tür ve cinsiyet tayini sonuçları 8. Ekstraksiyon kitinin kontrol sonucu. PCR standardizasyon bulguları.4 PCR bulguları. PCR ile C. burnetü pozitif bulunan kene gruplarının tür ve cinsiyet dağılımları 4.6 Restriction fragment length polymorrphism(rflp) bulguları TARTIŞMA ve SONUÇ 6. KAYNAKLAR 9

8

9 Tablolar Dizini Tablo. Toplanan kenelerin illere göre tür ve cinsiyet dağılımları 8 Tablo. Türkiye'nin 8 ilinden toplanan toplam 47 kenenin tür ve cinsiyet dağılımları Tablo. PCR ile C. burnetü pozitif bulunan kene gruplarının tür ve cinsiyet dağılımları ı

10

11 Şekiller Dizini Resim. Resim : Pozitif PCR ürünlerinin görüntüleri. 0M: 0'lik marker; P: Coxiella burnetii Nine Mile RSA49 susu; N: Negatif kontrol; 007: Denizli pozitif örnekler; 6 Ankara pozitif örnek; 00M:00'lük marker. 4 Resim. 7'lik pozitif PCR ürünlerinin restriksiyon profil analizi. 0 M: 0'lik marker; P: Coxiella burnetii Nine Mile RSA49 susu; N: Negatif kontrol; 007: Denizli pozitif örnekler; 6: Ankara pozitif örnek; 00M: 00'lük marker ıı

12

13 Yönetici Özeti Coxiella burnetii, Q humması hastalığının etiyolojik etkeni olup, obligat intraselüler bir bakteridir. Doğada yaygın olarak bulunur ve çeşitli hayvanlarda (sığır, koyun, keçi) ve insanlarda Qhumması enfeksiyonunu oluşturur. C. burnetii sütlerden, kenelerden ve akut veya kronik Q humması ile enfekte insanlardan izole edilmiştir. Keneler, C. burnetii 'nin rezervuarı ve birincil vektörleridir. Kırktan fazla kene türünün C. burnetii ile enfekte olduğu saptandığından keneler doğada enfeksiyonun belirleyicisi olarak görülmektedirler. Bu çalışmada, Türkiye'nin 8 ilinden toplam 47 (446 dişi, 0 erkek, nymph) adet kene toplandı. Bu keneler toplandığı ile, tür ve cinsiyetine göre 7 adedi bir araya getirilerek gruplandırıldı. Gruplar DNA ekstraksiyonu sonrasında CB ve CB primerleri kullanılarak PCR ile C. burnetii 'nin varlığı yönünde incelendi. Denizli'den toplam 6 kene toplanmış olup, bu keneler tür ve cinsiyetlerine göre gruba ayrılmışlardır. Bu gruplardan 6'sı PCR sonucunda pozitif bulunmuştur. Ankara'dan toplanan toplam 60 kene ise aynı şekilde gruba ayrılmış ve bu gruplardan sadece birinde PCR sonucunda pozitiflik saptanmıştır. PCR ürünlerinin spesifisitesi restriksiyon analizi ile değerlendirildi. Pozitif PCR ürünleri Taql enzimi ile kesildiğinde C. burnetii Nine Mile RSA49 susunda görüldüğü gibi yaklaşık 8, 7, 4 ve 9 bp'lik 4 bant ortaya konuldu.

14

15 Executive Summary Coxiella burnetii, as an obligate intracellular bacterium, is the etiologic agent of Q fever. It is widely distrubuted in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 47 ticks (446 female, 0 male and nymphs) were collected from 8 provinces of Turkey. The ticks were gathered into groups of lto 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burnetii by using the primers CB and CB. The ticks collected from the province of Denizli (6 in total) were gathered into groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 60 ticks, were grouped into as to their species and gender, and only one group was found to be positive for C. burnetii. The specificities of the PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taql and four bands in order of 8, 7, 4 and 9 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA49). IV

16

17 Kısaltmalar ve Terimler Kısaltmalar PCR DNA OMP ddh0 TAE Bp PCRRFLP : Polımeraz zmcır reaksiyonu : Deoksiribonükleik asit : Dış membran proteini : Çift distile su : TrisAsetatEDTA solüsyonu : Baz çifti : Polimeraz zincir reaksiyonurestriksiyon enzim analizi Terimler PCR : Laboratuar ortamında spesifik DNA dizilerinin primer denilen sentetik oligonükleotid diziler yardımıyla çoğaltılması işlemi. Transstadial bulaşma : Hastalık etkeninin parazitin bir gelişme aşamasından diğer gelişme aşamasına aktarılması. Örn: Kenenin nymf aşamasından ergin keneye aktarılması. Transovarial bulaşma : Anneden yavruya bulaşma yolu.

18

19 . GİRİŞ Q humması, obligat intrasellüler bir mikroorganizma olan Coxiella burnetifnm neden olduğu zoonotik bir enfeksiyondur. Etken insana öncelikli olarak aerosol yolla bulaşır ve rüzgar aracılığıyla yayılabilir. Diğer bulaşma yolları ise çok az öneme sahiptir. C. burnetü 'nin rezervuarları sayısızdır ve bunlar arasında evcil ve yabani memeliler, kuşlar ve artropodlar yer almaktadır [6,7]. Bunların içinde en önemli rezervuarlar sığır, koyun ve keçidir. Bu hayvanlarda enfeksiyonun sonucu olarak abortus oluşmasına karşın hastalık genellikle asemptomatik seyreder [ 9, ]. C. burnetü birçok fiziksel ve kimyasal faktörlere karşı dirençli olduğundan çevrede uzun süre canlı kalabilme yeteneğine sahiptir. Bu özellik hastalığın kontrolünde önemli bir engel oluşturmaktadır [6]. Keneler C. burnetü 'nin doğadaki vektörüdür. Keneler etkeni sadece dışkılarıyla veya ısırarak horizontal olarak bulaştırmazlar aynı zamanda transstadial ve transovarial olarak da aktarabilirler. Kene dışkıları doğada C. burnetivrim muhtemelen en yoğun kaynağıdır. C. burnetivmn konak hayvanlara bulaşması kenelerin ısırmasıyla ya da enfekte salgılarla temas aracılığıyla olmaktadır [9]. Kırktan fazla kene türünün C. burnetü ile infekte olduğu belirlenmiştir. Bu nedenle keneler doğada enfeksiyonun belirleyicisi olarak görülmektedir. Örneğin; Slovakya'nm farklı bölgelerinden toplanan Ixodes ricinus, Dermacentor reticulatus, Dermacentor marginatus, Haemaphysalis concinna ve Haemaphysalis inermis türlerinden 0 C. burnetü susu izole edilmiştir [7]. C. burnetü çeşitli kene türlerinden izole edilebilmesine karşın, insanlarda kene aracılığıyla enfeksiyon yaygın değildir. Çünkü enfeksiyon kontamine aerosollarm inhalasyonundan, taze çiftlik ürünlerinin tüketiminden ve enfekte hayvanlarla temastan sonra oluşmaktadır. Enfeksiyon insanlarda akut ve kronik olmak üzere iki formda ortaya çıkar. Akut formda; pnömoni, ateş, granülamatöz hepatitis ve nadiren meningoensefalitis görülmektedir. Kronik formda ise endokarditis oluşmaktadır. Farklı ülkelerden elde edilen veriler, hastalığın klinik görünümünün ve epidemiyolojisininbölgeden bölgeye değiştiğini göstermektedir [9]. Kenelerin bu etkenin çevrede canlılığını devam ettirmesinde önemli bir rol oynadığı görülmektedir. C. burnetü önceden bir riketsiyal etken olarak sınıflandırılmıştır. Daha sonra 6 S rrna geninin moleküler sekansına dayanarak proteobacteria kategorisinin

20 y altbölümüne yerleştirilmiştir. C. burnetii 'nin Rickettsid'dan ziyade Legionella ve Franciseüa türleri ile daha yakın ilişkili olduğu görülmüştür [4, 6]. C. burnetii küçük pleomorfik çomakcıklar şeklindedir ve zorunlu hücre içi parazitidir. Gram negatif bakterilerinkine biraz benzeyen membrana sahiptir. Etken bazı ayırıcı özelliklere sahiptir ve bu da patojenitelerine katkıda bulunur. Etken sporulasyona benzer bir süreç geçirir ve bu dış çevreden korunmasını ve dolayısıyla uzun süre canlı kalmasını sağlar. C. burnetii 4. ph'daki fagolizozomlar içerisinde bile canlı kalabilir, çoğalabilir ve metabolizmalarını devam ettirebilir [4]. Memeli konakçılarda, C. burnetii makrofajları infekte eder ve konak hücresi olarak buralara yerleşir. Etken büyük vakuollerde (fagolizozom) çoğalır ve makrofajlar bu etkenleri öldüremezler. C. burnetivmn çeşitli lipopolisakkarit presantasyonlarının olduğu ve faz varyasyonları denilen antijenik varyasyon tiplerinin bulunduğu görülmektedir. Faz antijen insan veya hayvandan izole edildiğinde etken tarafından ekspresse edilir. Bu formdaki etken enfeksiyözdür. Bir mikroorganizma bile insanların enfekte olması için yeterli olabilir. Etkenin hücrelerde veya embriyolu yumurtada subkültüründen sonra antijenik yapı faz antijenine dönüşür [4]. En azından 0 farklı C. burnetii genotipi identifiye edilmiştir. Farklı suşlar arasında lipopolisakkarit kompozisyonunda değişiklik saptanabilir. Buna karşın, C. burnetivnin farklı suşları arasında fazla genetik farklılık bulunmaz. Etkenin genomu integre olmuş plazmid sekansı içerebilir. Dört farklı plazmid tipi tanımlanmıştır [4]. C. burnetivmn saptanmasına yönelik olarak uygulanan moleküler biyolojik metotlarda keneler, taze dokular, dondurulmuş örnekler, parafinde saklanan klinik örnekler, formalinde fikze edilen dokular, serum örnekleri ve sütler materyal olarak kullanmaktadır [7]. Spyridaki ve ark. [8], C. burnetii ile enfekte olduğundan şüphelenilen 00 hastanın kan serumlarını indirekt immunofluoresan antikor tekniği ile etkenin faz II antijenlerine karşı antikorların varlığı açısından incelediklerinde, serumların 'sini pozitif olarak tespit etmişlerdir. 7 hastadan aldıkları kan örneklerini patojenin izolasyonu için santrifugasyon shell vial tekniği ile kültüre ettiklerinde, 8 suş izole etmişlerdir. Bu suşlarm C. burnetii olduğunun doğrulamasını nested PCR ile yapmışlardır. Çalışmalarının sonucunda C. burnetivnin Yunanistan'da endemik bir hastalık olduğunu ve enfeksiyonun teşhisinin nestedpcr ile hızlı bir şekilde yapılabildiğini bildirmişlerdir. Masala ve ark. [], Sardinya adasında bulunan 67 koyun ve 8 keçi çiftliğinden 949 serumu ELISA ile ve 7 atık materyalini (4 fötus ve 9 plesanta) de PCR ile C. burnetii yönünden incelemişlerdir. Koyun çiftliklerinden 'inde ve

21 keçi çiftliklerinden de 9'unda ELISAile antikor saptarlarken, 40 koyun fötusu ve keçi fötusunu PCR ile pozitif bulmuşlardır. Koyunlarda C.burnetü enfeksiyonunun seroprevalansı Hollanda'da [9] %,, Japonya'da [0] %8,, Türkiye'de [] % 0,, Sudan'da [6] ise % 6, bulunmuştur. Kalender [], Elazığ ve komşu illerden yavru atmış koyunlardan aldığı 84 serum örneğinin 7(%8,9)'ini ve yavru atmamış koyunlardan aldığı 7 serum örneğinin (%ll,0)'ini indirekt flouresan antikor testi ile C. burnetü pozitif bulmuştur. Elazığda %0, Malatya'da %0, Bingöl'de % 7,9 ve Muşta %7,7 oranında pozitiflik saptamıştır. Psaroulakiveark. [],nestedpcrile 4 kenenin (00Rhicephalussanguineus ve 4 Hyalomma spp.) 'ini C. burnetü yönünden pozitif bulmuşlardır. Spitalska ve Kocianova [7], yılları arasında Slovakya ve Macaristan'dan topladıkları adetyetişkinkeneyipcrile C. burnetüyömmden incelemişlerdir. Ixodes ricinus, Dermacentor marginatus ve Haemaphysalis concinna türlerine ait 6 keneyi pozitif olarak saptamışlardır. Spitalska ve Kocianova [7], C. burnetifnm com geni için CBCOS (GCT GTT TCT GCC GAA CGT AT) ve CBCOE (AGA CAA CGC GGA GGT TTT TA) primerlerini kullanmışlardır. Com geni, hem akut hem de kronik hastalık izolatlarmdan saptanan dış membranilişkili immunoreaktif proteini kodlar. Araştırıcılar, kullandıkları primerlerin spesifik olduğunu çünkü birçok bakteriden elde ettikleri DNA'ları bu primerlerle reaksiyona soktuklarında C. burnetü dışında hiçbir amplinye bant görmediklerini bildirmişlerdir. Zhang ve ark. [], OMP İve OMP primer setini kullanarak PCR uygulamışlardır. OMP ve OMP primerleri Nine Mile susunun coml gen sekansından elde edilmiştir. Spyridaki ve ark. [9], ezilmiş kenelerden C. burnetü 'nin direkt saptanmasında nested PCR uygulamışlardır. Nested PCR'nin kenelerden patojenleri çabuk, sensitif ve spesifik olarak saptadığını bildirmişlerdir. Aynı zamanda, sahadan çok fazla miktarda toplanan kenelerin alkolde veya formaldehitte nkzasyondan sonra kültürünün mümkün olmamasına karşın, PCR ile test edilme imkanı bulunmaktadır. Araştırıcılar, ilk PCR'da Hfragl/ Hfrag primerlerini ve ikinci PCR'da ise HF/HF primerlerini kullanmışlardır. Kıbrıs izolatlarmm DNA amplinkasyonunu yapmak ve referans suşlar ile karşılaştırmak için CB/CB genomik primerlerini kullanmışlardır. Bernasconi ve ark. [], keneye ait mitokondriyal S rdna geninin 8 9 bp parçası için TA (' AATGAGAGCGACGGGCGATGT ') ve TB (' AAACTAGGATTAGATTAGATACCCT ')primerlerini kullanmışlardır. Rickettsia'larm sitrat sentezini kodlayan genin(glta) 80 bp parçasının

22 amplifikasyonu için Cs.Rp877p ve Cs.Rpl8n primerlerlerinden OmpA geninin 6 bp parçasının amplifikasyonu için ise Rr 90.70p ve Rr 9070 primerlerinden yararlanmışlardır. C. burnetü 'nin 6S rdna geninin 484 bp parçasını ampmye etmek için ise fdl (' AGAGTTTGATCCTGGCTCAG ') ve rp (' ACGGCTACCTTGTTACGACTT ') primerlerini kullanmışlardır, fdl primerinde 44 bp Rickettsia ve 64 bp Coxiella içindir. Zhang ve ark. [], sığır, kene ve insanlardan izole edilen 0 suş ile adet referens susun com gen sekans analizini yapmışlar ve buna göre com geninin bütün suşlarda bulunduğunu; ancak, nükleotidte bazı farklılığın olduğunu, amino asit sekanslarının deduce olduğunu ve adet susun 4 gruba ayrıldığını tespit etmişlerdir. İnsanlarda Q hummasının klinik tanısı semptomlarının spesifik olmaması nedeniyle son derece zordur. Bu nedenle tanısı esas olarak serolojik testlere dayanmaktadır. Serolojik tanıda sık kullanılan testler; indirekt immunfloresan tekniği, komplement nkzasyon, ELISA ve mikroaglutinasyon teknikleridir. immunfloresan tekniği Q ateşinin serolojik tanısında referans test olarak kabul edilmektedir []. Ancak, serolojik testler retrospektif teşhise imkan verdiklerinden şimdiki veya daha önce gerçekleşen bir enfeksiyonun ayrımı kesin olarak yapılamaz. Bunun yanı sıra enfeksiyonun erken dönemlerinde antikorların kanda bulunmayışı bu testlere bazı sınırlamalar getirmektedir [], Akgün ve ark. [], 00 yılının NisanAğustos ayları arasında C.Ü. Araştırma Hastanesi'nde Q humması şüphesi ile gözlem altına alınmış hastaların kan ve serum örneklerinde C. burnetifnm saptanması için nestedpcr yöntemini kullanmışlardır. C. burnetifmn dış membran proteinini kodlayan com genini amplifıye etmek için OMP, OMP, OMP ve OMP4 primerlerinden yararlanmışlar ve 80 hastanın (%8,7)'inde C. burnetü saptamışlardır. Esen ve ark. [], 00 yılı MayısHaziran arasında Karadeniz bölgesinde ölüm olayının olduğu olası bir salgın tespit edildiğini, bu salgında 46 hastada görülen semptomların sıklık sırasına göre; karın ağrısı, bulantı, kusma, artralji/myalji, baş ağrısı, ateş, ishal ve döküntü olarak tespit edildiğini, bu olguların 8'inin Tokat ilinden, 4'ünün Sivas, 'ünün Yozgat ve birinin de Çorum ilinden çıktığını bildirmişlerdir. Bu vakaların hemen tümünün kırsal alanda yaşadığına dikkat çekmişlerdir. 4

23 . MATERYAL ve METOT. Kenelerin Toplanması ve Saklanması Türkiye'nin 8 ilinden toplam 47 (446 dişi, 0 erkek ve nymph) kene toplandı. İllerden toplanan keneler, içerisinde % 70'lik alkol bulunan şişelerde, tür ve cinsiyet tayinleri yapılıncaya kadar, +4 C'de saklandı.. Kenelerin Tür ve Cinsiyet Tayini Stereo mikroskop (NikonAFX) ile tür ve cinsiyet tayinleri yapılan keneler, ayrı ayrı, içlerinde % 70'lik alkol [7] bulunan şişelerde + 4 C'de muhafaza edildi.. Kenelerin Gruplandırılması Keneler alkolün uzaklaştırılması için distile sudan geçirilerek [7] toplandığı illere, tür ve cinsiyetlerine göre 7 adedi bir araya getirilerek gruplandırıldı ve numaralandırıldı..4 Kenelerin DNA Ekstraksiyonu İçin Hazırlanması Gruplandırılmış ve numaralandırılmış keneler alüminyum folyo içerisine konularak sıvı azot içerisinde dondurulduktan sonra bir havan eli yardımıyla toz haline gelinceye kadar iyice ezildi.. Kenelerden DNA Ekstraksiyonu Kenelerden total DNA ekstraksiyonu NucleoSpin Tissue kit (MachereyNagel GmbH, Düren, Almanya) kullanılarak gerçekleştirildi. Ezilmiş kenelerden ependorf tüplerine 0 mg kadar örnek aktarılarak, ekstraksiyon için kitte önerilen protokol izlendi. DNA ekstrakları çoğaltılmcaya kadar 0 C'de saklandı..6 Pozitif Kontrol DNA Coxiella burnetii Nine Mile RSA49 susuna ait DNA, Institut für Hygiene und Infektionskrankheiten der Tiere de JustusLiebigUniversitat Giessen'den Gf. Direktör Prof. Dr. Dr. Habil G Baljer'den sağlandı. Kullanılan pozitif DNA % 0.9 tuzlu suda. x 0 8 konsantrasyonunda kullanıldı.

24 .7 Kullanilan Primerler Hfragl Hfrag HF HF CB CB 8 SF 8 SR 'ATT GCT ATC ACT GAG GGT GAC G' 'CTG ACG AAG AAG CAG CAT TAG C' 'TCC TAAACAAGT GAT GGT CTC C' 'TTC GCA GAA GTC AGC TAT GC' 'ACT CAA CGC ACT GGA ACC GC' 'TAG CTG AAG CCA ATT CGC C' 'GAC TCT AGT CTG ACT CTG TG' 'GCC ACAAGC CAGTTATCC C'.8 Negatif Kontrol PCR reaksiyonunda kullanilan reagentlerin kontaminasyon kontrolii amaciyla, bir reagent kontrol tiipii kullamldi. Bu tiipe DNA yerine ddh 0 konuldu..9 PCR Igin Uygun Primer Segimi Uygun primerin seciminde pozitif ve negatif kontroller ile ilk turda Hfragl ve Hfrag ve ikinci turda da HF ve HF primer setleri kullamlarak nested PCR denendi. Daha sonra aym sekilde pozitif ve negatif kontrol kullamlarak CB ve CB primerleri denendi..0 PCR Amplifikasyonu PCR amplifikasyonu PTC00 thermal cycler (MJ Research, Watertown, MA) ile yapildi. DNA amplifikasyonu 0 ul hacimde gerceklestirildi. Her bir testte bir pozitif (Nine Mile RSA49) ve bir de negatif kontrol (distile su) kullamldi. Her bir reaksiyon icin; MgCl ( mm, Bioron),4 ul 0X reaksiyon buffer (Bioron),0 ul dntp Mix (0 mm, Fermentas) 0, ul Taq DNA polimeraz ( U/ul, Bioron) 0, ul CB 0, ul CB 0, ul DMSO (Fermentas),8 ul ddh 0 8,0 ul DNA ul kullamldi. CB ve CB primerleri kullamldi gmda PCR programi asagidaki gibi uygulandi. 6

25 94 C dk C 0 sn ^ 7 C dk V tur 94 C 4 sn J 0 C dk 7 C 0 dk NestedPCR'de ise her iki turda da aşağıdaki program uygulandı. 94 C dk C 0 sn ^ 7 C dk > tur 94 C 4 sn J 0 C ldk 7 C 0 dk. Ekstraksiyon Kitinin Kontrolü Kullanılan kitin DNA ekstraksiyonunu sağlayıp sağlayamadığının kontrolü için ekstrakte edilen DNA ile kenenin 8 S rrna geninin saptanmasına yönelik olan 8SR ve 8SF primerleri [] ile PCR yapıldı.. Elektroforez ve Görüntüleme PCR ürünleri Ethidium bromide ile boyalı %,'luk agaroz jelde (Ambresco) yürütüldü. Elektroforez tamponu olarak 0,X TAE (Fermentas) kullanıldı. DNA bantlarının görüntülenmesi ise görüntüleme cihazında (Vilbert Loumart) gerçekleştirildi.. Restriction Fragment Length Polymorphism (RFLP) PCR ürünlerinin spesifîsitesi PCR ürünlerinin restriksiyon analizi ile değerlendirildi. PCR ürünleri Taql enzimi (Fermentas) ile kesildi. Restriksiyon fragmentleri %, agaroz jelde elektroforez ile incelendi. Örnekler Coxiella burnetü Nine Mile RSA49 susuna ait fragmentlerle karşılaştırıldı. 7

26 . BULGULAR. Kenelerin Tür ve Cinsiyet Tayini Sonuçları Toplanan kenelerin illere göre tür ve cinsiyet dağılımları tablo'de verilmiştir. Tablo. Toplanan kenelerin illere göre tür ve cinsiyet dağılımları. Coğrafi Bölge ve İller Dişi Erkek MARMARA BÖLGESİ Edirne () Rhipicephalus turanicus Rhipicephalus sanguineus Rhipicephalus bursa Hyalomma. anatolicum anatolicum Tekirdağ (69) H. a. anatolicum Hyalomma anatolicum excavatum Bursa (8) Çanakkale (04) R. sanguineus Balıkesir (07) R. sanguineus H. a. anatolicum EGE BÖLGESİ izmir (0) H. a. anatolicum H. a. excavatum Afyon (9) Hyalomma detritum detritum

27 Coğrafi Bölge ve İller Dişi Erkek Denizli (6) R. sanguineus Muğla (99) R. sanguineus H. a. anatolicum H. a. excavatum H. d. detritum Kütahya (0) H. a. anatolicum H. d. detritum foodes ricinus foodes hexagonus Uşak (7) H. a. excavatum H. d. detritum Hyalomma marginatum marginatum I. ricinus Boophilus annulatus Manisa (7) H. a. anatolicum I. ricinus Dermacentor niveus AKDENİZ BÖLGESİ Antalya (9) H. a. anatolicum Nymph (Rhipicephalus) Adana (4) H. a. anatolicum Burdur (4) adet

28 Coğrafi Bölge ve İller Hatay (70) H. a. anatolicum H. a. excavatum H. d. detritum H. m. marginatum Kahramanmaraş (6) H. a. anatolicum H. a. excavatum H. d. detritum İÇ ANADOLU BÖLGESİ Ankara (60) R. sanguineus H. a. excavatum D. niveus Eskişehir (47) R. sanguineus H. m. marginatum I. ricinus Haemaphysalis sulcata Haemaphysalis punctata B. annulatus Dermacentor marginatus Sivas () R. sanguineus D. marginatus Konya () R. sanguineus H. d. detritum H. sulcata I. ricinus I. hexagonus D. niveus B. annulatus Dişi Erkek

29 Coğrafi Bölge ve İller Dişi Erkek Çankırı () R. sanguineus H. m. marginatum D. niveus D. marginatus B. annulatus Yozgat (8) Niğde (7) R. sanguineus KARADENİZ BÖLGESİ Kastamonu (4) R. sanguineus H. a. excavatum H. d. detritum Samsun (6) Ordu (7) Giresun (6) H. a. excavatum H. d. detritum Amasya (8) H. a. anatolicum H. a. excavatum H. d. detritum H. m. marginatum H. sulcata H. punctata D. niveus Bolu () D. niveus D. marginatus Çorum (40)

30 Coğrafi Bölge ve İller R. sanguineus H. a. anatolicum H. a. excavatum H. d. detritum DOĞU ANADOLU BÖLGESİ Malatya (86) R. sanguineus H. d. detritum H. m. marginatum Erzurum (8) H. a. anatolicum H. a. excavatum H. d. detritum İğdır (44) H. a. excavatum H. d. detritum I. ricinus H. sulcata H. punctata D. niveus GÜNEYDOĞU ANADOLU BÖLGESİ Gaziantep () Şanlı Urfa ( 84 ) R. sanguineus H. a. anatolicum Diyarbakır (6) R. sanguineus Mardin (7) Dişi Erkek

31 Tablo. Türkiye'nin 8 ilinden toplanan toplam 47 kenenin tür ve cinsiyet dağılımları Tür Toplam (%) Dişi Erkek R. sanguineus H. a. anatolicum H. a. excavatum H. d. detritum 6 (4,8) 94(,9) 0 (4,) (,4) 04 (4,) 4 (,8) H. m. marginatum 9(,) 7 D. niveus D. marginatus H. sulcata H. punctata I. ricinus I. hexagonus B. annulatus Nymph 6(,) (0,) (0,4) 4 (0,9) 6(,) (0,) 8 (0,) (0,) Eksfraksiyon Kitinin Kontrol Sonucu Kullanılan kitin DNA ekstraksiyonunu sağlayıp sağlayamadığının kontrolü için ekstrakte edilen DNA ile kenenin 8 S rrna geninin saptanmasına yönelik olan 8SR ve 8SF primerleri ile PCR yapıldı. 449 bp'lik bir PCR ürününün görülmesi kenenin 8S rrna geninin PCR ile saptandığını ve dolayısı ile bu genin ekstrakte edilebildiğini ortaya koydu.. PCR Standardizasyon Bulguları PCR standardizasyonu pozitif ve negatif kontroller kullanılarak yapıldı. Nested PCR'nin Hfragl ve Hfrag primerleri ile yapılan ilk turunda vermesi gereken 08 bp'lik bant net olarak görüntülenirken, HF ve HF primerleri kullanılarak gerçekleştirilen. turunda vermesi gereken 8 bp'lik bant çok silik olarak görüntülenmiştir. Bu primerler kullanıldığında saha örneklerinde bulunması muhtemel olan Coxiella burnetü DNA'smm tespit edilemeyeceği ve yanlış negatiftik çıkabileceği düşünülerek PCR çalışmasında daha kuvvetli bantların elde edildiği CB ve CB primerlerinin kullanılmasına karar verilmiştir..4 PCR Bulguları Denizliden toplam 6 kene toplanmış olup, bu keneler tür ve cinsiyetlerine göre gruba ayrılmışlardır. Bu gruplardan 6'sı PCR sonucunda pozitif bulunmuştur.

32 Ankara'dan toplanan toplam 60 kene ise aynı şekilde gruba ayrılmış ve bu gruplardan birinde PCR sonucunda pozitiflik saptanmıştır. PCR çalışmaları pozitif ve negatif kontrollerle birlikte yürütülmüş olup, pozitiflik durumunda 7 bp'lik bir PCR ürünü elde edilmiştir. Resim. Pozitif PCR ürünlerinin görüntüleri. 0M: 0'lik marker; P Coxiella burnetii Nine Mile RSA49 susu; N: Negatif kontrol: 007: Denizli pozitif örnekler; 6: Ankara pozitif örnek: 00M: 00'lük marker.. PCR ile C. burnetii Pozitif Bulunan Kene Gruplarının Tür ve Cinsiyet Dağılımları PCR ile C. burnetii pozitif bulunan kene gruplarının tür ve cinsiyet dağılımları tablo'de verilmiştir. 4

33 Tablo. PCR ile C. burnetii pozitif bulunan kene gruplarının tür ve cinsiyet dağılımları. İl Denizli Grup no. 0 Grup no. 0 Grup no. 04 Grup no. 0 Grup no. 06 Grup no. 07 Ankara Grup no. 6 Tür H. a. excavatum Cinsiyet dişi dişi dişi dişi erkek erkek erkek Gruptaki kene sayısı.6 Restriction Fragment Length Polymorphism (RFLP) Bulguları PCR ürünlerinin spesifisitesi PCR ürünlerinin restriksiyon analizi ile değerlendirildi. Pozitif PCR ürünleri Taq enzimi ile kesildiğinde, 8 ve 7 bp 'lik bantlar net olarak görülürken, 9 ve 4 bp'lik bantlar birbirine yakın olmaları nedeniyle Resim'de görüldüğü gibi kalın bir bant olarak görülmektedir ve bu iki bantm ayrı görüntülenebilmesi için özel agarozlara ihtiyaç duyulmaktadır. Bantlar pozitif ve negatif kontrollerle kıyaslanarak değerlendirildi. 4 Resim. 7'lik pozitif PCR ürünlerinin restriksiyon profil analizi. 0 M: 0'lik marker; P: Coxiella burnetii Nine Mile RSA49 susu; N: Negatif kontrol; 007: Denizli pozitif örnekler; 6: Ankara pozitif örnek; 00M: 00'lük marker.

34 4. TARTIŞMA ve SONUÇ Q fever bütün coğrafik ve iklim zonlarında ortaya çıkabilen bir zoonozdur. 9'de, Q humması'nm beş kıtada ülkede görüldüğü bildirilmiş, 999'da hastalık 8 ülkede daha rapor edilmiştir. Üstelik, seroepidemiyolojik veriler başka ülkelerde de Q humması'nm varlığına işaret etmektedir. C. burnetü keneleri bütün yaşamları boyunca canlılıklarını, çok yüksek titrelerde sürdürebilmektedir ve yeni nesillere transovariyal olarak aktarılabilmektedir. Enzootik siklusta rodentler gibi keneler ve vertabrahlar önemli komponentlerdir. Her bir kene türü, Q humması yönünden endemik bir bölgede duyarlı bir konakçıya yapışabilir ve C. burnetifyi yayabilir. Kenelerin çevrede bu hastalığın yayılmasında merkezi bir rol oynadığı görülmektedir. Doğada C. burnetü evcil hayvanlara kene ısırmasıyla ya da enfekte kene salgılarıyla temas aracılığıyla bulaşabilmektedir. Kene dışkıları da C. burnetü 'nin en yoğun muhtemel kaynağıdır. Kırktan fazla kene türünün C. burnetü ile enfekte olduğu tespit edildiğinden dolayı keneler doğada enfeksiyonun indikatörü olarak görülmektedir. C. burnetü'nin tanısı esas olarak serolojik testlere dayanmaktadır. Serolojik tanıda sık kullanılan testler; indirekt immunfloresan tekniği, komplement fikzasyon, ELISA ve mikroaglutinasyon teknikleridir, immunfloresan tekniği Q hummasının serolojik tanısında referans test olarak kabul edilmektedir []. Ancak, serolojik testler retrospektif teşhise imkan verdiklerinden şimdiki veya daha önce gerçekleşen bir enfeksiyonun ayrımını kesin olarak yapamaz. Bunun yanı sıra enfeksiyonun erken dönemlerinde antikorların kanda bulunmayışı bu testlere bazı sınırlamalar getirmektedir [], C. burnetü izolasyonlarının tehlikeli, zaman alıcı ve güç olması ve ayrıca mikroorganizmanın zoonotik özelliğine bağlı olarak çalışmalar için biyogüvenlik düzeyi laboratuarları gerektirmesi etken izolasyonlarında sıkıntı yaratmaktadır [].Ayrıca, C. burnetü 'nin diğer bir çokbakterinin aksine kültürlerinin embriyolu yumurta ve doku kültüründe yapılması da teşhiste moleküler yöntemleri cazip kılmaktadır. Son dönemlerde PCR yöntemi bir çok örnekte hastalık etkenlerinin saptanması için oldukça kullanışlı bir yöntem olarak benimsenmiştir. PCR yöntemi, çok az miktardaki örneklerde dahi hedef DNA sekanslarının ortaya çıkarılabilmesini 6

35 sağladığından insan ve hayvan orijinli bir çok materyalden C. burnetii enfeksiyonlarının laboratuvar teşhisinde oldukça güvenli ve kullanışlı bir metot olarak karşımıza çıkmaktadır. Ayrıca, PCR yöntemi, sahadan toplanan alkol ve formaldehitte fikze edilen çok sayıda örneğin de test edilmesine imkan sağlamaktadır. Spitalska ve Kocianova [7], kenelerden PCR ile C. burnetii saptanmasına yönelik çalışmalarında, pozitifliği en yüksek D. marginatus kenelerinde bulurlarken, bunu /. ricinus, Haemaphysalis inermis, Haemaphysalis concinna türlerinin izlediğini; Dermacentor reticulatus ve H. punctata türlerinde ise hiç pozitiflik saptamadıklarını bildirmişlerdir. Bu çalışmada görüldüğü üzere sahadan toplanan kenelerin % 4, 'ünü, % 4,8'ini ve %,9'unu R. sanguineus oluşturmaktadır. Spitalska ve Kocianova [7]'nm C. burnetii pozitifliği saptadıkları kene türlerinden D. marginatus çalışmamızda % 0, oranında ve /. ricinus ise %, oranında tespit edilmiştir ve bu kenelerde Spitalska ve Kocianova [7]'nm aksine C. burnetii saptanmamıştır. Bu kenelerin sahada bulunma oranlarının düşük olması nedeniyle, C. burnetii taşıma olasılığı da doğal olarak düşmektedir. Bu çalışmada sahada % 0,9 oranında bulunan H. punctata kene türünde Spitalska ve Kocianova [7] 'nm bulgularına benzer şekilde C. burnetii tespit edilememiştir. Bernasconi ve ark. [], Güney İsviçre'de R. sanguineus ve varlığını ortaya koymuşlar ve test ettikleri 48 keneden adet R. sanguineus ve adet kenesinde Coxiella saptamışlardır. Bu çalışmada da sahadan R. bursa'dan sonra en fazla ve R. sanguineus tespit edilmiştir. Aynı şekilde kenelerde C. burnetii pozitifliği 'dan sonra 'da bulunmuştur. Psaroulaki ve ark. [], topladıkları 4 kenenin % 7,8'ini PCR ile C. burnetii yönünden pozitif bulmuşlardır. Pozitif kenelerin aynı bu çalışmada olduğu gibi Rhipicephalus ve Hyalomma genusuna ait olduklarını bildirmişledir. Bu çalışmada ise toplanan 47 kenenin PCR ile incelemesi sonucunda bir pozitiflik oranı verilmesi imkansızdır. Kenelerin tek tek incelenmemesi, 7 adedinin toplandıkları il, tür ve cinsiyetlerine göre bir araya getirilerek gruplandırılması ve bu grupların DNA ekstraksiyonları yapılarak PCR ile incelenmesi nedeniyle ancak grup bazında pozitiflik verilebilmektedir. Bu çalışmada kenelerin cinsiyeti ile C. burnetii pozitifliği arasında bir ilişki olmadığı görülmüştür. C. burnetii pozitif bulunan kene gruplarının yaklaşık yarısının dişi kene grubu yarısının da erkek kene grubu olması bu şekilde düşünülmesine neden olmuştur, bu konu ile ilgili literatür verilerine de rastlanmamıştır. C. burnetii'n\n isocitrate dehydrogenase geni [4], süperoksit dismutase geni [0] ve kromozomal transpozonbenzeri sekanslar [8] PCR targetleri olarak kullanılmaktadır ve C. burnetii suşlarmm identinkasyonunda yararlı olduğu 7

36 bulunmuştur. Masala ve ark. [], koyun ve keçi yavru atıklarında C. burnetifnm etkisini araştırdıkları çalışmalarında, C. burnetü DNA'smm varlığını saptamak için süperoksit dismutase genini hedefleyen PCR kullanmışlar ve bu amaç için de CB ve CB primerlerinden yararlanmışlardır. Bu çalışmada da kenelerden C. burnetü DNA'smm saptanmasında süperoksit dismutase geninin saptanmasına yönelik CB ve CB primerleri kullanılmıştır. Bu çalışmada öncelikle Hfragl ve Hfrag ve ikinci turda da HF ve HF primerlerinin kullanıldığı nestedpcr yapılması planlanmıştır. Ancak, yapılan standardizasyon çalışmalarında ilk turda elde edilmesi gereken 08 bp'lik bant net olarak elde edilirken, ikinci turda elde edilmesi gereken 8 bp'lik bant çok silik olarak görülmüş ve saha örneklerinde bulunması olası olan C. burnetü DNA'smm tespit edilemeyeceği anlaşılmıştır. Dolayısıyla, yalancı negatiftik durumu göz önünde bulundurularak, bu primerler ile kullanılarak yapılması planlanan nestedpcr'den vazgeçilmiştir. Spyridaki ve ark. [8], insanlardan aldıkları kan örneklerinden QIAmp blood kit kullanarak genomik DNA ekstraksiyonu yapmışlardır. NestedPCR'de ise plasmidik DNA'yı hedefleyen Hfrag Hfrag ile HFHF primerlerini kullanmışlardır. Bu şekilde nestedpcr ile C. burnetü enfeksiyonlarının çabuk ve başarılı olarak tespit edilebileceğini bildirmişlerdir. Benzer şekilde çalışmamızda genomik DNA ekstraksiyonuna yönelik NucleoSpin Tissue kit kullanılmış ve PCR sırasında başarılı olduğu belirtilen plasmidik HfraglHfrag ile HFHF primerleri denenmiştir. Literatürde belirtilen bulguların aksine başarılı sonuç elde edilememiş ve yine aynı literatürde verilen genomik primerler kullanılmıştır. Bu değişiklik ile istenilen bantlar, pozitif DNA örneğine paralel şekilde elde edilmiştir. Sonuç olarak, genomik DNA ekstraksiyonu yapıldığı zaman kullanılan primerlerin de genomik DNA'yı hedeflemesi gerektiği ortaya çıkmıştır. Nine Mile referens susu ABD'de kenelerden izole edilmiştir. Fransa'da [0] ve Yunanistan'da [8] Q humması hastalarından izole edilen C. burnetü suşlarmm da Nine Mile ile aynı profile sahip olduğu tespit edilmiştir. Bu çalışmada da pozitif bulunan 7 örneğin profilinin C. burnetü Nine Mile ile aynı profile sahip olduğu restriksiyon analizi sonucunda ortaya konmuştur. PCRRFLP analizinin kenelerden C. burnetü saptanması, izolasyonu ve identifikasyonu çalışmalarında faydalı olduğu belirtilmiştir [7, 8, 9]. Bulgularımız bu görüşü destekler nitelikte olmuştur. 8

37 . KAYNAKLAR. Akgiin, E., Yilmaz, M., Pmarbasj, E.: Qfever Siiphesi Olan Hasta Serum ve Kan OrneklerindeNestedPCR Yontemiyle Coxiella burnetii 'nin Saptanmasi. C.U. Tip Fakiiltesi Dergisi, 8(): 04, (006).. Bernasconi, M.V., Casati, S., Peter, O., Piffaretti, J.C.: Rhipicephalus Ticks Infected with Rickettsia and Coxiella in Southern Switzerland (Canton Ticino). Infection, Genetics and Evolution, ():0, (00).. Cetinkaya, B., Kalender, H., Erta, H.B., Muz, A., Arslan, N., Ongor, H., Giircay, M.: Seroprevalence of Coxiellosis in Cattle, Sheep and People in the East of the Turkey. Vet. Rec, 46: 6, (000). 4. Choi, E.: Tularemi and Q Fever. Medical Clinics of North America, 86(): 946, (00).. Esen, B., Gozalan, A., Akin, L.,Noyan,N., Buyurgan, V.: Bir Salgm ihbarmm Epidemiyolojik Ara tirmasi. Ayhk Epidemiyoloji Raporu, Cilt, Sayi 6, (00). 6. Fournier, P.E., Marrie, T.J., Raoult, D.: Diagnosis of Q Fever. J. Clin. Microbiol., 6(7): 884, (998). 7. Higgins, J.A., Azad, A.F.: Use of Polymerase Chain Reaction to Detect Bacteria in Arthropods: a Review. J. Med. Entomol, ():, (99). 8. Houver, A.T., Vodkin, M.H., Williams, J.C.: A Coxiella burnetii Repeated DNA Element Resembling a Bacterial Insertion Sequence. J. bacteriol., 74: 4048,(99). 9. Houwers, D.J., Richardus, J.H.: Infections with Coxiella burnetii in Man and Animals in the Netherlands. Zentr. Bacteriol. Mikrobiol. Hyg. A, 67:06, (987). 9

38 0. Htwe K.K., Amano, K., Sugiyama, Y., Yagami, K., Minamota, N., Hashimoto, A.,Yamaguchi, T., Fukushi, H., Hirai, K.: Seroepidemiology of Coxiella burnetii in Domestic and Companion Animals in Japan. Vet. Rec., : 490. Inokuma, H., Yoshizaki, Y, Shimada, Y, Sakata, Y, Okuda, M., Onishi, T.: Epidemiological Survey of Babesia species in Japan Performed with Specimens from Ticks Collected from Dogs and Detection of New Babesia DNA Closely Related to Babesia odocoilei and Babesia divergens DNA. J. Clin. Microbiol., 4(8): , (00).. Kalender, H.: Elazig ve Komsu Illerde Koyunlarda Coxiella burnetii Enfeksiyonunun Yaygmligi. Turk. J. Vet. Anim. Sci., :, (00).. Masala, G., Porcu, R., Sana, G., Chessa, G., Cillara, G., Chisu, V, Tola, S.: Occurence, Distrubition, and Role in Abortion of Coxiella burnetii in Sheep and Goats in Sardinia, Italy. Vet. Microbiol., 99: 00, (004). 4. Nguyen, S.V, Hirai, K.: Differentiation of Coxiella burnetii Isolates by Sequence Determination and PCRRestriction Fragment Length Polymorphism Analysis of Isocitrate Dehydrogenase Gene. FEMS Microbiol. Lett, 80: 494, (999).. Psaroulaki, A., Hadjichristodoulou, C, Loukaides, F, Soteriades, E., Konstantinidis, A., Papastergiou, P., Ioannidou, M.C, Tselentis, Y. Epidemiological study of Q fever in Humans, Ruminant Animals, and Ticks in Cyprus Using a Geographical Information System. Eur. J. Microbiol. Infect. Dis., : 7686, (006). 6. Reinthaler, F.F., Mascher, F., Sixl, W., Arbesser, C.H.: Incidence of Q Fever Among Cattle, Sheep and Goats in the Upper Nile Province in Southern Sudan. Vet. Rec., : 7, (988). 7. Spitalska, E., Kocianova, E.: Detection of Coxiella burnetii in Ticks Collected in Slovakia and Hungary. European Journalof Epidemiology, 8: 666,(00). 8. Spyridaki, I., Gikas, A., Kofteridis, D., Psauroulaki, A., Tselentis, Y: Q fever in the Greek Island of Crete: Detection, Isolation and Molecular Identification of Eight Strains of Coxiella burnetii from Clinical Samples. J. Clin. Microbiology. 6(7): 06067, (998). 0

39 9. Spyridaki, J., Psaroulaki, A., Loukaides, F., Antoniou,M.,Hadjichristod olou,c, Tselentis,Y.: Isolation of Coxiella Burnetii by a Centrifugation ShellVial Assay from Ticks Collected in Cyprus: Detection by Nested Polymerase Chain Reaction (PCR) and by PCRRestriction Fragment Length Polymorphism Analyses. Am. J. Trop. Hyg., 66(): 8690, (00). 0. Stein, A., Raoult, D.: Detection of Coxiella burnetii by DNA Amplification Using Polymerase Chain Reaction. J. Clin. Microbiol., 0: 46466, (99).. Zhang, G.Q., To, H., Yamaguchi, T, Fukushi, H., Hirai, K.: Differentiation of Coxiella burnetii by Sequence Analysis of the Gene (com ) Enconding a 7kDa Outer Membrane Protein. Microbiol. Immunol., 4(): 87877, (997).

40

41 TAEK YAYIN BİLGİ FORMU Rapor Bilgileri. Rapor Başlığı Coxieîîa burnetii nin Kenelerden Polimeraz Zincir Reaksiyonu (PCR) ve PCR RFLP ile Saptanması I. Yayın Yılı/No 00/. Yay in Kur ulu Tarih (Gün/Ay/Yıl)No Yazarlar Dr. Gülay ALTAY, Doç. Dr. Zişan EMRE, Dr. Seyit CANPOLAT, Dr. Ali DÜZGÜN, Yusuf VATANSEVER, Hülya MERT 6. Çalışmayı Yapan Birim TAEK, SANAEM Uygulama Bölümü Hayvancılık Birimi. Yayın Türü Teknik Rapor 7. Destekleyen veya Ortak Çalışılan Kuruluşlar TAEK, TÜBİTAK 8. Özet Coxieîîa burnetii, Q humması hastalığının etiyolojik etkeni olup, obligat intraselüler bir bakteridir. Doğada yaygın olarak bulunur ve çeşitli hayvanlarda (sığır, koyun, keçi) ve insanlarda Qhumması enfeksiyonunu oluşturur. C. burnetii sütlerden, kenelerden ve akut veya kronik Q humması ile enfekte insanlardan izole edilmiştir. Keneler, C. burnetifmn rezervuan ve birincil vektörleridir. Kırktan fazla kene türünün C. burnetii ile enfekte olduğu saptandığından keneler doğada enfeksiyonun belirleyicisi olarak görülmektedirler. Bu çalışmada, Türkiye'nin 8 ilinden toplam 47 (446 dişi, 0 erkek, nymph) adet kene toplandı. Bu keneler toplandığı ile, tür ve cinsiyetine göre 7 adedi bir araya getirilerek gruplandınldı. Gruplar DNA ekstraksiyonu sonrasında CB ve CB primerleri kullanılarak PCR ile C. burnetifmn varlığı yönünde incelendi. Denizliden toplam 6 kene toplanmış olup, bu keneler tür ve cinsiyetlerine göre gruba ayrılmışlardır. Bu gruplardan 6'sı PCR sonucunda pozitif bulunmuştur. Ankara'dan toplanan toplam 60 kene ise aym şekilde gruba ayrılmış ve bu gruplardan sadece birinde PCR sonucunda pozitiflik saptanmıştır. PCR ürünlerinin spesifisitesi restriksiyon analizi ile değerlendirildi. Pozitif PCR ürünleri Taql enzimi ile kesildiğinde C. burnetii Nine Mile RSA49 susunda görüldüğü gibi yaklaşık 8, 7, 4 ve 9 bp'lik 4 bant ortaya konuldu. 9. Anahtar Kelimeler Coxieîîa burneti,kçnç, PCR GİZLİLİK DERECELERİ 0. Gizlilik derecesi Tasnif Dışı TASNİF DIŞI (UNCLASSIFIED): İçerdiği konu itibarıyla, gizlilik dereceli bilgi taşımayan, ancak devlet hizmetiyle ilgili bilgileri içeren evrak, belge ve mesajlara verilen en düşük gizlilik derecesidir. HIZMETE ÖZEL (RESTRICTED): İçerdiği konu itibarıyla, gizlilik dereceli konular dışında olan, ancak güvenlik işlemine ihtiyaç gösteren ve devlet hizmetine özel bilgileri içeren evrak, belge ve mesajlara verilen gizlilik derecesidir. ÖZEL (CONFIDENTIAL): İçerdiği konu itibanyla, izinsiz olarak açıklandığı takdirde, milli menfaatleri olumsuz yönde etkileyecek evrak, belge ve mesajlara verilen gizlilik derecesidir. GİZLİ (SECRET): İzinsiz açıklandığı takdirde, milli güvenliği, milli prestij ve menfaatleri ciddi ve önemli bir şekilde zedeleyecek olan evrak, belge ve mesajlara verilen gizlilik derecesidir.

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral

Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral Halis Akalın, Nesrin Kebabcı, Bekir Çelebi, Selçuk Kılıç, Mustafa Vural, Ülkü Tırpan, Sibel Yorulmaz Göktaş, Melda Sınırtaş, Güher Göral Uludağ Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik

Detaylı

VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ

VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Viroloji Ünitesi Viral Enfeksiyonlar... Klinik

Detaylı

TULAREMİ: Etken ve Epidemiyoloji. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Mikrobiyoloji AD

TULAREMİ: Etken ve Epidemiyoloji. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Mikrobiyoloji AD TULAREMİ: Etken ve Epidemiyoloji Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Mikrobiyoloji AD Francisella tularensis Tarihçe Tavşan hastalığı (Yato Byo, 1818) Lemming ateşi (Norveç, 1890) Tularemi hastalığı

Detaylı

Fren Test Cihazları Satış Bayiler. Administrator tarafından yazıldı. Perşembe, 05 Mayıs :26 - Son Güncelleme Pazartesi, 30 Kasım :22

Fren Test Cihazları Satış Bayiler. Administrator tarafından yazıldı. Perşembe, 05 Mayıs :26 - Son Güncelleme Pazartesi, 30 Kasım :22 FDR Adana Fren Test Cihazları FDR Adıyaman Fren Test Cihazları FDR AfyonFren Test Cihazları FDR Ağrı Fren Test Cihazları FDR Amasya Fren Test Cihazları FDR Ankara Fren Test Cihazları FDR Antalya Fren Test

Detaylı

TABLO-4. LİSANS MEZUNLARININ TERCİH EDEBİLECEĞİ KADROLAR ( EKPSS 2014 )

TABLO-4. LİSANS MEZUNLARININ TERCİH EDEBİLECEĞİ KADROLAR ( EKPSS 2014 ) 7769 MİLLİ EĞİTİM BAKANLIĞI Memur ADANA TÜM İLÇELER Taşra GİH 7 17 4001 7770 MİLLİ EĞİTİM BAKANLIĞI Memur ADIYAMAN TÜM İLÇELER Taşra GİH 7 9 4001 7771 MİLLİ EĞİTİM BAKANLIĞI Memur AFYONKARAHİSAR TÜM İLÇELER

Detaylı

TABLO-3. ÖNLİSANS MEZUNLARININ TERCİH EDEBİLECEĞİ KADROLAR ( EKPSS 2014 )

TABLO-3. ÖNLİSANS MEZUNLARININ TERCİH EDEBİLECEĞİ KADROLAR ( EKPSS 2014 ) 7858 MİLLİ EĞİTİM BAKANLIĞI Memur ADANA TÜM İLÇELER Taşra GİH 10 8 ### 7859 MİLLİ EĞİTİM BAKANLIĞI Memur ADIYAMAN TÜM İLÇELER Taşra GİH 10 4 ### 7860 MİLLİ EĞİTİM BAKANLIĞI Memur AFYONKARAHİSAR TÜM İLÇELER

Detaylı

Virulan Faz I. Çevresel faktörlere direncini sağlayan küçük spor benzeri formları var. Faz II. Avirulan. Ayrıca. Etkenin iki ayrı fazı saptanmış

Virulan Faz I. Çevresel faktörlere direncini sağlayan küçük spor benzeri formları var. Faz II. Avirulan. Ayrıca. Etkenin iki ayrı fazı saptanmış Coxiella burnetii Gram-negatif Pleomorfik (0.3-1.5 x 0.2-0.4 µm) Mononükleer hücrelerin fagozomları içinde, plasenta ve embriyolu yumurtanın sarı kesesi gibi hücrelerin intrasitoplazmik vakuollerinde ve

Detaylı

KAYSERİ YÖRESİNDE SIĞIR VE KOYUNLARDA KENE TÜRLERİNİN ARAŞTIRILMASI Investigation of Tick Species on Sheep and Cattle Around of Kayseri

KAYSERİ YÖRESİNDE SIĞIR VE KOYUNLARDA KENE TÜRLERİNİN ARAŞTIRILMASI Investigation of Tick Species on Sheep and Cattle Around of Kayseri ARAŞTIRMA (Research Report) Yay M, Yazar S, Aydın L, Şahin İ KAYSERİ YÖRESİNDE SIĞIR VE KOYUNLARDA KENE TÜRLERİNİN ARAŞTIRILMASI Investigation of Tick Species on Sheep and Cattle Around of Kayseri Mehmet

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

3. basamak. Otomobil Kamyonet Motorsiklet

3. basamak. Otomobil Kamyonet Motorsiklet Tablo-1: İndirim veya artırım uygulanmayan iller için azami primler (TL)* İzmir, Yalova, Erzurum, Kayseri Otomobil 018 614 211 807 686 565 444 Kamyonet 638 110 583 055 897 739 580 Motorsiklet 823 658 494

Detaylı

Q-Fever Şüphesi Olan Hasta Serum ve Kan Örneklerinde Nested-PCR Yöntemiyle Coxiella burnetii nin Saptanması

Q-Fever Şüphesi Olan Hasta Serum ve Kan Örneklerinde Nested-PCR Yöntemiyle Coxiella burnetii nin Saptanması Cumhuriyet Üniversitesi Tıp Fakültesi Q-Fever Şüphesi Olan Hasta Serum ve Kan Örneklerinde Nested-PCR Yöntemiyle Coxiella burnetii nin Saptanması Detection of Coxiella burnetti by Nested-PCR in Blood and

Detaylı

TABLO 27: Türkiye'deki İllerin 2006 Yılındaki Tahmini Nüfusu, Eczane Sayısı ve Eczane Başına Düşen Nüfus (2S34>

TABLO 27: Türkiye'deki İllerin 2006 Yılındaki Tahmini Nüfusu, Eczane Sayısı ve Eczane Başına Düşen Nüfus (2S34> 3.2.2. ECZANELER Osmanlı İmparatorluğu döneminde en eski eczane 1757 yılında Bahçekapı semtinde açılmış olan İki Kapılı Eczahane'dir. İstanbul'da sahibi Türk olan ilk eczahane ise "Eczahane-i Hamdi" adıyla

Detaylı

Türkiye nin Karadeniz Bölgesindeki Koyun ve Keçilerde Kene Enfestasyonları [1]

Türkiye nin Karadeniz Bölgesindeki Koyun ve Keçilerde Kene Enfestasyonları [1] Kafkas Univ Vet Fak Derg 18 (Suppl-A): A17-A22, 2012 DOI:10.9775/kvfd.2011.5209 RESEARCH ARTICLE Özet Bu çalışma, Karadeniz Bölgesi ndeki bazı illerde (Bolu, Kastamonu, Çorum, Samsun, Tokat, Giresun ve

Detaylı

OTO KALORİFER PETEK TEMİZLİĞİ - VİDEO

OTO KALORİFER PETEK TEMİZLİĞİ - VİDEO OTO KALORİFER PETEK TEMİZLİĞİ - VİDEO Oto Kalorifer Peteği Temizleme Makinası, Araç Kalorifer Petek Temizliği Cihazı. kalorifer peteği nasıl temizlenir, kalorifer peteği temizleme fiyatları, kalorifer

Detaylı

Francisella tularensis:

Francisella tularensis: Francisella tularensis: Doğal Rezervuarları,, Vektörleri ve Bulaşma Yolları Doç.Dr. Zati Vatansever Ankara Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Tularemi (tavşan an ateşi, geyik sineği

Detaylı

YEREL SEÇİM ANALİZLERİ. Şubat, 2014

YEREL SEÇİM ANALİZLERİ. Şubat, 2014 YEREL SEÇİM ANALİZLERİ Şubat, 2014 Partilerin Kazanacağı Belediye Sayıları Partilere Göre 81İlin Yerel Seçimlerde Alınması Muhtemel Oy Oranları # % AK Parti 37 45,7 CHP 9 11,1 MHP 5 6,2 BDP/HDP 8 9,9 Rekabet

Detaylı

TOKSOPLAZMA İNFEKSİYONUNUN LABORATUVAR TANISI UZM.DR.CENGİZ UZUN ALMAN HASTANESİ

TOKSOPLAZMA İNFEKSİYONUNUN LABORATUVAR TANISI UZM.DR.CENGİZ UZUN ALMAN HASTANESİ TOKSOPLAZMA İNFEKSİYONUNUN LABORATUVAR TANISI UZM.DR.CENGİZ UZUN ALMAN HASTANESİ KLİNİK Bağışıklık sistemi sağlam kişilerde akut infeksiyon Bağışıklık sistemi baskılanmış kişilerde akut infeksiyon veya

Detaylı

Türkiye İletim Sistemi Bağlantı Kapasitesi Raporu ( Dönemi)

Türkiye İletim Sistemi Bağlantı Kapasitesi Raporu ( Dönemi) Türkiye İletim Sistemi Bağlantı Kapasitesi Raporu (2016-2026 Dönemi) 13.04.2016 Yönetici Özeti Bu rapor, Türkiye elektrik iletim sistemi mevcut durumu, TEİAŞ tarafından planlanan iletim sistemi yatırımları

Detaylı

Yatırım Teşvik Uygulamalarında Bölgeler

Yatırım Teşvik Uygulamalarında Bölgeler Yatırım Teşvik Uygulamalarında Bölgeler 1. Bölge: Ankara, Antalya, Bursa, Eskişehir, İstanbul, İzmir, Kocaeli, Muğla 2. Bölge: Adana, Aydın, Bolu, Çanakkale (Bozcaada ve Gökçeada İlçeleri Hariç), Denizli,

Detaylı

TURIZM OTEL YÖNETICILERI DERNEĞI TANITIM DOSYASI

TURIZM OTEL YÖNETICILERI DERNEĞI TANITIM DOSYASI 2017 TURIZM OTEL YÖNETICILERI DERNEĞI TANITIM DOSYASI İcadiye Mahallesi Çifte Çınar Sokak No 26 Kuzguncuk Üsküdar İstanbul Tel : +90 (216) 383 2200 info@turoyd.org TURİZM OTEL YÖNETİCİLERİ DERNEĞİ (TUROYD)

Detaylı

PROGRAM EKİNİN GAYRİ RESMİ ÇEVİRİSİDİR. E K L E R EK 1.1... 4 DAİMİ İKAMET EDENLERİN SAYISI, TOPLAM NÜFUS, İLLERE GÖRE ŞEHİR VE KIRSAL

PROGRAM EKİNİN GAYRİ RESMİ ÇEVİRİSİDİR. E K L E R EK 1.1... 4 DAİMİ İKAMET EDENLERİN SAYISI, TOPLAM NÜFUS, İLLERE GÖRE ŞEHİR VE KIRSAL PROGRAM EKİNİN GAYRİ RESMİ ÇEVİRİSİDİR. E K L E R EK 1.1... 4 DAİMİ İKAMET EDENLERİN SAYISI, TOPLAM NÜFUS, İLLERE GÖRE ŞEHİR VE KIRSAL YERLEŞİMLERDEKİ NÜFUS %'Sİ... 4 EK 1.2... 6 KİŞİ BAŞI REEL GSYİH,

Detaylı

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ SELÇUK KILIÇ, BEKİR ÇELEBİ, MEHMET GENÇ, CANAN KETRE, MUSTAFA KOLUKIRIK 1, Ankara 2 Bioeksen Ar-Ge Teknolojileri

Detaylı

İL ADI UNVAN KODU UNVAN ADI BRANŞ KODU BRANŞ ADI PLANLANAN SAYI ÖĞRENİM DÜZEYİ

İL ADI UNVAN KODU UNVAN ADI BRANŞ KODU BRANŞ ADI PLANLANAN SAYI ÖĞRENİM DÜZEYİ ADANA 8140 BİYOLOG 0 1 LİSANS ADANA 8315 ÇOCUK GELİŞİMCİSİ 0 1 LİSANS ADANA 8225 DİYETİSYEN 0 1 LİSANS ADANA 8155 PSİKOLOG 0 1 LİSANS ADANA 8410 SAĞLIK MEMURU 6000 ÇEVRE SAĞLIĞI 4 LİSE ADANA 8410 SAĞLIK

Detaylı

TÜRKİYE DE MAĞDUR ÇOCUKLAR

TÜRKİYE DE MAĞDUR ÇOCUKLAR TÜRKİYE DE MAĞDUR ÇOCUKLAR Bilgi Notu-3: Toplumsal Olay Mağduru Çocuklar Yazan: Didem Şalgam, MSc Katkılar: Prof. Dr. Münevver Bertan, Gülgün Müftü, MA, Adem ArkadaşThibert, MSc MA İçindekiler Tablo Listesi...

Detaylı

BİLGİ TEKNOLOJİLERİ VE İLETİŞİM KURULU KARAR. : 2017 Yıllık Kullanım Hakkı Ücretleri. : Yetkilendirme Dairesi Başkanlığının hazırladığı takrir ve

BİLGİ TEKNOLOJİLERİ VE İLETİŞİM KURULU KARAR. : 2017 Yıllık Kullanım Hakkı Ücretleri. : Yetkilendirme Dairesi Başkanlığının hazırladığı takrir ve BİLGİ TEKNOLOJİLERİ VE İLETİŞİM KURULU KARARI Karar Tarihi : 14.12.2016 Karar No : 2016/DK-YED/486 Gündem Konusu : 2017 Yıllık Kullanım Hakkı Ücretleri KARAR ekleri incelenmiştir. : Yetkilendirme Dairesi

Detaylı

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ HANEHALKI İŞGÜCÜ İSTATİSTİKLERİ BİLGİ NOTU 2013 Yılı Türkiye İstatistik Kurumu 06/03/2014 tarihinde 2013 yılı Hanehalkı İşgücü İstatistikleri haber bültenini yayımladı. 2013 yılında bir önceki yıla göre;

Detaylı

Faaliyet Raporu (1 Ocak 31 Aralık 2009) İstatistikler İSTATİSTİKİ BİLGİLER

Faaliyet Raporu (1 Ocak 31 Aralık 2009) İstatistikler İSTATİSTİKİ BİLGİLER İSTATİSTİKİ BİLGİLER 1 MESLEK MENSUPLARI YILLARA GÖRE SAYILARI GRAFİĞİ 2009 Aralık 2008 Eylül-Aralık 2007-2008 2006-2007 2005-2006 2004-2005 2003-2004 2002-2003 2001-2002 2000-2001 1994-1995 1990-1991

Detaylı

KPSS-2014/3 Sağlık Bakanlığı ve Bağlı Kuruluşlarının Sözleşmeli Pozisyonlarına Yerleştirme (Ortaöğretim)

KPSS-2014/3 Sağlık Bakanlığı ve Bağlı Kuruluşlarının Sözleşmeli Pozisyonlarına Yerleştirme (Ortaöğretim) KURUM ADI KADRO ADI 190160001 SAĞLIK BAKANLIĞI SAĞLIK MEMURU (ADANA TÜM İLÇELER Taşra) 5 0 75,57278 78,51528 190160003 SAĞLIK BAKANLIĞI SAĞLIK MEMURU (ARTVİN TÜM İLÇELER Taşra) 4 0 75,26887 75,34407 190160005

Detaylı

İllere ve yıllara göre konut satış sayıları, House sales by provinces and years,

İllere ve yıllara göre konut satış sayıları, House sales by provinces and years, 2013 Ocak Şubat Mart Nisan Mayıs Haziran Temmuz Ağustos Eylül Ekim Kasım Aralık Toplam January February March April May June July August September October November December Total Türkiye 87 444 88 519

Detaylı

Eczacılık VII.1. ECZACILIK UYGULAMALARI VII.2. ECZACILIK EĞİTİMİ

Eczacılık VII.1. ECZACILIK UYGULAMALARI VII.2. ECZACILIK EĞİTİMİ VII.. ECZACILIK UYGULAMALARI VII.. ECZACILIK EĞİTİMİ VII.. Uygulamaları TABLO-: BRANŞLARA GÖRE ECZACI DAĞILIMI (008) BRANŞLAR ECZACI SAYISI Bakanlık ve SGK'da Çalışan Eczacılar (Kamu Eczacısı) İlaç Sektöründe

Detaylı

LİSTE - II TÜRKİYE HALK SAĞLIĞI KURUMU - TAŞRA

LİSTE - II TÜRKİYE HALK SAĞLIĞI KURUMU - TAŞRA YER DEĞİŞİKLİĞİ BAŞVURULARI İÇİN İLAN EDİLEN LİSTESİ 1 ADANA BİYOLOG GENEL BÜTÇE 1 1 ADANA EBE GENEL BÜTÇE 6 1 ADANA HEMŞİRE GENEL BÜTÇE 2 1 ADANA SAĞLIK MEMURU ÇEVRE SAĞLIĞI TEKNİSYENİ GENEL BÜTÇE 1 1

Detaylı

BAYİLER. Administrator tarafından yazıldı. Çarşamba, 18 Nisan :29 - Son Güncelleme Cuma, 03 Mayıs :39

BAYİLER. Administrator tarafından yazıldı. Çarşamba, 18 Nisan :29 - Son Güncelleme Cuma, 03 Mayıs :39 Federal CNG Dönüşüm Sistemleri olarak, başta Konya olmak üzere Türkiye'nin her bölgesinde ve her ilimizde CNG Dönüşüm Sistemleri konusunda hizmet vermekteyiz. FEDERAL CNG DÖNÜŞÜM SİSTEMLERİ Adana CNG Dönüşüm

Detaylı

Mayıs 2012 SAGMER İstatistikleri

Mayıs 2012 SAGMER İstatistikleri Mayıs 2012 SAGMER İstatistikleri *Ekli dosyadaki istatistikî veriler, Sigorta Şirketlerinin SBM ye gönderdiği verilerden oluşturulmuştur. Veriler 31 Mayıs 2012 itibariyle alınmıştır. Tablo 1: Ödeme Yöntemine

Detaylı

İL BAZINDA DAĞILIM İSTANBUL 136 ANKARA 36 İZMİR 23 ANTALYA 12 KOCAELİ 10 GAZİANTEP 9

İL BAZINDA DAĞILIM İSTANBUL 136 ANKARA 36 İZMİR 23 ANTALYA 12 KOCAELİ 10 GAZİANTEP 9 BAŞVURU ADEDİ 335 TEMMUZ-AĞUSTOS-EYLÜL 2010 BAŞVURU İSTATİSTİKLERİ ANA BRANŞ BAZINDA DAĞILIM HAYAT DIŞI 307 HAYAT 28 İL BAZINDA DAĞILIM İSTANBUL 136 ANKARA 36 İZMİR 23 ANTALYA 12 KOCAELİ 10 GAZİANTEP 9

Detaylı

Tüvturk Araç Muayene Gezici Mobil İstasyon Programı

Tüvturk Araç Muayene Gezici Mobil İstasyon Programı Tüvturk Araç Muayene Gezici Mobil İstasyon Programı Tüvturk Gezici istasyonlarında ağır vasıtalar (3.5 ton üzeri) hariç tüm motorlu ve motorsuz araçlar için muayene hizmeti verilmektedir. Gezici İstasyon

Detaylı

LİSTE - II TÜRKİYE HALK SAĞLIĞI KURUMU - TAŞRA

LİSTE - II TÜRKİYE HALK SAĞLIĞI KURUMU - TAŞRA 1 ADANA EBE 4 1 ADANA SAĞLIK MEMURU RÖNTGEN TEKNİSYENİ 1 1 ADANA SAĞLIK MEMURU TIBBİ SEKRETER 2 2 ADIYAMAN DİYETİSYEN 2 2 ADIYAMAN EBE 2 2 ADIYAMAN HEMŞİRE 1 2 ADIYAMAN SAĞLIK MEMURU TIBBİ SEKRETER 1 2

Detaylı

Başarılı bir kongre ve toplantı olması dileği

Başarılı bir kongre ve toplantı olması dileği Dr. Suna Gedikoğlu Elimde olmayan bir neden ile kongreye katılamadığım için üzgünüm Bu toplantıda emekli ve kıdemli bir öğretim üyesi olarak deneyimlerimi paylaşmayı arzu etmiştim Katılamamakla beraber

Detaylı

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ Doç.Dr. Aynur KARADENİZLİ Kocaeli Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Francisella tularensis Küçük, aerobik, pleomorfik,

Detaylı

2009 AFYONKARAHİSAR ÖNSÖZ. Sonsuz saygı, sevgi ve teşekkürlerimi sunmayı borç bilirim.

2009 AFYONKARAHİSAR ÖNSÖZ. Sonsuz saygı, sevgi ve teşekkürlerimi sunmayı borç bilirim. 2009 AFYONKARAHİSAR ÖNSÖZ Bu çalışmada, Afyon Kocatepe Üniversitesi, Tıp Fakültesi Ahmet Necdet Sezer Uygulama Araştırma Hastanesi nden ve Zübeyde Hanım Doğum ve Çocuk Hastanesi nden; gastrenteritli çocuklardan

Detaylı

2015 KOCAELİ NÜFUSUNUN BÖLGESEL ANALİZİ TUİK

2015 KOCAELİ NÜFUSUNUN BÖLGESEL ANALİZİ TUİK 0 NÜFUSUNUN BÖLGESEL ANALİZİ TUİK Verilerine Göre Hazırlanmıştır. İLİNİN NÜFUSU.. NÜFUSUNA KAYITLI OLANLAR NDE YAŞAYIP NÜFUS KAYDI BAŞKA İLLERDE OLANLAR.0 %... %. NÜFUSUNUN BÖLGESEL ANALİZİ 0 TUİK Verilerine

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

T.C. KÜLTÜR VE TURİZM BAKANLIĞI

T.C. KÜLTÜR VE TURİZM BAKANLIĞI T.C. KÜLTÜR VE TURİZM BAKANLIĞI TELİF HAKLARI GENEL MÜDÜRLÜĞÜ İSTATİSTİKSEL BİLGİLENDİRME RAPORU (SERTİFİKA) Hazırlayan: İrfan Taylan ÇOKYAMAN OCAK 2013 ANKARA SERTİFİKA BÖLÜM İSTATİSTİKLERİ 2 1) SERTİFİKA

Detaylı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 16S rrna Analizi Doç. Dr. Zeynep Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum içeriği Genel bilgi Uygulanışı Kullanım alanları Avantajları Dezavantajları Neden

Detaylı

Ocak SAGMER İstatistikleri

Ocak SAGMER İstatistikleri 2015 SAGMER İstatistikleri Tablo 1: Ödeme Yöntemine Göre Yazılan Poliçe Adedi Dağılımı 2014 2015 ÜRÜN GRUBU ÖDEME TİPİ Ferdi Grup Ferdi Grup BANKAYA ÖDEME 6,7% 8,6% 9,0% 8,3% ÇEK 0,0% 0,0% 0,0% 0,0% DİĞER

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ ADRESE DAYALI NÜFUS KAYIT SİSTEMİ (ADNKS) 2015 Yılı Türkiye İstatistik Kurumu 28/01/2016 tarihinde 2015 yılı Adrese Dayalı Kayıt Sistemi Sonuçları haber bültenini yayımladı. 31 Aralık 2015 tarihi itibariyle;

Detaylı

Q HUMMASI NIN EPİDEMİYOLOJİSİ VE TEŞHİSİ Epidemiology and Diagnosis of Q Fever

Q HUMMASI NIN EPİDEMİYOLOJİSİ VE TEŞHİSİ Epidemiology and Diagnosis of Q Fever DERLEME (Review Article) Q HUMMASI NIN EPİDEMİYOLOJİSİ VE TEŞHİSİ Epidemiology and Diagnosis of Q Fever Gökben ÖZBEY 1, Hakan KALENDER 2, Adile MUZ 3 Özet : Query (Q) humması birçok ülkede görülen, zorunlu

Detaylı

Mayıs 2014 SAGMER İstatistikleri

Mayıs 2014 SAGMER İstatistikleri Mayıs 2014 SAGMER İstatistikleri *Ekli dosyadaki istatistikî veriler, Sigorta Şirketlerinin SBM ye gönderdiği verilerden oluşturulmuştur. Veriler 31 Mayıs 2014 itibariyle alınmıştır. Tablo 1: Ödeme Yöntemine

Detaylı

EK 1: TABLO VE ŞEKİLLER

EK 1: TABLO VE ŞEKİLLER EK 1: TABLO VE ŞEKİLLER NET OKULLULAŞMA TABLO 1: Türkiye Net Okullulaşma Oranı Trendleri (%) Kademe ve cinsiyet 2001-02 2002-03 2003-04 2004-05 2005-06 2006-07 2007-08 2008-09 2009-10 2010-11 5,40% 7,50%

Detaylı

Türkiye'nin en rekabetçi illeri "yorgun devleri"

Türkiye'nin en rekabetçi illeri yorgun devleri Türkiye'nin en rekabetçi illeri "yorgun devleri" Türkiye nin kalkınmasında önemli rol üstlenen İstanbul, Ankara ve İzmir, iller arasında rekabet sıralamasında da öne çıktı. İSTANBUL - Elif Ferhan Yeşilyurt

Detaylı

LİMANLAR GERİ SAHA KARAYOLU VE DEMİRYOLU BAĞLANTILARI MASTER PLAN ÇALIŞMASI

LİMANLAR GERİ SAHA KARAYOLU VE DEMİRYOLU BAĞLANTILARI MASTER PLAN ÇALIŞMASI T.C. ULAŞTIRMA, DENİZCİLİK VE HABERLEŞME BAKANLIĞI ALTYAPI YATIRIMLARI GENEL MÜDÜRLÜĞÜ LİMANLAR GERİ SAHA KARAYOLU VE DEMİRYOLU BAĞLANTILARI MASTER PLAN ÇALIŞMASI SONUÇ RAPORU-EKLER Mühendislik Anonim

Detaylı

İLLERE GÖRE NÜFUS KÜTÜKLERİNE KAYITLI EN ÇOK KULLANILAN 5 KADIN VE ERKEK ADI

İLLERE GÖRE NÜFUS KÜTÜKLERİNE KAYITLI EN ÇOK KULLANILAN 5 KADIN VE ERKEK ADI İLLERE GÖRE NÜFUS KÜTÜKLERİNE KAYITLI EN ÇOK KULLANILAN 5 KADIN VE ERKEK ADI İL KADIN ADI ERKEK ADI ADANA ADIYAMAN AFYONKARAHİSAR AKSARAY SULTAN SULTAN İBRAHİM RAMAZAN 1/17 2/17 AMASYA ANKARA ANTALYA ARDAHAN

Detaylı

TLERDE SEROLOJİK/MOLEK HANGİ İNCELEME?) SAPTANMASI

TLERDE SEROLOJİK/MOLEK HANGİ İNCELEME?) SAPTANMASI * VİRAL V HEPATİTLERDE TLERDE SEROLOJİK/MOLEK K/MOLEKÜLER LER TESTLER (NE ZAMANHANG HANGİ İNCELEME?) *VİRAL HEPATİTLERDE TLERDE İLAÇ DİRENCİNİN SAPTANMASI *DİAL ALİZ Z HASTALARININ HEPATİT T AÇISINDAN

Detaylı

TAŞRA TEŞKİLATI MÜNHAL TEKNİKER KADROLARI

TAŞRA TEŞKİLATI MÜNHAL TEKNİKER KADROLARI ADANA MERKEZ 111918 İL MEM İNŞAAT 1 ADANA MERKEZ 111918 İL MEM ELEKTRİK 2 ADIYAMAN MERKEZ 114014 İL MEM İNŞAAT 1 ADIYAMAN MERKEZ 114014 İL MEM ELEKTRİK 1 AFYONKARAHİSARMERKEZ 114972 İL MEM İNŞAAT 1 AFYONKARAHİSARMERKEZ

Detaylı

TABİP İL BÖLGE SE PDC KAD ORAN GRUP KİLİS 4 63 88 96 109,09% A1 KARAMAN 4 32 127 130 102,36% A2 İZMİR 1 3 1821 1864 102,36% A3 MALATYA 5 42 373 375

TABİP İL BÖLGE SE PDC KAD ORAN GRUP KİLİS 4 63 88 96 109,09% A1 KARAMAN 4 32 127 130 102,36% A2 İZMİR 1 3 1821 1864 102,36% A3 MALATYA 5 42 373 375 TABİP İL BÖLGE SE PDC KAD ORAN GRUP KİLİS 4 63 88 96 109,09% A1 KARAMAN 4 32 127 130 102,36% A2 İZMİR 1 3 1821 1864 102,36% A3 MALATYA 5 42 373 375 100,54% A4 ELAZIĞ 5 39 308 309 100,32% A5 YALOVA 2 13

Detaylı

Doğal Gaz Sektör Raporu

Doğal Gaz Sektör Raporu GAZBİR Türkiye Doğal Gaz Dağıtıcıları Birliği TEMMUZ Doğal Gaz Sektör Raporu İthalat 4.5, 4., Temmuz ayında yılının aynı ayına göre ülke ithalat miktarında 915,37 milyon sm 3, %28,43 lük bir artış meydana

Detaylı

122. GRUPTA İHALE EDİLECEK SAHALARIN LİSTESİ. Belirlenen Taban İhale Bedeli TL. 1 Adana 3327245 3183357 II. Grup 81.07 Arama 6.06.2016 9,30 60.

122. GRUPTA İHALE EDİLECEK SAHALARIN LİSTESİ. Belirlenen Taban İhale Bedeli TL. 1 Adana 3327245 3183357 II. Grup 81.07 Arama 6.06.2016 9,30 60. 122. GRUPTA İHALE EDİLECEK SAHALARIN LİSTESİ Sıra No İli Erişim İlişkili Erişim Maden Grubu Alanı Ruhsat Safhası İhale Tarihi Saati Belirlenen Taban İhale Bedeli TL. 1 Adana 3327245 3183357 II. Grup 81.07

Detaylı

EĞİTİM VE ÖĞRETİMDE YENİLİKÇİLİK ÖDÜLLERİ EĞİTİM VE ÖĞRETİM YILI ÖDÜL SÜRECİ. Rapor Yazım Esasları

EĞİTİM VE ÖĞRETİMDE YENİLİKÇİLİK ÖDÜLLERİ EĞİTİM VE ÖĞRETİM YILI ÖDÜL SÜRECİ. Rapor Yazım Esasları Ek-1 EĞİTİM VE ÖĞRETİMDE YENİLİKÇİLİK ÖDÜLLERİ 2015-2016 EĞİTİM VE ÖĞRETİM YILI ÖDÜL SÜRECİ Raporun Biçimsel Düzeni Rapor Yazım Esasları Times New Roman, 11 punto, 1,15 satır aralığı kullanılacaktır. Paragraf

Detaylı

Bilim, Sanayi ve Teknoloji Bakanlığı. Mayıs 2013 - Düzce 1

Bilim, Sanayi ve Teknoloji Bakanlığı. Mayıs 2013 - Düzce 1 Mayıs 2013 - Düzce 1 İçerik Giriş Kamu Üniversite Sanayi İşbirliğinde En Somut Ara Yüzler: Teknoloji Geliştirme Bölgeleri Ülkemizde Teknoloji Geliştirme Bölgeleri Teknoloji Geliştirme Bölgelerinin Bölgesel

Detaylı

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ ADRESE DAYALI NÜFUS KAYIT SİSTEMİ (ADNKS) 2013 Yılı Türkiye İstatistik Kurumu 29/01/2014 tarihinde 2013 yılı Adrese Dayalı Kayıt Sistemi Sonuçları haber bültenini yayımladı. 31 Aralık 2013 tarihi itibariyle;

Detaylı

RUH HASTALARININ SEVK VE AYAKTAN TAKİPLERİ HAKKINDA GENELGE

RUH HASTALARININ SEVK VE AYAKTAN TAKİPLERİ HAKKINDA GENELGE RUH HASTALARININ SEVK VE AYAKTAN TAKİPLERİ HAKKINDA GENELGE Temel Sağlık Hizmetleri G.M.Tarih:27.02.98 Sayı:2195 T.C. SAĞLIK BAKANLIĞI Temel Sağlık Hizmetleri Genel Müdürlüğü SAYI:B100TSH0140005/2195 KONU:Ruh

Detaylı

2012-ÖMSS Sınav Sonucu İle Yapılan Yerleştirme Sonuçlarına İlişkin Sayısal Bilgiler (Ortaöğretim)

2012-ÖMSS Sınav Sonucu İle Yapılan Yerleştirme Sonuçlarına İlişkin Sayısal Bilgiler (Ortaöğretim) 10020121001 ABANT İZZET BAYSAL ÜNİVERSİTESİ SANTRAL MEMURU (BOLU / MERKEZ - Merkez) 1 0 90,04922 90,04922 10020121003 AİLE VE SOSYAL POLİTİKALAR BAKANLIĞI HİZMETLİ (ADIYAMAN / MERKEZ - Taşra) 1 0 86,74214

Detaylı

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Spesifik tanı yöntemleri: 1. Direk (kült ltür r ve bakterinin gösterilmesi) g 2. Antikorların n gösterilmesig 1.Standart tüp aglütinasyonu 2.Rose Bengal

Detaylı

ÜLKEMİZDE VE DOĞU KARADENİZ BÖLGESİ HİDROELEKTRİK ENERJİ POTANSİYELİ

ÜLKEMİZDE VE DOĞU KARADENİZ BÖLGESİ HİDROELEKTRİK ENERJİ POTANSİYELİ ÜLKEMİZDE VE DOĞU KARADENİZ HİDROELEKTRİK ENERJİ POTANSİYELİ Prof. Dr. Hızır ÖNSOY K.T.Ü. İnş. Müh. Hidrolik Anabilim Dalı Öğr. Üyesi honsoy@ktu.edu.tr Dünya, ileri teknoloji ve sanayide, baş döndürücü

Detaylı

Gayri Safi Katma Değer

Gayri Safi Katma Değer Artıyor Ekonomik birimlerin belli bir dönemde bir bölgedeki ekonomik faaliyetleri sonucunda ürettikleri mal ve hizmetlerin (çıktı) değerinden, bu üretimde bulunabilmek için kullandıkları mal ve hizmetler

Detaylı

VERGİ BİRİMLERİ. Taşra Teşkilatındaki Birimlerin Yıllar İtibariyle Sayısal Durumu

VERGİ BİRİMLERİ. Taşra Teşkilatındaki Birimlerin Yıllar İtibariyle Sayısal Durumu VERGİ BİRİMLERİ Taşra Teşkilatındaki Birimlerin Yıllar İtibariyle Sayısal Durumu 2. Vergi Birimleri. 2.1. Vergi Birimlerinin Yıllar İtibariyle Sayısal Durumu Birimin Adı 31/12/1996 31/12/1997 31/12/1998

Detaylı

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite

Detaylı

VİRAL TANI KİTLERİ (GFJ-480)

VİRAL TANI KİTLERİ (GFJ-480) VİRAL TANI KİTLERİ (GFJ-480) CMV PCR Tanı Kiti Cytomegalovirus un Konvensiyonel PCR yöntemiyle tanınması. HHV-5 olarak da bilinen Sitomegalovirüs, herpes virus ailesinin bir üyesidir. Oldukça sık görülen

Detaylı

BLACK QUEEN CELL VİRUS. Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı

BLACK QUEEN CELL VİRUS. Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı BLACK QUEEN CELL VİRUS Emre ÖZAN Veteriner Hekim Viroloji Laboratuarı Giriş Bal arısı(apis Mellifera) yetiştiriciliği Bakteriyel ve paraziter arı hastalıkları İzole edilen 18 arı virusu Black Queen Cell

Detaylı

Tarım İşletmeleri Genel Müdürlüğü (Personel Daire Bşk.)

Tarım İşletmeleri Genel Müdürlüğü (Personel Daire Bşk.) Şube Başkanlıkları 1 NOLU ANKARA ŞUBESİ Mustafa GÜRAN Tarım İşletmeleri Genel Müdürlüğü (Personel Daire Bşk.) Tarım ve Köyişleri Bakanlığı Tel 5366400073 2 NOLU KAHRAMANMARAŞ ŞUBESİ Mustafa Ertan ATALAR

Detaylı

Virulan Faz I. Çevresel faktörlere direncini sağlayan küçük spor benzeri formları var. Faz II. Avirulan. Ayrıca. Etkenin iki ayrı fazı saptanmış

Virulan Faz I. Çevresel faktörlere direncini sağlayan küçük spor benzeri formları var. Faz II. Avirulan. Ayrıca. Etkenin iki ayrı fazı saptanmış Coxiella burnetii Gram-negatif Pleomorfik (0.2-0.4 x 0.4-1 µm) Mononükleer hücrelerin fagozomları içinde, plasenta ve embriyolu yumurtanın sarı kesesi gibi hücrelerin intrasitoplazmik vakuollerinde ve

Detaylı

Yığma Yapıların Deprem Güvenliklerinin Arttırılması

Yığma Yapıların Deprem Güvenliklerinin Arttırılması Yığma Yapıların Deprem Güvenliklerinin Arttırılması TÜRKİYE DE YIĞMA BİNALAR İÇİN DEPREMSEL RİSK HARİTASI ELDE EDİLMESİ Yard. Doç. Dr. Ahmet TÜRER & Abdullah DİLSİZ (M.S.) 17.02.2005 AMAÇ & KAPSAM Bu çalışmada,

Detaylı

İSTİHDAM İZLEME BÜLTENİ

İSTİHDAM İZLEME BÜLTENİ 29 11 2014 Sayı 32 TEPAV İstihdam İzleme Bülteni Temmuz 2014 TEPAV İstihdam İzleme Bülteni nin -Sosyal Güvenlik Kurumu (SGK) ve Türkiye İş Kurumu (İŞKUR) Temmuz 2014 verilerinin değerlendirildiği- 32.

Detaylı

SURİYE ARAP CUMHURİYETİNE YAPILAN İHRACAT ANALİZİ

SURİYE ARAP CUMHURİYETİNE YAPILAN İHRACAT ANALİZİ SURİYE ARAP CUMHURİYETİNE YAPILAN İHRACAT ANALİZİ Sayfa 1 / 12 İLLER BAZINDA SURİYE YAPILAN İHRACAT -2011 Sayfa 2 / 12 GAZIANTEP SURİYE 98.011.759,68 HATAY SURİYE 102.197.108,56 SAKARYA SURİYE 2.432.730,63

Detaylı

Moleküler Yöntemlerin Klinik Mikrobiyolojide Kullanımı Ne zaman? Nerede? Ne kadar? Klinik Parazitoloji

Moleküler Yöntemlerin Klinik Mikrobiyolojide Kullanımı Ne zaman? Nerede? Ne kadar? Klinik Parazitoloji Moleküler Yöntemlerin Klinik Mikrobiyolojide Kullanımı Ne zaman? Nerede? Ne kadar? Klinik Parazitoloji Metin Korkmaz Ege Üniversitesi Tıp Fakültesi Tıbbi Parazitoloji AD İnsandaki Paraziter Hastalıkların

Detaylı

Osmanlı dan Günümüze Seçimler ( ) Kitabımızdan alınmıştır. Çok Partili Dönemde Yapılan Milletvekili Ara Seçimi Sonuçları

Osmanlı dan Günümüze Seçimler ( ) Kitabımızdan alınmıştır. Çok Partili Dönemde Yapılan Milletvekili Ara Seçimi Sonuçları Osmanlı dan Günümüze Seçimler (1877 2002) Kitabımızdan alınmıştır Çok Partili Dönemde Yapılan Milletvekili Ara Seçimi Sonuçları 6 Nisan 1947 Milletvekili Ara Seçimi Sonuçları (*) Partilerin Mv. Sayısı

Detaylı

SAMSUN TİCARET VE SANAYİ ODASI EKONOMİK BÜLTEN

SAMSUN TİCARET VE SANAYİ ODASI EKONOMİK BÜLTEN SAMSUN TİCARET VE SANAYİ ODASI EKONOMİK BÜLTEN ARALIK 2016 Bu eserin tüm telif hakları Samsun Ticaret ve Sanayi Odası na aittir. Samsun Ticaret ve Sanayi Odası nın ismi kaydedilmek koşulu ile alıntı yapmak

Detaylı

4. İLLERE GÖRE ÖĞRENCİ VE ÖĞRETİM ELEMANLARI SAYILARI NUMBER OF STUDENTS & TEACHING STAFF BY PROVINCES

4. İLLERE GÖRE ÖĞRENCİ VE ÖĞRETİM ELEMANLARI SAYILARI NUMBER OF STUDENTS & TEACHING STAFF BY PROVINCES 17 TÜRKİYE TOPLAMI T 492828 1841546 289579 38293 6383 90333 24891 16433 2815 4121 15892 2408 78804 10864 5298 13555 49087 11534 3204 1625 3850 2855 TOTAL FOR TURKEY K 202734 762487 126623 16538 2530 37671

Detaylı

T.C. ÇEVRE VE ŞEHİRCİLİK BAKANLIĞI TEHLİKELİ ATIK İSTATİSTİKLERİ BÜLTENİ(2013)

T.C. ÇEVRE VE ŞEHİRCİLİK BAKANLIĞI TEHLİKELİ ATIK İSTATİSTİKLERİ BÜLTENİ(2013) Sayı: 4 02.07.2015 16:00 Mülga Tehlikeli Atıkların Kontrolü Yönetmeliği kapsamında yıllık tehlikeli atık beyanları, Çevre ve Şehircilik Bakanlığı Çevre Bilgi Sistemi altında yer alan Atık Yönetim Uygulaması/Tehlikeli

Detaylı

GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60

GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60 Dr. Tolga BAŞKESEN GİRİŞ Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi ABD de yılda 200.000 KDE, mortalite % 35-60 Erken ve doğru tedavi ile mortaliteyi azaltmak mümkün GİRİŞ Kan

Detaylı

SİYASİ PARTİLERİN SEÇİM YARIŞI HIZ KESMİYOR

SİYASİ PARTİLERİN SEÇİM YARIŞI HIZ KESMİYOR BÜLTEN 21.05.2015 SİYASİ PARTİLERİN SEÇİM YARIŞI HIZ KESMİYOR 7 Haziran genel seçimine günler kala nefesler tutuldu, gözler yapılan anket çalışmalarına ve seçim vaatlerine çevrildi. Liderlerin seçim savaşının

Detaylı

Türkiye nin mevcut HPAI Durumu. o Türkiye, de OIE ye HPAI yönünden arilik bildirimini yapmıştır.

Türkiye nin mevcut HPAI Durumu. o Türkiye, de OIE ye HPAI yönünden arilik bildirimini yapmıştır. Türkiye nin mevcut HPAI Durumu o Türkiye, 14.07. 2008 de OIE ye HPAI yönünden arilik bildirimini yapmıştır. Survey Çalışmaları PASİF SURVEY (1) 2005-2006 salgınlar sonrası 01/04/2006-05/02/2007 *Muayeneye

Detaylı

Türkiye den bir eşitsizlik fotoğrafı daha: Yaşlanmadan ölenler! / Kayıhan Pala

Türkiye den bir eşitsizlik fotoğrafı daha: Yaşlanmadan ölenler! / Kayıhan Pala Türkiye den bir eşitsizlik fotoğrafı daha: Yaşlanmadan ölenler! / Kayıhan Pala Yeni açıklanan 2015 yılı ölüm istatistikleri Türkiye nin eşitsizliklerle dolu karnesini bir kez daha gündeme getiriyor. Türkiye

Detaylı

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ Sayfa 1 Gözden Geçirme Notları 2010 Yılı Göç İstatistikleri Türkiye İstatistik Kurumu (TÜİK) Adrese Dayalı Nüfus Kayıt Sistemi (ADNK) sonuçları veri tabanı ve 2000 yılı Genel Nüfus Sayımı sonuçlarına göre,

Detaylı

Talepte Bulunan PersonelinÜnvanlara Göre Dağılımı

Talepte Bulunan PersonelinÜnvanlara Göre Dağılımı 15/06/2011-05/08/2011 Tarihleri Arasında Başkanlığımız İnternet Sitesinde Yayınlanan "Hizmetiçi Eğitim İhtiyacının Belirlenmesi Anketi"ne Katılan 7.191 Personelin 58.878 Tercihin, "Tercih Edilen Eğitim

Detaylı

TABLO-1. MERKEZİ YERLEŞTİRMEDEKİ EN KÜÇÜK VE EN BÜYÜK PUANLAR ( ORTAÖĞRETİM MEZUNLARI )

TABLO-1. MERKEZİ YERLEŞTİRMEDEKİ EN KÜÇÜK VE EN BÜYÜK PUANLAR ( ORTAÖĞRETİM MEZUNLARI ) 1573951 3 0 091.496 092.411 HEMŞİRE (BOLU) ABANT İZZET BAYSAL ÜNİVERSİTESİ (Merkez) 1573953 29 0 093.232 096.492 KORUMA VE GÜVENLİK GÖREVLİSİ (ANKARA) ADALET BAKANLIĞI (Merkez) 1573955 11 0 092.813 093.230

Detaylı

Yrd. Doç. Dr. Tahsin KARABULUT

Yrd. Doç. Dr. Tahsin KARABULUT Yrd. Doç. Dr. Tahsin KARABULUT -İllerin Sosyo-ekonomik gelişmişlik düzeylerinin belirlenmesi amacıyla yapılan bu çalışmada niceliksel bir büyüme anlayışından ziyade, niteliksel bir Sosyo-ekonomik gelişme

Detaylı

Ajans Press; Marka Şehir ve Belediyelerin Medya Karnesini açıkladı

Ajans Press; Marka Şehir ve Belediyelerin Medya Karnesini açıkladı Basın Bildirisi Ajans Press; Marka Şehir ve Belediyelerin Medya Karnesini açıkladı 01 Ocak - 31 Aralık 2011 tarihleri arası Ajans Press in takibinde olan yerel, bölgesel ve ulusal 2659 yazılı basın takibinden

Detaylı

BRUSELLA ERADİKASYON PROGRAMI

BRUSELLA ERADİKASYON PROGRAMI BRUSELLA ERADİKASYON PROGRAMI Dr. Nahit YAZICIOĞLU Gıda ve Kontrol Genel Müdürlüğü Hayvan Sağlığı ve Karantina Daire Başkanı V.Türkiye Zoonotik Hastalıklar Sempozyumu-24/25 Ekim 2014-Erzurum 1 YASAL ALT

Detaylı

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ

TÜRKİYE ODALAR VE BORSALAR BİRLİĞİ TÜKETİCİ FİYATLARI ENDEKSİ (TÜFE) BİLGİ NOTU HAZİRAN 2013 Türkiye İstatistik Kurumu 03/07/2013 tarihinde 2013 yılı Haziran ayı Tüketici Fiyatları Endeksi (TÜFE) haber bültenini yayımladı. 2013 yılı Haziran

Detaylı

Olimpik Yüzme Günleri Kardeş İller Projesi Bölgesel ve Türkiye Finali Müsabaka Reglemanı

Olimpik Yüzme Günleri Kardeş İller Projesi Bölgesel ve Türkiye Finali Müsabaka Reglemanı Olimpik Yüzme Günleri Kardeş İller Projesi Bölgesel ve Türkiye Finali Müsabaka Reglemanı Final Müsabaka Yeri : Mersin ya da Adana Müsabaka tarihi : Eylül 2014 Teknik Toplantı : Müsabakalardan 1 gün önce

Detaylı

Tularemi: Tanı yöntemleri. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD

Tularemi: Tanı yöntemleri. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD Tularemi: Tanı yöntemleri Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD Dünyada Tularemi Francisella tularensis: Taksonomi Bacterium tularensis Tulare kasabası, Kaliforniya, Dr.

Detaylı

TABLO-1. İLKÖĞRETİM/ORTAOKUL/İLKOKUL MEZUNLARININ TERCİH EDEBİLECEĞİ KADROLAR (2015 EKPSS/KURA )

TABLO-1. İLKÖĞRETİM/ORTAOKUL/İLKOKUL MEZUNLARININ TERCİH EDEBİLECEĞİ KADROLAR (2015 EKPSS/KURA ) KURUM KODU DPB NO KURUM ADI / POZİSYON UNVANI İL İLÇE TEŞKİLAT SINIF 490060001 12062 AİLE VE SOSYAL POLİTİKALAR BAKANLIĞI HİZMETLİ IĞDIR TÜM İLÇELER Taşra YH 12 2 999 1000 1001 490060003 12079 AİLE VE

Detaylı

Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi

Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi Kırım Kongo Kanamalı Ateş hastalarında ağırlık ve ölüm riskinin tahmininde plazma cell-free DNA düzeyinin önemi Bakır M¹, Engin A¹, Kuşkucu MA², Bakır S³, Gündağ Ö¹, Midilli K² Cumhuriyet Üniversitesi

Detaylı

KPSS - 2004/2 ve Ek Yerleştirmedeki En Küçük ve En Büyük Puanlar ( TABLO-2 Önlisans Mezunları III. Grup Yeni Kadrolar )

KPSS - 2004/2 ve Ek Yerleştirmedeki En Küçük ve En Büyük Puanlar ( TABLO-2 Önlisans Mezunları III. Grup Yeni Kadrolar ) KPSS - 2004/2 ve Ek Yerleştirmedeki En Küçük ve En Büyük Puanlar ( TABLO-2 Önlisans Mezunları III. Grup Yeni Kadrolar ) EN EN BOŞ KÜÇÜK BÜYÜK K.KODU KONTENJAN KONTENJAN PUAN PUAN UNVAN KURUM ADI KURUM

Detaylı

BÖLGE GRUP SIRALAMASI

BÖLGE GRUP SIRALAMASI ACİL TIP ADANA ANKARA MERSİN KOCAELİ BURSA GAZİANTEP YALOVA ESKİŞEHİR HATAY DENİZLİ ANTALYA TEKİRDAĞ BALIKESİR KONYA AYDIN EDİRNE ZONGULDAK SAKARYA ÇANAKKALE MUĞLA MANİSA RİZE KÜTAHYA BARTIN BOLU SAMSUN

Detaylı

Temmuz 2015. SAGMER İstatistikleri

Temmuz 2015. SAGMER İstatistikleri Temmuz 2015 SAGMER İstatistikleri Tablo 1: Ödeme Yöntemine Göre Yazılan Poliçe Adedi Dağılımı 2014 2015 Temmuz Ocak - Temmuz Temmuz Ocak - Temmuz ÜRÜN GRUBU ÖDEME TİPİ Ferdi Grup Ferdi Grup Ferdi Grup

Detaylı

KPSS-2014/3 Sağlık Bakanlığı ve Bağlı Kuruluşlarının Kadrolarına Yerleştirme Sonuçlarına Göre En Büyük ve En Küçük Puanlar (Lisans)

KPSS-2014/3 Sağlık Bakanlığı ve Bağlı Kuruluşlarının Kadrolarına Yerleştirme Sonuçlarına Göre En Büyük ve En Küçük Puanlar (Lisans) KURUM ADI ADI 390160001 SAĞLIK BAKANLIĞI PSİKOLOG (AĞRI TÜM İLÇELER Taşra) 1 0 72,44764 72,44764 390160003 SAĞLIK BAKANLIĞI PSİKOLOG (ARDAHAN TÜM İLÇELER Taşra) 1 0 72,11422 72,11422 390160005 SAĞLIK BAKANLIĞI

Detaylı

GOOGLEDA ARAÇ KLİMA GAZ DOLUM CİHAZI. klima gaz dolum cihazı klima gazı nasıl doldurulur

GOOGLEDA ARAÇ KLİMA GAZ DOLUM CİHAZI. klima gaz dolum cihazı klima gazı nasıl doldurulur GOOGLEDA ARAÇ KLİMA GAZ DOLUM CİHAZI klima gaz dolum cihazı klima gazı nasıl doldurulur oto klima gazı fiyatları federal klima klima gaz dolum cihazı fiyatları klima gazı oto klima gaz dolum cihazı fiyatları

Detaylı