Trombofiliye Genetik Yaklaşım

Save this PDF as:

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Trombofiliye Genetik Yaklaşım"




3 Trombofili sonuçlarının değerlendirilmesi Kanserde tedavi hedeflerini belirlemek için hangi genetik testler kullanılabilir? PCA3 ve günümüzdeki tanısal değeri nedir? Nörodejeneratik hastalıklarda ne zaman genetik test yapılmalı? Metabolik hastalıklarda genetik test neden yapılır?

4 Telomere illustration. (Credit: Copyright The Nobel Committee for Physiology or Medicine 2009 / Illustration: Annika Roḧl) The Nobel Prize in Physiology or Medicine Ekim.2009 da bu yılın Fizyoloji/Tıp Nobel ödülleri açıklandı. Ödül, kromozomların telomer ve telomeraz ile nasıl korunduğunun bulunması alanında yaptıkları çalışmalarla üç araştırıcıya UCSF den Elizabeth Blackburn, Johns Hopkins den Carol Greider ve Harvard Medical School dan Jack Szostak - verildi. Elizabeth Blackburn, Jack Szostak ile kromozomların ucunda yer alan ve onların yıkılmasını engelleyen telomerleri, Carol Greider ile ise bu telomerleri sentezleyen telomeraz enzimini keşfetmişlerdi lu yıllarda yine Nobel ödüllü iki araştırıcı olan Hermann Muller (1946 Nobel ödülü sahibi) ve Barbara McClintock (1983 Nobel ödülü sahibi) insanda kromozomların uçlarının; kromozomları, birbirine yapışmaktan koruduğunu gözlemişlerdi.

5 Elizabeth H. Blackburn Avusturalya ve A.B.D vatandaşı olup 1948 de doğdu. Melbourne Üniversitesini bitirdikten sonra doktora için Cambridge Üniversitesine gitti. Yale de araştırmacı olarak çalışmaya başladı yılında Biyoloji ve Fizyoloji Profesörü olduğu California Üniversitesinde görevine devam ediyor lerden bu yana telomerler üzerinde çalışıyor.

6 Elizabeth H. Blackburn Avusturalya ve A.B.D vatandaşı olup 1948 de doğdu. Melbourne Üniversitesini bitirdikten sonra doktora için Cambridge Üniversitesine gitti. Yale de araştırmacı olarak çalışmaya başladı yılında Biyoloji ve Fizyoloji Profesörü olduğu California Üniversitesinde görevine devam ediyor lerden bu yana telomerler üzerinde çalışıyor. Carol W. Greider 1961 de San Diego da doğdu. Tüm eğitimini California Üniversitesinde aldı lerden 1997 ye kadar doktora danışmanı olan Blackburn ile çalıştı. Bu tarihte Johns Hopkins Universitesi Tıp Fakültesi Moleküler Biyoloji ve Genetik departmanında Profesör oldu. Greider 1984 te Blackburn un laboratuarında çalışırken telomeraz enzimini buldu.

7 Elizabeth H. Blackburn Avusturalya ve A.B.D vatandaşı olup 1948 de doğdu. Melbourne Üniversitesini bitirdikten sonra doktora için Cambridge Üniversitesine gitti. Yale de araştırmacı olarak çalışmaya başladı yılında Biyoloji ve Fizyoloji Profesörü olduğu California Üniversitesinde görevine devam ediyor lerden bu yana telomerler üzerinde çalışıyor. Carol W. Greider 1961 de San Diego da doğdu. Tüm eğitimini California Üniversitesinde aldı lerden 1997 ye kadar doktora danışmanı olan Blackburn ile çalıştı. Bu tarihte Johns Hopkins Universitesi Tıp Fakültesi Moleküler Biyoloji ve Genetik departmanında Profesör oldu. Greider 1984 te Blackburn un laboratuvarında çalışırken telomeraz enzimini buldu. Jack W. Szostak 1952 de San Diego da doğdu. McGill ve Cornell Üniversitelerinde eğitim aldıktan sonra 1979 yılına kadar Harvard Tıp Fakültesinde çalıştı. Halen Massachusetts General Hospital da genetik profesörü olarak çalışıyor lerin başından beri Blackburn ile telomer üzerinde ortak çalışmalar yürütüyor.

8 TELOMER 5-15 kbp TTAGGG G-dörtlü yapı Uç replikasyon sorunu Yaşlanma ile kısalma TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 3 AATCCCAATCCC 5


10 TELOMERAZ Revers transkriptaz htert (5p15.33) Telomeraz iş başında ise htr (TERC, 3q26) Kontrol edici lokuslar (3p21)


12 TÜBİTAK- SBAG BAP BAP BAP BAP Proje Adı Mide kanserinde Glipikan 5 ve Glipikan 6 nın ekspresyon seviyelerinin prognostik önemi Mide kanserinde genomik değişikliklerin telomeraz aktivitesi üzerine etkisi 190 BCR-ABL ve 210 BCR-ABL füzyon genlerinin hematopoetik hücrelerdeki proliferatif etkilerinin, telomeraz aktivitesi ve telomer boyu ile ilişkisi Başlama/ Bitiş Tarihi Reprodüktif yaşam süresi ve telomer boyu ilişkisinin analizi Kronik Myelositer Lösemi Etyopatogenezine Telomer Uzunluklarının Etkisi

13 Kalıtılabilir Genetik Risk Faktörleri Faktör V geni 1691G A (Leiden) mutasyonu Protrombin geni 20210G A mutasyonu Antitrombin eksikliği Protein C eksikliği Protein S eksikliği

14 Genetik Komponenti Olan Risk Faktörleri Hiperhomosisteinemi MTHFR geni 677C T ve 1298A C mutasyonları Faktör VIII, IX ve XI düzeyi yüksekliği Fibrinojen düzeyi yüksekliği

15 Genetik Risk Faktörleri Risk Faktörü Sıklık (%) (normal toplum) VTE deki sıklığı (%) Tekrarlayan VTE lerde sıklık (%) Trombotik risk (relatif) F5 Leiden (50-100) Protrombin Antitrombin Protein C Protein S Hiperhomosisteinemi Faktör VIII Faktör IX Faktör XI 10 19

16 Genetik Risk Faktörleri Risk Faktörü Sıklık (%) (normal toplum) VTE deki sıklığı (%) Tekrarlayan VTE lerde sıklık (%) Trombotik risk (relatif) F5 Leiden (50-100) Protrombin Antitrombin Protein C Protein S Hiperhomosisteinemi Faktör VIII Faktör IX Faktör XI 10 19

17 PAI 1 (Plasminogen activator inhibitor I) Glycoprotein III Endojen fibrinolitik aktivitenin başlıca inhibitörü Platelet membranı üzerinde fibrinojen reseptörü Wt:-675 GGGGG Mt:-675 GGGG Leu33Pro (C1565T) PL A1/A2 PL A2/A2 koagulasyon ve platelet agregasyonunda artma 4G/4G: MI için 2 kat artmış risk platelet agregasyonunda artma MTHFR Ala 222 Val Hiperhomosissteinemi

18 MTHFR geni mutasyonları 677C T mutasyonu 1298A C mutasyonu


20 Trombofili Genetik Risk Faktörleri Test Endikasyonları (önerilen) 50 yaşın altında venöz tromboz Tekrarlayan venöz tromboz Beklenmedik lokalizasyonlarda venöz tromboz (portal, mezenterik, serebral) Aile öyküsü olan venöz tromboz Gebe ya da oral kontraseptif kullanan kadınlarda venöz tromboz Genetics in Medicine, 2005, 7(6):

21 Trombofili Genetik Risk Faktörleri Test Endikasyonları (düşünülebilir) Mutasyonu taşıdığı bilinen kişilerin ailesindeki asemptomatik bireyler Mutasyonu taşıdığı bilinen kişilerin ailesindeki gebe olan, gebelik ya da oral kontraseptif kullanmayı düşünen bayanlar 50 yaşın üzerinde, malignensi ya da kalp içi cihaz öyküsü olmayan venöz tromboz Açıklanamayan gebelik kayıpları ya da komplikasyonları 50 yaşın altında, sigara içen, MI geçiren kadınlar Genetics in Medicine, 2005, 7(6):

22 Kanserde tedavi hedeflerini belirlemek için hangi genetik testler kullanılabilir?

23 İnaktif TK ATP Parsiyel aktivite P P P P Aktif TK P P substrat

24 Imatinib mesylat (STI571) 2-fenilaminopirimidin BCR-ABL tirozin kinaz inhibitörü Moleküler etyolojiyi hedef alan ilk tedavi İlk oral kullanılan sinyal iletimi inhibitörü

25 Imatinib

26 FIP1L1/PDGFRA- HES BCR/PDGFRA-aKML PDGFRB-CML,CMML,AML,CEL,MPD (T681I) KIT- Mast hücreli, (D816X) AML (CBFB mutasyonları taşıyanlarda sık ve dirençli) CSF1R/FMS- MDS, AML ABL2

27 İmatinib direnci Primer direnç Erken kronik fazda %2 hastada hematolojik yanıt alınamaz %8-13 hastada majör veya komplet sitogenetik yanıt alınamaz Sekonder direnç BCR-ABL füzyon geninde tek nükloeotid yer değişimi ile kinaz reaktivasyonu

28 c-bcr c-abl SH3 SH2 Tyr kinase NLS DNA BD actin BD cgcaacaagcccactgtctatggtgtgtcccccaactacgacaagtgggagatggaacgcacggac M244V L248V G250E Y253F atcaccatgaagcacaagctgggcgggggccagtacggggaggtgtacgagggcgtgtggaaga aatacagcctgacggtggccgtgaagaccttgaaggaggacaccatggaggtggaagagttcttga Q252H E255K aagaagctgcagtcatgaaagagatcaaacaccctaacctggtgcagctccttggggtctgcacccg F311L T315I F317L G321E ggagcccccgttctatatcatcactgagttcatgacctacgggaacctcctggactacctgagggagtg caaccggcaggaggtgaacgccgtggtgctgctgtacatggccactcagatctcgtcagccatggagt M351T E355G gcacctggagaagaaaacttcatccacagagatcttgctgcccgaaactgcctggtaggggagaacc F359V acttggtgaaggtagctgattttggcctgagcaggttgatgacaggggacacctacacagcccatgctg gagccaagttccccatcaaatggactgcacccgagagcctggcctacaacaagttctccatcaagtcc gacgtctgggcatttggagtattgctttgggaaattgctacctatggcatgtccccttacccgggaattgac S417Y ctgtcccaggtgtatgagctgctagagaaggactaccgcatggagcgcccagaaggctgcccagag E459K aaggtctatgaactcatgcgagcatgttggcagtggaatccctctgaccggccctcctttgctgaaatcc F486S accaagcctttgaaacaatgttccaggaatccagtatctcagacgaagtgga

29 KML hastalarında İmatinib (STI571) direncine yol açan ATP bağlanma bölgesi nokta mutasyonlarının kökeninin araştırılması Semin Gursoy, Gizem Aliş, Ajlan Tükün Olgu No Aminoasit değişimi Baz değişimi Direnç tipi Füzyon geni ABL geni 1 E255K 763G>A Sekonder Bialelik(G/A) 2 T315I 944C>T Sekonder Bialelik(C/T) 3 M351T 1052T>C Sekonder? 4 E277V 836A>T Sekonder Bialelik(A/T) 5 F311L 931C>T Primer Monoalelik (T) Bialelik(C/T) 6 I313V 937T>C Sekonder Monoalelik (C) Monoalelik (A) 7 F359Y 1075T>C Sekonder Bialelik (T/C) 8 V371I 1111T>C Sekonder Bialelik (T/C) 9 G390V 1168T>C Sekonder Bialelik (T/C)

30 Dasatinib FDA labelling information (2006) SPRYCEL (dasatinib) is indicated for the treatment of adults with chronic, accelerated, or myeloid or lymphoid blast phase chronic myeloid leukemia with resistance or intolerance to prior therapy including imatinib. Dasatinib, at nanomolar concentrations, inhibits the following kinases: BCR-ABL, SRC family (SRC, LCK, YES, FYN), c-kit, EPHA2, and PDGFRβ. Based on modeling studies, dasatinib is predicted to bind to multiple conformations of the ABL kinase

31 RTKlar: KIT PDGFR FGFR Kinaz SHP2 Ras Raf GDP GTP Gerb2 SOS STATs STATs P P She PI3-K MEKK p110 p85 Bad Akt mtor MAPK JNK STATs STATs P P IKK p21 AP-1 casp9 FKHR GSK3 Hücre büyümesi IκB NF-κB Transkripsiyon Hücre yaşaması

32 Tedavi AdenoCa EGFR mutasyon/amplifikasyonu HER2 mutasyonu KRAS mutasyonu BRAF mutasyonu PIC3CA mutasyonu FGFR4 mutasyonu HER4 mutasyonu????? gefitinib erlotinib HER2 inhibitörü MEK inhibitörü? Edinilmiş gefitinib/erlotinib direnci T790M MET amplifikasyonu D761Y? İrreversible MET inhibitörü? EGFR-TKI + EGFR-TKI

33 TK inhibitörü İmatinib AMN107 Dasatinib Lestaurtinib Semaxanib Erlotinib Lapatinib Herceptin (Trastuzumab) Hedef TK ABL,ABL2,KIT,PDGFRA,PDGFRB,CSF1R ABL,KIT,PDGFR ABL, SRC kinazlar, KIT D816X, PDGFR FLT3 FLT3, VEGFR2,KIT EGFR BRAF, KRAS, EBF,ERBB4 HER2

34 İnhibitör Hedef TK Hastalık Farnesyl transferaz inhibitörleri R115777,SCH66336 Staurosporin derivativleri UCN-O1,CGP41251,PKC412 PD098059,PD184352,UO126 Ras PKC,MAP kinaz MEK AML, yüksek risk MDS, imatinibe dirençli KML, MM Perifosine Akt MM Rapamycin mtor AML Temsirolimus mtor Mantle cell lenfoma Everolimus mtor Hodgkin/NonHodgkin, MM Wortmannin PI3-K

35 PCA3 ve günümüzdeki tanısal değeri nedir?

36 PCA3 Marker Materyal Duyarlık Özgüllük Negatif prediksiyon α-methylacyl coenzyme A racemase (AMACR) Doku Etkinlik İdrar CaP için erken belirteç AMACR/PSA İdrar 0.70 TMPRSS2- ETS PCA3/PSA Doku CaP için geç belirteç (tanı) Doku İdrar Gereksiz biyopsi tekrarını azaltır

37 Nörodejeneratik hastalıklarda ne zaman genetik test yapılmalı?

38 Nörodejeneratik Hastalıklar Huntington hastalığı Alzheimer hastalığı


40 Metabolik hastalıklarda genetik test neden yapılır?

41 Metabolik Hastalıklar Fenil Ketonüri Biyotinidaz defekti Galaktozemi Konjenital Adrenal Hiperplazi

42 Hipotalamus Nöronal uyarı Kolesterol StAR ACTH 0-22 desmolaz Pregnenolon 17α-OHlaz 17,20 liyaz 17-OH Pregnenolon DHEA 17 -HSD Androstenediol 3 -HSD 3 -HSD 3 -HSD Progesteron 17α-OHlaz 17-OH Progesteron 17 -HSD Androstenedion 5α-redüktaz Testosteron Dihidrotestosteron 21-OHlaz 21-OHlaz DOC 11-deoksikortizol Aromataz Aromataz 11 -OHlaz 11 -OHlaz Kortikositeron Kortizol Östron 17 -HSD Östradiol 18-OHlaz Glukokortikoidler Seks steroidleri 8-OH Kortikositeron 18-oksidaz RENİN Aldosteron Mineralokortikoidler

43 Hipotalamus Nöronal uyarı Kolesterol StAR ACTH 0-22 desmolaz Pregnenolon 17α-OHlaz 17,20 liyaz 17-OH Pregnenolon DHEA 17 -HSD Androstenediol 3 -HSD 3 -HSD 3 -HSD Progesteron 17α-OHlaz 17-OH Progesteron 17 -HSD Androstenedion 5α-redüktaz Testosteron Dihidrotestosteron 21-OHlaz 21-OHlaz DOC 11-deoksikortizol Aromataz Aromataz 11 -OHlaz 11 -OHlaz Kortikositeron Kortizol Östron 17 -HSD Östradiol 18-OHlaz Glukokortikoidler Seks steroidleri 8-OH Kortikositeron 18-oksidaz RENİN Aldosteron Mineralokortikoidler

44 Hipotalamus Nöronal uyarı Kolesterol StAR ACTH 0-22 desmolaz Pregnenolon 17α-OHlaz 17,20 liyaz 17-OH Pregnenolon DHEA 17 -HSD Androstenediol 3 -HSD 3 -HSD 3 -HSD Progesteron 17α-OHlaz 17-OH Progesteron 17 -HSD Androstenedion 5α-redüktaz Testosteron Dihidrotestosteron 21-OHlaz 21-OHlaz DOC 11-deoksikortizol Aromataz Aromataz 11 -OHlaz 11 -OHlaz Kortikositeron Kortizol Östron 17 -HSD Östradiol 18-OHlaz Glukokortikoidler Seks steroidleri 8-OH Kortikositeron 18-oksidaz RENİN Aldosteron Mineralokortikoidler

45 0 h 7 h 10 h Anneye DEX başlanması CVS SRY-PCR, CYP21 genotiplemesi 24 h Eğer fetus erkek yada normal dişi ise (olguların 7/8) DEX kesilir Eğer fetus çift doz mutasyon taşıyan dişi ise (olguların 1/8) Tedavi sürdürülür 40 h

46 Enzim aktivitesi Hastalık seyri Mutasyon %0 %1 Ağır (Klasik) Gen delesyonu, büyük Delesyon gen dönüşümü, 3. ekzon da 8bplik delesyon, E3 del ekzon 8bp 6 cluster mutasyonu, Cluster L307 E6insT, Q318X ve R356W A/C 659G (İntron 2 ayıklanma bölge R356W mutasyonu) (I2G) %1-11 I172N ~%20-50 P453S P3OL V281L NK IVS2 splice I172N BV Orta (Klasik olmayan) L307insT Q318X TK P30L V281L P453S

47 KAH de prenatal tanı Delesyon E3 del 8bp Cluster E6 L307insT Q318X R356W IVS2 splice I172N P453S P3OL V281L TK BV NK DEX


49 Tesekkür Ederim

Myeloproliferatif Hastalıklar ve Genetik

Myeloproliferatif Hastalıklar ve Genetik Myeloproliferatif Hastalıklar ve Genetik Ajlan Tükün 5 Ekim 2013 Myeloproliferatif Hastalıklar (MPDs) Klonal myeloid hastalık grubu Bir hematopoetik kök hücrede genetik değişiklik Periferik kanda WBC,


KHDAK da Güncel Hedef Tedaviler

KHDAK da Güncel Hedef Tedaviler KHDAK da Güncel Hedef Tedaviler Prof.Dr. Adnan Aydıner İstanbul Üniversitesi Onkoloji Enstitüsü İstanbul William, WN et al. Nature Reviews, 2009 a Güncel Hedef Tedaviler EGFR İnhibitörleri EGFR: transmembran


Yaygın Hastalıklarda Genetik Yaklaşım

Yaygın Hastalıklarda Genetik Yaklaşım GENETİKTE YENİ AÇILIMLAR Yaygın Hastalıklarda Genetik Yaklaşım Ajlan Tükün XVIII. DÜZEN LABORATUVARLARI KLİNİK BİYOKİMYA GÜNLERİ Ankara, 19.10.2008 Riskim nedir? Risk Sınıflaması Risk Düzeyi Düşük Girişim


Kanser Tedavisi: Günümüz

Kanser Tedavisi: Günümüz KANSER TEDAVİSİNDE MOLEKÜLER HEDEFLER Doç. Dr. Işık G. YULUĞ Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Kanser Tedavisi: Günümüz Geleneksel sitotoksik ilaçlar ve


* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde

* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde GENETİK HASTALIKLAR TANI MERKEZİ TEST LİSTESİ * Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde yapılmakta olup


Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı

Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Dersin Amacı KAH patogenezinin öğrenilmesi KAH lı hastaların klinik ve laboratuar bulgularının


Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı

Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Dersin Amacı KAH patogenezinin öğrenilmesi KAH lı hastaların klinik ve laboratuar bulgularının


SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD

SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD SİNYAL İLETİMİ ve KANSER Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD Reseptör Tirozin Kinaz (RTK)= Protein Tirozin Kinaz RTK lar hücre membranında yerleşim gösterir. İnsan


YENİ TESTLER. Düzen Laboratuvarlar Grubu

YENİ TESTLER. Düzen Laboratuvarlar Grubu YENİ TESTLER Düzen Laboratuvarlar Grubu METABOLİZMA İmmunoreaktif Tripsin (IRT) Total Galaktoz Lökosit Arylsülfataz A düzeyi Gama Aminobütirik Asit (GABA) Pristanik Asit-Fitanik Asit Immunoreaktif Tripsin


GÖRSEL VAKA TANITIMLARI: Adrenal Yetmezlik / Cushing -Sendromu. İ.Ü. İstanbul Tıp Fakültesi

GÖRSEL VAKA TANITIMLARI: Adrenal Yetmezlik / Cushing -Sendromu. İ.Ü. İstanbul Tıp Fakültesi GÖRSEL VAKA TANITIMLARI: Adrenal Yetmezlik / Cushing -Sendromu Prof. Dr. Feyza DARENDELİLER Prof. Dr. Firdevs BAŞ Çocuk Sağlığı ve Hastalıkları, Çocuk Endokrinolojisi İ.Ü. İstanbul Tıp Fakültesi Adrenal


Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı

Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Konjenital adrenal hiperplazi Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Adrenal bez Adrenal korteks fonksiyonları: Mineralokortikoidler sodyum geri alımı ve potasyum


Raporlamayla İlgili Düzenleme ve Tartışmalar. Beyhan DURAK ARAS Eskişehir Osmangazi Üniversitesi Tıp Fakültesi Tıbbi GeneCk AD

Raporlamayla İlgili Düzenleme ve Tartışmalar. Beyhan DURAK ARAS Eskişehir Osmangazi Üniversitesi Tıp Fakültesi Tıbbi GeneCk AD Raporlamayla İlgili Düzenleme ve Tartışmalar Beyhan DURAK ARAS Eskişehir Osmangazi Üniversitesi Tıp Fakültesi Tıbbi GeneCk AD Kromozom Adlandırma Sistemi 1960 yılında Danver toplantısı Kabul edilen sistem


En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı



POLİKİSTİK OVER SENDROMU VE GENİTAL KANSER İLİŞKİSİ POLİKİSTİK OVER SENDROMU VE GENİTAL KANSER İLİŞKİSİ Prof. Dr. Fırat ORTAÇ Ankara Üniversitesi Tıp Fakültesi Kadın Hastalıkları ve Doğum AD. Jinekolojik Onkoloji Departmanı Polikistik Over Sendromu(PKOS)


Metabolik Hastalıklarda Genetik

Metabolik Hastalıklarda Genetik Metabolik Hastalıklarda Genetik XXII. DÜZEN KLİNİK LABORATUVAR GÜNLERİ 14 Ekim 2012 Pazar, Ankara Ajlan Tükün Kalıtsal Metabolik Hastalıklar Gen G1 G2 mtg3 G4 Enzim Substrat A E1 E2 E3 E4 B C D E Sonuçlar


Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş

Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Sunum Akışı DNA replikasyonu Telomer Telomeraz Telomeraz eksikliğinde görülen hastalıklar


Ne Bekliyoruz? Kapsamı

Ne Bekliyoruz? Kapsamı HOŞGELDİNİZ XIX. Düzen Klinik Biyokimya Günleri Ne Bekliyoruz? Kapsamı Dr. Yahya Laleli Kayda ve Kanıta Dayalı Uygulama Fikre, kanaate, tahmine bağlı sağlık hizmetinden, delile kanıta dayalı sağlık hizmetine


Trombofili nin Tekrarlayan Gebelik Kayıplarındaki Rolü. Dr. Ayhan SUCAK

Trombofili nin Tekrarlayan Gebelik Kayıplarındaki Rolü. Dr. Ayhan SUCAK Trombofili nin Tekrarlayan Gebelik Kayıplarındaki Rolü Dr. Ayhan SUCAK www.tmftpkongre2012 Tekrarlayan gebelik kaybı TANIM European Society for Human Reproduction and Embryology 20 haftalık amenoreden


Kronik Miyelositer Lösemi

Kronik Miyelositer Lösemi Kronik Miyelositer Lösemi Tanı ve Tedavi Yaklaşımı Dr Adalet Meral Güneş Uludağ Üniv.TıpFak. Çocuk Hematoloji Onkoloji BD Görülme Sıklığı Yıllık insidans ;





Minimal Kalıntı Hastalık (MRD)

Minimal Kalıntı Hastalık (MRD) Minimal Kalıntı Hastalık (MRD) Doç. Dr. Müge GÖKÇE İstanbul Yeni Yüzyıl Üniversitesi Özel Gaziosmanpaşa Hastanesi Çocuk Hematoloji & Onkoloji Bilim Dalı Sitomorfolojik Remisyon Kemik iliğinde %5 in altında


Doç. Dr. Ahmet Gül MFTP Kongresi Ekim 2012, İstanbul

Doç. Dr. Ahmet Gül MFTP Kongresi Ekim 2012, İstanbul Doç. Dr. Ahmet Gül MFTP Kongresi 11-14 Ekim 2012, İstanbul Obstetrik Pratiğinde Trombofili Taramalarını Kime, Nasıl Yapalım? Trombofili Kalıtsal Edinsel Literatür ve Kadın-doğum birliklerinin önerileri


Ülkemizde Sık Karşılaştığımız Sağlık Sorunlarına Genetik Yaklaşım Multidisipliner Vizyon ile

Ülkemizde Sık Karşılaştığımız Sağlık Sorunlarına Genetik Yaklaşım Multidisipliner Vizyon ile Ülkemizde Sık Karşılaştığımız Sağlık Sorunlarına Genetik Yaklaşım Multidisipliner Vizyon ile Ajlan Tükün İnfertilite Kadın İnfertilitesi (%48) Anamnez Fizik muayene Hormon profili Transvajinal US Histerosalpingografi


Adölesanda Lösemi & İnfant Lösemi

Adölesanda Lösemi & İnfant Lösemi Adölesanda Lösemi & İnfant Lösemi Prof. Dr. Özcan Bör Eskişehir Osmangazi Üniversitesi TPHD OKULU 18 20 Kasım 2016 Ankara 1 Adölesanda Lösemi Dünya Sağlık Örgütü 10 19 yaşlarını Adölesan Dönemi olarak


Doç. Dr. Ahmet Gül TJOD İstanbul, Ocak 2013. Not: Bu sunum daha önce MFTP Kongresi 11-14 Ekim 2012, İstanbul da yapılmıştır

Doç. Dr. Ahmet Gül TJOD İstanbul, Ocak 2013. Not: Bu sunum daha önce MFTP Kongresi 11-14 Ekim 2012, İstanbul da yapılmıştır Doç. Dr. Ahmet Gül TJOD İstanbul, Ocak 2013 Not: Bu sunum daha önce MFTP Kongresi 11-14 Ekim 2012, İstanbul da yapılmıştır Trombofili etkenleri ve gebelik Kalıtsal trombofili Faktör V Leiden Prothrombin


GnRH LH Gonadotropinler FSH Leydig hücresi Sertoli hücresi. Transkripsiyon Transkripsiyon

GnRH LH Gonadotropinler FSH Leydig hücresi Sertoli hücresi. Transkripsiyon Transkripsiyon GONAD HORMONLAR Uyarı Hipotalamus GnRH LH Gonadotropinler FSH Leydig hücresi Sertoli hücresi camp Protein fosforilasyon camp Protein fosforilasyon Transkripsiyon Transkripsiyon Testosteron sentez ve salınım


Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması

Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik nın Karşılaştırılması Dr.M.Çisel Aydın, Doç.Dr.Sevgen Önder, Prof.Dr.Gaye Güler Tezel Hacettepe


MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı

MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Malign Melanom (MM) Moleküler Çağ öncesi MM Moleküler Çağ da MM Moleküler








Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/6) Tıbbi Laboratuar Akreditasyon No: Adresi :Cemal Sahir Sok. No:14 Mecidiyeköy 34387 İSTANBUL / TÜRKİYE Tel : 0 212 272 48 00 Faks : 0 212 272 48 04 E-Posta :


Hedefe yönelik tedaviler, yönlendirici rolümüz ve artan sorumluluğumuz. Serpil Dizbay Sak Ankara Üniversitesi Tıp Fakültesi Patoloji ABD

Hedefe yönelik tedaviler, yönlendirici rolümüz ve artan sorumluluğumuz. Serpil Dizbay Sak Ankara Üniversitesi Tıp Fakültesi Patoloji ABD Hedefe yönelik tedaviler, yönlendirici rolümüz ve artan sorumluluğumuz Serpil Dizbay Sak Ankara Üniversitesi Tıp Fakültesi Patoloji ABD 1. Akciğer kanseri tüm dünyada büyük bir sorun North America Central


Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β


KANSER NEDİR? ONKOGEN VE KANSER. Hücre döngüsü. Siklin-Siklin Kinaz 1/30/2012 HÜCRE DÖNGÜSÜ. Siklin Kinaz inhibitörleri BÜYÜME FAKTÖRLERİ

KANSER NEDİR? ONKOGEN VE KANSER. Hücre döngüsü. Siklin-Siklin Kinaz 1/30/2012 HÜCRE DÖNGÜSÜ. Siklin Kinaz inhibitörleri BÜYÜME FAKTÖRLERİ KANSER NEDİR? ONKOGEN VE KANSER Prof.Dr.Dildar Konukoğlu Bir hücre veya hücre grubunun kontrol dışı büyümesi ve çoğalması ve Bu hücrelerin bulundukları yerden ayrılarak farklı lokalizasyonlarda bu faaliyetlerini


Polikistik Over Sendromu ve Hiperandrojenemi

Polikistik Over Sendromu ve Hiperandrojenemi Polikistik Over Sendromu ve Hiperandrojenemi Ayırıcı Tanı Nasıl Yapılmalı? Prof. Dr. Kürşad Ünlühızarcı Erciyes Üniversitesi Tıp Fakültesi Endokrinoloji Bilim Dalı Kayseri PKOS Tanı Kriterleri NIH 1990



ÇOCUKLARDA TROMBOEMBOLİK HASTALIKLAR ÇOCUKLARDA TROMBOEMBOLİK HASTALIKLAR Dr. Ülker Koçak Gazi Üniversitesi Tıp Fakültesi, Çocuk Hematoloji Bilim Dalı HEMOSTAZ Prokoagülan Antifibrinolitik Antikoagülan Profibrinolitik ÇOCUKLARDA HEMOSTAZ



ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Dönem V Tıbbi Genetik Staj Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Baran GENCER Oğuz GÜÇLÜ Erkam KÖMÜRCÜ Staj Eğitim Sorumlusu: Genel



SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm


Dr. İhsan ESEN. Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği

Dr. İhsan ESEN. Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği Cinsel Farklılaşma Bozuklukları Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği Cinsel farklılaşma bozuklukları Geniş bir spektrum Farklı patofizyolojiler Nadir Yenidoğanda atipik



HÜCRE SĠNYAL OLAYLARI PROF. DR. FATMA SAVRAN OĞUZ HÜCRE SĠNYAL OLAYLARI PROF. DR. FATMA SAVRAN OĞUZ Çok hücreli organizmaların kompleks omurgalılara evrimi, hücreler birbirleriyle iletişim kuramasalardı mümkün olmazdı. Hücre-hücre Hücre-matriks etkileşimini


Meme Kanserinde Umut Vaat Eden Tedavi Alternatifleri

Meme Kanserinde Umut Vaat Eden Tedavi Alternatifleri Meme Kanserinde Umut Vaat Eden Tedavi Alternatifleri Banu Arun, M.D. Professor, Breast Medical Oncology; Co-Director Clinical Cancer Genetics III. Tıbbi Onkoloji Kongresi Antalya, 24-28 Mart, 2010 Meme


Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış. Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD

Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış. Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD Metafaz fazında hücrelere uygulanan sitogenetik analiz altın standarttır


HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı

HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı HALK SAĞLIĞI ANABĠLĠM DALI Ders adı : Endokrin çevre bozucular ve tarama programı Öğretim Üyesi : Prof. Dr. A. Emel ÖNAL Endokrin sistemin çalışmasını değiştiren, sağlıklı insanda veya çocuklarında sağlık


RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod






HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Hücrenin biyosentez mekanizmalarındaki hatalar toplamıdır Hücresel metabolizmanın yavaşlaması sonucu geri dönüşü olmayan olaylar toplamıdır Yaşlılık



MESANE TÜMÖRLERİNİN DOĞAL SEYRİ MESANE TÜMÖRLERİNİN DOĞAL SEYRİ ve MOLEKÜLER PROGNOSTİK FAKTÖRLER Prof. Dr. Levent Türkeri Üroloji Anabilim Dalı Marmara Üniversitesi Tıp Fakültesi Mesane Tümörü (Transizyonel Hücreli Karsinom) Yüzeyel



GENETİK HASTALIKLARDA TOPLUM TARAMALARI GENETİK HASTALIKLARDA TOPLUM TARAMALARI Bir genetik hastalığa neden olan veya bir genetik hastalığa yatkınlığa neden olan belirli genleri taşıyan kişilerin tespit edilmesi için yapılan toplum temelli çalışmalardır.


PI3K/AKT/mTOR Yolağı

PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı Phospha'dilinositol 3-kinaz/protein kinaz B/mammalian target of rapamycin (PI3K/Akt/mTOR) Normal hücresel fonksiyonların yerine ge'rilebilmesi için gerekli olan


İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Hücre iletişimi Tüm canlılar bulundukları çevreden sinyal alırlar ve yanıt verirler Bakteriler glukoz ve amino asit gibi besinlerin


Plasenta ilişkili gebelik komplikasyonları ve trombofili. Dr. Kadir Acar Gazi Üniversitesi Tıp Fakültesi Erişkin Hematoloji BD.

Plasenta ilişkili gebelik komplikasyonları ve trombofili. Dr. Kadir Acar Gazi Üniversitesi Tıp Fakültesi Erişkin Hematoloji BD. Plasenta ilişkili gebelik komplikasyonları ve trombofili Dr. Kadir Acar Gazi Üniversitesi Tıp Fakültesi Erişkin Hematoloji BD. Trombofili nedir? Trombofili tromboza eğilim oluşturan durumları tanımlamakta


KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI. Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD

KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI. Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD Kanser Önemli Bir Sağlık Sorunudur Kanser milyonları etkileyen,


Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Türkiye'de 2015-2016 İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Dilek Güldemir 1,Ayşe Başak Altaş 1,Fatma Filiz Arı 1,Zekiye Bakkaloğlu 1,Özlem Ünaldı 1,Fatma


Ökaryotik Kromozomlar

Ökaryotik Kromozomlar Telomer Ökaryotik Kromozomlar Mitoz metafazında kromozomlar mikroskop altında görülebilir Kromozomların uçlarında telomer denilen yapılar vardır, bu yapıların görevi kromozomu korumaktır Ortaya yakın bir


Meme Kanserinde Genetik Yaklaşım Yeni Açılımlar. Ajlan Tükün

Meme Kanserinde Genetik Yaklaşım Yeni Açılımlar. Ajlan Tükün Meme Kanserinde Genetik Yaklaşım Yeni Açılımlar Ajlan Tükün ONKOGEN vs. TüMöR SUPRESOR GEN Mutasyon Proliferasyon Yok Normal Onkogen Tümör Tek doz Spontan veya Germline Normal TSG İkinci allelde Tümör


Dr. İhsan ESEN. Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği

Dr. İhsan ESEN. Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği Cinsel Gelişim Bozuklukları Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği Cinsel gelişim bozuklukları Geniş bir spektrum Farklı patofizyolojiler Nadir Yenidoğanda atipik genitalya





Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını



KANSEROLOJİDE FARMAKOGENOMİ KANSEROLOJİDE FARMAKOGENOMİ Prof.Dr. Işık TUĞLULAR Ege Üniversitesi İlaç Geliştirme ve Farmakokinetik Araştırma - Uygulama Merkezi ( ARGEFAR ) Müdürü Farmakogenomik Kursu 24 Mart 2010 ANTALYA İLAÇ Klinik


Over Kanserinde Tedavi. Dr. M. Faruk Köse Etlik Zübeyde Hanım Kadın Hastalıkları Eğitim ve Araştırma Hastanesi

Over Kanserinde Tedavi. Dr. M. Faruk Köse Etlik Zübeyde Hanım Kadın Hastalıkları Eğitim ve Araştırma Hastanesi Over Kanserinde Tedavi Dr. M. Faruk Köse Etlik Zübeyde Hanım Kadın Hastalıkları Eğitim ve Araştırma Hastanesi Over Ca Tipleri Tip 1 Tip 2 Yavaş ilerleyen İyi belirlenmiş borderline prekürsör lezyonları


Telomerleri Hedefleyen Terapiler

Telomerleri Hedefleyen Terapiler Telomerleri Hedefleyen Terapiler Doç.Dr. Z.Günnur Dikmen Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı, XXVII. Ulusal Biyokimya Kongresi, Antalya, 3-6 Kasım 215 "how chromosomes are



BÖLÜM I HÜCRE FİZYOLOJİSİ... BÖLÜM I HÜCRE FİZYOLOJİSİ... 1 Bilinmesi Gereken Kavramlar... 1 Giriş... 2 Hücrelerin Fonksiyonel Özellikleri... 2 Hücrenin Kimyasal Yapısı... 2 Hücrenin Fiziksel Yapısı... 4 Hücrenin Bileşenleri... 4


Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı

Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Antibiyotik kullanımına bağlı ishal etkeni olan Clostridium difficile, nozokomiyal diyarenin en sık



ONKOGENLER VE TÜMÖR SUPRESSÖR GENLER ONKOGENLER VE TÜMÖR SUPRESSÖR GENLER Gen kanser ilişkisi 1911 1964 1970 1975 1981 1982 RSV izole edildi DNA virüsü ile transformasyon RSV de transformasyondan sorumlu dizilerin varlığı, ters transkriptaz



MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri






KRON K FAZ KRON K M YELO D LÖSEM DE K NC NES L T ROZ N K NAZ NH B TÖRÜ KULLANIMI TÜRK HEMATOLOJ DERNE 2012: 2 1 Dr. brahim C. Haznedaro lu Hacettepe Üniversitesi, Tıp Fakültesi, İç Hastalıkları Anabilim Dalı, Hematoloji Ünitesi, Ankara e-posta: Tel: 0312 305 15 42


Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar

Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar 1945 ANKARA ÜNİVERSİTESİ TIP FAKÜLTESİ ÇOCUK SAĞLIĞI VE HASTALIKLARI Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar Dr. Talia İleri Ankara Üniversitesi Tıp Fakültesi Pediatrik Hematoloji


GEBELİKTE SİFİLİZ. Dr. Mustafa Özgür AKÇA Bursa Yüksek İhtisas E.A.H. Enfeksiyon Hastalıkları Kliniği

GEBELİKTE SİFİLİZ. Dr. Mustafa Özgür AKÇA Bursa Yüksek İhtisas E.A.H. Enfeksiyon Hastalıkları Kliniği GEBELİKTE SİFİLİZ Dr. Mustafa Özgür AKÇA Bursa Yüksek İhtisas E.A.H. Enfeksiyon Hastalıkları Kliniği SİFİLİZ TANIM T.pallidum un neden olduğu sistemik bir hastalıktır Sınıflandırma: Edinilmiş (Genellikle


Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N

Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Hacettepe Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı Çocuk Nefrolojisi Bilim Dalı Ankara Giriş Sistinozis (OMIM 219800),






TROMBOFİLİ ve TEKRARLAYAN GEBELİK KAYBI. Dr. Mustafa ÇETİN Erciyes Hematoloji 2004 TROMBOFİLİ ve TEKRARLAYAN GEBELİK KAYBI Dr. Mustafa ÇETİN Erciyes Hematoloji 2004 1 Plasental dolaşım Yeterli ve sürekli bir plasental dolaşım başarıyla sonuçlanacak bir gebeliğin temel şartıdır. 2 Plasental


TKİ'ye Dirençli GİST Tedavisinin Zorlukları

TKİ'ye Dirençli GİST Tedavisinin Zorlukları Doktor Jean-Yves Blay, PhD: Merhaba ve programa hoşgeldiniz. Adım Jean-Yves Blay. Fransa'da Lyon'da çalışan bir Tıbbi Onkoloji Profesörüyüm. TKİ'ye Dirençli GİST Tedavisinin Zorlukları başlıklı bu programa



BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ Celal Bayar Üniversitesi Deri ve Zührevi Hastalıklar Anabilim Dalı-MANİSA Bazal Hücreli Kanser (BCC) 1827 - Arthur Jacob En sık rastlanan deri kanseri (%70-80) Açık


NOBEL PRIZE IN MEDICINE 2009. 2009 NOBEL TIP ÖDÜLLERİ 5.Ekim.2009 Pazartesi günü açıklandı

NOBEL PRIZE IN MEDICINE 2009. 2009 NOBEL TIP ÖDÜLLERİ 5.Ekim.2009 Pazartesi günü açıklandı NOBEL PRIZE IN MEDICINE 2009 Jack W. Szostak Professor of Genetics Harvard Medical School and MGH Carol W.Greider * Department of Molecular Biology Johns Hopkins University Medical School Ph.D. Supervisor





İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz AYDIN

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz AYDIN İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz AYDIN Tüm çok hücreli organizmaların kökeninde döllenmiş bir yumurta hücresi- zigot- vardır. Embriyonal gelişimin tüm ayrıntıları zigottaki DNA


Gebelik ve Trombositopeni

Gebelik ve Trombositopeni Gebelik ve Trombositopeni Prof.Dr. Sermet Sağol EÜTF Kadın Hast. ve Doğum AD Gebelik ve Trombositopeni Kemik iliğinde megakaryosit hücrelerinde üretilir. Günde 35.000-50.000 /ml üretilir. Yaşam süresi



SANKO ÜNİVERSİTESİ TIP FAKÜLTESİ EĞİTİM-ÖĞRETİM YILI DERS KURULU 103: HÜCRE VE DOKU SİSTEMLERİ GELİŞİMİ Ders Kurulu Başkanı: Prof. Dr. Şahin A. Sırmalı / Histoloji ve Embriyoloji Başkan Yardımcıları: Yrd. Doç. Dr. Elif Pala / Tıbbi Biyoloji Yrd. Doç. Dr. Ş. Esra Özkaplan / Kadın Hastalıkları ve Doğum Üyeler:



G E E X. AAT MUTASYON ANALiZ KiTi KATALOG NO: DA ÇALIŞMA BASAMAKLARI X G X G AAT MUTASY AALiZ KiTi KATALG : DA.01.100 Alfa 1 antitripsin (AAT) eksikliği, AAT proteinin katlanmasında bozukluk ile karakterize konformasyonel bir hastalıktır. AAT proteinini kodlayan SRPİA 1



BÖBREKÜSTÜ BEZİ FİZYOPATOLOJİSİ FİZYOPATOLOJİ (KLİNİK BİYOKİMYA) BÖBREKÜSTÜ BEZİ FİZYOPATOLOJİSİ Prof. Dr Arif ALTINTAŞ Prof. Dr. Ulvi Reha FİDANCI Ankara Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Yapı-Fonksiyon Böbreküstü


Flow Sitometrinin Malign Hematolojide Kullanımı. Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya

Flow Sitometrinin Malign Hematolojide Kullanımı. Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya Flow Sitometrinin Malign Hematolojide Kullanımı Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya Neyi ölçer? Hücre çapı, hacmi, yüzey alanı ve granülaritesini


KARSİNOGENEZ II. Doç. Dr. Yasemin Özlük. 1- Büyüme sinyallerinde kendi kendine yeterlilik

KARSİNOGENEZ II. Doç. Dr. Yasemin Özlük. 1- Büyüme sinyallerinde kendi kendine yeterlilik KARSİNOGENEZ II Doç. Dr. Yasemin Özlük 1- Büyüme sinyallerinde kendi kendine yeterlilik Kanser hücrelerinde, hücre büyümesini otonom olarak uyaran genlere onkogen denir. Protoonkogenlerin mutasyonu sonucu





Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu


Gebelikte Tromboz ve Tromboproflaksi. Dr Şahika Zeynep Akı Gazi Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı

Gebelikte Tromboz ve Tromboproflaksi. Dr Şahika Zeynep Akı Gazi Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Gebelikte Tromboz ve Tromboproflaksi Dr Şahika Zeynep Akı Gazi Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Gebelikte Ölüm Nedenleri Roos- Hesselink JW Heart 2009 Gebelikte Tromboembolik Olay Epidemiyoloji


CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı?

CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı? CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı? Maternal inf.tanısı Fetal inf.tanısı Yenidoğan inf.tanısı Bir test sonucunun doğru yorumlanabilmesi, testin tanı doğruluğunun bilinmesi


J Popul Ther Clin Pharmacol 8:e257-e260;2011



İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın Dominant / resesif tanımları Otozomal ve gonozomal kalıtım nedir? İnkomplet dominant/ kodominant ne ifade eder? Pedigri nedir, Neden yapılır?






GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL III. Kurul Hücresel Metabolizma ve Moleküler Tıp III. Kurul Süresi: 6 hafta III. Kurul Başlangıç Tarihi: 23 Aralık 2009 III. Kurul Bitiş ve Sınav Tarihi: 1 2 Şubat 2010 Ders Kurulu Sorumlusu: Yrd. Doç.






ÜNİTE 19 KANSER VE GENETİK ÜNİTE 19 KANSER VE GENETİK Prof. Dr. Gönül OĞUR 19.1. Normal Hücre-Kanser İlişkisi Vücut hücreleri, konsepsiyonu (spermin ovumu döllemesi) takiben oluşan zigotun ilk hücrelerinin defalarca tekrarlanan



BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER Plazmid ve Epizomlar Bakterilerin kendi kromozomlarının yanı sıra, kromozom dışı bazı genetik parçacıklar bulunmaktadır Bakteri kromozomundan daha küçük yapıda



HORMONLARIN ETKİ MEKANİZMALARI HORMONLARIN ETKİ MEKANİZMALARI Prof. Dr. Orhan Turan KAYNAKÇA: 1.Stephen J. McPhee, Gary D.Hammer eds. Pathophysiology of Disease. 6th ed. Mc Graw Hill; 2010. 2.Damjanov I. Pathophisiology. 1st ed. Saunders


Çocukluk Çağında Akut Myeloid Lösemi

Çocukluk Çağında Akut Myeloid Lösemi 1945 ANKARA ÜNİVERSİTESİ TIP FAKÜLTESİ ÇOCUK SAĞLIĞI VE HASTALIKLARI Çocukluk Çağında Akut Myeloid Lösemi Dr. Mehmet ERTEM Ankara Üniversitesi Tıp Fakültesi Pediatrik Hematoloji Bilim Dalı ÇOCUKLUK ÇAĞI


Antalya İlindeki Beta-Talasemi Gen Mutasyonları, Tek Merkez Sonuçları

Antalya İlindeki Beta-Talasemi Gen Mutasyonları, Tek Merkez Sonuçları Antalya İlindeki Beta-Talasemi Gen Mutasyonları, Tek Merkez Sonuçları Ayşegül UĞUR KURTOĞLU, Volkan KARAKUŞ, Özgür ERKAL, Erdal KURTOĞLU Antalya Eğitim ve Araştırma Hastanesi Biyokimya Kliniği,Genetik


JAK STAT Sinyal Yolağı

JAK STAT Sinyal Yolağı The Janus kinase/signal transducers and ac4vators of transcrip4on (JAK/STAT) JAK/STAT sinyal yolu sitokinler tara>ndan ak4fleş4rilir. ü Hücre farklılaşması ü Hücre çoğalması ü Hücre göçü ü Apoptoz gibi


FİBRİNOJEN DEPO HASTALIĞI. Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara

FİBRİNOJEN DEPO HASTALIĞI. Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara FİBRİNOJEN DEPO HASTALIĞI Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara H. K., 5 yaşında, Kız çocuğu Şikayet: Karında şişlik Özgeçmiş: 8 aylıkken karında
