Trombofiliye Genetik Yaklaşım

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Trombofiliye Genetik Yaklaşım"

Transkript

1

2 Trombofiliye Genetik Yaklaşım Ajlan Tükün DÜZEN LABORATUVARLAR GRUBU XIX. KLİNİK BİYOKİMYA GÜNLERİ Ankara,

3 Trombofili sonuçlarının değerlendirilmesi Kanserde tedavi hedeflerini belirlemek için hangi genetik testler kullanılabilir? PCA3 ve günümüzdeki tanısal değeri nedir? Nörodejeneratik hastalıklarda ne zaman genetik test yapılmalı? Metabolik hastalıklarda genetik test neden yapılır?

4 Telomere illustration. (Credit: Copyright The Nobel Committee for Physiology or Medicine 2009 / Illustration: Annika Roḧl) The Nobel Prize in Physiology or Medicine Ekim.2009 da bu yılın Fizyoloji/Tıp Nobel ödülleri açıklandı. Ödül, kromozomların telomer ve telomeraz ile nasıl korunduğunun bulunması alanında yaptıkları çalışmalarla üç araştırıcıya UCSF den Elizabeth Blackburn, Johns Hopkins den Carol Greider ve Harvard Medical School dan Jack Szostak - verildi. Elizabeth Blackburn, Jack Szostak ile kromozomların ucunda yer alan ve onların yıkılmasını engelleyen telomerleri, Carol Greider ile ise bu telomerleri sentezleyen telomeraz enzimini keşfetmişlerdi lu yıllarda yine Nobel ödüllü iki araştırıcı olan Hermann Muller (1946 Nobel ödülü sahibi) ve Barbara McClintock (1983 Nobel ödülü sahibi) insanda kromozomların uçlarının; kromozomları, birbirine yapışmaktan koruduğunu gözlemişlerdi.

5 Elizabeth H. Blackburn Avusturalya ve A.B.D vatandaşı olup 1948 de doğdu. Melbourne Üniversitesini bitirdikten sonra doktora için Cambridge Üniversitesine gitti. Yale de araştırmacı olarak çalışmaya başladı yılında Biyoloji ve Fizyoloji Profesörü olduğu California Üniversitesinde görevine devam ediyor lerden bu yana telomerler üzerinde çalışıyor.

6 Elizabeth H. Blackburn Avusturalya ve A.B.D vatandaşı olup 1948 de doğdu. Melbourne Üniversitesini bitirdikten sonra doktora için Cambridge Üniversitesine gitti. Yale de araştırmacı olarak çalışmaya başladı yılında Biyoloji ve Fizyoloji Profesörü olduğu California Üniversitesinde görevine devam ediyor lerden bu yana telomerler üzerinde çalışıyor. Carol W. Greider 1961 de San Diego da doğdu. Tüm eğitimini California Üniversitesinde aldı lerden 1997 ye kadar doktora danışmanı olan Blackburn ile çalıştı. Bu tarihte Johns Hopkins Universitesi Tıp Fakültesi Moleküler Biyoloji ve Genetik departmanında Profesör oldu. Greider 1984 te Blackburn un laboratuarında çalışırken telomeraz enzimini buldu.

7 Elizabeth H. Blackburn Avusturalya ve A.B.D vatandaşı olup 1948 de doğdu. Melbourne Üniversitesini bitirdikten sonra doktora için Cambridge Üniversitesine gitti. Yale de araştırmacı olarak çalışmaya başladı yılında Biyoloji ve Fizyoloji Profesörü olduğu California Üniversitesinde görevine devam ediyor lerden bu yana telomerler üzerinde çalışıyor. Carol W. Greider 1961 de San Diego da doğdu. Tüm eğitimini California Üniversitesinde aldı lerden 1997 ye kadar doktora danışmanı olan Blackburn ile çalıştı. Bu tarihte Johns Hopkins Universitesi Tıp Fakültesi Moleküler Biyoloji ve Genetik departmanında Profesör oldu. Greider 1984 te Blackburn un laboratuvarında çalışırken telomeraz enzimini buldu. Jack W. Szostak 1952 de San Diego da doğdu. McGill ve Cornell Üniversitelerinde eğitim aldıktan sonra 1979 yılına kadar Harvard Tıp Fakültesinde çalıştı. Halen Massachusetts General Hospital da genetik profesörü olarak çalışıyor lerin başından beri Blackburn ile telomer üzerinde ortak çalışmalar yürütüyor.

8 TELOMER 5-15 kbp TTAGGG G-dörtlü yapı Uç replikasyon sorunu Yaşlanma ile kısalma TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG 3 AATCCCAATCCC 5

9

10 TELOMERAZ Revers transkriptaz htert (5p15.33) Telomeraz iş başında ise htr (TERC, 3q26) Kontrol edici lokuslar (3p21)

11

12 TÜBİTAK- SBAG BAP BAP BAP BAP Proje Adı Mide kanserinde Glipikan 5 ve Glipikan 6 nın ekspresyon seviyelerinin prognostik önemi Mide kanserinde genomik değişikliklerin telomeraz aktivitesi üzerine etkisi 190 BCR-ABL ve 210 BCR-ABL füzyon genlerinin hematopoetik hücrelerdeki proliferatif etkilerinin, telomeraz aktivitesi ve telomer boyu ile ilişkisi Başlama/ Bitiş Tarihi Reprodüktif yaşam süresi ve telomer boyu ilişkisinin analizi Kronik Myelositer Lösemi Etyopatogenezine Telomer Uzunluklarının Etkisi

13 Kalıtılabilir Genetik Risk Faktörleri Faktör V geni 1691G A (Leiden) mutasyonu Protrombin geni 20210G A mutasyonu Antitrombin eksikliği Protein C eksikliği Protein S eksikliği

14 Genetik Komponenti Olan Risk Faktörleri Hiperhomosisteinemi MTHFR geni 677C T ve 1298A C mutasyonları Faktör VIII, IX ve XI düzeyi yüksekliği Fibrinojen düzeyi yüksekliği

15 Genetik Risk Faktörleri Risk Faktörü Sıklık (%) (normal toplum) VTE deki sıklığı (%) Tekrarlayan VTE lerde sıklık (%) Trombotik risk (relatif) F5 Leiden (50-100) Protrombin Antitrombin Protein C Protein S Hiperhomosisteinemi Faktör VIII Faktör IX Faktör XI 10 19

16 Genetik Risk Faktörleri Risk Faktörü Sıklık (%) (normal toplum) VTE deki sıklığı (%) Tekrarlayan VTE lerde sıklık (%) Trombotik risk (relatif) F5 Leiden (50-100) Protrombin Antitrombin Protein C Protein S Hiperhomosisteinemi Faktör VIII Faktör IX Faktör XI 10 19

17 PAI 1 (Plasminogen activator inhibitor I) Glycoprotein III Endojen fibrinolitik aktivitenin başlıca inhibitörü Platelet membranı üzerinde fibrinojen reseptörü Wt:-675 GGGGG Mt:-675 GGGG Leu33Pro (C1565T) PL A1/A2 PL A2/A2 koagulasyon ve platelet agregasyonunda artma 4G/4G: MI için 2 kat artmış risk platelet agregasyonunda artma MTHFR Ala 222 Val Hiperhomosissteinemi

18 MTHFR geni mutasyonları 677C T mutasyonu 1298A C mutasyonu

19

20 Trombofili Genetik Risk Faktörleri Test Endikasyonları (önerilen) 50 yaşın altında venöz tromboz Tekrarlayan venöz tromboz Beklenmedik lokalizasyonlarda venöz tromboz (portal, mezenterik, serebral) Aile öyküsü olan venöz tromboz Gebe ya da oral kontraseptif kullanan kadınlarda venöz tromboz Genetics in Medicine, 2005, 7(6):

21 Trombofili Genetik Risk Faktörleri Test Endikasyonları (düşünülebilir) Mutasyonu taşıdığı bilinen kişilerin ailesindeki asemptomatik bireyler Mutasyonu taşıdığı bilinen kişilerin ailesindeki gebe olan, gebelik ya da oral kontraseptif kullanmayı düşünen bayanlar 50 yaşın üzerinde, malignensi ya da kalp içi cihaz öyküsü olmayan venöz tromboz Açıklanamayan gebelik kayıpları ya da komplikasyonları 50 yaşın altında, sigara içen, MI geçiren kadınlar Genetics in Medicine, 2005, 7(6):

22 Kanserde tedavi hedeflerini belirlemek için hangi genetik testler kullanılabilir?

23 İnaktif TK ATP Parsiyel aktivite P P P P Aktif TK P P substrat

24 Imatinib mesylat (STI571) 2-fenilaminopirimidin BCR-ABL tirozin kinaz inhibitörü Moleküler etyolojiyi hedef alan ilk tedavi İlk oral kullanılan sinyal iletimi inhibitörü

25 Imatinib

26 FIP1L1/PDGFRA- HES BCR/PDGFRA-aKML PDGFRB-CML,CMML,AML,CEL,MPD (T681I) KIT- Mast hücreli, (D816X) AML (CBFB mutasyonları taşıyanlarda sık ve dirençli) CSF1R/FMS- MDS, AML ABL2

27 İmatinib direnci Primer direnç Erken kronik fazda %2 hastada hematolojik yanıt alınamaz %8-13 hastada majör veya komplet sitogenetik yanıt alınamaz Sekonder direnç BCR-ABL füzyon geninde tek nükloeotid yer değişimi ile kinaz reaktivasyonu

28 c-bcr c-abl SH3 SH2 Tyr kinase NLS DNA BD actin BD cgcaacaagcccactgtctatggtgtgtcccccaactacgacaagtgggagatggaacgcacggac M244V L248V G250E Y253F atcaccatgaagcacaagctgggcgggggccagtacggggaggtgtacgagggcgtgtggaaga aatacagcctgacggtggccgtgaagaccttgaaggaggacaccatggaggtggaagagttcttga Q252H E255K aagaagctgcagtcatgaaagagatcaaacaccctaacctggtgcagctccttggggtctgcacccg F311L T315I F317L G321E ggagcccccgttctatatcatcactgagttcatgacctacgggaacctcctggactacctgagggagtg caaccggcaggaggtgaacgccgtggtgctgctgtacatggccactcagatctcgtcagccatggagt M351T E355G gcacctggagaagaaaacttcatccacagagatcttgctgcccgaaactgcctggtaggggagaacc F359V acttggtgaaggtagctgattttggcctgagcaggttgatgacaggggacacctacacagcccatgctg gagccaagttccccatcaaatggactgcacccgagagcctggcctacaacaagttctccatcaagtcc gacgtctgggcatttggagtattgctttgggaaattgctacctatggcatgtccccttacccgggaattgac S417Y ctgtcccaggtgtatgagctgctagagaaggactaccgcatggagcgcccagaaggctgcccagag E459K aaggtctatgaactcatgcgagcatgttggcagtggaatccctctgaccggccctcctttgctgaaatcc F486S accaagcctttgaaacaatgttccaggaatccagtatctcagacgaagtgga

29 KML hastalarında İmatinib (STI571) direncine yol açan ATP bağlanma bölgesi nokta mutasyonlarının kökeninin araştırılması Semin Gursoy, Gizem Aliş, Ajlan Tükün Olgu No Aminoasit değişimi Baz değişimi Direnç tipi Füzyon geni ABL geni 1 E255K 763G>A Sekonder Bialelik(G/A) 2 T315I 944C>T Sekonder Bialelik(C/T) 3 M351T 1052T>C Sekonder? 4 E277V 836A>T Sekonder Bialelik(A/T) 5 F311L 931C>T Primer Monoalelik (T) Bialelik(C/T) 6 I313V 937T>C Sekonder Monoalelik (C) Monoalelik (A) 7 F359Y 1075T>C Sekonder Bialelik (T/C) 8 V371I 1111T>C Sekonder Bialelik (T/C) 9 G390V 1168T>C Sekonder Bialelik (T/C)

30 Dasatinib FDA labelling information (2006) SPRYCEL (dasatinib) is indicated for the treatment of adults with chronic, accelerated, or myeloid or lymphoid blast phase chronic myeloid leukemia with resistance or intolerance to prior therapy including imatinib. Dasatinib, at nanomolar concentrations, inhibits the following kinases: BCR-ABL, SRC family (SRC, LCK, YES, FYN), c-kit, EPHA2, and PDGFRβ. Based on modeling studies, dasatinib is predicted to bind to multiple conformations of the ABL kinase

31 RTKlar: KIT PDGFR FGFR Kinaz SHP2 Ras Raf GDP GTP Gerb2 SOS STATs STATs P P She PI3-K MEKK p110 p85 Bad Akt mtor MAPK JNK STATs STATs P P IKK p21 AP-1 casp9 FKHR GSK3 Hücre büyümesi IκB NF-κB Transkripsiyon Hücre yaşaması

32 Tedavi AdenoCa EGFR mutasyon/amplifikasyonu HER2 mutasyonu KRAS mutasyonu BRAF mutasyonu PIC3CA mutasyonu FGFR4 mutasyonu HER4 mutasyonu????? gefitinib erlotinib HER2 inhibitörü MEK inhibitörü? Edinilmiş gefitinib/erlotinib direnci T790M MET amplifikasyonu D761Y? İrreversible MET inhibitörü? EGFR-TKI + EGFR-TKI

33 TK inhibitörü İmatinib AMN107 Dasatinib Lestaurtinib Semaxanib Erlotinib Lapatinib Herceptin (Trastuzumab) Hedef TK ABL,ABL2,KIT,PDGFRA,PDGFRB,CSF1R ABL,KIT,PDGFR ABL, SRC kinazlar, KIT D816X, PDGFR FLT3 FLT3, VEGFR2,KIT EGFR BRAF, KRAS, EBF,ERBB4 HER2

34 İnhibitör Hedef TK Hastalık Farnesyl transferaz inhibitörleri R115777,SCH66336 Staurosporin derivativleri UCN-O1,CGP41251,PKC412 PD098059,PD184352,UO126 Ras PKC,MAP kinaz MEK AML, yüksek risk MDS, imatinibe dirençli KML, MM Perifosine Akt MM Rapamycin mtor AML Temsirolimus mtor Mantle cell lenfoma Everolimus mtor Hodgkin/NonHodgkin, MM Wortmannin PI3-K

35 PCA3 ve günümüzdeki tanısal değeri nedir?

36 PCA3 Marker Materyal Duyarlık Özgüllük Negatif prediksiyon α-methylacyl coenzyme A racemase (AMACR) Doku Etkinlik İdrar CaP için erken belirteç AMACR/PSA İdrar 0.70 TMPRSS2- ETS PCA3/PSA Doku CaP için geç belirteç (tanı) Doku İdrar Gereksiz biyopsi tekrarını azaltır

37 Nörodejeneratik hastalıklarda ne zaman genetik test yapılmalı?

38 Nörodejeneratik Hastalıklar Huntington hastalığı Alzheimer hastalığı

39

40 Metabolik hastalıklarda genetik test neden yapılır?

41 Metabolik Hastalıklar Fenil Ketonüri Biyotinidaz defekti Galaktozemi Konjenital Adrenal Hiperplazi

42 Hipotalamus Nöronal uyarı Kolesterol StAR ACTH 0-22 desmolaz Pregnenolon 17α-OHlaz 17,20 liyaz 17-OH Pregnenolon DHEA 17 -HSD Androstenediol 3 -HSD 3 -HSD 3 -HSD Progesteron 17α-OHlaz 17-OH Progesteron 17 -HSD Androstenedion 5α-redüktaz Testosteron Dihidrotestosteron 21-OHlaz 21-OHlaz DOC 11-deoksikortizol Aromataz Aromataz 11 -OHlaz 11 -OHlaz Kortikositeron Kortizol Östron 17 -HSD Östradiol 18-OHlaz Glukokortikoidler Seks steroidleri 8-OH Kortikositeron 18-oksidaz RENİN Aldosteron Mineralokortikoidler

43 Hipotalamus Nöronal uyarı Kolesterol StAR ACTH 0-22 desmolaz Pregnenolon 17α-OHlaz 17,20 liyaz 17-OH Pregnenolon DHEA 17 -HSD Androstenediol 3 -HSD 3 -HSD 3 -HSD Progesteron 17α-OHlaz 17-OH Progesteron 17 -HSD Androstenedion 5α-redüktaz Testosteron Dihidrotestosteron 21-OHlaz 21-OHlaz DOC 11-deoksikortizol Aromataz Aromataz 11 -OHlaz 11 -OHlaz Kortikositeron Kortizol Östron 17 -HSD Östradiol 18-OHlaz Glukokortikoidler Seks steroidleri 8-OH Kortikositeron 18-oksidaz RENİN Aldosteron Mineralokortikoidler

44 Hipotalamus Nöronal uyarı Kolesterol StAR ACTH 0-22 desmolaz Pregnenolon 17α-OHlaz 17,20 liyaz 17-OH Pregnenolon DHEA 17 -HSD Androstenediol 3 -HSD 3 -HSD 3 -HSD Progesteron 17α-OHlaz 17-OH Progesteron 17 -HSD Androstenedion 5α-redüktaz Testosteron Dihidrotestosteron 21-OHlaz 21-OHlaz DOC 11-deoksikortizol Aromataz Aromataz 11 -OHlaz 11 -OHlaz Kortikositeron Kortizol Östron 17 -HSD Östradiol 18-OHlaz Glukokortikoidler Seks steroidleri 8-OH Kortikositeron 18-oksidaz RENİN Aldosteron Mineralokortikoidler

45 0 h 7 h 10 h Anneye DEX başlanması CVS SRY-PCR, CYP21 genotiplemesi 24 h Eğer fetus erkek yada normal dişi ise (olguların 7/8) DEX kesilir Eğer fetus çift doz mutasyon taşıyan dişi ise (olguların 1/8) Tedavi sürdürülür 40 h

46 Enzim aktivitesi Hastalık seyri Mutasyon %0 %1 Ağır (Klasik) Gen delesyonu, büyük Delesyon gen dönüşümü, 3. ekzon da 8bplik delesyon, E3 del ekzon 8bp 6 cluster mutasyonu, Cluster L307 E6insT, Q318X ve R356W A/C 659G (İntron 2 ayıklanma bölge R356W mutasyonu) (I2G) %1-11 I172N ~%20-50 P453S P3OL V281L NK IVS2 splice I172N BV Orta (Klasik olmayan) L307insT Q318X TK P30L V281L P453S

47 KAH de prenatal tanı Delesyon E3 del 8bp Cluster E6 L307insT Q318X R356W IVS2 splice I172N P453S P3OL V281L TK BV NK DEX

48

49 Tesekkür Ederim

Myeloproliferatif Hastalıklar ve Genetik

Myeloproliferatif Hastalıklar ve Genetik Myeloproliferatif Hastalıklar ve Genetik Ajlan Tükün 5 Ekim 2013 Myeloproliferatif Hastalıklar (MPDs) Klonal myeloid hastalık grubu Bir hematopoetik kök hücrede genetik değişiklik Periferik kanda WBC,

Detaylı

KHDAK da Güncel Hedef Tedaviler

KHDAK da Güncel Hedef Tedaviler KHDAK da Güncel Hedef Tedaviler Prof.Dr. Adnan Aydıner İstanbul Üniversitesi Onkoloji Enstitüsü İstanbul William, WN et al. Nature Reviews, 2009 a Güncel Hedef Tedaviler EGFR İnhibitörleri EGFR: transmembran

Detaylı

Yaygın Hastalıklarda Genetik Yaklaşım

Yaygın Hastalıklarda Genetik Yaklaşım GENETİKTE YENİ AÇILIMLAR Yaygın Hastalıklarda Genetik Yaklaşım Ajlan Tükün XVIII. DÜZEN LABORATUVARLARI KLİNİK BİYOKİMYA GÜNLERİ Ankara, 19.10.2008 Riskim nedir? Risk Sınıflaması Risk Düzeyi Düşük Girişim

Detaylı

Kanser Tedavisi: Günümüz

Kanser Tedavisi: Günümüz KANSER TEDAVİSİNDE MOLEKÜLER HEDEFLER Doç. Dr. Işık G. YULUĞ Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü yulug@fen.bilkent.edu.tr Kanser Tedavisi: Günümüz Geleneksel sitotoksik ilaçlar ve

Detaylı

* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde

* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde GENETİK HASTALIKLAR TANI MERKEZİ TEST LİSTESİ * Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde yapılmakta olup

Detaylı

Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı

Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Dersin Amacı KAH patogenezinin öğrenilmesi KAH lı hastaların klinik ve laboratuar bulgularının

Detaylı

Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı

Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Konjenital adrenal hiperplazi (KAH) Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Dersin Amacı KAH patogenezinin öğrenilmesi KAH lı hastaların klinik ve laboratuar bulgularının

Detaylı

SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD

SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD SİNYAL İLETİMİ ve KANSER Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD Reseptör Tirozin Kinaz (RTK)= Protein Tirozin Kinaz RTK lar hücre membranında yerleşim gösterir. İnsan

Detaylı

YENİ TESTLER. Düzen Laboratuvarlar Grubu

YENİ TESTLER. Düzen Laboratuvarlar Grubu YENİ TESTLER Düzen Laboratuvarlar Grubu METABOLİZMA İmmunoreaktif Tripsin (IRT) Total Galaktoz Lökosit Arylsülfataz A düzeyi Gama Aminobütirik Asit (GABA) Pristanik Asit-Fitanik Asit Immunoreaktif Tripsin

Detaylı

Metabolik Hastalıklarda Genetik

Metabolik Hastalıklarda Genetik Metabolik Hastalıklarda Genetik XXII. DÜZEN KLİNİK LABORATUVAR GÜNLERİ 14 Ekim 2012 Pazar, Ankara Ajlan Tükün Kalıtsal Metabolik Hastalıklar Gen G1 G2 mtg3 G4 Enzim Substrat A E1 E2 E3 E4 B C D E Sonuçlar

Detaylı

Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı

Konjenital adrenal hiperplazi. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Konjenital adrenal hiperplazi Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Adrenal bez Adrenal korteks fonksiyonları: Mineralokortikoidler sodyum geri alımı ve potasyum

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

POLİKİSTİK OVER SENDROMU VE GENİTAL KANSER İLİŞKİSİ

POLİKİSTİK OVER SENDROMU VE GENİTAL KANSER İLİŞKİSİ POLİKİSTİK OVER SENDROMU VE GENİTAL KANSER İLİŞKİSİ Prof. Dr. Fırat ORTAÇ Ankara Üniversitesi Tıp Fakültesi Kadın Hastalıkları ve Doğum AD. Jinekolojik Onkoloji Departmanı Polikistik Over Sendromu(PKOS)

Detaylı

Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş

Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Sunum Akışı DNA replikasyonu Telomer Telomeraz Telomeraz eksikliğinde görülen hastalıklar

Detaylı

Ne Bekliyoruz? Kapsamı

Ne Bekliyoruz? Kapsamı HOŞGELDİNİZ XIX. Düzen Klinik Biyokimya Günleri Ne Bekliyoruz? Kapsamı Dr. Yahya Laleli Kayda ve Kanıta Dayalı Uygulama Fikre, kanaate, tahmine bağlı sağlık hizmetinden, delile kanıta dayalı sağlık hizmetine

Detaylı

Trombofili nin Tekrarlayan Gebelik Kayıplarındaki Rolü. Dr. Ayhan SUCAK

Trombofili nin Tekrarlayan Gebelik Kayıplarındaki Rolü. Dr. Ayhan SUCAK Trombofili nin Tekrarlayan Gebelik Kayıplarındaki Rolü Dr. Ayhan SUCAK www.tmftpkongre2012 Tekrarlayan gebelik kaybı TANIM European Society for Human Reproduction and Embryology 20 haftalık amenoreden

Detaylı

SEREBRAL TROMBOZLU ÇOCUKLARDA KLİNİK BULGULAR VE TROMBOTİK RİSK FAKTÖRLERİ

SEREBRAL TROMBOZLU ÇOCUKLARDA KLİNİK BULGULAR VE TROMBOTİK RİSK FAKTÖRLERİ SEREBRAL TROMBOZLU ÇOCUKLARDA KLİNİK BULGULAR VE TROMBOTİK RİSK FAKTÖRLERİ Ankara Çocuk Sağlığı Hastalıkları Hemotoloji Onkoloji Eğitim Araştırma Hastanesi 2 Amaç Klinik bulguların özellikleri Kalıtsal

Detaylı

Ülkemizde Sık Karşılaştığımız Sağlık Sorunlarına Genetik Yaklaşım Multidisipliner Vizyon ile

Ülkemizde Sık Karşılaştığımız Sağlık Sorunlarına Genetik Yaklaşım Multidisipliner Vizyon ile Ülkemizde Sık Karşılaştığımız Sağlık Sorunlarına Genetik Yaklaşım Multidisipliner Vizyon ile Ajlan Tükün İnfertilite Kadın İnfertilitesi (%48) Anamnez Fizik muayene Hormon profili Transvajinal US Histerosalpingografi

Detaylı

Doç. Dr. Ahmet Gül TJOD İstanbul, Ocak 2013. Not: Bu sunum daha önce MFTP Kongresi 11-14 Ekim 2012, İstanbul da yapılmıştır

Doç. Dr. Ahmet Gül TJOD İstanbul, Ocak 2013. Not: Bu sunum daha önce MFTP Kongresi 11-14 Ekim 2012, İstanbul da yapılmıştır Doç. Dr. Ahmet Gül TJOD İstanbul, Ocak 2013 Not: Bu sunum daha önce MFTP Kongresi 11-14 Ekim 2012, İstanbul da yapılmıştır Trombofili etkenleri ve gebelik Kalıtsal trombofili Faktör V Leiden Prothrombin

Detaylı

GnRH LH Gonadotropinler FSH Leydig hücresi Sertoli hücresi. Transkripsiyon Transkripsiyon

GnRH LH Gonadotropinler FSH Leydig hücresi Sertoli hücresi. Transkripsiyon Transkripsiyon GONAD HORMONLAR Uyarı Hipotalamus GnRH LH Gonadotropinler FSH Leydig hücresi Sertoli hücresi camp Protein fosforilasyon camp Protein fosforilasyon Transkripsiyon Transkripsiyon Testosteron sentez ve salınım

Detaylı

Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması

Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik nın Karşılaştırılması Dr.M.Çisel Aydın, Doç.Dr.Sevgen Önder, Prof.Dr.Gaye Güler Tezel Hacettepe

Detaylı

MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı

MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Malign Melanom (MM) Moleküler Çağ öncesi MM Moleküler Çağ da MM Moleküler

Detaylı

EDİNSEL KANAMA BOZUKLUKLARI VE KALITSAL TROMBOFİLİ TANI VE TEDAVİ KILAVUZU I. BÖLÜM TROMBOTİK TROMBOSİTOPENİK PURPURA TANI VE TEDAVİ KILAVUZU...

EDİNSEL KANAMA BOZUKLUKLARI VE KALITSAL TROMBOFİLİ TANI VE TEDAVİ KILAVUZU I. BÖLÜM TROMBOTİK TROMBOSİTOPENİK PURPURA TANI VE TEDAVİ KILAVUZU... EDİNSEL KANAMA BOZUKLUKLARI VE KALITSAL TROMBOFİLİ TANI VE TEDAVİ KILAVUZU İÇİNDEKİLER Önsöz...iii Ulusal Tanı ve Tedavi Kılavuzu Çalışma Grupları... iv Kısaltmalar... vii Tablolar Listesi... xv Şekiller

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/6) Tıbbi Laboratuar Akreditasyon No: Adresi :Cemal Sahir Sok. No:14 Mecidiyeköy 34387 İSTANBUL / TÜRKİYE Tel : 0 212 272 48 00 Faks : 0 212 272 48 04 E-Posta : kalite@duzen.com.tr

Detaylı

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β

Detaylı

Polikistik Over Sendromu ve Hiperandrojenemi

Polikistik Over Sendromu ve Hiperandrojenemi Polikistik Over Sendromu ve Hiperandrojenemi Ayırıcı Tanı Nasıl Yapılmalı? Prof. Dr. Kürşad Ünlühızarcı Erciyes Üniversitesi Tıp Fakültesi Endokrinoloji Bilim Dalı Kayseri PKOS Tanı Kriterleri NIH 1990

Detaylı

ÇOCUKLARDA TROMBOEMBOLİK HASTALIKLAR

ÇOCUKLARDA TROMBOEMBOLİK HASTALIKLAR ÇOCUKLARDA TROMBOEMBOLİK HASTALIKLAR Dr. Ülker Koçak Gazi Üniversitesi Tıp Fakültesi, Çocuk Hematoloji Bilim Dalı HEMOSTAZ Prokoagülan Antifibrinolitik Antikoagülan Profibrinolitik ÇOCUKLARDA HEMOSTAZ

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Dönem V Tıbbi Genetik Staj Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Baran GENCER Oğuz GÜÇLÜ Erkam KÖMÜRCÜ Staj Eğitim Sorumlusu: Genel

Detaylı

Hedefe yönelik tedaviler, yönlendirici rolümüz ve artan sorumluluğumuz. Serpil Dizbay Sak Ankara Üniversitesi Tıp Fakültesi Patoloji ABD

Hedefe yönelik tedaviler, yönlendirici rolümüz ve artan sorumluluğumuz. Serpil Dizbay Sak Ankara Üniversitesi Tıp Fakültesi Patoloji ABD Hedefe yönelik tedaviler, yönlendirici rolümüz ve artan sorumluluğumuz Serpil Dizbay Sak Ankara Üniversitesi Tıp Fakültesi Patoloji ABD 1. Akciğer kanseri tüm dünyada büyük bir sorun North America Central

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış. Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD

Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış. Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD Sıvı bazlı (Hematopatoloji) FISH uygulaması değerlendirmelerine temel bakış Prof Dr Melek Ergin Çukurova Üni Tıp Fak Patoloji AD Metafaz fazında hücrelere uygulanan sitogenetik analiz altın standarttır

Detaylı

Meme Kanserinde Genetik Yaklaşım Yeni Açılımlar. Ajlan Tükün

Meme Kanserinde Genetik Yaklaşım Yeni Açılımlar. Ajlan Tükün Meme Kanserinde Genetik Yaklaşım Yeni Açılımlar Ajlan Tükün ONKOGEN vs. TüMöR SUPRESOR GEN Mutasyon Proliferasyon Yok Normal Onkogen Tümör Tek doz Spontan veya Germline Normal TSG İkinci allelde Tümör

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı

HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı HALK SAĞLIĞI ANABĠLĠM DALI Ders adı : Endokrin çevre bozucular ve tarama programı Öğretim Üyesi : Prof. Dr. A. Emel ÖNAL Endokrin sistemin çalışmasını değiştiren, sağlıklı insanda veya çocuklarında sağlık

Detaylı

HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin

HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Hücrenin biyosentez mekanizmalarındaki hatalar toplamıdır Hücresel metabolizmanın yavaşlaması sonucu geri dönüşü olmayan olaylar toplamıdır Yaşlılık

Detaylı

Meme Kanserinde Umut Vaat Eden Tedavi Alternatifleri

Meme Kanserinde Umut Vaat Eden Tedavi Alternatifleri Meme Kanserinde Umut Vaat Eden Tedavi Alternatifleri Banu Arun, M.D. Professor, Breast Medical Oncology; Co-Director Clinical Cancer Genetics III. Tıbbi Onkoloji Kongresi Antalya, 24-28 Mart, 2010 Meme

Detaylı

MESANE TÜMÖRLERİNİN DOĞAL SEYRİ

MESANE TÜMÖRLERİNİN DOĞAL SEYRİ MESANE TÜMÖRLERİNİN DOĞAL SEYRİ ve MOLEKÜLER PROGNOSTİK FAKTÖRLER Prof. Dr. Levent Türkeri Üroloji Anabilim Dalı Marmara Üniversitesi Tıp Fakültesi Mesane Tümörü (Transizyonel Hücreli Karsinom) Yüzeyel

Detaylı

PI3K/AKT/mTOR Yolağı

PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı Phospha'dilinositol 3-kinaz/protein kinaz B/mammalian target of rapamycin (PI3K/Akt/mTOR) Normal hücresel fonksiyonların yerine ge'rilebilmesi için gerekli olan

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Hücre iletişimi Tüm canlılar bulundukları çevreden sinyal alırlar ve yanıt verirler Bakteriler glukoz ve amino asit gibi besinlerin

Detaylı

KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI. Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD

KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI. Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD KANSER TANI VE TEDAVİSİNDE BİREYSEL TIP UYGULAMALARI Doç. Dr. Yasemin BASKIN Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Temel Onkoloji AD Kanser Önemli Bir Sağlık Sorunudur Kanser milyonları etkileyen,

Detaylı

Ökaryotik Kromozomlar

Ökaryotik Kromozomlar Telomer Ökaryotik Kromozomlar Mitoz metafazında kromozomlar mikroskop altında görülebilir Kromozomların uçlarında telomer denilen yapılar vardır, bu yapıların görevi kromozomu korumaktır Ortaya yakın bir

Detaylı

Dr. İhsan ESEN. Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği

Dr. İhsan ESEN. Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği Cinsel Gelişim Bozuklukları Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Kliniği Cinsel gelişim bozuklukları Geniş bir spektrum Farklı patofizyolojiler Nadir Yenidoğanda atipik genitalya

Detaylı

MEME KANSERİNDE YÜKSEK RİSK TANIMI

MEME KANSERİNDE YÜKSEK RİSK TANIMI MEME KANSERİNDE YÜKSEK RİSK TANIMI DOÇ DR GÜL DAĞLAR ANEAH GENEL CERRAHİ MEME ENDOKRİN CERRAHİSİ KLİNİĞİ Prof Dr Lale Atahan Risk nedir? Absolut risk Belli bir sürede belli bir hastalığın bir olguda gelişme

Detaylı

KANSEROLOJİDE FARMAKOGENOMİ

KANSEROLOJİDE FARMAKOGENOMİ KANSEROLOJİDE FARMAKOGENOMİ Prof.Dr. Işık TUĞLULAR Ege Üniversitesi İlaç Geliştirme ve Farmakokinetik Araştırma - Uygulama Merkezi ( ARGEFAR ) Müdürü Farmakogenomik Kursu 24 Mart 2010 ANTALYA İLAÇ Klinik

Detaylı

Telomerleri Hedefleyen Terapiler

Telomerleri Hedefleyen Terapiler Telomerleri Hedefleyen Terapiler Doç.Dr. Z.Günnur Dikmen Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı, XXVII. Ulusal Biyokimya Kongresi, Antalya, 3-6 Kasım 215 "how chromosomes are

Detaylı

Over Kanserinde Tedavi. Dr. M. Faruk Köse Etlik Zübeyde Hanım Kadın Hastalıkları Eğitim ve Araştırma Hastanesi

Over Kanserinde Tedavi. Dr. M. Faruk Köse Etlik Zübeyde Hanım Kadın Hastalıkları Eğitim ve Araştırma Hastanesi Over Kanserinde Tedavi Dr. M. Faruk Köse Etlik Zübeyde Hanım Kadın Hastalıkları Eğitim ve Araştırma Hastanesi Over Ca Tipleri Tip 1 Tip 2 Yavaş ilerleyen İyi belirlenmiş borderline prekürsör lezyonları

Detaylı

BÖLÜM I HÜCRE FİZYOLOJİSİ...

BÖLÜM I HÜCRE FİZYOLOJİSİ... BÖLÜM I HÜCRE FİZYOLOJİSİ... 1 Bilinmesi Gereken Kavramlar... 1 Giriş... 2 Hücrelerin Fonksiyonel Özellikleri... 2 Hücrenin Kimyasal Yapısı... 2 Hücrenin Fiziksel Yapısı... 4 Hücrenin Bileşenleri... 4

Detaylı

ONKOGENLER VE TÜMÖR SUPRESSÖR GENLER

ONKOGENLER VE TÜMÖR SUPRESSÖR GENLER ONKOGENLER VE TÜMÖR SUPRESSÖR GENLER Gen kanser ilişkisi 1911 1964 1970 1975 1981 1982 RSV izole edildi DNA virüsü ile transformasyon RSV de transformasyondan sorumlu dizilerin varlığı, ters transkriptaz

Detaylı

Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar

Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar 1945 ANKARA ÜNİVERSİTESİ TIP FAKÜLTESİ ÇOCUK SAĞLIĞI VE HASTALIKLARI Kronik Myeloid Lösemi ve Diğer Myeloproliferatif Hastalıklar Dr. Talia İleri Ankara Üniversitesi Tıp Fakültesi Pediatrik Hematoloji

Detaylı

GENETİK HASTALIKLAR TANI MERKEZİ TEST REHBERİ

GENETİK HASTALIKLAR TANI MERKEZİ TEST REHBERİ GENETİK HASTALIKLAR TANI MERKEZİ TEST REHBERİ GENETİK HASTALIKLAR TANI MERKEZİ TEST REHBERİ Bu kitapçık Yeditepe Üniversitesi Hastanesi Genetik Hastalıklar Tanı Merkezi işleyişinin düzenlenmesi, kalite

Detaylı

KRON K FAZ KRON K M YELO D LÖSEM DE K NC NES L T ROZ N K NAZ NH B TÖRÜ KULLANIMI

KRON K FAZ KRON K M YELO D LÖSEM DE K NC NES L T ROZ N K NAZ NH B TÖRÜ KULLANIMI TÜRK HEMATOLOJ DERNE 2012: 2 1 Dr. brahim C. Haznedaro lu Hacettepe Üniversitesi, Tıp Fakültesi, İç Hastalıkları Anabilim Dalı, Hematoloji Ünitesi, Ankara e-posta: haznedar@yahoo.com Tel: 0312 305 15 42

Detaylı

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri

Detaylı

BÖBREKÜSTÜ BEZİ FİZYOPATOLOJİSİ

BÖBREKÜSTÜ BEZİ FİZYOPATOLOJİSİ FİZYOPATOLOJİ (KLİNİK BİYOKİMYA) BÖBREKÜSTÜ BEZİ FİZYOPATOLOJİSİ Prof. Dr Arif ALTINTAŞ Prof. Dr. Ulvi Reha FİDANCI Ankara Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Yapı-Fonksiyon Böbreküstü

Detaylı

VIII. FAKTÖR XII EKSİKLİĞİ TANI VE TEDAVİ KILAVUZU BÖLÜM ULUSAL TANI VE TEDAVİ KILAVUZU 2013

VIII. FAKTÖR XII EKSİKLİĞİ TANI VE TEDAVİ KILAVUZU BÖLÜM ULUSAL TANI VE TEDAVİ KILAVUZU 2013 ULUSAL TANI VE TEDAVİ KILAVUZU 2013 FAKTÖR XII EKSİKLİĞİ VIII. BÖLÜM TANI VE TEDAVİ KILAVUZU KALITSAL FAKTÖR XII EKSİKLİĞİ TANI VE TEDAVİ KILAVUZU FAKTÖR XII EKSİKLİĞİ Dr. M. Cem Ar ve THD Hemofili Bilimsel

Detaylı

TROMBOFİLİ ve TEKRARLAYAN GEBELİK KAYBI. Dr. Mustafa ÇETİN Erciyes Hematoloji 2004

TROMBOFİLİ ve TEKRARLAYAN GEBELİK KAYBI. Dr. Mustafa ÇETİN Erciyes Hematoloji 2004 TROMBOFİLİ ve TEKRARLAYAN GEBELİK KAYBI Dr. Mustafa ÇETİN Erciyes Hematoloji 2004 1 Plasental dolaşım Yeterli ve sürekli bir plasental dolaşım başarıyla sonuçlanacak bir gebeliğin temel şartıdır. 2 Plasental

Detaylı

TKİ'ye Dirençli GİST Tedavisinin Zorlukları

TKİ'ye Dirençli GİST Tedavisinin Zorlukları Doktor Jean-Yves Blay, PhD: Merhaba ve programa hoşgeldiniz. Adım Jean-Yves Blay. Fransa'da Lyon'da çalışan bir Tıbbi Onkoloji Profesörüyüm. TKİ'ye Dirençli GİST Tedavisinin Zorlukları başlıklı bu programa

Detaylı

BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ

BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ Celal Bayar Üniversitesi Deri ve Zührevi Hastalıklar Anabilim Dalı-MANİSA Bazal Hücreli Kanser (BCC) 1827 - Arthur Jacob En sık rastlanan deri kanseri (%70-80) Açık

Detaylı

IX. BÖLÜM KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011

IX. BÖLÜM KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011 ULUSAL TEDAVİ KILAVUZU 2011 KRONİK HASTALIK ANEMİSİ IX. BÖLÜM TANI VE TEDAVİ KILAVUZU KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU GİRİŞ VE TANIM Kronik

Detaylı

NOBEL PRIZE IN MEDICINE 2009. 2009 NOBEL TIP ÖDÜLLERİ 5.Ekim.2009 Pazartesi günü açıklandı

NOBEL PRIZE IN MEDICINE 2009. 2009 NOBEL TIP ÖDÜLLERİ 5.Ekim.2009 Pazartesi günü açıklandı NOBEL PRIZE IN MEDICINE 2009 Jack W. Szostak Professor of Genetics Harvard Medical School and MGH Carol W.Greider * Department of Molecular Biology Johns Hopkins University Medical School Ph.D. Supervisor

Detaylı

Gebelik ve Trombositopeni

Gebelik ve Trombositopeni Gebelik ve Trombositopeni Prof.Dr. Sermet Sağol EÜTF Kadın Hast. ve Doğum AD Gebelik ve Trombositopeni Kemik iliğinde megakaryosit hücrelerinde üretilir. Günde 35.000-50.000 /ml üretilir. Yaşam süresi

Detaylı

Flow Sitometrinin Malign Hematolojide Kullanımı. Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya

Flow Sitometrinin Malign Hematolojide Kullanımı. Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya Flow Sitometrinin Malign Hematolojide Kullanımı Dr. Alphan Küpesiz Akdeniz Üniversitesi Tıp Fakültesi Çocuk Hematoloji/Onkoloji BD Antalya Neyi ölçer? Hücre çapı, hacmi, yüzey alanı ve granülaritesini

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

GEBELİKTE SİFİLİZ. Dr. Mustafa Özgür AKÇA Bursa Yüksek İhtisas E.A.H. Enfeksiyon Hastalıkları Kliniği

GEBELİKTE SİFİLİZ. Dr. Mustafa Özgür AKÇA Bursa Yüksek İhtisas E.A.H. Enfeksiyon Hastalıkları Kliniği GEBELİKTE SİFİLİZ Dr. Mustafa Özgür AKÇA Bursa Yüksek İhtisas E.A.H. Enfeksiyon Hastalıkları Kliniği SİFİLİZ TANIM T.pallidum un neden olduğu sistemik bir hastalıktır Sınıflandırma: Edinilmiş (Genellikle

Detaylı

Gebelikte Tromboz ve Tromboproflaksi. Dr Şahika Zeynep Akı Gazi Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı

Gebelikte Tromboz ve Tromboproflaksi. Dr Şahika Zeynep Akı Gazi Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Gebelikte Tromboz ve Tromboproflaksi Dr Şahika Zeynep Akı Gazi Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Gebelikte Ölüm Nedenleri Roos- Hesselink JW Heart 2009 Gebelikte Tromboembolik Olay Epidemiyoloji

Detaylı

YÜKSEK İHTİSAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I 2015-2016 MOLEKÜLDEN HÜCREYE DERS KURULU- I. (12 Ekim - 20 Kasım 2015) ZORUNLU DERSLER

YÜKSEK İHTİSAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I 2015-2016 MOLEKÜLDEN HÜCREYE DERS KURULU- I. (12 Ekim - 20 Kasım 2015) ZORUNLU DERSLER YÜKSEK İHTİSAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I 2015-2016 MOLEKÜLDEN HÜCREYE DERS KURULU- I (12 Ekim - 20 Kasım 2015) DERSLER TEORİK PRATİK TOPLAM Tıbbi Biyoloji ve Genetik 30 4X2 34 Tıbbi Biyokimya

Detaylı

J Popul Ther Clin Pharmacol 8:e257-e260;2011

J Popul Ther Clin Pharmacol 8:e257-e260;2011 SİTOMEGALOVİRUS (CMV) Prof. Dr. Seyyâl ROTA Gazi Ü.Tıp Fakültesi LOW SYSTEMIC GANCICLOVIR EXPOSURE AND PREEMPTIVE TREATMENT FAILURE OF CYTOMEGALOVIRUS REACTIVATION IN A TRANSPLANTED CHILD J Popul Ther

Detaylı

CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı?

CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı? CMV lab.tanı Hangi test, ne zaman, laboratuvar sonucunun klinik anlamı? Maternal inf.tanısı Fetal inf.tanısı Yenidoğan inf.tanısı Bir test sonucunun doğru yorumlanabilmesi, testin tanı doğruluğunun bilinmesi

Detaylı

ÜNİTE 19 KANSER VE GENETİK

ÜNİTE 19 KANSER VE GENETİK ÜNİTE 19 KANSER VE GENETİK Prof. Dr. Gönül OĞUR 19.1. Normal Hücre-Kanser İlişkisi Vücut hücreleri, konsepsiyonu (spermin ovumu döllemesi) takiben oluşan zigotun ilk hücrelerinin defalarca tekrarlanan

Detaylı

ANTİFUNGAL DİRENÇ MEKANİZMALARI ve DUYARLILIK TESTLERİ. Nilgün ÇERİKÇİOĞLU 2014 MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD

ANTİFUNGAL DİRENÇ MEKANİZMALARI ve DUYARLILIK TESTLERİ. Nilgün ÇERİKÇİOĞLU 2014 MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD ANTİFUNGAL DİRENÇ MEKANİZMALARI ve DUYARLILIK TESTLERİ Nilgün ÇERİKÇİOĞLU 2014 MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD İn Vitro Duyarlılık Test Sonuçları Duyarlı (MİK) Doza bağımlı duyarlı

Detaylı

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL III. Kurul Hücresel Metabolizma ve Moleküler Tıp III. Kurul Süresi: 6 hafta III. Kurul Başlangıç Tarihi: 23 Aralık 2009 III. Kurul Bitiş ve Sınav Tarihi: 1 2 Şubat 2010 Ders Kurulu Sorumlusu: Yrd. Doç.

Detaylı

Çocukluk Çağında Akut Myeloid Lösemi

Çocukluk Çağında Akut Myeloid Lösemi 1945 ANKARA ÜNİVERSİTESİ TIP FAKÜLTESİ ÇOCUK SAĞLIĞI VE HASTALIKLARI Çocukluk Çağında Akut Myeloid Lösemi Dr. Mehmet ERTEM Ankara Üniversitesi Tıp Fakültesi Pediatrik Hematoloji Bilim Dalı ÇOCUKLUK ÇAĞI

Detaylı

Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi

Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi Trombofili Pıhtılaşmaya eğilim Akkiz veya edinsel Psikiyatri dahil tıbbın tüm dallarını kapsar!!! Koagulasyon-Kanama

Detaylı

Telomer Nedir ve Neden Kısalır?

Telomer Nedir ve Neden Kısalır? Telomer Nedir ve Neden Kısalır? Telomer uzunluğunun hücrelerin yaşını gösterdiği fikrini teorik olarak ilk defa 1960 lı yıllarda Leonard Hayflick adlı araştırmacı ileri sürmüş ve biyolojik yaşlanmayla

Detaylı

2009 yılında Amerika Birleşik Devletlerinde yaklaşık 22.475 kişide KML vardır.

2009 yılında Amerika Birleşik Devletlerinde yaklaşık 22.475 kişide KML vardır. 1 GİRİŞ Hematoloji Uzmanlık Derneği, the Leukemia & Lymphoma Society(LLS)'e 18.10.2010 tarihinde çevirisi yapılan Kronik Miyelojenöz Lösemi (KML) kitapçığına yeniden basım izni verdiği için minnetle teşekkür

Detaylı

FİBRİNOJEN DEPO HASTALIĞI. Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara

FİBRİNOJEN DEPO HASTALIĞI. Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara FİBRİNOJEN DEPO HASTALIĞI Yrd.Doç.Dr. Güldal YILMAZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Patoloji Anabilim Dalı Ankara H. K., 5 yaşında, Kız çocuğu Şikayet: Karında şişlik Özgeçmiş: 8 aylıkken karında

Detaylı

TROMBOFİLİ TARAMASI KİME NE ZAMAN NASIL. Doç. Dr. Özgür Yeniel

TROMBOFİLİ TARAMASI KİME NE ZAMAN NASIL. Doç. Dr. Özgür Yeniel TROMBOFİLİ TARAMASI KİME NE ZAMAN NASIL Doç. Dr. Özgür Yeniel Hemostaz Kan kaybının önlenmesi Kan ve dokular pıhtılaşma sistemini etkikleyen çok sayıda faktör içermektedir Prokoagülan < Antikoagülan Sınırlandırılmış

Detaylı

Hücreler Arası Sinyal İletim Mekanizmaları

Hücreler Arası Sinyal İletim Mekanizmaları Hücreler Arası Sinyal İletim Mekanizmaları Prof. Dr. Selma YILMAZER Tibbi Biyoloji Anabilim Dalı Hücrelerarası iletişim(sinyalleşme) Sinyal molekülleri: Protein,küçük peptid,amino asid, nukleotid,steroid,vit

Detaylı

Herediter Meme Over Kanseri Sendromunda. Prof.Dr.Mehmet Ali Ergün Gazi Üniversitesi Tı p Fakültesi T ı bbi Genetik Anabilim Dalı

Herediter Meme Over Kanseri Sendromunda. Prof.Dr.Mehmet Ali Ergün Gazi Üniversitesi Tı p Fakültesi T ı bbi Genetik Anabilim Dalı Herediter Meme Over Kanseri Sendromunda Prof.Dr.Mehmet Ali Ergün Gazi Üniversitesi Tı p Fakültesi T ı bbi Genetik Anabilim Dalı Herediter Meme Over Kanseri (HBOC) %5-10 arası kalıtsaldır Erken başlama

Detaylı

PAPİLLER TİROİD KARSİNOMLU OLGULARIMIZDA BRAF(V600E) GEN MUTASYON ANALİZİ. Klinik ve patolojik özellikler

PAPİLLER TİROİD KARSİNOMLU OLGULARIMIZDA BRAF(V600E) GEN MUTASYON ANALİZİ. Klinik ve patolojik özellikler PAPİLLER TİROİD KARSİNOMLU OLGULARIMIZDA BRAF(V600E) GEN MUTASYON ANALİZİ Klinik ve patolojik özellikler Neslihan KURTULMUŞ,, Mete DÜREN, D Serdar GİRAY, G Ümit İNCE, Önder PEKER, Özlem AYDIN, M.Cengiz

Detaylı

RENCİ ve TEDAVİSİ. Doç. Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi

RENCİ ve TEDAVİSİ. Doç. Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi İMATİNİB B DİRENCD RENCİ ve TEDAVİSİ Doç. Dr. Fevzi Altuntaş Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Öğretim Üyesi KML Güncel Tanı ve Tedavi 10 Mayıs 2008, Konya SUNU AKIŞI BCR-ABL / SRC

Detaylı

PRENATAL TARAMA TESTLERİ. Dr.Murat Öktem Düzen Laboratuvarlar Grubu

PRENATAL TARAMA TESTLERİ. Dr.Murat Öktem Düzen Laboratuvarlar Grubu PRENATAL TARAMA TESTLERİ Dr.Murat Öktem Düzen Laboratuvarlar Grubu Riskler Down sendromu 1/800 Spina bifida 1/1800 Anensefali 1/1800 Trizomi 18 1/3800 Omfalosel 1/6000 Gastroşizis 1/10000 Türkiye de her

Detaylı

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ Seçici gen ifadesi embriyonun gelişmesini sağlayan 4 temel işlevi denetler: 1. Hücre çoğalması 2. Hücre farklılaşması 3. Hücre etkileşimleri 4. Hücre hareketi HÜCRE

Detaylı

İlaç Direnci ve Farmakogenomik. Dr.Ebru Dündar Yenilmez Tıbbi Biyokimya AD Aralık 2012

İlaç Direnci ve Farmakogenomik. Dr.Ebru Dündar Yenilmez Tıbbi Biyokimya AD Aralık 2012 İlaç Direnci ve Farmakogenomik Dr.Ebru Dündar Yenilmez Tıbbi Biyokimya AD Aralık 2012 Sunu Akışı Tarihçe Tanımlar İlaç metabolize eden enzim farmakogenomiği İlaç taşıyıcı farmakogenomiği İlaç hedef farmakogenomiği

Detaylı

Beyin Yaşlanması ve Yeni Hücre Oluşumu

Beyin Yaşlanması ve Yeni Hücre Oluşumu Beyin Yaşlanması ve Yeni Hücre Oluşumu AYÇA ARSLAN ERGÜL - ASO Sağlık Odaklı Üniversite Sanayi İşbirliği Çalıştayı 2 Nisan 2015, Perşembe Sunum İçeriği Araştırma Alanı Araştırma- Proje- İşbirliği Deneyimi

Detaylı

KOLOREKTAL KARSİNOMA VE ÖNCÜ LEZYONLARINDA MİKROSATELLİT İNSTABİLİTESİNİN İMMÜNHİSTOKİMYASAL OLARAK DEĞERLENDİRİLMESİ

KOLOREKTAL KARSİNOMA VE ÖNCÜ LEZYONLARINDA MİKROSATELLİT İNSTABİLİTESİNİN İMMÜNHİSTOKİMYASAL OLARAK DEĞERLENDİRİLMESİ KOLOREKTAL KARSİNOMA VE ÖNCÜ LEZYONLARINDA MİKROSATELLİT İNSTABİLİTESİNİN İMMÜNHİSTOKİMYASAL OLARAK DEĞERLENDİRİLMESİ Seher YÜKSEL 1, Berna SAVAŞ 2, Elçin KADAN 3, Arzu ENSARİ 2, Nazmiye KURŞUN 4 1 Gümüşhane

Detaylı

BİRLEŞİK PRENATAL TARAMA TESTLERİ. Dr. Alev Öktem Düzen Laboratuvarlar Grubu

BİRLEŞİK PRENATAL TARAMA TESTLERİ. Dr. Alev Öktem Düzen Laboratuvarlar Grubu BİRLEŞİK PRENATAL TARAMA TESTLERİ Dr. Alev Öktem Düzen Laboratuvarlar Grubu Prenatal tarama testleri kavramları Tarama testi: Normal vakalarda anormal sonuçlar, hasta vakalarda normal sonuçlar elde edilebilir.

Detaylı

KROMOZOM YAPISINDAKİ BOZUKLUKLAR

KROMOZOM YAPISINDAKİ BOZUKLUKLAR KROMOZOM YAPISINDAKİ BOZUKLUKLAR http://radyolojii.blogspot.com.tr/2014_08_01_archive.html http://tr.wikipedia.org/wiki/dna_onar%c4%b1m%c4%b1 Kromozomun yapısal formunun değişmesiyle oluşur. Kırıklar gibi

Detaylı

XXVII. ULUSAL BİYOKİMYA KONGRESİ

XXVII. ULUSAL BİYOKİMYA KONGRESİ XXVII. ULUSAL BİYOKİMYA KONGRESİ TİP2 DİYABETİK RATLARDA Vitis vinifera L. EKSTRAKTININ PIK3R1 (phosphatidylinositol 3-kinase regulatory subunit 1) GEN İFADESİ ÜZERİNE ETKİSİ 1 Emine Gülsün CAN 1 Emine

Detaylı

STEROİDE DİRENÇLİ NEFROTİK SENDROM OLGULARINDA SİKLOSPORİN TEDAVİSİ: 12 AYLIK TAKİP

STEROİDE DİRENÇLİ NEFROTİK SENDROM OLGULARINDA SİKLOSPORİN TEDAVİSİ: 12 AYLIK TAKİP STEROİDE DİRENÇLİ NEFROTİK SENDROM OLGULARINDA SİKLOSPORİN TEDAVİSİ: 12 AYLIK TAKİP Dr. Murat Şakacı Ankara Eğitim E ve Araştırma rma Hastanesi Nefroloji Kliniği GİRİŞİŞ Steroide dirençli nefrotik sendrom

Detaylı

HEMOLİTİK ÜREMİK SENDROM

HEMOLİTİK ÜREMİK SENDROM HEMOLİTİK ÜREMİK SENDROM KOMPLEMAN SİSTEM GENLERİNDE MUTASYON VARLIĞI GENOTİP FENOTİP İLİŞKİSİ VE TEDAVİ Ş. Hacıkara, A. Berdeli, S. Mir HEMOLİTİK ÜREMİK SENDROM (HÜS) Hemolitik anemi (mikroanjiopatik

Detaylı

Kök Hücre ve Gene-k Hastalıklar

Kök Hücre ve Gene-k Hastalıklar Kök Hücre ve Gene-k Hastalıklar Kök Hücre ve Gene-k Hastalıklar Genetik hastalıkların çoğusunda semptomlar ilerleyen karakterdedir ve şu anda genetik hastalıklar için etkili bir tedavi yöntemi mevcut değildir.

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde

Detaylı

START Çalışmasının Sonuçları: Antiretroviral Tedavide Yeni Bir Dönem mi Başlıyor?

START Çalışmasının Sonuçları: Antiretroviral Tedavide Yeni Bir Dönem mi Başlıyor? START Çalışmasının Sonuçları: Antiretroviral Tedavide Yeni Bir Dönem mi Başlıyor? Dr. Sabri Atalay İzmir Tepecik Eğitim ve Araştırma Hastanesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Kliniği KLİMİK

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Haziran 2013

Moleküler Biyoloji ve Genetik Bölümü Haziran 2013 Moleküler Biyoloji ve Genetik Bölümü Haziran 2013 Moleküler Biyoloji ve Genetik Bölümü (MBGB) Güçlü ve çok yönlü bir eğitim programı sunarak, gelişen teknoloji çağında, çok hızlı gelişen alanımızda ileri

Detaylı

PREMATÜR OVARYEN YETMEZLİK (POY) [(Premature ovarian failure/insufficiency POF/I)]

PREMATÜR OVARYEN YETMEZLİK (POY) [(Premature ovarian failure/insufficiency POF/I)] PREMATÜR OVARYEN YETMEZLİK (POY) [(Premature ovarian failure/insufficiency POF/I)] DR.ALTAY GEZER İSTANBUL ÜNİVERSİTESİ CERRAHPAŞA TIP FAKÜLTESİ KADIN HASTALIKLARI ve DOĞUM ANABİLİM DALI Ovaryum Fizyolojisi

Detaylı

Kardiyovasküler Hastalıklarda Çekirdekli Kırmızı Kan Hücrelerinin Tanısal Değeri

Kardiyovasküler Hastalıklarda Çekirdekli Kırmızı Kan Hücrelerinin Tanısal Değeri Kardiyovasküler Hastalıklarda Çekirdekli Kırmızı Kan Hücrelerinin Tanısal Değeri Doç. Dr. Meral Yüksel Marmara Üniversitesi Sağlık Hizmetleri Meslek Yüksekokulu Tıbbi Laboratuvar Teknikleri Programı meralyuksel@gmail.com

Detaylı

Adrenal Yetmezlik. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı

Adrenal Yetmezlik. Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Adrenal Yetmezlik Dr. İhsan ESEN Fırat Üniversitesi Hastanesi Çocuk Endokrinolojisi Bilim Dalı Adrenal bez Etiyoloji Adrenal yetmezlik Primer adrenal yetmezlik Sekonder adrenal yetmezlik Fizyo-patoloji

Detaylı

İBH da osteoporoz. Dr. Ahmet TEZEL Trakya Üniversitesi Tıp Fakültesi İBH Okulu Mayıs 2013

İBH da osteoporoz. Dr. Ahmet TEZEL Trakya Üniversitesi Tıp Fakültesi İBH Okulu Mayıs 2013 İBH da osteoporoz Dr. Ahmet TEZEL Trakya Üniversitesi Tıp Fakültesi İBH Okulu Mayıs 2013 WHO a göre osteoporoz «Osteoporoz; azalmış kemik kitlesi, kemik dokusunun mikroçatısında bozulma, kemik frajilitesinde

Detaylı

KOLOREKTAL TÜMÖRLERDE HEDEFE YÖNELİK TEDAVİLER VE RADYOTERAPİ. Dr. M. Gamze Aksu Akdeniz Üniversitesi Tıp Fakültesi Radyasyon Onkolojisi AD

KOLOREKTAL TÜMÖRLERDE HEDEFE YÖNELİK TEDAVİLER VE RADYOTERAPİ. Dr. M. Gamze Aksu Akdeniz Üniversitesi Tıp Fakültesi Radyasyon Onkolojisi AD KOLOREKTAL TÜMÖRLERDE HEDEFE YÖNELİK TEDAVİLER VE RADYOTERAPİ Dr. M. Gamze Aksu Akdeniz Üniversitesi Tıp Fakültesi Radyasyon Onkolojisi AD HEDEFE YÖNELİK TEDAVİ CERRAHİ RT KT % 6-8 Lokal bölgesel yineleme

Detaylı