Yrd.Doç.Dr. Yosun MATER

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Yrd.Doç.Dr. Yosun MATER"

Transkript

1 * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER

2 *Evrimsel açıdan genlerin çoğaltılmasının önemi ilk defa Haldane (1932) ve Muller (1935 ) tarafından önerildi ve tanımlandı. *Evrimsel açıdan bir genin yenilenmesi çoğalması aşamasında veya devamındaki süreçlerde ortaya çıkan farklı mutasyonlarla gerçekleşir. *Bir gen çoğaltması ilk defa Bridges (1936) tarafından Drosophila da Bar cisimciği benzeri, Bar yerleşimlerinde gözlemlenmiş ve tanımlanmıştır. *Bu keşfe rağmen, bulunan diğer birkaç gen örneği için, biyokimyasal ve moleküler biyolojik tekniklerde bazı gelişmelerin olması gerekmiştir.

3 *1950'lerde protein dizilenmesi yöntemlerinde olan gelişmeler sayesinde uzun vadeli evrimsel süreçlerin çalışması mümkün olmuştur. *Ancak 1950'lerin sonlarında hemoglobin için α ve β zincirlerinin bulunması ve tanımlanması mümkün olmuştur (Itano 1957; Rhinesmith ve ark. 1958; Braunitzer ve ark. 1961). *Bu bulgudan sonra yapılan sitolojik çalışmalarda evrim sırasında gen çoğaltılması çoğunlukla kanıt olarak kullanılmaya başlanmıştır. Yrd.Doç.Dr. Yosun MATER

4 *Bu ve benzeri çalışmalarda çeşitli gen verileri kullanılmıştır. *Ohno (1970) buna zıt bir görüş ortaya sürmüştür. *Buna göre Gen çoğaltma tekniği bize aslında sadece oluşabilecek yeni bir geni verebilir fikri idi, bu fikrin doruluğunu günümüzde yapılan çalışmalar ile ancak anlamamıza rağmen, bu görüş o zamanda oldukça geçerli oldu. *Bölünmüş genlerin keşfi Gilbert (1978) tarafından yapıldı. *Buna göre rekombinasyonda DNA üzerinde yer alan exonların (gen veya gen parçalarının) arasında intronların varlığı tespit edildi. *Genler arasında yer alan, bu gen parçalar, ekzonların yer değiştirdiği belirlendi (Exon exchange). *Bu mekanizmanın özelliklen ökaryotik canlıların evrimsel değişiminde ve gelişiminde önemli bir rol oynadığı fikri kabul edildi. *Elbette burada ökaryotik genlerin evrimsel gelişiminde intronlarında rolleri de göz ardı edilmemelidir.

5 *Gen Çoğaltılmasının Çeşitleri *Gen çoğaltılması; bir DNA segmentinin kopya sayısında bir artış meydana getirilmesi olarak tanımlanır. *Gen çoğaltılmasını farklı şekilleri vardır. *Bunlar genellikle genomik bölgenin büyüklüğüne göre sınıflandırılırlar. *Buna göre duplikasyon çeşitleri: (1) Kısmi veya iç gen çoğaltılması, (2) Genin tamamının çoğaltılması, (3) Kısmi kromozomal çoğaltım, (4) Kromozomun tamamının çoğaltılması (5) Poliploidi veya genom çoğaltılması olarak tanımlanır. *Bunlardan ilk dört tanesi haploit bir kromozomda bölgesel olarak çoğaltımdır ve çok da etkili değildir.

6 *Gen Çoğaltılmasının Çeşitleri (devam) *Ohno (1970) genomun çoğaltılmasını irdelemiş ve bölgesel çoğaltılmalardan daha önemli olduğunu idda etmiştir. *Görüşüne göre bölgesel çoğaltımda aynı gen içindeki parçalarda değişiklik olmakta ve sadece bir dengesizliğe yol açmaktadır. *Bu durumun genomun çoğaltılması kadar etkin olamayacağı görüşünü ortaya atmıştır. *Bununla karşın, günümüzde bölgesel duplikasyonların evrimde çok önemli bir rol oynadığı bilinmektedir.

7 *Gen çoğaltılmasından sorumlu moleküler mekanizma eşit olmayan bir krosignoverla ya da çaprazlama üzerinden gerçekleşir (Şekil 1.15). *Bu aşamada gerçekleşen krosingover miktarının farklığının nedenlerine bakarsak; 1.Karşılıklı gelen kromozomlar üzerindeki sekansların, bir kromozom üzerinde ardışık şekilde kopyalanmış bir bölge meydana getirmesi, 2.Buna karşın diğer kromozomda yer alan tamamlayıcı bölgelerde silinmeler, kaymalar olması ve 3.Bu kaymaların boyutuna bağlı olarak ortaya çıkan farklılıklar diyebiliriz. *Eşit olmayan bu geçişlerde, tekrar dizilerinin varlığı ve büyüklüğü de önemlidir. *Bir DNA sekansında yer alan ardışık dizilerin kopyalanması işlemi bir kere başladığında giderek hızlanan basamakları içeren bir işlemdir. *Böylece eşit olmayan bu çoğaltım devam eder.

8 Yrd.Doç.Dr. Yosun MATER

9 *ÖZETLE; *Uzun DNA ipliklerinin kopyalanması, genom boyutunun evriminde en önemli faktörlerden biri olarak kabul edilir. *Özellikle, tüm genomun çoğaltılmasında (veya büyük bir bölümünün çoğaltılmasında Ör: bir kromozomun tamamının çoğaltılması gibi) bir anda genom boyutunun artmasında önemli bir neden olabilir. *Farklı organizmalar için bu şekilde genom çoğaltma olayları tespit edilmiştir. Yrd.Doç.Dr. Yosun MATER

10 *Domainler ve Ekzonlar *Bir domain (birim), bir protein içinde belli bir yeri olan, iyi tanımlanmış bir bölgedir. *Bu bölge; ya proteinlerin alt birimlerini bağlayan ve fonksiyonun gerçekleştiren bölgelerdir; ya da kararlı, sabit bir yapısı olan, bağımsız katlanabilen, tüm parçaları ayırt edilebilen, kompakt olarak katlanmış bir yapı birimidir. *Domainler eskiden fonksiyonel birim olarak adlandırılırlardı. * Sonrasında yapısal domain (birim) veya modül adını aldılar (Gō ve Nosaka 1987). *Domainlerin fonksiyonel bir etki sınırlarının tanımlanması genellikle zordur. *Bunun nedeni aynı anda bir çok durumda işlevleri olması ve bu işlevleri yapılarında bulunan polipeptit bağları ile bağlı amino asit birimleri vasıtasıyla yapmalarıdır.

11 *Domainler ve Ekzonlar (Devam) *Diğer yandan, bu yapısal modüller aynı zamanda oluşturdukları proteinde yer alan doğrusal amino asit dizilerinin birlikte oluşturduğu bir yapıdır (Ör: bir modül amino asitlerin sürekli bir dizilimini içerir). *Bu ayrım önemlidir. *Olası evrimsel mekanizmalar göz önüne alındığında, multidomain içeren proteinlerin meydana gelmiş olabileceği sonucuna varılır. *Eğer fonksiyonel bir domain nin, bir modüle karşılık geldiğini kabul edersek, çoğaltılması ile fonksiyonel birimlerin, segmentlerinin sayısı artması beklenir.

12 *Bunun aksine, eğer oluşan fonksiyonel birimler, amino asitlerin dağılmasını tetiklediyse, farklı modüllerin oluştuğu ve bunlar arasında fonksiyonel işlevselliklerin oluştuğu düşünülebilir. * Çoğaltılmış fonksiyonel modül iş yapamıyor da olabilirler. *Bu elbette fonksiyonel grup oluşumu için istenmeyen bir durumdur. *Gerçekten de bir çok proteinin çekirdeğinde bulunan tekrarlar ya yapısal modüllere ya da tek bir fonksiyonel modüle karşılık gelirler (Barker ve ark 1978). Yrd.Doç.Dr. Yosun MATER

13 *Proteinlerde modüllerin kimlikleri genellikle Gō dağılımı adını alan grafiksel bir yöntem kullanılarak tanımlanır (Gō 1981). *Bu yöntemde, bir proteine ait amino asit birimleri, iki eksen üzerinde, iki boyutlu olarak arka arkaya sıralanmış matris yapısındadır. *Bu dizilim bize proteinin üçüncül yapısını verir. *Elde edilen veriler ışığında, iki eksen arasındaki mesafenin uygun olması durumunda, artı işareti (+) matrise girilir. *Bu şekilde belirlenen değerler elde edilmiş değerlerden daha büyük olur (Şekil 6.1). *Küresel proteinler için kullanılan değer genellikle küresel proteini oluşturan kürenin yarıçapıdır ve ideal durumda R olarak belirtilir. * İdeal durumlarda, domainler boş, örtüşmeyen, sağa açılı üçgenler, hipotenüsler üzerinde Gō dağılımı yardımıyla artı işaretleri ile tanımlanır (Şekil 6.1a ).

14 Yrd.Doç.Dr. Yosun MATER

15 *Daha az ideal olan durumlarda, birbirleri ile örtüşen ve aralarında mesafeler olan boş üçgenler (Şekil 6.1b ) şeklinde tanımlanır. *Gerçekte bu durum çok daha karmaşık ve kompleks istatistiksel yöntemler kullanılarak belirlenir. *Modüller arasındaki bağlantıları tanımlamak ise çok daha karmaşık bir işlemdir. *Şekil 6.1c de insan hemoglobininin β alt-birimi için oluşturulmuş bir Gō dağılım grafiği görülmektedir. Yrd.Doç.Dr. Yosun MATER

16

17 *Teorik olarak, yapısal domainler arasında birkaç olası ilişki tahmin edilebilir ve böylece genlerdeki ekzonların düzenlenmesine dair yorumlar yapılabilir (Şekil 6.2). *Gō (1981) birçok küresel proteinin, iç bölgesinde, farklı modüler bölümlerin bulunduğunu belirlemiştir. *Böylece genlerde yer alan ekzonların varlığı ve bağlantısı kesin olmasa da gösterilmiştir (Şekil 6.2a ve b). *Sadece birkaç durumda, tek bir modülün tek bir ekzonu kodladığı bulunmuştur (Şekil 6.2d). *Arasında tam bir uyumsuzluk olan modüller içeren proteinlerle yapılan çalışmalarda genlerde bölünen ekzonlarla ilgili çalışmalara rastlanmamıştır (Şekil 6.2e). *Yine çoğu çalışmada bir ekzonun birden fazla modülde (genellikle komşu modüllerde) görev alması veya kodlanması hakkında yapılmıştır (Şekil 6.2c).

18 Yrd.Doç.Dr. Yosun MATER

19 *Vertebrat (omurgalı) hemoglobinlerinde yer alan α ve β zincirlerine bakarsak, bunların dört alt birimden oluştuğunu görürüz. *Aslında üç ekzon ve bir komşu dizi etkisiyle kodlanır. *Gō (1981 ) ekzonlar arasında bir birleşme meydana geldiğinde, bunun merkezi bir intron kaybına sebebiyet verdiğini öne sürmüştür. *Gerçekten de bitkilerde görülen homolog globulin genlerine (leghemoglobins) bakıldığında, birleşmelerin tahmini noktalarına eklenmiş intron bölgelerine rastlanmıştır. *Ve omurgalı globin genlerine benzer yapılar belirlenmiştir (Landsman ve ark. 1986). Yrd.Doç.Dr. Yosun MATER

20 *Benzer bir intron eklenmesi nematod (yassı kurt) Pseudoterranova decipiens in globin genleri arasında bulundu (Dixon ve ark. 1991). *İlginç bir şekilde, serbest yaşayan ve globin geni kodlayan nematod (yuvarlak kurtlar) Caenorhabditis elegans ın globulin genleri arasında yer alan bir intron bölgesine benzeyen merkezi bir intron bölgesine de leghemoglobinlerde rastlanmıştır (Kloek ve ark konumunda 1993). *Bu nedenle, evrim sırasında globin gen ailesinin ata genini oluşturduğu düşünülen dört ekzon arasındaki intron kayıpları ve eklenmeleri, genetik yelpazeyi oluşturduğu ve globulin gen çeşitlerini ortaya çıkardığı düşünülmektedir (Şekil 6.3). Yrd.Doç.Dr. Yosun MATER

21 Yrd.Doç.Dr. Yosun MATER

22 *Olguların çoğunda, protein düzeyinde etki gösteren artış, aslında DNA seviyesinde oluşan bir dizi ekzon çoğaltılmasıdır. *Bu nedenle, ekzonların çoğaltılması, genin çoğaltılması için temeldir. *Ökaryotik genleri genellikle birden çok ekzon ve introndan oluşur (Bölüm 1) ve birbirine komşu ekzonlar genellikle aynı veya birbirine çok benzerdir. *Dahası, günümüz organizmaların çoğunda var olan proteinler içinde, amino asit dizi tekrarları görülür ve bu tekrarlar genellikle oluşturdukları proteinler içinde fonksiyonel ve/veya yapısal bölgeleri etkilerler (Barker ve ark. 1978). *Bu gözlemler birçok proteinleri tanımlayan özel genler olduğunu ve bunların kendilerini çoğalttıklarını göstermektedir.

23 *Bu durum aynı zamanda proteinlerin işlevsel kararlılıklarını arttırmak ve aktif bölgelerini çoğaltmak için sayılarını arttırabildiklerini de göstermektedir. *Protein ve DNA düzeyinde oluşan bu kendi içinde çoğaltılması durumu, gereksiz DNA segmentleri oluşmasına neden olabilir. *Aynı zamanda böyle bölgeler, yeni fonksiyonlar geliştirmek için bir gen oluşumuna da neden olabilir. *Bu durumda, günümüz yaşayan organizmaları oluşturan/yapısında bulunan birçok karmaşık gen, bu şekilde içsel olarak çoğaltılmış küçük, basit, ilkel genlerden evrimleşmiş ve bunu takiben değişime uğramış olabilirler (Li 1983).

24 *KULLANILAN KAYNAKLAR * 1 Fundamentals of Molecular Evolution (2000) Dan Graur and Wen-Hsiung Li Sinauer Associates, Inc.,Publishers. Sunderland, MA, USA. Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

Gen Organizasyonu ve Genomların Evrimi

Gen Organizasyonu ve Genomların Evrimi GENETĐK 111-503 Gen Organizasyonu ve Genomların Evrimi Doç. Dr. Hilâl Özdağ 1 RNA nın Kendi Kendini Kopyalayabiliyor Olmalıydı Đlkin zamanlardaki RNA dünyasında RNA moleküllerinin kopyalanması. RNA polimerazlar

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Domain Çoğalması ve Gen Uzaması *Ökaryotlarda modern genler üzerine yapılan bir araştırma gösteriyor ki, içsel duplikasyonlar evrim boyunca sık sık meydana

Detaylı

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması

Detaylı

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM Burcu GÜNGÖR, Sami ÖZGÜR Balıkesir Üniversitesi Necatibey Eğitim OFMA Biyoloji Eğitimi A.B.D Özet Ders kitapları, hem öğretmenlerin hem öğrencilerin

Detaylı

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ Seçici gen ifadesi embriyonun gelişmesini sağlayan 4 temel işlevi denetler: 1. Hücre çoğalması 2. Hücre farklılaşması 3. Hücre etkileşimleri 4. Hücre hareketi HÜCRE

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik hücreler, transkripsiyondan sonra RNA yı değişikliğe uğratırlar

Detaylı

Yrd.Doç.Dr.Yosun MATER

Yrd.Doç.Dr.Yosun MATER * *1.GİRİŞ 1 *Londra Linne Topluluğunun 1 Temmuz 1858 de toplantısında, Charles Darwin doğal seçilim ile anlattığı evrim teorisini sundu. *Türlerin Kökeni basılalı bir yıl olmuştu. Darwin in teorisi sadece

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

KOMPERATİF GENOMİK Principles of Genome Analysis and Genomics S.B. Primrose and R.M. Twyman Bölüm 7 s. 113-132 Amacı; farklı organizmaların genom yapısındaki farklılık ve benzerliklerin ortaya çıkarılmasıdır.

Detaylı

1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM

1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1 DNA (Deosiribo Nükleik Asit) Kalıtım maddesi hücre çekirdeğinde bulunur. Kalıtım maddesi iğ ipliği (Yumak) şeklinde bir görünümdedir. İğ ipliğindeki kalıtım maddesi

Detaylı

III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler

Detaylı

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D 1. DNA replikasyonu.. için gereklidir A) sadece mitoz B) sadece mayoz C) mitoz ve mayoz D) sadece gamet oluşumu E) sadece protein sentezi 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki

Detaylı

Model Organizmalar. Yusuf DOĞAN

Model Organizmalar. Yusuf DOĞAN Model Organizmalar Yusuf DOĞAN Model Organizma Nedir? Model organizmalar çeşitli biyolojik olayların anlaşılması için üzerinde çalışılan bir türdür. Bu organizmaları laboratuvar ortamında üretmek ve üretimlerini

Detaylı

Biochemistry Chapter 4: Biomolecules. Hikmet Geçkil, Professor Department of Molecular Biology and Genetics Inonu University

Biochemistry Chapter 4: Biomolecules. Hikmet Geçkil, Professor Department of Molecular Biology and Genetics Inonu University Biochemistry Chapter 4: Biomolecules, Professor Department of Molecular Biology and Genetics Inonu University Biochemistry/Hikmet Geckil Chapter 4: Biomolecules 2 BİYOMOLEKÜLLER Bilim adamları hücreyi

Detaylı

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 12 Prokaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

Mustafa EMREM

Mustafa EMREM Mustafa EMREM 162161022 Bakterilerdeki transformasyonun ilk kanıtları İngiliz bilim adamı Frederick Griffith tarafından elde edilmiştir. Genetik materyal aktarımı Dikey Gen Transferi ebeveyn ile yavru

Detaylı

8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için

8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için 8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için koruyucu kalkan görevi görmektedir. Protein kendi kendine

Detaylı

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ 1 Genetik mühendisliği canlıların kalıtsal özelliklerinin değiştirilerek onlara yeni işlevler kazandırılmasına yönelik araştırmalar yapan bilim dalıdır. Genetik mühendisleri

Detaylı

Fonksiyon Optimizasyonunda Genetik Algoritmalar

Fonksiyon Optimizasyonunda Genetik Algoritmalar 01-12-06 Ümit Akıncı Fonksiyon Optimizasyonunda Genetik Algoritmalar 1 Fonksiyon Optimizasyonu Fonksiyon optimizasyonu fizikte karşımıza sık çıkan bir problemdir. Örneğin incelenen sistemin kararlı durumu

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların

Detaylı

YÜKSEK İHTİSAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I 2015-2016 MOLEKÜLDEN HÜCREYE DERS KURULU- I. (12 Ekim - 20 Kasım 2015) ZORUNLU DERSLER

YÜKSEK İHTİSAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I 2015-2016 MOLEKÜLDEN HÜCREYE DERS KURULU- I. (12 Ekim - 20 Kasım 2015) ZORUNLU DERSLER YÜKSEK İHTİSAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I 2015-2016 MOLEKÜLDEN HÜCREYE DERS KURULU- I (12 Ekim - 20 Kasım 2015) DERSLER TEORİK PRATİK TOPLAM Tıbbi Biyoloji ve Genetik 30 4X2 34 Tıbbi Biyokimya

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı Dönem I. 2. Ders Kurulu II. HÜCRE BİLİMLERİ-I Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Prof. Dr. Alirıza ERDOĞAN Yrd. Doç. Ders Kurulu

Detaylı

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır.

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır. BİYOLOJİYE GİRİŞ Canlılığın bilimsel olarak araştırılmasıdır. Biyolojik Organizasyon; Her düzeydeki biyolojik organizasyon belirgin özelliklere sahiptir. Her türlü maddenin kimyasal yapıtaşları olan ve

Detaylı

ADIM ADIM YGS LYS. 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON

ADIM ADIM YGS LYS. 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON ADIM ADIM YGS LYS 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON GENETİK VARYASYON Aynı türün bireyleri arasındaki farklılığa VARYASYON denir. Varyasyonların hepsi

Detaylı

CANLILARDA ÜREME. Üreme canlıların ortak özelliğidir. Her canlının kendine benzer canlı meydana getirebilmesi üreme ile gerçekleşir

CANLILARDA ÜREME. Üreme canlıların ortak özelliğidir. Her canlının kendine benzer canlı meydana getirebilmesi üreme ile gerçekleşir CANLILARDA ÜREME EYLÜL 3.HAFTA MİTOZ VE EŞEYSİZ ÜREME Her canlının kendine benzer canlı meydana getirebilmesi üreme ile gerçekleşir Üreme canlıların ortak özelliğidir 3 4 Canlılar hücrelerden meydana gelir

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

TEOG1 DENEME SINAVI 1 ( DNA, Mitoz, Mayoz Kapsamlı)

TEOG1 DENEME SINAVI 1 ( DNA, Mitoz, Mayoz Kapsamlı) TEOG1 DENEME SINAVI 1 ( DNA, Mitoz, Mayoz Kapsamlı) 4. 1.Şekilde hayvan hücresinin mitoz bölünmede bir evresi gösterilmiştir. Bu evreden sonra aşağıdakilerden hangisi gerçekleşmez? A) Kalıtım maddesinin

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

10. SINIF KONU ANLATIMI 6 MAYOZ BÖLÜNME-3

10. SINIF KONU ANLATIMI 6 MAYOZ BÖLÜNME-3 10. SINIF KONU ANLATIMI 6 MAYOZ BÖLÜNME-3 Mayoz Bölünmenin Genel Özellikleri Üreme ana hücrelerinde görülür. Üreme hücrelerinin oluşmasını sağlar. Sadece 2n kromozomlu hücrelerde görülür. 4 yeni hücre

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

GENETİK ALGORİTMALAR. Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ

GENETİK ALGORİTMALAR. Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ GENETİK ALGORİTMALAR Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ GENETİK ALGORİTMALAR Genetik algoritmalar, Darwin in doğal seçim ve evrim teorisi ilkelerine dayanan bir arama ve optimizasyon yöntemidir.

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

Kök Hücre ve Farklılaşma

Kök Hücre ve Farklılaşma Kök Hücre ve Farklılaşma Kök Hücre Erişkin ve embriyonik kök hücreler farklılaşarak soma7k hücreleri oluştururlar. Kök hücre Progenitör hücre Farklılaşmış hücre Neden Farklılaşmaya İh7yaç Duyulur Tek hücreli

Detaylı

YAZILIYA HAZIRLIK TEST SORULARI. 10. Sınıf

YAZILIYA HAZIRLIK TEST SORULARI. 10. Sınıf YAZILIYA HAZIRLIK TEST SORULARI 10. Sınıf 1) Hücre döngüsünün interfaz evresini yeni tamamlamış bir hücre ile bu hücrenin döngü sonunda oluşturduğu yeni hücrelerde; I. DNA miktarı II. Gen Sayısı III. Gen

Detaylı

Proteinlerin Primer & Sekonder Yapıları. Dr. Suat Erdoğan

Proteinlerin Primer & Sekonder Yapıları. Dr. Suat Erdoğan Proteinlerin Primer & Sekonder Yapıları Dr. Suat Erdoğan Sunum planı Proteinlerin moleküler yapılarını hangi kimyasal güçler belirler? Proteinlerin moleküler yapıları Primer yapı Sekonder yapı α-heliks

Detaylı

Wnt/β-katenin Yolağı

Wnt/β-katenin Yolağı Wnt/β-katenin Yolağı Wnt/β-katenin Yolağı Memeli canlılarda oldukça korunmuş ve gelişim için oldukça önemli olan bir yolak7r. Drosophila da yapılan gene>k çalışmalar sırasında keşfedilmiş>r. Özellikle

Detaylı

Genetik Yöntemlerle Bakterilere Gen Transferleri. (Cüneyt Akdeniz)

Genetik Yöntemlerle Bakterilere Gen Transferleri. (Cüneyt Akdeniz) Genetik Yöntemlerle Bakterilere Gen Transferleri (Cüneyt Akdeniz) Bakterilerde genetik maddenin bir kısmı bakteriden bakteriye aktarılabilmekte ve bunun sonucunda önemli genetik değişmeler olmaktadır.

Detaylı

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri mrna trna - rrna Taşıyıcı (transfer) RNA (trna) Nispeten küçük moleküllerdir. Bir öncu molekülün nükleusta işlenmesiyle oluşurlar. trna molekülleri, mrna

Detaylı

GEN EKSPRESYONU: GENDEN PROTEİNE

GEN EKSPRESYONU: GENDEN PROTEİNE GENLER ve İŞLEVLERİ GEN EKSPRESYONU: GENDEN PROTEİNE Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Genlerin Doğası Şimdiye kadar öğrendiklerimiz bize canlıya ait bilgilerin DNA da yer aldığını

Detaylı

TRANSKRİPSİYON AŞAMASINDA KROMATİN YAPININ DÜZENLENMESİ

TRANSKRİPSİYON AŞAMASINDA KROMATİN YAPININ DÜZENLENMESİ İ.Ü Fen Bilimleri Enstitüsü Moleküler Biyoloji ve Genetik TRANSKRİPSİYON AŞAMASINDA KROMATİN YAPININ DÜZENLENMESİ Merve YILMAZER 2601120219 İÇERİK Kromatin ve nükleozom yapısı Transkripsiyon aşamasında

Detaylı

Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören

Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu Dr. Mahmut Çerkez Ergören Genetik materyal; Kendini çoğaltır. Bilgi depolar. Bilgiyi ifade eder. Mutasyonla varyasyonlara izin verir. Genetik Tarihçe

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde

Detaylı

HAFTA II Mendel Genetiği

HAFTA II Mendel Genetiği GENETĐK 111-503 HAFTA II Mendel Genetiği Doç. Dr. Hilâl Özdağ 1865 Gregor Mendel kalıtım kurallarının temellerini attı. http://www.dnaftb.org/dnaftb/1/concept/ 1 Seçilen Özellikler Hartl DL, Jones EW,

Detaylı

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 SANTRAL DOGMA Hücredeki bilgi aktarım mekanizmasının tamamına SANTRAL DOGMA denir. Santral dogma tek yönlü bilgi aktarımıdır. Geri dönüşümü

Detaylı

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI 12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların genlerine

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

Gezgin Satıcı Probleminin İkili Kodlanmış Genetik Algoritmalarla Çözümünde Yeni Bir Yaklaşım. Mehmet Ali Aytekin Tahir Emre Kalaycı

Gezgin Satıcı Probleminin İkili Kodlanmış Genetik Algoritmalarla Çözümünde Yeni Bir Yaklaşım. Mehmet Ali Aytekin Tahir Emre Kalaycı Gezgin Satıcı Probleminin İkili Kodlanmış Genetik Algoritmalarla Çözümünde Yeni Bir Yaklaşım Mehmet Ali Aytekin Tahir Emre Kalaycı Gündem Gezgin Satıcı Problemi GSP'yi Çözen Algoritmalar Genetik Algoritmalar

Detaylı

EĞİTİM - ÖĞRETİM YILI DÖNEM I. III. KURULDERS PROGRAMI GENETİK BİLGİNİN AKIŞI- DOKUYA GİRİŞ (16 Ocak Mart 2017 )

EĞİTİM - ÖĞRETİM YILI DÖNEM I. III. KURULDERS PROGRAMI GENETİK BİLGİNİN AKIŞI- DOKUYA GİRİŞ (16 Ocak Mart 2017 ) 2015 2016 EĞİTİM - ÖĞRETİM YILI DÖNEM I III. KURULDERS PROGRAMI GENETİK BİLGİNİN AKIŞI- DOKUYA GİRİŞ (16 Ocak 2017-10 Mart 2017 ) Dekan Baş Koordinatör Dönem I Koordinatörü Dönem I Koordinatör Yardımcısı

Detaylı

Kategori Alt Kategori Program İçeriği Kazanımlar Dersler Arası İlişki I. HAYATSAL OLAYLAR

Kategori Alt Kategori Program İçeriği Kazanımlar Dersler Arası İlişki I. HAYATSAL OLAYLAR 200 Kategori Alt Kategori Program İçeriği Kazanımlar Dersler Arası İlişki I. HAYATSAL OLAYLAR I.1. Genetik Mühendisliği ve Biyoteknoloji İnsan için önemli olan birçok ürünlerin üretimi biyoteknolojinin

Detaylı

8. SINIF KAZANIM TESTLERİ 2.SAYI. Ar-Ge Birimi Çalışmasıdır ŞANLIURFA İL MİLLİ EĞİTİM MÜDÜRLÜĞÜ DİZGİ & TASARIM İBRAHİM CANBEK

8. SINIF KAZANIM TESTLERİ 2.SAYI. Ar-Ge Birimi Çalışmasıdır ŞANLIURFA İL MİLLİ EĞİTİM MÜDÜRLÜĞÜ DİZGİ & TASARIM İBRAHİM CANBEK 8. SINIF ŞANLIURFA İL MİLLİ EĞİTİM MÜDÜRLÜĞÜ 2016-2017 KAZANIM TESTLERİ TÜRKÇE MATEMATİK T.C İNKİLAP TARİHİ VE ATATÜRKÇÜLÜK FEN VE TEKNOLOJİ DİN KÜLTÜRÜ VE AHLAK BİLGİSİ İNGİLİZCE Ar-Ge Birimi Çalışmasıdır

Detaylı

Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın

Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın Hücre Nükleusu, Nükleus Membranı, Nükleus Porları Doç. Dr. Ahmet Özaydın Nükleus (çekirdek) ökaryotlar ile prokaryotları ayıran temel özelliktir. Çekirdek hem genetik bilginin deposu hem de kontrol merkezidir.

Detaylı

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE YAZILIYA HAZIRLIK SORULARI 12. Sınıf 1 GENDEN PROTEİNE Protein sentezini tüm canlılar gerçekleştirir. Bir mrna molekülünde en fazla 64 çeşit kodon bulunur. DOĞRU YANLIŞ SORULARI Canlıların heterotrof beslenenleri

Detaylı

DNA ve Genetik Kod Kazanım Değerlendirme Sınavı 2 1-

DNA ve Genetik Kod Kazanım Değerlendirme Sınavı 2 1- DNA ve Genetik Kod Kazanım Değerlendirme Sınavı 2 1-4- C-G-T-T-A-G-C-G-G-A-G-G-T DNA zincirinin diğer halkası aşağıdakilerden hangisidir? A. G-C-A-A-T-C-G-C-C-T-C-C-G B. T-C-A-A-T-G-C-C-C-T-C-C-T C. G-C-A-A-T-C-G-C-C-T-C-C-A

Detaylı

ECZACILIK FAKÜLTESİ BİYOKİMYA

ECZACILIK FAKÜLTESİ BİYOKİMYA PROGRAM KOORDİNATÖRÜ Prof. Dr. Güldal MEHMETÇİK, gmehmetcik@neu.edu.tr YÜKSEK LİSANS DERSLERİ EBM 600 Uzmanlık Alanı Dersi Z 4 0 4 EBM 601 Biyokimya I S 3 0 3 EBM 602 Biyokimya I Laboratuvar S 0 3 1 EBM

Detaylı

HÜCRE BÖLÜNMESİ VE ÜREME. Mitoz Bölünme ve Eşeysiz Üreme 1

HÜCRE BÖLÜNMESİ VE ÜREME. Mitoz Bölünme ve Eşeysiz Üreme 1 HÜCRE BÖLÜNMESİ VE ÜREME Mitoz Bölünme ve Eşeysiz Üreme 1 Hücrenin bölünmeye başlamasından itibaren onu takip eden diğer hücre bölünmesine kadar geçen zaman aralığına hücre döngüsü denir. Hücreler belli

Detaylı

Ökaryotik Kromozomlar

Ökaryotik Kromozomlar Telomer Ökaryotik Kromozomlar Mitoz metafazında kromozomlar mikroskop altında görülebilir Kromozomların uçlarında telomer denilen yapılar vardır, bu yapıların görevi kromozomu korumaktır Ortaya yakın bir

Detaylı

Genetik MühendisliM. hendisliği BYM613. Mutasyonlar ve Doğal Gen Transfer Mekanizmaları. MUTASYON bir canl. Hacettepe Üniversitesi

Genetik MühendisliM. hendisliği BYM613. Mutasyonlar ve Doğal Gen Transfer Mekanizmaları. MUTASYON bir canl. Hacettepe Üniversitesi BYM613 Genetik MühendisliM hendisliği Mutasyonlar ve Doğal Gen Transfer Mekanizmaları Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr

Detaylı

CİNSİYETE BAĞLI KALITIM

CİNSİYETE BAĞLI KALITIM CİNSİYETE BAĞLI KALITIM *Cinsiyetin belirlenmesi: Eşeyli üreyen hayvanlarda cinsiyetin belirlenmesi farklı şekillerde olabilmektedir. Bazı hayvanlarda cinsiyetin belirlenmesi, çevre koşulları tarafından

Detaylı

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır.

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır. Allel: Bir genin seçenekli biçimi Wild Tip: Normal allel. Bireylerin çoğunda bulunan Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda

Detaylı

I. DÖNEM - 2. DERS KURULU ( )

I. DÖNEM - 2. DERS KURULU ( ) Açıklamalar: I. DÖNEM - 2. DERS KURULU (2014-2015) Kısaltmalar: DK: Ders kurulu, IHU: İyi hekimlik uygulamaları, Mİng: Akademik/Medikal İngilizce, TDE: Türk Dili ve Edebiyatı, Bilgisayar Okur yazarlığı:

Detaylı

Uygulama 6. Transkripsiyon yönü. Ekzonlar (kodlama bölgeleri) Transkripsiyon. Sonlandırıcı kodon başlangıcı

Uygulama 6. Transkripsiyon yönü. Ekzonlar (kodlama bölgeleri) Transkripsiyon. Sonlandırıcı kodon başlangıcı Uygulama 6 DNA Dizilerinde Bazı Đstatistiksel Analizler DNA molekülleri nükleotidlerin uzun birer dizileridir. Dizilenmiş bir DNA molekülüne A,C,G,T harflerinin oluşturduğu bir kelimelik uzun bir yazı

Detaylı

Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I -

Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I - Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I - Pre-mRNA (hnrna) cap mrna AAAAAAAAAAAAA REPLİKASYON DNA nın kendini eşlemesi TRANSKİPSİYON DNA dan RNA ya gene

Detaylı

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz İnsan Mikrobiyom Projesi Prof. Dr. Tanıl Kocagöz Human Microbiome Project İnsan Mikrobiyom Projesi (İMP) 2007 yılında NIH tarafından başlatıldı 300 gönüllünün 5 vücut bölgesinden değişik zamanlarda, toplam

Detaylı

1- Aşağıda verilen mayoz bölünme geçirmekte olan hücrelerin evrelerini ve her birinin kromozom sayısını yazınız. (6*1,5=9 ) 5- Mayoz bölünmede kalıtsal çeşitliliği sağlayan olaylar nelerdir? (2*4=8 ) Profaz_I

Detaylı

Tarifname P53 AKTİVASYONU VESİLESİ İLE ANTİ-KARSİNOJENİK ETKİ GÖSTEREN BİR FORMÜLASYON

Tarifname P53 AKTİVASYONU VESİLESİ İLE ANTİ-KARSİNOJENİK ETKİ GÖSTEREN BİR FORMÜLASYON 1 Tarifname P3 AKTİVASYONU VESİLESİ İLE ANTİ-KARSİNOJENİK ETKİ GÖSTEREN BİR Teknik Alan FORMÜLASYON Buluş, p3 aktivasyonu vesilesi ile anti-karsinojenik etki göstermeye yönelik oluşturulmuş bir formülasyon

Detaylı

YGS YE HAZIRLIK DENEMESi #16

YGS YE HAZIRLIK DENEMESi #16 YGS YE HAZIRLIK DENEMESi #16 1) Topraktaki azotlu bileşik miktarını, I. Denitrifikasyon bakteri sayısındaki artış II. Saprofit bakterilerce gerçekleşen çürüme III. Şimşek ve yıldırım olaylarındaki artış

Detaylı

Mendel Genetiği, Kalıtım, Gen Mühendisliği ve Biyoteknoloji

Mendel Genetiği, Kalıtım, Gen Mühendisliği ve Biyoteknoloji Mendel Genetiği, Kalıtım, Gen Mühendisliği ve Biyoteknoloji MENDEL GENETİĞİ Ebeveyn (ana-baba) ile oğul bireyler arasındaki benzerlik ve farklılıkların nasıl veya hangi oranlarda ortaya çıkabileceğini

Detaylı

ÜNİTE I HÜCRE BÖLÜNMESİ VE KALITIM 1.1 HÜCRE BÖLÜNMESİ Hücre bölünmesi canlılar aleminde görülen en önemli biyolojik olaylardan biridir.

ÜNİTE I HÜCRE BÖLÜNMESİ VE KALITIM 1.1 HÜCRE BÖLÜNMESİ Hücre bölünmesi canlılar aleminde görülen en önemli biyolojik olaylardan biridir. ÜNİTE I HÜCRE BÖLÜNMESİ VE KALITIM 1.1 HÜCRE BÖLÜNMESİ Hücre bölünmesi canlılar aleminde görülen en önemli biyolojik olaylardan biridir. Hücre büyürken, hücre zan genişler, hacmi artar. Ancak hücrenin

Detaylı

A. EġEYĠN BELĠRLENMESĠ

A. EġEYĠN BELĠRLENMESĠ Modern Genetik Biyoloji Ders Notları A. EġEYĠN BELĠRLENMESĠ Bazı omurgasız hayvanlarda ve tam çiçek bulunduran bitkilerin büyük çoğunluğunda hem dişi hem de erkek organ birlikte bulunur. Bazı canlılarda

Detaylı

MAYOZ VE EŞEYLİ YAŞAM DÖNGÜLERİ

MAYOZ VE EŞEYLİ YAŞAM DÖNGÜLERİ MAYOZ VE EŞEYLİ YAŞAM DÖNGÜLERİ Kalıtıma giriş Ebeveynler yavrularına gen adı verilen kodlanmış bilgileri verirler. Genler DNA parçalarıdır. Çoğu gen, hücreyi özgün enzimler ve diğer proteinleri sentezlemesi

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

Şekil 1. Mitoz bölünmenin profaz evresi.

Şekil 1. Mitoz bölünmenin profaz evresi. KONU 9. HÜCRE BÖLÜNMESİ MİTOZ BÖLÜNME Mitoz bölünme tek hücreli canlılardan, çok hücreli canlılara ve insana kadar birçok canlı grubu tarafından gerçekleştirilebilir. Mitoz bölünme sonunda bölünen hücrelerden

Detaylı

ADIM ADIM YGS LYS Adım EVRİM

ADIM ADIM YGS LYS Adım EVRİM ADIM ADIM YGS LYS 191. Adım EVRİM EVRİM İLE İLGİLİ GÖRÜŞLER Evrim, geçmiş ile gelecekteki canlıların ve olayların yorumlanmasını sağlayarak, bugün dünyada yaşayan canlılar arasındaki akrabalık derecesini

Detaylı

Genetik Algoritmalar. Bölüm 1. Optimizasyon. Yrd. Doç. Dr. Adem Tuncer E-posta:

Genetik Algoritmalar. Bölüm 1. Optimizasyon. Yrd. Doç. Dr. Adem Tuncer E-posta: Genetik Algoritmalar Bölüm 1 Optimizasyon Yrd. Doç. Dr. Adem Tuncer E-posta: adem.tuncer@yalova.edu.tr Optimizasyon? Optimizasyon Nedir? Eldeki kısıtlı kaynakları en iyi biçimde kullanmak olarak tanımlanabilir.

Detaylı

8. SINIF KAZANIM TESTLERİ 1.SAYI. Ar-Ge Birimi Çalışmasıdır ŞANLIURFA İL MİLLİ EĞİTİM MÜDÜRLÜĞÜ DİZGİ & TASARIM İBRAHİM CANBEK MEHMET BOZKURT

8. SINIF KAZANIM TESTLERİ 1.SAYI. Ar-Ge Birimi Çalışmasıdır ŞANLIURFA İL MİLLİ EĞİTİM MÜDÜRLÜĞÜ DİZGİ & TASARIM İBRAHİM CANBEK MEHMET BOZKURT 8. SINIF ŞANLIURFA İL MİLLİ EĞİTİM MÜDÜRLÜĞÜ KAZANIM TESTLERİ TÜRKÇE MATEMATİK T.C İNKİLAP TARİHİ VE ATATÜRKÇÜLÜK FEN VE TEKNOLOJİ DİN KÜLTÜRÜ VE AHLAK BİLGİSİ İNGİLİZCE Ar-Ge Birimi Çalışmasıdır 1.SAYI

Detaylı

YGS YE HAZIRLIK DENEMESi #7

YGS YE HAZIRLIK DENEMESi #7 YGS YE HAZIRLIK DENEMESi #7 1) 48 saat karanlıkta bekletilen bir saksı bitkisinden bu sürenin sonunda bir yaprak kopartılmış (1. yaprak) ve bitki aydınlık ortamda 12 saat bekletilmiştir. Bu sürenin sonunda

Detaylı

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA (Ribonükleik Asit) Nükleik asitler, Friedrich Miescher tara2ndan 1869'da keşfedildi. İl=haplı bandajlardan izole edilen bu maddeye nüklein adını

Detaylı

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces YAPAY KROMOZOMLAR Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces cerevisiae. de kurulmuştur. Halkasal plazmid maya sentromerinden,replikasyon orijininden, seçici bir işaret geninden ve

Detaylı

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir.

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. METABOLİZMA ve ENZİMLER METABOLİZMA Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. A. ÖZÜMLEME (ANABOLİZMA) Metabolizmanın yapım reaksiyonlarıdır. Bu tür olaylara

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

Muhasebe Entegrasyon Tanımlarının Yapılması. Stok Programından Yapılan Muhasebe Entegrasyon Tanımları

Muhasebe Entegrasyon Tanımlarının Yapılması. Stok Programından Yapılan Muhasebe Entegrasyon Tanımları Muhasebe Entegrasyon Tanımlarının Yapılması Cari, fatura, çek/senet, kasa ve banka gibi modülerden hareket girişleri yapıldığında bu hareketler anlık olarak muhasebe programına entegre edilerek muhasebe

Detaylı

Dersin Kodu 1206.7102. Dersin Seviyesi

Dersin Kodu 1206.7102. Dersin Seviyesi Evrim Dersin Adı Dersin Seviyesi Evrim Dersin Kodu 1206.7102 Dersin Türü Dersin AKTS Kredisi 4,00 Haftalık Ders Saati (Kuramsal) 2 Haftalık Uygulama Saati 0 Haftalık Laboratuar Saati 0 Dersin Verildiği

Detaylı

3) Aşağıda verilen ifadelerden hangisi mayoz bölünmenin sebep olduğu faydalardan değildir?

3) Aşağıda verilen ifadelerden hangisi mayoz bölünmenin sebep olduğu faydalardan değildir? 1) 3) Aşağıda verilen ifadelerden hangisi mayoz bölünmenin sebep olduğu faydalardan değildir? A) Genetik yapısı aynı hücreler oluşur. B) Tür içi çeşitliliğin ortaya çıkmasını sağlar. C) Eşeyli üreme için

Detaylı

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin.

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin. GENOMUN YAPISI Gen ve un tanımı Büyüklükleri Dizi Tipleri Doç. Dr. Metin Aytekin www.metinaytekin.com Erciyes Üniversitesi Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı 11 Kasım 2014 Nedir? Bir organizmanın

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI Moleküler biyolojiye giriş Doç.Dr.Pınar AKSOY SAĞIRLI Molecular biology terimi ilk kez Warren Weaver tarafından 1938 de kullanıldı. Hayatın fiziksel ve kimyasal olarak açıklanması olarak tanımlandı. 1977

Detaylı

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky.

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky. Evrimsel Perspektifte KARŞILAŞTIRMALI GENOMİK Fatih Dikmen http://cigbrowser.berkeley.edu/ Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky Santral Dogma kavramı 1958

Detaylı

Mutasyon ve Genetik Sürüklenme

Mutasyon ve Genetik Sürüklenme Mutasyon ve Genetik Sürüklenme Bir popülasyondaki alel frekanslarını değiştiren doğal sebepler Doğal seçilim Mutasyon Genetik sürüklenme Kurucu etki (Founder effect) Popülasyon darboğazı, MUTASYON Genel

Detaylı

B unl a r ı B i l i yor mus unuz? MİTOZ. Canlının en küçük yapı biriminin hücre olduğunu 6. sınıfta öğrenmiştik. Hücreler; hücre zarı,

B unl a r ı B i l i yor mus unuz? MİTOZ. Canlının en küçük yapı biriminin hücre olduğunu 6. sınıfta öğrenmiştik. Hücreler; hücre zarı, MİTOZ Canlının en küçük yapı biriminin hücre olduğunu 6. sınıfta öğrenmiştik. Hücreler; hücre zarı, sitoplazma ve çekirdekten meydana gelmiştir. Hücreler büyüme ve gelişme sonucunda belli bir olgunluğa

Detaylı

Bir çiftin dört çocuğunun kan grubu yukarıdaki gibidir. Buna göre aşağıdakilerden hangisi anne ve babanın kan gruplarından olamaz?

Bir çiftin dört çocuğunun kan grubu yukarıdaki gibidir. Buna göre aşağıdakilerden hangisi anne ve babanın kan gruplarından olamaz? 4) İnsanlarda kahverengi gözlülük yeşil gözlülüğe baskındır.aşağıda verilen göz genotiplerinden hangisine sahip olan aileden, yeşil gözlü çocuk olma ihtimali yoktur? 1) Himalaya tavşanı, tüyü kazınıp buz

Detaylı

MAYOZ BÖLÜNME ve EŞEYLİ ÜREME

MAYOZ BÖLÜNME ve EŞEYLİ ÜREME MAYOZ BÖLÜNME ve EŞEYLİ ÜREME MBG 111 BİYOLOJİ I Hazırlayan: Yrd.Doç.Dr. Yosun MATER Türe ait genetik özelliklerin soylar arası aktarılmasına kalıtım adı verilir. Bu işleyişte türlerin genetik bilgisinin

Detaylı