Ebat: px
Şu sayfadan göstermeyi başlat:

Download "ANTİ-TÜBERKÜLOZ İLAÇ DUYARLILIK TESTLERİ ve TÜRKİYE VERİLERİ. Dr. Ali ALBAY Gülhane Askeri Tıp Akademisi Tıbbi Mikrobiyoloji. AD."


1 ANTİ-TÜBERKÜLOZ İLAÇ DUYARLILIK TESTLERİ ve TÜRKİYE VERİLERİ Dr. Ali ALBAY Gülhane Askeri Tıp Akademisi Tıbbi Mikrobiyoloji. AD. Öğretim Üyesi

2 Tüberküloz tüm dünyada özellikle Asya ve Afrika da önemli bir hastalık ve ölüm sebebi Mycobacterium tuberculosis, tek bir infeksiyöz ajana bağlı ölümlerin sebebi olarak ilk sıralarda

3 DSÖ ne göre 2008 yılında; * 9.4 milyon yeni vaka * 4.1 milyon kişi yeni yayma pozitif (toplam vakaların ~ %44 ü) * Global insidans 139/ * 1.3 milyon HIV ( ) ölüm * 0.52 milyon kişi HIV (+) ölüm * Toplam ~ 1.8 milyon kişi

4 Tüberküloz tanısında kullanılan geleneksel yaklaşımlar; Aside dirençli boyama ve mikroskopi Katı veya sıvı besiyerine ekim Basilin tanımlanması Antibiyotik duyarlılık testlerinin yapılması **Moleküler tanı yöntemleri

5 CDC (Centers for Disease Control and Prevention) Her hasta için kültürde izole edilen ilk M.tuberculosis izolatına duyarlılık testi Üç aylık tedaviden sonra, * kültür pozitifliği devam eden veya * klinik yanıtsızlığı olan her hastada testin tekrarı

6 CLSI a göre Primer İlaçlar İzoniazid Rifampisin Etambutol Pirazinamid Ülkemizde Primer İlaçlar İzoniazid Rifampisin Etambutol Streptomisin Sekonder ilaçlar Streptomisin Kapreomisin Etionamid Kanamisin Kinolonlar Rifabutin PAS


8 Multidrug Resistant-Tuberculosis (MDR-TB) Çok İlaca Dirençli-Tüberküloz (ÇİD-TB) Duyarlı TB tedavisi 6040 MDR TB tedavisi

9 Extensively Drug Resistant-Tuberculosis (XDR-TB) Yaygın İlaç Dirençli-Tüberküloz (YİD-TB) Extremely Drug-Resistant TB (XXDR-TB)!!??

10 Hızlı Güvenilir Basit Ekonomik

11 Anti-Mikobakteriyel Duyarlılık Test Yöntemleri Konvansiyonel yöntemler Proporsiyon (orantı) yöntemi Direnç oranı yöntemi Mutlak konsantrasyon yöntemi Genotipik (Moleküler) yöntemler DNA dizi analizi Reverse hibridizasyon testi (Line probe Assay) RNA/RNA mismatch analiz Heterodubleks analiz SSCP (Single strand conformation polymorphism) Real-time PCR DNA microarray PCR-ELISA Kültüre dayalı hızlı yöntemler BACTEC 460 TB MGIT 960 Versa TREK (ESP II) BacT/Alert 3D (MB/BACT) Kültüre dayalı diğer yöntemler Disk elüsyon E test MODS Kolorimetrik yöntemler Mycolor-TK Resazurin (Alamar mavisi) Canlı bakteri varlığına dayalı yöntemler Flow sitometri Lusiferaz taşıyıcı faj yöntemi Faj çoğaltma yöntemi

12 Agar Proporsiyon (orantı) Yöntemi Canettii, Rist ve Grosset tarafından 1960 ların başında Pirazinamid dışındaki tüm antimikobakteriyel ilaçlar için güvenilir bir yöntemdir Test edilecek bakteri suşu değişik dilüsyonlarda ( ) standardize edilerek sayılabilir koloniler elde edilir Test suşu ilaçlı ve ilaçsız besiyerlerine ekilir K I K I R E R E


14 Agar Proporsiyon Yöntemi Kontrol İlaçlı K/İ < %1 Duyarlı İlaçlı K/İ > %1 Dirençli NCCLS; 2002: M24-T2

15 Agar Proporsiyon Yöntemi

16 Besiyeri Lowenstein-Jensen (LJ) Uzun süre saklanabilir Ekonomiktir Koagülasyon işlemi sırasında ilaç büyük oranda inaktive olur CLSI tarafından önerilmemektedir. Middlebrook 7H10-7H11 Raf ömrü kısa Pahalı Daha kısa sürede (21 gün) Daha güvenilir

17 Kritik Konsantrasyon(KK): Belli bir oranda veya miktarda bakteri üremesine izin verilen (belli oran veya miktarda üremesi direnç testi açısından önemli olmayan) besiyeri içerisindeki antibiyotik konsantrasyonudur. Kritik Proporsiyon(KP): Kritik konsantrasyonda üremesine izin verilen basil popülasyonu oranıdır. Proporsiyon yönteminde amaç; KK da dirençli olan bakterilerin KP un üzerinde olup olmadığını saptamaktır. Kritik Proporsiyon genelde %1 LJ de bazı ilaçların KP u %10 (SM, ETH vs.)

18 Kritik Konsantrasyon (KK) İlaç-yöntem-besiyeri etkileşimleri sonucu ulaşılmış ve standardize edilmiş değerdir. Bu konsantrasyonlarda bakterinin üremesi engelleniyor ise ilacın o bakteriye etkili olduğu söylenebilir. Yönteme ve besiyerine göre KK farklılığı İlacın, bazı besiyeri komponentlerine farklı oranlarda bağlanması ve absorbsiyonu Besiyerinin hazırlanması sırasında değişik oranlarda inaktivasyonu, Yeterli üreme için gerekli olan sürede değişik oranlarda inaktivasyonu

19 Antitüberküloz ilaç 7H10 LJ KK (μg/ml) KP (%) KK (μg/ml) KP (%) İzoniazid (INH) Rifampisin (RİF) Streptomisin (SM) Ethambutol (EMB) Pirazinamid (PZA)* 50.0? Amikasin (AMK) Kapreomisin (KAP) Kanamisin (KAN) Etyonamid (ETH) Klofazimin (CLF) Sikloserin (CYC) Ofloksasin (OFL) PAS

20 Test edilen suşun dirençli yada duyarlı olduğuna KK da karar verilir. Bazı ilaçların yüksek konsantrasyonunun da test edilmesi önerilir. INH 0.2μg/ml (KK) R düşük düzeyde INH 1.0μg/ml S direnç Bu durumda INH ın tedavi rejiminde yer alması yararlı olabilir.

21 Direnç Oranı Yöntemi Standart suş M. tuberculosis H37Rv Test suşu TS/SS MİK 2 duyarlı TS/SS MİK 8 dirençli Değerlendirmesi zordur, yeterli çalışma yoktur, hata oranı yüksek

22 Mutlak Konsantrasyon Yöntemi Kontrol İlaçlı Duyarlı Dirençli 2x10 3 veya 1x10 4 cfu/ml mikobakteri, dört hafta sonra İlaçlı besiyerinde 20 cfu dan fazla koloni dirençli Hata oranı yüksek

23 Genotipik testler (2-8 h) Canlı bakteri varlığına dayalı testler (2-10 gün) Sıvı besiyerinde kültüre dayalı testler (1-2 hf) Katı besiyerinde kültüre dayalı testler (3-4 hf) Middlebrook 7H10 (3 hf) LJ (4 hf)

24 Hızlı Ticari Sistemler

25 Hızlı Ticari Sistemler Hızlı ticari sistemlerde elde edilen sonuç, Test edilen izolatın herhangi bir ilaca karşı dirençli olduğunu gösteriyorsa, Kararsız kalınmışsa Standart agar proporsiyon yöntemi ile testin tekrarı, Tekrar sırasında İNH ın yüksek konsantrasyonunun da test edilmesi önerilmiştir

26 BACTEC 460 TB (Becton Dickinson) B460 radyoaktif atık üreten yarı otomatize bir sistemdir BACTEC 12B şişesi, Middlebrook 7H9, karbon kaynağı 14 C işaretli palmitik asit içerir 14 C işaretli palmitik asit kullanımı 14 CO 2 Üreme İndeksi (GI) DSÖ ve CLSI standart yöntem 5-7 günde sonuç

27 Günlük GI Gün Kontrol SM INH R I F EMB Δ GI

28 Modifiye Middlebrook 7H9 tüpleri Tüpün dibinde silikona gömülü O 2 ile bileşik halde bulunan fenatrolin rutenyum klorid pentahidrat adında floresans veren bir indikatör bulunmakta Mikobakteriler tüpteki O 2 ni tüketmekte İndikatör serbest kalarak floresans açığa çıkmakta Floresans miktarı, üreme indeksi olarak değerlendirilmekte

29 MGIT 960 Sistemi (BD) O 2 O 2 CO 2 O 2 O 2 O 2 O 2 O 2 O 2 O 2 O 2 O 2 CO 2 CO 2 O 2 O 2 O 2 CO 2 FO 2 FO FO 2 FO 2 F 2 F FO FO2 F 2 FO 2 F F F FO 2 F F F FO 2 F F


31 Modifiye Middlebrook 7H9 sıvı besiyeri içeren şişeler Kolorimetrik, bilgisayar destekli kapalı sistem BACTEC 460TB ve proporsiyon ile,özellikle INH ve RIF sonuçları uyumlu BacT/ALERT 3D - (240 lık) Saptama süresi B460 TB ye yakın

32 Her şişenin tabanında silikona gömülü kolorimetrik sensör bulunmakta, Sensör, mikobakterilerin oluşturduğu çözünmüş CO 2 değişimine ve bunun sonucunda değişen ph ya duyarlı renk değişikliği Pozitiflik durumunda sensörün rengi koyu yeşilden sarıya dönmekte

33 BACTEC 460TB ve proporsiyon ile uyumlu Saptama süresi B460 TB ye yakın

34 TK Kültür Sistemi (Salubris) İzolasyon: TK Medium, TK SLC (selektif, PolyPANT: polimiksin B, piperasilin, amfoterisin B, nalidiksik asit, trimetoprim ) Tür ayrımı: TK PNB (p-nitro-benzoik asit) Anti-TB ilaçlara duyarlılık: TK INH, TK RIF, TK STR ve TK EMB katı besiyerleri ve TKPZA MYCOLOR TK otomatik okuyucu inkübatör

35 TK Kültür Sistemi (Salubris) TK Medium, çoklu renk indikatörleri kimyasından yararlanılarak hazırlanmış Mikobakterilerin ürettiği metabolitlere ve enzimlere bağlı olarak TK Medium besiyerinin orijinal KIRMIZI renkten SARIya Diğer bakteri veya fungal türlerin varlığında ise KIRMIZI renk YEŞİLe dönmekte



38 Primer antitüberküloz ilaçların MİK değerleri Test süresi ortalama 5 gün (5-10 gün) Yüksek konsantrasyonda inokulum, pahalı Gelişmekte olan ülkeler için çok uygun değil Etest / BACTEC460 (J Clin Microbiol 2002; 40: 6, ) RIF de %97, INH da %96 ve STR de %80

39 Genotipik Yöntemler İlaç Direnç geni Mutasyonun sıklığı (%) RİF rpob INH katg inha kasa - ahpc PZA pnca EMB embcab STR rpsl rrs 8-21 FQ gyra gyrb -

40 DNA eldesi Genotipik Yöntemler Aynı Farklı Hedef bölgenin amplifikasyonu TTCTTCGGCACCAGCCAGCTGAG CCAATTCATGGACCAGAACAACC CGCTGTCGGGGTTGACCCACAAG CGCCGACTGTCGGCGCTGGGGC n Duyarlı Dirençli Mutasyonun saptanması

41 Dünya Sağlık Örgütü 2009 Global Raporu Bütün TB vakalarının %5 i ÇİD-TB 2007 yılında civarında yeni ÇİD-TB En fazla görülen beş ülke; Hindistan Çin Rusya Federasyonu Güney Afrika Bangladeş *** Eski Sovyetler Birliği ülkelerinde yeni vakaların %10 u ÇİD-TB, bunların da 1/10 u YİD-TB

42 Ülkemizde daha önce yapılan çalışmalarda; Yöntemlerin farklı olması Kullanılan ilaç konsantrasyonlarının belirtilmemesi Standart ve ortak miktarda ilaç kullanılmaması Türkiye Ulusal Tüberküloz Sürveyans araştırması (TUTSA) verileri; Dispanserlere kayıtlı tüm hastaların sonuçlarından oluşmaktadır




46 Türkiye de Tüberküloz İlaç Direnci Türkiye de birçok merkezde bu amaçla çalışmalar yapılmaktadır. ÇİD-TB oranları % 3 ila % 14 arasında değişmektedir. *GATA Tıbbi Mikrobiyoji AD da ( , , ) total ÇİD-TB oranları; * % 1.7, % 2.6, % 2.9 * INH direnci; % 9.8, % 15.2, % 17.8 * RIF direnci; % 2.6, % 3.3, % 4.0 Aydın ve ark Trabzon-ÇİD-TB %4.36 Ocak ve ark Kocaeli- ÇİD-TB %2 Aktaş ve ark Erzurum- ÇİD-TB %2.7 Durmaz ve ark Malatya-ÇİD-TB % 4.8

47 Türkiye de Tüberküloz İlaç Direnci *Sekonder anti-tüberküloz ilaçlar ile ilgili sınırlı verilere sahibiz *Özkütük ve ark Manisa da 40 MDR-TB suşuna sekonder anti-tb. duy. Testi * Bir tanesi YİD-TB olarak saptanmış * Türkiye de ilk YİD-TB vakası Türkiye de anti tüberküloz ilaç direnci çok yüksek değilmiş gibi görünse de, bu direnç uzun yıllardan beri devam etmekte olup mutlaka dikkate alınması gerekir. Hedef bu direnç oranlarının gelişmiş ülkelerdeki daha düşük seviyelere indirilmesi olmalıdır.

48 Ali Albay


YOTİK K DUYARLILIK TEST YÖNTEMLERY NTEMLERİ. Mikrobiyoloji ve Klinik Mikrobiyoloji AD ANTİBİYOT YOTİK K DUYARLILIK TEST YÖNTEMLERY NTEMLERİ Dr Nuri ÖZKÜTÜK Celal Bayar Üniversitesi Tıp T p Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji AD MANİSA Tüberküloz ile savaşta en etkili yol; Hastalarının


Antimikobakteriyel Direnç Mekanizmaları ve Duyarlılık Testleri

Antimikobakteriyel Direnç Mekanizmaları ve Duyarlılık Testleri Antimikobakteriyel Direnç Mekanizmaları ve Duyarlılık Testleri Doç. Dr. Nuri ÖZKÜTÜK Celal Bayar Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD MANİSA Sunum İçeriği Mikobakterilerde direnç mekanizmaları


Küresel Bir Problem Olarak Tüberküloz. Prof. Dr. Ali ALBAY Gülhane Askeri Tıp Akademisi Tıbbi Mikrobiyoloji. AD. Öğretim Üyesi

Küresel Bir Problem Olarak Tüberküloz. Prof. Dr. Ali ALBAY Gülhane Askeri Tıp Akademisi Tıbbi Mikrobiyoloji. AD. Öğretim Üyesi Küresel Bir Problem Olarak Tüberküloz Prof. Dr. Ali ALBAY Gülhane Askeri Tıp Akademisi Tıbbi Mikrobiyoloji. AD. Öğretim Üyesi Tüberküloz: En eski hastalıklardan Tedavisi var Korunabilir En yaygın ve ölümcül


Yeni İlaç Duyarlılık Testleri Çalışmaları Prof. Dr. Ahmet Yılmaz ÇOBAN

Yeni İlaç Duyarlılık Testleri Çalışmaları Prof. Dr. Ahmet Yılmaz ÇOBAN Yeni İlaç Duyarlılık Testleri Çalışmaları Prof. Dr. Ahmet Yılmaz ÇOBAN Ondokuz Mayıs Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Samsun Sunum içeriği I Nitrat redüktaz testi (NRT) Direkt test; İndirekt


İlaç direnci saptanmasında yeni yöntemler. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR

İlaç direnci saptanmasında yeni yöntemler. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR İlaç direnci saptanmasında yeni yöntemler Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR 2050 TB Eliminasyon Hedefi (WHO; Global Tuberculosis Report 2012)



KLASİK ANTİBİYOTİK DUYARLILIK TEST YÖNTEMLERİ 21. Yüzyılda Tüberküloz Sempozyumu ve II. Tüberküloz Laboratuvar Tanı Yöntemleri Kursu, Samsun KLASİK ANTİBİYOTİK DUYARLILIK TEST YÖNTEMLERİ Y. Doç. Dr Özlem Tansel Trakya Üniversitesi Tıp Fakültesi, İnfeksiyon








SALUBRIS Gateway to Health Worldwide Dünya Çapında Sağlığa Açılan Kapı

SALUBRIS Gateway to Health Worldwide Dünya Çapında Sağlığa Açılan Kapı SALUBRIS Gateway to Health Worldwide Dünya Çapında Sağlığa Açılan Kapı Dekontaminasyon ve Konsantrasyonun Üç Yolu Mycoprosafe Decocent - Decomics Prof. Dr. Tanıl Kocagöz Kuruluş 2003 Çalışan sayısı 35


İkinci Sıra İlaç Direncinin Moleküler Yöntemlerle Saptanması

İkinci Sıra İlaç Direncinin Moleküler Yöntemlerle Saptanması İkinci Sıra İlaç Direncinin Moleküler Yöntemlerle Saptanması Doç. Dr. Nuri ÖZKÜTÜK Celal Bayar Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD MANİSA Sunum Planı Tüberkülozda ilaç direnci ilgili tanımlar








Mikobakteriyolojide Örneklerin İşlenmesi, Mikroskopi, Moleküler Yöntemler ve Duyarlılık Testleri

Mikobakteriyolojide Örneklerin İşlenmesi, Mikroskopi, Moleküler Yöntemler ve Duyarlılık Testleri Mikobakteriyolojide Örneklerin İşlenmesi, Mikroskopi, Moleküler Yöntemler ve Duyarlılık Testleri Doç.Dr. Alpaslan Alp Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Ekim Öncesinde


Mikobakteriyolojide yeni nesil dizileme ile analiz

Mikobakteriyolojide yeni nesil dizileme ile analiz Mikobakteriyolojide yeni nesil dizileme ile analiz Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, İzmir Mikobakteriyolojide kullanım alanları Moleküller epidemiyoloji



TÜBERKÜLOZ LABORATUVARI TEST REHBERİ TÜBERKÜLOZ LABORATUVARI TEST REHBERİ TEST ADI SONUÇ VERME ARB (Aside Dirençli Bakteri) Boyalı Direkt Bakı Erlich- Ziehl Neelsen boyamalı preparatta mikroskobik inceleme (acil ise her saat). Her gün 14:30,


Çok ilaca dirençli Mycobacterium tuberculosis izolatlarının hızlı tespitinde nitrat redüktaz testinin değerlendirilmesi: Çok merkezli bir çalışma

Çok ilaca dirençli Mycobacterium tuberculosis izolatlarının hızlı tespitinde nitrat redüktaz testinin değerlendirilmesi: Çok merkezli bir çalışma Çok ilaca dirençli Mycobacterium tuberculosis izolatlarının hızlı tespitinde nitrat redüktaz testinin değerlendirilmesi: Çok merkezli bir çalışma Ahmet Yılmaz Çoban 1, Berika Taştekin 1, Meltem Uzun 2,


Propolisin Mikobakterilere Karşı in-vitro Etkinliğinin Araştırılması

Propolisin Mikobakterilere Karşı in-vitro Etkinliğinin Araştırılması Propolisin Mikobakterilere Karşı in-vitro Etkinliğinin Araştırılması Melek İnci 1, Ayşe Nedret Koç 2, Mustafa Altay Atalay 2, Sibel Silici 3, Hafize Sav 2, Fatma Mutlu Sarıgüzel 4, Aslıhan Gültekin Çökük


Mycobacterium Tuberculosis ve Direnç

Mycobacterium Tuberculosis ve Direnç Mycobacterium Tuberculosis ve Direnç Selin Yılmaz, Ayşe Şenol, Gülay Çandır, Bekem Güvenir Danışman: J. Sedef Göçmen ÖZET Tüberküloz(TB) dünya çapında hala çözülemeyen en eski sağlık sorunlarından biridir.


Tüberküloz laboratuvarında kalite kontrol

Tüberküloz laboratuvarında kalite kontrol Tüberküloz laboratuvarında kalite kontrol Prof. Dr. Aydan Özkütük Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Sunum planı Kalite gereklilikleri Yöntem geçerli kılma İç Kalite Kontrol


Sivas İlinde Klinik Örneklerden İzole Edilen Mycobacterium tuberculosis Kompleks Suşlarının Primer Anti-tüberküloz İlaçlara Direnç Oranları

Sivas İlinde Klinik Örneklerden İzole Edilen Mycobacterium tuberculosis Kompleks Suşlarının Primer Anti-tüberküloz İlaçlara Direnç Oranları Türk Mikrobiyol Cem Derg 1(1):371, 2011 doi:10.5222/tmcd.2011.037 Araştırma Sivas İlinde Klinik Örneklerden İzole Edilen Mycobacterium tuberculosis Kompleks Suşlarının Primer Antitüberküloz İlaçlara Direnç


Tüberküloz Tanısında Yeni Moleküler Testler

Tüberküloz Tanısında Yeni Moleküler Testler Tüberküloz Tanısında Yeni Moleküler Testler Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Bornova-İZMİR Hızlı tanıda kullanılan yöntemler PCR (Polymerase chain


T.C. SAĞLIK BAKANLIĞI Verem Savaşı Daire Başkanlığı

T.C. SAĞLIK BAKANLIĞI Verem Savaşı Daire Başkanlığı T.C. SAĞLIK BAKANLIĞI Verem Savaşı Daire Başkanlığı Uzm. Dr. Feyzullah GÜMÜŞLÜ Verem Savaşı Dairesi Başkanı Kurs Programı Tüberküloz tanı ve tedavisi TB bakteriyolojik tanısında yeni yöntemler 23 Nisan


ANTİ-TÜBERKÜLOZ İLAÇLARA KARŞI DİRENÇ MEKANİZMALARI. Prof. Dr. Yasemin BULUT Fırat Üniversitesi, Tıp Fakültesi, Tıbbi Mikrobiyoloji AD.

ANTİ-TÜBERKÜLOZ İLAÇLARA KARŞI DİRENÇ MEKANİZMALARI. Prof. Dr. Yasemin BULUT Fırat Üniversitesi, Tıp Fakültesi, Tıbbi Mikrobiyoloji AD. ANTİ-TÜBERKÜLOZ İLAÇLARA KARŞI DİRENÇ MEKANİZMALARI Prof. Dr. Yasemin BULUT Fırat Üniversitesi, Tıp Fakültesi, Tıbbi Mikrobiyoloji AD. ELAZIĞ Tüberküloz, Mycobacterium tuberculosis in sebep olduğu değişik



TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM) TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM) Ne zaman etkendir? Duyarlılık testleri ne zaman ve nasıl yapılmalıdır? Nasıl tedavi edilmelidir? TDM NE ZAMAN ETKENDİR? Şebeke suyundan, topraktan, doğal sulardan,


Doğrudan klinik örnekte hızlı tanı. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR

Doğrudan klinik örnekte hızlı tanı. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR Doğrudan klinik örnekte hızlı tanı Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR TİCARİ KONVANSİYONEL PCR SİTEMLERİ TİCARİ REAL-TIME PCR SİTEMLERİ IN-HOUSE


Evaluation of Second-Line Antituberculosis Drug Susceptibilities of Multidrug-Resistant Mycobacterium tuberculosis Complex Isolates by E-Test Method

Evaluation of Second-Line Antituberculosis Drug Susceptibilities of Multidrug-Resistant Mycobacterium tuberculosis Complex Isolates by E-Test Method Özgün Çalışma/Original Article Mikrobiyol Bul 2015; 49(1): 47-55 Çok İlaca Dirençli Mycobacterium tuberculosis Kompleks İzolatlarında İkinci Basamak Antitüberküloz İlaç Duyarlılıklarının E-Test Yöntemi


İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler. O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi

İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler. O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi TB solunum yoluyla bulaşan önlenebilir bir hastalıktır Bulaşları





Konya İlinde Klinik Örneklerden İzole Edilen Mycobacterium tuberculosis Kompleks Suşlarının Birinci Seçenek Anti-tüberküloz İlaçlara Direnç Oranları

Konya İlinde Klinik Örneklerden İzole Edilen Mycobacterium tuberculosis Kompleks Suşlarının Birinci Seçenek Anti-tüberküloz İlaçlara Direnç Oranları doi:10.5222/tmcd.2016.165 Araştırma Konya İlinde Klinik Örneklerden İzole Edilen Mycobacterium tuberculosis Kompleks Suşlarının Birinci Seçenek Anti-tüberküloz İlaçlara Direnç Oranları Fatma ESENKAYA TAŞBENT*,


Çok ilaca dirençli tüberküloz tedavisinde cerrahinin yeri. Dr. Kemal Tahaoğlu Antalya 2007

Çok ilaca dirençli tüberküloz tedavisinde cerrahinin yeri. Dr. Kemal Tahaoğlu Antalya 2007 Çok ilaca dirençli tüberküloz tedavisinde cerrahinin yeri Dr. Kemal Tahaoğlu Antalya 2007 Tüberküloz tedavisinin tarihçesi İkinci Yüzyıl İstirahat, Diyet Öksürüğün önlenmesi Onsekizinci Yüzyıl Kır havası


Izmir Ataturk Training and Research Hospital, Medical Microbiology Laboratory, Izmir, Turkey.

Izmir Ataturk Training and Research Hospital, Medical Microbiology Laboratory, Izmir, Turkey. Özgün Çalışma/Original Article Mikrobiyol Bul 2011; 45(4): 623-631 Mycobacterium tuberculosis İzolatlarının Antitüberküloz İlaçlara Duyarlılığının Saptanmasında Antibiyotikli Löwenstein-Jensen Besiyerinde


İLAÇ DİRENCİNİN TESPİTİ. Dr.Meltem Uzun İstanbul Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı

İLAÇ DİRENCİNİN TESPİTİ. Dr.Meltem Uzun İstanbul Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı İLAÇ DİRENCİNİN TESPİTİ Dr.Meltem Uzun İstanbul Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı DSÖ nün 2013 verilerine göre, 9.0 milyon kişide tb gelişti (2012 de 8.6 milyon) 9.0


suşlarının dört farklı yöntemle antimikobakteriyel ajanlara duyarlılık tespiti

suşlarının dört farklı yöntemle antimikobakteriyel ajanlara duyarlılık tespiti doi 10.5578/tt.7323 Geliş Tarihi/Received: 25.10.2013 Kabul Ediliş Tarihi/Accepted: 09.03.2014 KLİNİK ÇALIŞMA RESEARCH ARTICLE Van yöresinde izole edilen Mycobacterium tuberculosis suşlarının dört farklı


Kayseri Eğitim ve Araştırma Hastanesi, Göğüs Kliniği, Mikrobiyoloji Laboratuvarı, KAYSERİ 2



Yaygın İlaç Dirençli Tüberküloz (YİD-TB)

Yaygın İlaç Dirençli Tüberküloz (YİD-TB) Şeref ÖZKARA Atatürk Göğüs Hastalıkları ve Göğüs Cerrahisi Eğitim ve Araştırma Hastanesi, ANKARA ÖZET Yaygın ilaç dirençli tüberküloz (YİD-TB), Dünya Sağlık Örgütü (DSÖ) Görev Grubu tarafından Ekim 2006






ANTİTÜBERKÜLOZ İLAÇLARA DİRENÇ MEKANİZMALARI ve YENİ İLAÇLAR 21. Yüzyılda Tüberküloz Sempozyumu ve II. Tüberküloz Laboratuvar Tanı Yöntemleri Kursu, Samsun ANTİTÜBERKÜLOZ İLAÇLARA DİRENÇ MEKANİZMALARI ve YENİ İLAÇLAR Prof. Dr. Nuri Kiraz Osmangazi Üniversitesi Tıp


TB Laboratuvar Tanısında Kullanılan Geleneksel Yaklaşımlar * Aside dirençli boyama * Mikroskopi * Kültür (Katı(Katı-Sıvı) * Seroloji?? * Moleküler yöntemler KÜLTÜR YÖNTEMLERİ Geç sonuç alınması Altın standart


Tüberkülozun Mikrobiyolojik Tanısı. Süheyla SÜRÜCÜOĞLU

Tüberkülozun Mikrobiyolojik Tanısı. Süheyla SÜRÜCÜOĞLU Tüberkülozun Mikrobiyolojik Tanısı Süheyla SÜRÜCÜOĞLU Tüberkülozun etkin kontrolü için; Yayma sonuçları Kültür ve identifikasyon Duyarlılık testleri ; 24 saat ; 21 gün ; 30 günde bildirilmeli CDC, 1995


Tüberküloz Sorun mudur? Tüberkülozun güncel tanısı ve sorunlar

Tüberküloz Sorun mudur? Tüberkülozun güncel tanısı ve sorunlar Tüberküloz Sorun mudur? Tüberkülozun güncel tanısı ve sorunlar Dr. Nurhan Albayrak Türkiye Halk Sağlığı Kurumu, Ulusal TB Referans Laboratuvarı Tüberküloz Sorun mu? Dünyanın en ölümcül bulaşıcı hastalığı



ÖRNEKLERİN İŞLEMLENMESİ ve KÜLTÜR YÖNTEMLERİ 21. Yüzyılda Tüberküloz Sempozyumu ve II. Tüberküloz Laboratuvar Tanı Yöntemleri Kursu, Samsun ÖRNEKLERİN İŞLEMLENMESİ ve KÜLTÜR YÖNTEMLERİ Doç. Dr. Meltem Uzun İ.Ü İstanbul Tıp Fakültesi, Mikrobiyoloji





Prof. Dr. Ayşe Yüce. Dokuz Eylül Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Nisan-2014

Prof. Dr. Ayşe Yüce. Dokuz Eylül Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Nisan-2014 Prof. Dr. Ayşe Yüce Dokuz Eylül Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Nisan-2014 1 Global Tuberculosis Report 2013, World Health Organization 2 Kötü sosyo-ekonomik



MIDDLE-BROOK 7H10 BESİYERİ İLE ANTİBİYOTİK DUYARLILIK TESTLERİ 21. Yüzyılda Tüberküloz Sempozyumu ve II. Tüberküloz Laboratuvar Tanı Yöntemleri Kursu, Samsun MIDDLE-BROOK 7H10 BESİYERİ İLE ANTİBİYOTİK DUYARLILIK TESTLERİ Doç. Dr. Hakan Öztürkeri Girne Askeri Hastanesi,


Anahtar sözcükler: Mycobacterium tuberculosis, antitüberküloz ilaçlar, büyük hata, çok büyük hata.

Anahtar sözcükler: Mycobacterium tuberculosis, antitüberküloz ilaçlar, büyük hata, çok büyük hata. Özgün Çalışma/Original Article Mikrobiyol Bul 2009; 43: 403-409 MİKOBAKTERİLERİN MAJÖR ANTİTÜBERKÜLOZ İLAÇLARA DUYARLILIĞININ OTOMATİZE BACTEC MGIT 960 SİSTEMİ İLE ARAŞTIRILMASI VE RADYOMETRİK BACTEC 460






BACTEC MGIT 960 PZA Kit BACTEC MGIT 960 PZA Kit Mycobacterium tuberculosis in Antimikobakteriyel Duyarlılık Testi için L005486JAA 2007/03 Türkçe KULLANIM AMACI BACTEC MGIT 960 PZA Kit ( BACTEC MGIT 960 PZA Kiti), kültürdeki Mycobacterium


2000-2012 Yılları Arasında Ülkemizde Kan Kültürü ve Antibiyotik Duyarlılık Sonuçlarının Değerlendirmesi

2000-2012 Yılları Arasında Ülkemizde Kan Kültürü ve Antibiyotik Duyarlılık Sonuçlarının Değerlendirmesi 2000-2012 Yılları Arasında Ülkemizde Kan Kültürü ve Antibiyotik Duyarlılık Sonuçlarının Değerlendirmesi Serap SÜZÜK 1, Ekrem YAŞAR 2, Sebahat AKSARAY 3 1 Kırıkkale Yüksek İhtisas Hastanesi 2 Diyarbakır





Genişlemiş Spektrumlu Beta-Laktamaz Üreten Gram Negatif Kan İzolatları: Karbapenemlere Duyarlılık ve Fenotipik/Genotipik Direnç Mekanizmaları

Genişlemiş Spektrumlu Beta-Laktamaz Üreten Gram Negatif Kan İzolatları: Karbapenemlere Duyarlılık ve Fenotipik/Genotipik Direnç Mekanizmaları Genişlemiş Spektrumlu Beta-Laktamaz Üreten Gram Negatif Kan İzolatları: Karbapenemlere Duyarlılık ve Fenotipik/Genotipik Direnç Mekanizmaları 1. ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 12-16 KASIM 2011, ANTALYA






ÇEŞİTLİ KLİNİK ÖRNEKLERDEN İZOLE EDİLEN MYCOBACTERIUM TUBERCULOSIS KOMPLEKSİ SUŞLARININ MAJÖR ANTİTÜBERKÜLOZ İLAÇLARA DİRENÇ ORANLARI* Çeşitli Türk Mikrobiyol Klinik Örneklerden Cem Derg İzole (2009) Edilen 39 Mycobacterium (3-4): 89-93 Tuberculosis Kompleksi Suşlarının Majör Antitüberküloz İlaçlara Direnç Oranları 1993 Türk Mikrobiyoloji





Çok İlaca Dirençli Tüberkülozdan Sonra Yaygın İlaca Dirençli ve Tüm İlaçlara Dirençli Tüberküloz Formları: Eski Hastalığın Yeni Yüzleri

Çok İlaca Dirençli Tüberkülozdan Sonra Yaygın İlaca Dirençli ve Tüm İlaçlara Dirençli Tüberküloz Formları: Eski Hastalığın Yeni Yüzleri Derleme Yazı/Review Article Mikrobiyol Bul 2011; 45(1): 181-195 Çok İlaca Dirençli Tüberkülozdan Sonra Yaygın İlaca Dirençli ve Tüm İlaçlara Dirençli Tüberküloz Formları: Eski Hastalığın Yeni Yüzleri Extensively


Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları. Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna

Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları. Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları Dr Dilara








Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı

Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Antibiyotik kullanımına bağlı ishal etkeni olan Clostridium difficile, nozokomiyal diyarenin en sık






TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM Doç. Dr. Alpaslan Alp Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Dünya Sağlık Örgütü 2009 Yılı Raporu Aktif tüberkülozlu hasta





Jülide Sedef GÖÇMEN*, Altan AKSOY*, Teoman Zafer APAN*, Demet KARNAK**, Oya KAYACAN**

Jülide Sedef GÖÇMEN*, Altan AKSOY*, Teoman Zafer APAN*, Demet KARNAK**, Oya KAYACAN** Ankara Üniversitesi Tıp Fakültesi Göğüs Hastalıkları Anabilim Dalı, Tüberküloz Laboratuvarında 2001-2006 yılları Arasında İzole Edilmiş Mycobacterium Tuberculosis Suşlarında İlaç Direnci Jülide Sedef GÖÇMEN*,


Özel durumlarda tüberküloz tedavisi. Dr. Serir Aktoğu Özkan İzmir Göğüs Hastalıkları ve Cerrahisi Eğitim ve Araştırma Hastanesi

Özel durumlarda tüberküloz tedavisi. Dr. Serir Aktoğu Özkan İzmir Göğüs Hastalıkları ve Cerrahisi Eğitim ve Araştırma Hastanesi Özel durumlarda tüberküloz tedavisi Dr. Serir Aktoğu Özkan İzmir Göğüs Hastalıkları ve Cerrahisi Eğitim ve Araştırma Hastanesi ÖZEL DURUMLARDA TÜBERKÜLOZ TEDAVİSİ Gebelik Lohusalık, emzirme,



VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Viroloji Ünitesi Viral Enfeksiyonlar... Klinik


Tersiyer referans hastanesinde Mycobacterium tuberculosis izolasyon sıklığı ve dört major anti-tüberküloz ilaca karşı duyarlılık durumu

Tersiyer referans hastanesinde Mycobacterium tuberculosis izolasyon sıklığı ve dört major anti-tüberküloz ilaca karşı duyarlılık durumu 240 JCEI / M. Saygun ve ark. M.tuberculosis isolation frequency and resistance 2012; 3 (2): 240-244 Journal of Clinical and Experimental Investigations doi: 10.5799/ahinjs.01.2012.02.0151 RESEARCH ARTICLE





3. OLGU. Tüberküloz Kursu 2008 Antalya

3. OLGU. Tüberküloz Kursu 2008 Antalya 3. OLGU Tüberküloz Kursu 2008 Antalya 43 yaşında erkek hasta, çiftçi Yakınması: Öksürük, balgam, balgamla karışık kan tükürme, nefes darlığı Hikayesi: Yaklaşık 5 aydır öksürük ve balgam yakınması olan



BACTEC MGIT 960 SIRE Kitleri BACTEC MGIT 960 SIRE Kitleri Mycobacterium tuberculosis in Antimikobakteriyel Duyarlılık Testi İçin Tasarlanmıştır. 8008200 2007/03 Türkçe KULLANIM AMACI BACTEC MGIT 960 SIRE Kiti kültürdeki Mycobacterium


Mikobakterilerin Üretilmesinde Kanlı Agar Besiyerinin Değerlendirilmesi*

Mikobakterilerin Üretilmesinde Kanlı Agar Besiyerinin Değerlendirilmesi* Özgün Çalışma/Original Article Mikrobiyol Bul 2011; 45(4): 617-622 Mikobakterilerin Üretilmesinde Kanlı Agar Besiyerinin Değerlendirilmesi* Evaluation of Blood Agar Medium for the Growth of Mycobacteria








Mikrobiyol Bul 2010; 44: Özgün Çalışma/Original Article



Laboratuvarda Tularemi Örnekleriyle Çalışma Rehberi

Laboratuvarda Tularemi Örnekleriyle Çalışma Rehberi Laboratuvarda Tularemi Örnekleriyle Çalışma Rehberi Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Bakteri ile çalışmaya uygun laboratuar


Enfeksiyon odaklarından izole edilen Gram negatif ve Gram pozitif bakterilerde antimikrobiyal duyarlılık sonuçları

Enfeksiyon odaklarından izole edilen Gram negatif ve Gram pozitif bakterilerde antimikrobiyal duyarlılık sonuçları Enfeksiyon odaklarından izole edilen Gram negatif ve Gram pozitif bakterilerde antimikrobiyal duyarlılık sonuçları Doç. Dr. Gönül Şengöz 13 Haziran 2015 KAYIP DİLLERİN FISILDADIKLARI SERGİSİ-İSTANBUL Antimikrobiyal


442 Mycobacterium tuberculosis Su unda BACTEC Yöntemi ile Kombine laç Direncinin Ara tırılması

442 Mycobacterium tuberculosis Su unda BACTEC Yöntemi ile Kombine laç Direncinin Ara tırılması ARAŞTIRMA / Original Article TÜBERKÜLOZ / Tuberculosis Toraks Dergisi 7; 8(3): 174-178 442 Mycobacterium tuberculosis Su unda BACTEC Yöntemi ile Kombine laç Direncinin Ara tırılması Özlem Bayraktar Saral









DÜNYADA VE TÜRKİYE DE TÜBERKÜLOZ DÜNYADA VE TÜRKİYE DE TÜBERKÜLOZ Esra Nurlu Temel Süleyman Demirel Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. KASIM 2015 Isparta Tüberküloz çok eski çağlardan beri bilinen





Akreditasyon Sertifikası Eki (Sayfa 1/11) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/11) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/11) Tıbbi Laboratuar Adresi :Sağlık Mahallesi Saygun Caddesi No:55 Sıhhiye 06100 ANKARA / TÜRKİYE Tel : 0 312 565 53 62 Faks : 0 312 565 54 55 E-Posta :


*WHO Report 2009.Global Tuberculosis Control

*WHO Report 2009.Global Tuberculosis Control TÜBERKÜLOZUN MOLEKÜLER TANISINDA TİCARİ SİSTEMLER Doç.Dr.Mustafa ÖZYURT GATA Haydarpaşa Eğitim Hastanesi Kl.Mikrobiyoloji Servisi TÜBERKÜLOZ* Dünyada en sık ölüme neden olan infeksiyonlardan biri


DÜNYA SAĞLIK ÖRGÜTÜ - STANDART TÜBERKÜLOZ TEDAVİSİ, Haziran 2004, Gözden geçirme STAG tarafından onaylanmıştır. (Çeviri: Şeref Özkara)

DÜNYA SAĞLIK ÖRGÜTÜ - STANDART TÜBERKÜLOZ TEDAVİSİ, Haziran 2004, Gözden geçirme STAG tarafından onaylanmıştır. (Çeviri: Şeref Özkara) DÜNYA SAĞLIK ÖRGÜTÜ - STANDART TÜBERKÜLOZ TEDAVİSİ, Haziran 2004, Gözden geçirme STAG tarafından onaylanmıştır. (Çeviri: Şeref Özkara) 4. STANDART TEDAVİ REJİMLERİ 4.1 Bölümün konusu Bu bölüm, değişik


Laboratuvar Sürveyans Ağı (TULSA) Çalışmaları

Laboratuvar Sürveyans Ağı (TULSA) Çalışmaları Laboratuvar Sürveyans Ağı (TULSA) Çalışmaları Nilay Uçarman, Ahmet Arslantürk, Hülya Şimşek, Ulusal Tüberküloz Referans Laboratuvarı 37. TMC Kongresi 16-20 Kasım 2016, Antalya 1 Sunum içeriği TULSA nın



DÜNYA TÜBERKÜLOZ GÜNÜ DÜNYA TÜBERKÜLOZ GÜNÜ TÜBERKÜLOZ Hastalık etkeni nedir? Çağlar öncesinden beri bilinen tüberküloz (TB) hala dünya çapında önemli bir halk sağlığı problemi olmaya devam etmektedir. Halk arasında ince hastalık


VERİFİKASYON. Dr. Tijen ÖZACAR. Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD - İZMİR

VERİFİKASYON. Dr. Tijen ÖZACAR. Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD - İZMİR VERİFİKASYON Dr. Tijen ÖZACAR Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD - İZMİR TANIM Ticari veya laboratuvarda geliştirilmiş bir testin, laboratuvardaki performansının ölçülerek dökümante


Gereç ve yöntem. Şişli Hamidiye Etfal EAH- 700-yataklı. Yenidoğan yoğun bakım ünitesi -29 yataklı Bir izolasyon odası Üç farklı bölüm

Gereç ve yöntem. Şişli Hamidiye Etfal EAH- 700-yataklı. Yenidoğan yoğun bakım ünitesi -29 yataklı Bir izolasyon odası Üç farklı bölüm Amaç Şişli Hamidiye Etfal EAH yenidoğan yoğun bakım ünitesinde üç haftalık süreçte üç hastanın idrar örneğinden karbapenem dirençli Klebsiella oxytoca üremesi üzerine yapılan salgın incelemesi Gereç ve


Özel durumlarda tüberküloz tedavisi

Özel durumlarda tüberküloz tedavisi Özel durumlarda tüberküloz tedavisi Dr. Serir Aktoğu Özkan İzmir Göğüs Hastalıkları ve Cerrahisi Eğitim ve Araştırma Hastanesi ÖZEL DURUMLARDA TÜBERKÜLOZ TEDAVİSİ Gebelik Lohusalık, emzirme,


Klinik Örneklerden İzole Edilen E.coli Suşlarının Kümülatif Antibiyotik Duyarlılıklarının Belirlenmesi

Klinik Örneklerden İzole Edilen E.coli Suşlarının Kümülatif Antibiyotik Duyarlılıklarının Belirlenmesi Klinik Örneklerden İzole Edilen E.coli Suşlarının Kümülatif Antibiyotik Duyarlılıklarının Belirlenmesi Mine Aydın Kurç,Özge Tombak,Dumrul Gülen,Hayati Güneş,Aynur Eren Topkaya Antibiyotik duyarlılık raporlarının


Bununla birlikte tüberkülozla savaş yeterli bütçeyi büyük ölçüde bulamamaktadır. Bu kabul edilemez bir durumdur.

Bununla birlikte tüberkülozla savaş yeterli bütçeyi büyük ölçüde bulamamaktadır. Bu kabul edilemez bir durumdur. DÜNYA SAĞLIK ÖRGÜTÜ (DSÖ) 2012 KÜRESEL TÜBERKÜLOZ RAPORUNU YAYIMLADI - Genç Gelişim K Tüberküloz, ülkemizdeki adıyla verem, havayolu ile bulaşan ve öldürebilen bir hastalıktır. Çok az maliyetle tedavi


Dr. Servet ALAN Memorial Sağlık Grubu

Dr. Servet ALAN Memorial Sağlık Grubu Dr. Servet ALAN Memorial Sağlık Grubu Olgu 1 56 y, Erkek Karaciğer sirozu, hepatit B, C, ve HCC Hepatik ensefalopati KC alıcı VDRL: + TPHA: + (1/640) Anti-TP : + Olgu 1 Preoperatif 10 gün seftriakson 1x1





AGHH de 1997 Yılında Tüberküloz İlaç Direnç Oranları

AGHH de 1997 Yılında Tüberküloz İlaç Direnç Oranları AGHH de 1997 Yılında Tüberküloz İlaç Direnç Oranları Gülnaz ÇOBAN, Behiye AKKALYONCU, Tuğrul ŞİPİT, Bahadır BERKTAŞ, Berna DURSUN, Ayşe GÖZÜ Atatürk Göğüs Hastalıkları ve Göğüs Cerrahisi Eğitim ve Araştırma


ARAŞTIRMA (Research Report)



Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test. Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul

Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test. Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul Sorunlu Mikroorganizmalar Nonfermentatif bakteriler Acinetobacter sp. Stenotrophomonas


T.C. Sağlık Bakanlığı Türkiye Halk Sağlığı Kurumu






Ulusal Tüberküloz Laboratuvar Sürveyansına İlk Adım; Ankara, 2011

Ulusal Tüberküloz Laboratuvar Sürveyansına İlk Adım; Ankara, 2011 Özgün Çalışma/Original Article Mikrobiyol Bul 2015; 49(2): 143-155 Ulusal Tüberküloz Laboratuvar Sürveyansına İlk Adım; Ankara, 2011 The First Step for National Tuberculosis Laboratory Surveillance; Ankara,


Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans



NON-MOLEKÜLER TEKN KLER N TANI AMAÇLI KULLANIMLARI NON-MOLEKÜLER TEKN KLER N TANI AMAÇLI KULLANIMLARI Yrd.Doç.Dr.Alpaslan ALP Hacettepe Üniversitesi T p Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji AB Dal, ANKARA Tüberküloz kontrolünde anahtar faktörler


SSK Ballıdağ Göğüs Hastalıkları Hastanesi nde Yılları Arasında İzlenen Tüberküloz Olgularında İlaç Direnci

SSK Ballıdağ Göğüs Hastalıkları Hastanesi nde Yılları Arasında İzlenen Tüberküloz Olgularında İlaç Direnci SSK Ballıdağ Göğüs Hastalıkları Hastanesi nde 1995-1997 Yılları Arasında İzlenen Tüberküloz Olgularında İlaç Direnci Sefa Levent ÖZŞAHİN*, Özgür KARACAN**, Remziye EL***, Zuhal GÜLLÜ**** * SSK Ankara Eğitim
