KAFKAS ÜNİVERSİTESİ VETERİNER FAKÜLTESİ DERGİSİ

Transkript

1

2 ISSN: e-issn: KAFKAS ÜNİVERSİTESİ VETERİNER FAKÜLTESİ DERGİSİ THE JOURNAL OF THE FACULTY OF VETERINARY MEDICINE UNIVERSITY OF KAFKAS (MAYIS - HAZİRAN) (MAY - JUNE) Cilt/Volume: 18 Sayı/Number: 3 Yıl/Year: 2012

3 This journal is indexed and abstracted by Thomson Reuters Services beginning with Volume 13 (1) 2007 in the followings: Science Citation Index Expanded (also known as SciSearch ) Journal Citation Reports/Science Edition This journal is also indexed and abstracted in: ELSEVIER CAB Abstracts TÜRKİYE ATIF DİZİNİ ULAKBİM-TÜBİTAK EBSCO Bu dergi Kafkas Üniversitesi Veteriner Fakültesi tarafından iki ayda bir yayımlanır This journal is published bi-monthly, by the Faculty of Veterinary Medicine, University of Kafkas YAZIŞMA ADRESİ (Address for Correspondence) Kafkas Üniversitesi Veteriner Fakültesi Dergisi Editörlüğü Kars / TÜRKİYE Phone: /5228 Fax: vetdergi@kafkas.edu.tr ELEKTRONİK BASKI (Electronic Edition) ISSN: ONLINE MAKALE GÖNDERME (Online Submission)

4 YABANCI DİL EDİTÖRLERİ (English Editors) Doç.Dr. Hasan ÖZEN Doç.Dr. Ahmet ÜNVER İSTATİSTİK EDİTÖRÜ (Statıstıcs Editor) Prof.Dr. Gül ERGÜN Prof.Dr. Kemal AK Prof.Dr. Harunl AKSU Prof.Dr. Belma ALABAY Prof.Dr. Mustafa ALİŞARLI Prof.Dr. Feray ALKAN Prof.Dr. Çiğdem ALTINSAAT Prof.Dr. Kemal ALTUNATMAZ Prof.Dr. Mustafa ARICAN Prof.Dr. Mustafa ATASEVER Prof.Dr. Sırrı AVKİ Prof.Dr. Metin BAYRAKTAR Prof.Dr. Burhan ÇETİNKAYA Prof.Dr. Nazir DUMANLI Prof.Dr. Hasan Hüseyin DÖNMEZ Prof.Dr. Hüdaverdi ERER Prof.Dr. Ayhan FİLAZİ Prof.Dr. Ekrem GÜREL Prof.Dr. Tolga GÜVENÇ Prof.Dr. Ali İŞMEN Prof.Dr. Hakkı İZGÜR Prof.Dr. Zafer KARAER Prof.Dr. Arif KURTDEDE Prof.Dr. Erdoğan KÜÇÜKÖNER Prof.Dr. Mehmet MADEN Prof.Dr. Kamil ÖCAL Prof.Dr. Metin PETEK Prof.Dr. Sevim ROLLAS Prof.Dr. Berrin SALMANOĞLU Prof.Dr. Nesrin SULU Prof.Dr. Ayşe TOPAL Prof.Dr. Ş. Doğan TUNCER Prof.Dr. Cevdet UĞUZ Prof.Dr. Zafer ULUTAŞ Prof.Dr. Rıfat VURAL Prof.Dr. Cengiz YALÇIN Prof.Dr. Halis YERLİKAYA Kafkas Üniversitesi Veteriner Fakültesi Adına Sahibi (Owner) Prof.Dr. Hidayet Metin ERDOĞAN Dekan (Dean) EDİTÖR (Editor-in-Chief) Prof.Dr. İsa ÖZAYDIN EDİTÖR YARDIMCILARI (Associate Editors) Prof.Dr. Mehmet ÇİTİL Doç.Dr. Özgür AKSOY Yrd.Doç.Dr. Duygu KAYA DANIŞMA KURULU (Advisory Board) SAYFA DÜZENİ (Composition) Dr. Erol AYDIN SEKRETER (Secretary) Fahri ALTUN İstanbul Üniversitesi Veteriner Fakültesi İstanbul Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi İstanbul Üniversitesi Veteriner Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Atatürk Üniversitesi Veteriner Fakültesi Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Abant İzzet Baysal Üniversitesi Fen Edebiyat Fakültesi Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Süleyman Demirel Üniversitesi Mühendislik Mimarlık Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Adnan Menderes Üniversitesi Veteriner Fakültesi Uludağ Üniversitesi Veteriner Fakültesi Marmara Üniversitesi Eczacılık Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Uludağ Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Afyon Kocatepe Üniversitesi Veteriner Fakültesi Gaziosmanpaşa Üniversitesi Zirrat Fakültesi Ankara Üniversitesi Veteriner Fakültesi Dicle Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi BASKI (Print) ESER OFSET MATBAACILIK Tel: ERZURUM

5 Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) AÇIKGÖZ Zümrüt AKÇA Atilla AKSOY Melih AKYÜZ Bilal ALKAN Fahrettin ALTINER Ayşen ALTUĞ Gülşen ALTUĞ Nuri ARICAN Mustafa ARSLAN Cavit ARSLAN Öznur ATAKİŞİ Onur AYAŞAN Tugay AYHAN Veysel BAHAR Sadullah BARAN Alper BAŞTAN Ayhan BERİK Nermin BİLGİLİ Hasan BÜYÜKOĞLU Tülay CERİT Harun ÇETİNKAYA Nurcan ÇOBAN Özlem EMİR ÇOLAK Armağan ÇOLPAN İrfan DENEK Nihat EGEMEN Özdemir ERDEM Hüseyin ERDOĞAN Metin ERDOĞAN Zeynep ERGUN Sebahattin EŞSİZ Dinç EYDURAN Ecevit GÖKÇEN Ahmet GÜLER Mehmet GÜLŞEN Nurettin GÜNGÖR Örsan İNCİ Abdullah KABAK Murat KALE Mehmet KARA Murat KARAKAŞ Alper KARAKURUM Çağrı KART Asım KEÇECİ Tufan KILIÇ Nuh KIRIKÇI Kemal KOYUNCU Mehmet KUMLAY Ahmet Metin KURAR Ercan KURTOĞLU Firuze Ege Üniversitesi Ziraat Fakültesi Zootekni Bölümü Kafkas Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Adnan Menderes Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı Erciyes Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı İstanbul Üniversitesi Su Ürünleri Fakültesi Temel Bilimler Bölümü Mustafa Kemal Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Erciyes Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Doğu Akdeniz Tarımsal Araştırma Enstitüsü Müdürlüğü Süleyman Demirel Üniversitesi Ziraat Fakültesi Zootekni Bölümü Selçuk Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi İşleme Teknolojisi Bölümü Ankara Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı Afyon Kocatepe Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Fırat Üniversitesi Su Ürünleri Fakültesi Su Ürünleri İşleme Teknolojisi Atatürk Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Harran Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Ege Üniversitesi Su Ürünleri Fakültesi Temel Bilimler Bölümü Selçuk Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Afyon Kocatepe Üniversitesi Veteriner Fakültesi Medikal Biyoloji ve Genetik Anabilim Dalı Mustafa Kemal Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Su Ürünleri Yetiştiriciliği Bölümü Kafkas Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı Iğdır Üniversitesi Ziraat Fakültesi Zootekni Bölümü Harran Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Erciyes Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Viroloji Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Abant İzzet Baysal Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Fizyoloji Anabilim Dalı Adnan Menderes Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Uludağ Üniversitesi Ziraat Fakültesi Zootekni Bölümü Iğdır Üniversitesi Ziraat Fakültesi Tarla Bitkileri Bölümü Selçuk Üniversitesi Veteriner Fakültesi Genetik Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı

6 Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) KÜPLÜLÜ Şükrü LAÇİN Ekrem MUTUŞ Rıfat NAK Yavuz ODABAŞIOĞLU Fuat OĞAN Mustafa OĞUZ Fatma KARAKAŞ OĞUZOĞLU Tuba Çiğdem OKUMUŞ Zafer OR Erman ÖZCAN Ayla Özcan CENGİZ ÖZGEL Özcan ÖZKAN Kadircan ÖZMEN Özlem ÖZTÜRKLER Yavuz PANCARCI Şükrü Metin SAÇAKLI Pınar ŞAHİN Emine Hesna ŞENLİK Bayram ŞİRİN Özlem ŞENGÖZ TATLI SEVEN Pınar TİLKİ Muammer UYSAL Ongun VURAL Rıfat YALÇIN Sakine YETİŞEMİYEN Atila YILDIZ Gültekin YILDIZ Harun YILMAZ Alper YILMAZ Fetih YİĞİT Murat Ankara Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Atatürk Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı Uludağ Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Mustafa Kemal Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Uludağ Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Viroloji Anabilim Dalı Atatürk Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Adnan Menderes Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı Mehmet Akif Ersoy Üniversitesi Patoloji Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Afyon Kocatepe Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Uludağ Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı Fırat Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Zootekni ve Hayvan Besleme Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Ankara Üniversitesi Ziraat Fakültesi Süt Teknolojisi Bölümü Ankara Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Temel Bilimler Bölümü İstanbul Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Fırat Üniversitesi Veteriner Fakültesi Patoloji Anabilim Dalı Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Yetiştiricilik Bölümü

7 İÇİNDEKİLER (Contents) ARAŞTIRMA MAKALELERİ (Research Articles) Fertility and Milk Production Characteristics of Saanen Goats Raised in Muş Region BOLACALI M, KUCUK M... Effects of Dietary Puncture Vine (Tribulus terrestris) Powder in Different Carriers on Growth Performance, Carcass Characteristics and Blood Parameters of Broiler Chicks DURU M, SAHIN A... Effects of Antioxidants Resveratrol, Catechin and Lipoic Acid and Carcinogen KBrO 3 on Lipophylic Vitamins and Cholesterol in Lung, Liver and Kidney of Wistar Rats KESER S, YILMAZ O, TUZCU M, ERMAN O, IRTEGUN S... Etlik Piliçlerde Kısıtlı Yemlemenin Performans Özelliklerine Etkisi SHADDEL TELLI AA, ALARSLAN OF, ALTINSAAT C, MAHERI SIS N, HATEFI NAZHAD K, AHMADZADEH A... Stereological Measurement of Testicular Volume in Kivircik Rams GEZER INCE N, PAZVANT G, OTO C, KAHVECIOGLU O... Identification of β-lactoglobulin Gene SacII Polymorphism in Honamli, Hair and Saanen Goat Breeds Reared in Burdur Vicinity KORKMAZ AGAOGLU O, CINAR KUL B, AKYUZ B, ELMAZ O, OZCELIK METIN M, SAATCI M, ERTUGRUL O... Growth Performance and Body Composition in Mirror Carp (Cyprinus carpio) Fed Culban Seed (Vicia peregrina) with Different Heat Treatments BUYUKCAPAR HM... Ham Petrolün Poecilia sphenops (Valenciennes, 1846) (Cyprinidae, Teleostei) Deri Histolojisi Üzerine Etkileri ONEN O, GOKCE B, ERGEN G, ISISAG UCUNCU S... Identifying the Bacteria Causing Ovine Gangrenous Mastitis and Detection of Staphylococcus aureus in Gangrenous Milk by PCR TEL OY, BOZKAYA F... The Effect of Amniotic Membrane on Serum Biochemical Parameters in Experimentally Induced Non-Sterile Clean Wound Inflammation HISMIOGULLARI SE, HISMIOGULLARI AA, YAMAN I, YAVUZ O, SEYREK K, KARACA O, KARA C, HAYIRLI A.. Changes in Hematological and Biochemical Parameters of European Chub (Squalius cephalus L.) in Unpolluted Reservoir and Polluted Creek CELIK ES, KAYA H, YILMAZ S... Determination of Potential Nutritive Value of Exotic Tree Leaves in Turkey CANBOLAT O... Effects of Mass Selection Based on Phenotype and Early Feed Restriction on the Performance and Carcass Characteristics in Japanese Quails NARINC D, AKSOY T... Excision Arthroplasty of the Hip Joint in Dogs: The Role of Age, Weight, Degenerative Joint Disease on the Outcome FATTAHIAN H, MOHYEDDIN H, HOSEINZADEH A, AKBAREIN H, MORIDPOUR R... Ördeklerin Kesim ve Karkas Özelliklerine Cinsiyet ve Irkın Etkisi SARI M, ONK K, TILKI M, AKSOY AR... Effect of Salting and Packaging Treatments on Fresh Rainbow Trout (Oncorhynchus mykiss) Fillets During Storage at Refrigerator Temperatures OGUZHAN P, ANGIS S... Antimicrobial Susceptibility, Presence of Resistance Genes and Biofilm Formation in Coagulase Negative Staphlococci Isolated from Subclinical Sheep Mastitis ERGUN Y, ASLANTAS O, KIRECCI E, OZTURK F, CEYLAN A, BOYAR Y... Sayfa (Page)

8 Sayfa (Page) The Investigation of Pestivirus and Rift Valley Fever Virus Infections in Aborted Ruminant Foetuses in the Blacksea Region in Turkey ALBAYRAK H, OZAN E... Expression of Epidermal Growth Factor (EGF) and Heparin-Binding EGF (HB-EGF) mrna in Mare Endometrium ATLI MO, GUZELOGLU A, KURAR E, KAYIS SA, ASLAN S, SEMACAN A, CELIK S... Clinical and Histopathological Evaluation of Bovine Ocular and Periocular Neoplasms in 15 Cases in Sanliurfa Region CEYLAN C, OZYILDIZ Z, YILMAZ R, BIRICIK HS... The Effect of Different Storage Temperature on Sperm Parameters and DNA Damage in Liquid Stored New Zealand Rabbit Spermatozoa SARIOZKAN S, CANTURK F, YAY A, AKCAY A... The Determination of Some Morphological Characteristics of Honamlı Goat and Kids, Defined as A New Indigenius Goat Breed of Turkey ELMAZ O, SAATCI M, MAMAK N, DAG B, AKTAS AH, GOK B... Effect of Adding Linseed and Selenium to Diets of Layer Hen s on Performance, Egg Fatty Acid Composition and Selenium Content GURBUZ E, BALEVI T, COSKUN B, CITIL OB... Acute Phase Proteins, Clinical, Hematological and Biochemical Parameters in Dairy Cows Naturally Infected with Anaplasma Marginale COSKUN A, DERINBAY EKICI O, GUZELBEKTES H, AYDOGDU U, SEN I... Antibacterial Effects of Ethanol and Acetone Extract of Plantago major L. on Gram Positive and Gram Negative Bacteria METINER K, OZKAN O, AK S... Effects of Long and Short-Term Progestagen Treatments Plus GnRH Followed by TAI on Fertility Parameters in Lactating Hair Goats during the Transition Period SARIBAY MK, KARACA F, DOGRUER G, ATES CT... Effect of Presence of Corpus Luteum at the Beginning of Ovsynch Protocol on Pregnancy Rates in Lactating Dairy Cows CINAR M, GUZELOGLU D, ERDEM H... Effectiveness of Aglepristone at Lower-Than-Standard Doses in Prevention of Pregnancy in Mismated Bitches KANCA H, KARAKAS K KISA BİLDİRİ (Short Communıcatıon) Clinical Effectiveness of Ivermectin on Bovine Dermatophytosis KIRMIZIGUL AH, GOKCE E, SAHIN M, KIZILTEPE S, BUYUK F, ERKILIC EE OLGU SUNUMU (Case Report) Holstein Irkı Bir İnekte Hemorajik Bağırsak Sendromu: Olgu Sunumu CIFTCI MK, YAVUZ O, HATIPOGLU F, OZDEMIR O

9 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Fertility and Milk Production Characteristics of Saanen Goats Raised in Muş Region [1] Memiş BOLACALI * Mürsel KÜÇÜK * [1] This study was summarized from PhD thesis of first author * Yüzüncü Yıl University, Faculty of Veterinary Medicine, Department of Animal Husbandry, TR Van - TURKEY Makale Kodu (Article Code): KVFD Summary The aim of this study was to determine the fertility and milk yield characteristics of Saanen goats raised in Muş province, Eastern Anatolia region. This experiment was carried out in Düzova village of Korkut country, Muş. 129 female and 8 male Saanen goats, for first year and 122 female and 7 male Saanen goats for second year ( ) were utilized for mating seasons. Goats were fertilized as free mating in the years (August-September). Percentages of pregnancy, abortion, birth, single birth and twinning were 90.04, 9.73, 81.27, and 57.84%, respectively, kid yields per birth and yields of kids were 1.59 and 129%, respectively. Lactation period, daily milk yield and milk yield per lactation were d, 1.37 kg and kg. The effects of factors such as year, age and birth types on fertility and lactation of goats were evaluated. In conclussion, the reproduction and milk production data obtained in the current study from Saanen goats raised in Muş province have revealed that Saanen goats can be used for goat milk and kid production in the region. Keywords: Goat, Saanen, Fertility, Milk yield Özet Muş Bölgesinde Yetiştirilen Saanen Keçilerinin Döl Verimi ve Süt Verimi Özellikleri Bu araştırma, Doğu Anadolu Bölgesi Muş ilinde yetiştirilen Saanen keçilerinin döl verimi ve süt verimi özelliklerini belirlemek amacıyla yapılmıştır. Bu çalışma, Muş ili Korkut ilçesi Düzova Köyünde özel bir işletmede yürütülmüştür ve 2008 sıfat sezonlarında sırasıyla 129 ve 122 baş Saanen keçisi, 8 ve 7 baş Saanen tekesi kullanılmıştır. Keçiler 2007 ve 2008 yılı sıfat sezonlarında (Ağustos- Ekim) serbest sıfat yöntemiyle tohumlanmıştır. Saanen keçilerinde gebelik, abort, doğum, tek doğum ve ikiz doğum oranları genel olarak sırasıyla %90.04, 9.73, 81.27, ve 57.84; bir doğumda ortalama doğan oğlak sayısı 1.59 ve oğlak verimi ise %129 olarak saptanmıştır. Laktasyon süresi, günlük süt verimi ve laktasyon süt verimi genel olarak sırasıyla gün, 1.37 kg ve kg olarak saptanmıştır. Keçilerin döl verimi ve laktasyon süt verimi üzerine yıl, yaş ve doğum tipi gibi faktörlerin etkisi incelenmiştir. Sonuç olarak, Muş ilinde yetiştirilen Saanen keçileri üzerinde yürütülen bu araştırmada elde edilen dölverimi ve süt verimi özelliklerine ait bulgular ışığında, Saanen keçi ırkının bölgede keçi sütü ve oğlak üretiminde kullanılabileceği sonucuna varılmıştır. Anahtar sözcükler: Keçi, Saanen, Döl verimi, Süt verimi INTRODUCTION The world s goat population was around 867 million in 2009, with over 60% of that found in Asia and more than 95% in developing countries. Since 1990, there has been a significant increase (47%) in goat numbers all over the world. The goat population has been described as comprising three main types; namely, fiber goats (e.g. Angora, Cashmere), dairy goats (e.g. Saanen, Toggenburg, Nubian), and meat goats (e.g. Boer, Spanish). Annual mean milk production per goat is 84.3 kg in worldwide. When countries are ranked based on annual milk production per goat, Germany comes first with a kg, Belarus is second with kg and Czech Republic comes third with kg. However, Turkey is ranked 43th with kg 1. İletişim (Correspondence) /1554 bolacali@yyu.edu.tr

10 352 Fertility and Milk Production... Goat farming is highly common in Turkey due to geographical and economical conditions of Turkey, agricultural background and traditions of Turkish people. Turkish goat population comprises of hair, Angora and dairy goats. Based on 2009 statistics, Turkish goat population is ranked 27th in World with and has great potential as number of goats. Majority of Turkish goat population consists of hair goat, followed by Angora, dairy and their cross-breeds. Contribution of goat into meat and milk production as percentage in animal production sector is considerable. Goat milk comprises of 1.53%, of total milk production and goat meat comprises of 2.83% of total meat production in Turkey in Moreover goat provided 2002 tons of goat hair and 174 tons of mohair 1-3. There are some criteria used in the evaluation of fertility. These are: pregnancy rate, infertility rate, mortality rate, birth rate, abortion rate, single kidding rate, twinning rate, mean kid number per birth and kid yield. These criteria are under the effects of dam s age, genotype, live weight and environmental climate conditions such as season, feeding and hormones. However, numbers of weaned kids are used as main criteria for fertility in practice 4-7. Following factors can be counted as factors affecting milk production in goats. These factors are; pure breeding, crossing, age, birth season, birth type, duration of lactation and dry period, milking type, frequency and duration of milking, mating season, first pregnancy age, survival rate of kids, nutrition and diseases. Saanen goat which is the most commonly used breed in goat breeding studies possesses kg milk yield with 3-4% fat content, d of lactation period kidding rate and kg live weight 8. Lactation period and milk yield of Saanen goat raised at Aegean Sea region ranged 213 d and kg; 247d and kg in first and second lactation periods, respectively. Averages of these values after 8 years of control studies were d and kg, respectively 9. The aim of this study was to determine the fertility and milk yield characteristics of Saanen goats raised in Muş province, Eastern Anatolia region. MATERIAL and METHODS The experiment was conducted at Düzova village of Korkut county of Muş province with a Project prepared by village administration (Project reference number: DG- ELARG/MEDTQ/04-01/ARD-176). Animal materials of the experiment consisted of Saanen male and female goats obtained from Sarıdüz and Türkmenli villages of Bayramiç county of Çanakkale province and Animal husbandry and Agricultural research center of Çanakkale Onsekiz Mart University in July female and 8 male Saanen goats for first year and 122 female and 7 male Saanen goats for second year ( ) were utilized for mating seasons. Goats were fertilized as free mating in year (August-September). Goats were grazed on pasture which belong to the village during April-June months (first 90 days of lactation), and also fed 500 g of concentrate feed per day per animal. Thus, animals were taken to highland pasture due to significant reduction of pasture quality in July. Goats were grazed on highland pasture from July to October. Goats were brought back to barn at November and kept in a barn from October to March. Goats were fed 200 g/animal/d oncentrate and ground alfalfa hay ad libitum. Data regarding fertility were calculated according to Akçapınar and Özbeyaz 5. Pregnancy rate; number of pregnant goat/number of goat for mating *100 İnfertility rate; number of none-pregnant goat/number of goat for mating * 100 Birth rate; number of goat having birth/number of goat for mating * 100 Abortion rate; number of goat with abortion/number of pregnant goat * 100 Single kidding rate; number of goat with single kid/ number of goat having birth * 100 Twinning rate; number of goat with twin kids/number of goat having birth * 100 Mean kid number per birth; number of kid born/number of goat having birth * 100 Kid yield; number of kid born/number of goat for mating * 100 Milk were sampled every month starting 10 day after parturition and continued until daily milk production was less than 50 ml. Before milk sampling kids were separated from their mothers for 24 h. Milk were sampled twice a day at morning and evening. Milk samples were achived with hand milking. Amount of milk were measured with a measure sensitive to 10 ml and multiplied with to convert to kilogram. Daily milk production at 30, 60, 90, 120, 150, 180, 210, 240, 270, 300 and 330th day were determined using interpolation method. Milk production at different period of lactation milk yield was calculated with Trapez II (Fleischmann) method using daily milk production data. Moreover, lactation period were also determined after culling off goats giving less than 50 ml daily milk 10. Xi square method was used to compare infertility, pregnancy, abortion, birth, single and twinning rates. Comparison tests were used for comparison of mean number of kid born per birth and kids yield. Kruskall Wallis test was used for comparison of more than two groups 11.

11 353 BOLACALI, KÜÇÜK A model of Y ijkl = μ+a i +b j +c k +e ijkl was used to determine daily milk production and lactation periods where Y = lactation period daily milk yield and lactation milk yield of a goat at any given time, μ = population mean of given trait, a i = the effect of year, b j = the effect of age, c k = effect of birth type, e ijkl = error terms. It was assumed that there was no interaction among factors used in the model and thus, the sum of addition effect of a factor on its sub-group was zero. Data regarding the milk production features of goats were analyzed using GLM procedures of SAS. Means were separated with Duncan s multiple comparison tests 12. RESULTS Fertility features of Saanen goat are presented in Table 1. In general, pregnancy rate, infertility rate, birth rate, abortion rate, single kidding rate, twinning rate, mean kid number per birth and kid yield were 90.04%, 9.96%, 81.27%, 9.73%, 42.16%, 57.48%, 1.59 and 129%, respectively. Least square means, significance and the results of multiple comparison test for lactation period, daily milk production and lactation milk yield of Saanen goats are shown in Table 2. In general, mean lactation period, daily milk production and lactation milk yield were d, 1.37 kg and kg. While the effect of year was not significant (P>0.05), the effects of age (P<0.001) and birth type (P<0.01) was significant on lactation period, daily milk production and lactation milk yield. As age and the number of kid per birth increased, lactation period and lactation milk yield also increased. The higher daily milk production was observed at 5 year old goats. Least square means, significance and the results of multiple comparison tests for daily milk production of different times of lactation are seen in Table 3. Mean daily milk production at 30, 60, 90, 120, 150, 180, 210, 240, 270, 300 and 330th days of lactation were generally 2.15, 2.44, 2.19, 1.70, 1.25, 0.89, 0.62, 0.45, 0.30, 0.26 and 0.19 kg, respectively. DISCUSSION The pregnancy rate of Saanen goats was 90.04% in the current study. When this rate is compared to some studies carried out in Turkey, it was higher than value reported by Çam et al. (75.00%) 13 but lower than the values reported by Tozlu (94.12%) 14, Koylu (96.3%) 15 and Gül et al. (100.0%) 16, which were carried out with Saanen cross-breeds. These differences in the literature regarding pregnancy rate of Table 1. Fertility parameters of Saanen goats Tablo 1. Saanen keçilerinin döl verimi parametreleri Factors General Number of Goat for Mating Pregnancy Rate İnfertility Rate Birth Rate Abortion Rate Single Kidding Rate Twinning Rate Mean Kid Number Per Birth Kid Yield (%) n % Year * ** ** ** *** 2008 n % n % X Age * * *** ** *** *** *** *** n % a a b b a c 1.22 e 66 e n % b 8.00 b a 8.70 a a c 1.37 d 115 d n % bc 4.05 bc a 5.71 a b b 1.68 c 150 c n % ab ab a 7.50 a bc ab 1.86 b 157 b n % ab 5.88 ab a 0.00 a 6.25 c a 2.00 a 188 a X : P>0.05, * : P<0.05, ** : P<0.01, *** : P<0.001, a,b,c,d,e : Subscripts with different letters within columns significantly (P<0.05) differ

12 354 Fertility and Milk Production... Table 2. Least square means, significance and the results of multiple comparison test for lactation period, daily milk production and lactation milk yield Tablo 2. Laktasyon süresi, günlük süt verimi ve laktasyon süt verimine ait en küçük kareler ortalamaları, önemlilik ve çoklu karşılaştırma testi sonuçları Lactation Period (Day) Factors n X±Sx %S 2 Min. Max. General ± Year ± ± Age *** ±7.004 c ±4.229 b ±4.072 b ±5.553 a ±8.647 a Birth Type * Single ± Twin ± Daily milk production (kg) Factors n X±Sx %S 2 Min. Max. General ± Year ± ± Age *** ±0.054 e ±0.032 d ±0.031 c ±0.042 a ±0.066 a Birth Type *** Single ± Twin ± Lactation milk yield (kg) Factors n X±Sx %S 2 Min. Max. General ± Year ± ± Age *** ± e ± d ± c ± b ± a Birth Type *** Single ± Twin ± : P>0.05, * : P<0.05, *** : P<0.001, a, b, c, d, e : Subscripts with different letters within columns significantly (P<0.05) differ; %S 2 : Percent of variance

13 355 BOLACALI, KÜÇÜK Table 3. Least square means, significance, the results of multiple comparisons for daily milk production at different times of lactation (kg) Tablo 3. Laktasyonun çeşitli dönemlerindeki günlük süt verimlerine ait en küçük kareler ortalamaları, önemlilik ve çoklu karşılaştırma testi sonuçları (kg) 30 d 60 d 90 d 120 d Factors n X±Sx n X±Sx n X±Sx n X±Sx General ± ± ± ±0.035 Year * * ± ± ± ± ± ± ± ±0.044 Age *** *** *** *** ±0.091 e ±0.096 e ±0.095 e ±0.090 e ±0.055 d ±0.058 d ±0.057 d ±0.054 d ±0.053 c ±0.056 c ±0.055 c ±0.052 c ±0.072 b ±0.076 b ±0.075 b ±0.072 b ±0.113 a ±0.119 a ±0.117 a ±0.111 a Birth type *** *** *** ** Single ± ± ± ±0.052 Twin ± ± ± ± d 180 d 210 d 240 d Factors n X±Sx n X±Sx n X±Sx n X±Sx General ± ± ± ±0.021 Year ± ± ± ± ± ± ± ±0.027 Age *** *** *** *** ±0.072 e ±0.061 d ±0.057 e ±0.070 d ±0.043 d ±0.037 c ±0.032 d ±0.031 d ±0.042 c ±0.035 b ±0.031 c ±0.027 c ±0.057 b ±0.048 a ±0.041 b ±0.036 b ±0.088 a ±0.075 a ±0.064 a ±0.056 a Birth type ** ** *** ** Single ± ± ± ±0.031 Twin ± ± ± ± d 300 d 330 d Factors n X±Sx n X±Sx n X±Sx General ± ± ±0.028 Year ** ± ± ± ± ± ±0.031 Age *** *** ±0.089 d ±0.035 cd ±0.041 b ±0.031 bc ±0.028 b ± ±0.034 ab ±0.029 a ± ±0.052 a ±0.041 a ±0.035 Birth type * Single ± ± ±0.049 Twin ± ± ±0.021 : P>0.05, * : P<0.05, ** : P<0.01, *** : P<0.001, a, b, c, d,e : Subscripts with different letters within columns significantly (P<0.05) differ

14 356 Fertility and Milk Production... Saanen goat may have resulted from the differences in environment, care, nutrition where animals were raised and also genotype of animals. Infertility rate was 9.96% in Saanen goat in this study. This rate was higher than the value by Ulutaş et al. (4.76%) 17 and lower than those of Ceyhan and Karadağ (18.3%) 18 and Karadağ (12.79%) 19. When this fertility rate was compared to the values obtained with Saanen cross-breed, it was higher than those of Tozlu (5.88%) 14, Koylu (3.6%) 15 and Şengonca et al. (4.47%) 20, but lower than the value reported by Karadağ (15.38 and 20.00% for Saanen Hair goat F 1 and G 1 cross-breed) 19. In the study, among factors affecting infertility, the effect of year was not significant but the effect of age was significant (P<0.05). Contrary to the result of the current study, Şengonca et al. 20 reported a significant year effect on infertility rate. Similar to the results of the current study, Taşkın et al. 21 reported non-significant year effect and Şengonca et al. 20 and Taşkın et al. 21 noted a significant age effect on fertility rate. The birth rate of Saanen goat in this study was 81.27%. When the birth rate observed in this study was compared to some value in the literature it was similar to those of Ceyhan and Karadağ (81.7%) 19, Koylu (84.13%) 15 and Ulutaş et al. (80.95%) 17. The birth rate observed in this study was lower than the values observed with Saanen cross-breed by Tozlu (94.2%) 14 and Gül et al. (100.0%) 16 but similar to the value of. Saanen goats has 9.73% abortion rate in this study. The abortion rate observed in this study was lower compared to the results in the study of Ulutaş et al. (12.50%) 17 but similar to those of Çam et al. (10.00%) 12. When the abortion rate in the current study was compared to experiment carried out with Saanen cross-breed, it was higher than that of Tozlu (0.00%) 14 but lower than that of Koylu (12.5%) 15. The single birth rate of Saanen goat was 42.16% in this study. The single birth rate of Saanen goat was lower than the results in the study of Ceyhan and Karadağ (50.0%) 18, similar to those of Ulutaş et al. (41.17%) 17 and Karadağ (47.69%) 19. When this value was compared to Saanen cross-breed, it was lower than those of Tozlu (88.54%) 14, Koylu (60.5%) 15 and Gül et al. (55.0%) 16 but higher than that of Karadağ (50.00% and 83.33% for Saanen Hair goat F 1 and G 1 cross-breed) 19. Saanen goat had 57.84% twinning rate in the current study. The twinning rate observed in this study was lower than that of Taşkın et al. (71.43%) 21, similar to that of Ulutaş et al. (58.83%) 17, but higher than those of Ceyhan and Karadağ (44.2%) 18 and Karadağ (52.31%) 19. When twinning rate observed in this study was compared to crossbreeding studies carried out in Turkey it was lower than those of Tozlu (11.46%) 14, Koylu (14.4%) 15 and Gül et al. (45.0%) 16. In the study, among factors affecting twinning rate, the effects of year (P<0.01) and age (P<0.001) were significant. The significant effects of year and age were in agreement with the results of Taşkın et al. 21. Mean number of kids born per birth was 1.59 in this study. When this value was compared to some domestic literature value, it was lower than that of Taşkın et al. (1.85) 21, similar to those of Ceyhan and Karadağ (1.6) 18, Karadağ (1.52) 19 and Ulutaş et al. (1.55) 17. When number of kid born per birth in the current study was compared to the values observed with Saanen cross-breed, it was lower than that of Eker and Tuncel (1.82 for Saanen Hair goat F 1 ) 22, higher than those of Tozlu (1.11) 14 and Koylu (1.06) 15 and similar to that of Karadağ (1.68 and 1.50 for Saanen Hair goat F 1 and G 1 cross-breed) 19. In the study among factors affecting the number of kids born per birth, the effects of year (P<0.01) and age (P<0.001) were significant. The significant effects of year and age on the number of kids per birth were in agreement with the results of Şengonca et al. 20 and Taşkın et al. 21. Saanen goats had 129% kid production in this study. The kid production obtained in this study were lower than that of Taşkın et al. (152%) 21 but similar to those of Ulutaş et al. (126%) 17 and Ceyhan and Karadağ (120%) 18. When this value was compared to the values obtained with Saanen cross-breed, it was lower than that of Gül et al. (148%) 16, higher than those of Koylu (89%) 15 and Karadağ (70% for Saanen Hair goat G 2 cross-breed) 19 but similar to those of Karadağ (141 and 121% for Saanen Hair goat F 1 and G 1 cross-breed) 19 and Şengonca et al. (125%) 20. In the experiment, the effects of year and age on kids production were significant (P<0.001). These significant year and age effects were in agreement with the results of Şengoca et al. 20 and Taşkın et al. 21. When the birth rate, abortion rate, single kidding rate, twinning rate, mean kid number per birth and kid yield was examined according to years, they were 77.52% and 85.25%; 13.79% and 5.45%; 54.00% and 30.77%; 46.00% and 69.23%; 1.46 and 1.72; 113% and 147% for 2008 and 2009, respectively. These values showed that birth rate, twinning rate, mean kid number per birth and kid yield were higher and abortion rate and single kidding rate were lower in second year of arrival of goats into region. The increased birth rate, twinning rate, mean kid number per birth and kid yield and the decreased abortion rate and single kidding rate in second year may have resulted from better adaptation of Saanen goat in region and improved knowledge of farmers about dairy goat raising. Mean lactation period of Saanen goats in this study was d. The lactation period observed in this study was higher than that of Ulutaş et al. (204.9 d) 17, but less than that of Tölü (288.4 d) 23. When this lactation period was

15 357 BOLACALI, KÜÇÜK compared to the lactation period obtained with Saanen cross-breed, it was higher than those values reported by Koylu (240.0 d) 15, Gül et al. (238.3 d) 16 and Şengonca et al. (201.5 d) 20. Among factors affecting lactation period, while the effect of year was not significant (P>0.05), the effects of age (P<0.001) and birth type (P<0.001) were significant in this study. Similarly Şengonca et al. 20 has reported a significant age effect on lactation period. In contrast to the result of current study, Şengonca et al. 20 noted a significant year effect on lactation period. The longer lactation period observed with Saanen goats in the current study compared with values in the literature may have been due to environmental factors such as taking animals to highland pastures and having longer vegetation period during summer. Saanen goats had average of 1.37 kg daily milk production in this study. The daily milk production obtained in this study was less than that of Pala and Savaş 24 who obtanined an average of 1.8 kg/d milk from goat with machine milking, however goats were fed 500 g/animal/d concentrate feed in addition to grazing on pature in that study. Our value was higher than that of Ulutaş et al. (0.95kg) 17 but was similar to values reported for crossbreed by Gül et al. (1.3 L) 16 and Şengonca et al. (1.83 kg) 20. Among factors affecting daily milk production, the effect of year was not significant (P>0.05) but effects of age and birth type were significant (P<0.001) in the experiment. The significant age effect on daily milk production observed in the study was in agreement with the result of Şengonca et al. 20. However, in contrary to our finding, Şengonca et al. 20 has noted a significant year effect on daily milk production. Mean lactation milk yield was kg in this study. When lactation milk yield obtained in this study was compared to some literature, it was lower than that of Sönmez et al. (423.09kg) 9, higher than those of Ulutaş et al. (193.2 kg) 17 and Karadağ (277.1 L) 19 and similar to that of Tölü (408.6 kg) 23. When the lactation yield was compared to the values obtained in the literature, for crossbreeds with this lactation milk yield was less than those of Eker and Tuncel ( kg) 22 and higher than those of Koylu (332.6 kg) 15, Gül et al. (302.3L) 16 and Karadağ (290.1 and kg for Saanen Hair goat F 1 and G 1 cross-breed) 19. In the experiment, among factors affecting lactation milk yield, the effect of year was not significant (P>0.05) but the effects of age and birth type were significant (P<0.001). Similar to Şengonca et al. 20 noted a significant age effect on lactation milk yield, which is in agreement with our result. In contrary to our result, Şengonca et al. 20 also reported a significant year effect on lactation milk yield. In conclussion, the reproduction and milk production data obtained in the current study from Saanen goats raised in Muş province have revealed that Saanen goats can be used for goat milk and kid production in the region. REFERENCES 1. FAO: Food and agriculture organization statistical databese. faostat.fao.org/site/339/ default.aspx Erişim tarihi: DPT: Dokuzuncu kalkınma planı, , Hayvancılık özel ihtisas komisyon raporu. Devlet Planlama Teşkilatı, 2007, Ankara. P.18-19, DPT ÖİK 670, Ankara. oik670.pdf, Erişim tarihi: TUIK: Hayvancılık istatistikleri. hayvancilik.zul Erişim tarihi: Sönmez R, Şengonca M: Saanen süt keçilerinde Ege Bölgesi adaptasyonu ve verimleri üzerine bir araştırma. Ege Üniv Zir Fak Derg, 1, 1-19, Akçapınar H, Özbeyaz C: Hayvan Yetiştiriciliği Temel Bilgileri. Kariyer Matbaacılık Ltd. Şti. 1. Baskı, Ankara, Al-Najjar K, Salhab S, Al-Merestani S, Kasem R, Al-Azzawi W, Dawa M, Omed H, Saatcı M: Environmental factors affecting kid mortality in Shami Goats. Kafkas Univ Vet Fak Derg, 16 (3): , Ceyhan A, Sezenler T, Yıldırır M, Erdogan İ: Reproductive performance and lamb growth characteristics of Ramlıç sheep. Kafkas Univ Vet Fak Derg, 16 (2): , Aytuğ CN, Alaçam E, Özkoç O, Yalçın BC, Türker H, Gökçen H: Koyun- Keçi Hastalıkları ve Yetiştiriciliği. Tüm Vet Hayv Hiz Yay No:2, Teknografik Basımevi, İstanbul, Sönmez R, Şengonca M, Alpbaz AG: Ege Üniversitesi Ziraat Fakültesinde yetiştirilen Saanen süt keçilerinin çeşitli özellikleri ve verimleri üzerinde bir araştırma. Ege Üniv Zir Fak Derg, 7 (1): , Maria G, Gabina D: Simplification of milk recording scheme in Latxa milking sheep. Livest Prod Sci, 31, , MINITAB: MINITAB 16, trail version. products/minitab/free-trial.aspx Erişim tarihi: SAS: Institute Inc., SAS OnlineDoc, Version 8, Cary, NC, Çam MA, Olfaz M, Selçuk E, Şekeroğlu A: Saanen ve Ezine keçilerinin süt ve döl verim özellikleri. Karadeniz Bölgesi Tarım Sempozyumu, Bildiriler, Cilt 2, , Tozlu H: Amasya ili Kıl keçisi ıslah projesi kapsamında elde edilen Saanen x Kıl keçisi (F1) melezleri ile saf Kıl keçilerinin büyüme ve diğer yetiştiricilik özellikleri bakımından mukayesesi. Yüksek Lisans Tezi. Ondokuz Mayıs Üniv. Fen Bil. Enst., Koylu MU: İleri kan dereceli Saanen melezi keçilerin mersin koşullarında adaptasyonu ve verimleri üzerine bir araştırma. Yüksek Lisans Tezi. Çukurova Üniv. Fen Bil. Enst., Gül S, Keskin M, Biçer O: Farklı keçi genotiplerinin Doğu Akdeniz Bölgesi koşullarındaki performanslarının karşılaştırılması: 2. Verim özellikleri. Ulusal Keçicilik Kongresi, s, , Haziran, Çanakkale, Ulutaş Z, Kuran M, Şirin E, Aksoy Y: Tokat şartlarında yetiştirilen Saanen ırkı keçilerin döl, süt verimi ve oğlakların gelişme özelliklerinin belirlenmesi. Ulusal Keçicilik Kongresi, s, , Haziran, Çanakkale, Ceyhan A, Karadağ O: Marmara araştırma enstitüsünde yetiştirilen Saanen keçilerinin bazı tanımlayıcı özellikleri. Tarım Bilimleri Dergisi, 15 (2): , Karadağ O: Saanen, (Saanen x Kıl) G1 ve (Saanen x Kıl) G2 keçilerinde verim özellikleri üzerine karşılaştırmalı araştırmalar. TAGEM/HAYSÜT/ 08/08/04/0, HAYSUD/2010_%20Buyukbas_%20Kucukbas_Prog_Deg_Kitabi.pdf Erişim tarihi: Şengonca M, Taşkın T, Koşum N: Saanen x Kıl keçi melezlerinin ve saf

16 358 Fertility and Milk Production... Kıl keçilerinin kimi verim özelliklerinin belirlenmesi üzerine eş zamanlı bir araştırma. Turk J Vet Anim Sci, 27 (6): , Taşkın T, Demirören E, Kaymakçı M: Saanen ve Bornova keçilerinde oğlak veriminin üretkenliği ve etkinliği. Ege Üniv Zir Fak Derg, 40 (2): 33-40, Eker M, Tuncel E: Ankara Üniversitesi Ziraat Fakültesinde yetiştirilen Kilis ve Saanen x Kilis melezi sütçü keçilerde döl verimi ve yaşama gücü üzerinde araştırmalar. Ankara Üniv. Zir. Fak. Yıllığı, 22 (1-2): , Tölü C: Farklı keçi genotiplerinde davranış, sağlık ve performans özellikleri üzerine araştırmalar. Doktora Tezi. Çanakkale Onsekiz Mart Üniv. Fen Bil. Enst., Pala A, Savaş T: Persistency within and between lactations in morning, evening and daily test day milk in dairy goats. Arch Tierz, 48 (4): , 2005.

17 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Effects of Dietary Puncture Vine (Tribulus terrestris) Powder in Different Carriers on Growth Performance, Carcass Characteristics and Blood Parameters of Broiler Chicks [1] Metin DURU * Ahmet ŞAHİN ** [1] This study is a part of PhD thesis and supported by MKUBAP (01D 0102) * University of Mustafa Kemal, Faculty of Agriculture, Department of Animal Science, TR Hatay - TURKEY ** University of Ahi Evran, Faculty of Agriculture, Department of Animal Science, TR Kırşehir - TURKEY Makale Kodu (Article Code): KVFD Summary This study was carried out to investigate the effects of dietary powder of Puncture Vine (Tribulus terrestris (TT)), carried with cotton oil, cellulose and bentonite on growth performance, carcass characteristics, TBA (thiobarbituric acid) value of breast meat and blood parameters of broiler chicks. In total, 192, day old broiler chicks were divided into 12 groups of 16 chicks each one was one replicate with similar body weights. Treatment birds were fed on their own diets supplemented with 0 (control); 1 g TT; 2 g TT; 0.1 g cotton oil; 0.5 g cellulose; 0.5 g bentonite; 1 g TT with 0.1 g cotton oil; 2 g TT with 0.2 g cotton oil; 1 g TT with 0.5 g cellulose; 2 g TT with 1 g cellulose; 1 g TT with 0.5 g bentonite and 2 g TT with 1 g bentonite per kg diet during 6 weeks. Results showed that there were no significant differences between control and treatment groups (P>0.05) with respect to the observed parameters (growth performance, body components, TBA value and blood parameters), except abdominal fat pad. Bentonit control (30.5 g), 1 g of TT carried with bentonite (31.0 g) and 1 g of TT carried with cellulose (31.4 g), increased abdominal fat pad compared to control (26.4 g) (P<0.01). It is concluded that future studies on TT as a feed supplement by examining different extraction methods, coverage methods, doses and carriers are needed. Keywords: Puncture vine, Broiler chicks, Blood parameters, Performance, Lipid oxidation Özet Farklı Taşıyıcılarla Rasyona Eklenen Demir Dikeni (Tribulus terrestris) Bitki Tozunun Etlik Civcivlerde Performans, Karkas Özellikleri ve Kan Parametreleri Üzerine Etkisi Bu deneme demir dikeni (Tribulus terrestris) bitki tozunun bentonit, selüloz ve pamuk yağı ile taşınmasının etlik civcivlerde büyüme performansı, karkas özellikleri, TBA (tiyobarbütürik asit) değerleri ve kan parametreleri üzerine etkilerini belirlemek amacı ile yürütülmüştür. Benzer ağırlıklara sahip 12 gruptan oluşan, her bir hayvanın bir alt grubu oluşturduğu her grupta 16 olmak üzere toplamda 192 adet günlük erkek etlik civciv kullanılmıştır. Denemedeki etlik civcivlerin her kg yemlerine 6 hafta boyunca 0 (kontrol); 1 g TT; 2 g TT; 0.1 g pamuk yağı; 0.5 g selüloz; 0.5 g bentonit; 1 g TT ile 0.1 g pamuk yağı; 2 g TT ile 0.2 g pamuk yağı; 1 g TT ile 0.5 g selüloz; 2 g TT ile 1 g selüloz; 1 g TT ile 0.5 g bentonit ve 2 g TT ile 1 g bentonit eklenmiştir. Çalışma sonunda, abdominal yağ hariç diğer saptanan parametreler (büyüme performansı, vücut parçaları, TBA değeri ve kan parametreleri) bakımından kontrol ile diğer gruplar arasında herhangi bir önemli farklılığa rastlanmamıştır (P>0.05). Abdominal yağ ağırlığı bakımından kontrol (26.4 g) grubuna göre sadece bentonit (30.5 g), bentonit ile birlikte 1 g demir dikeni (31.0 g) ve selüloz ile birlikte 1 g demir dikeni (31.4 g) grupları daha yüksek değerler vermişlerdir (P<0.01). Sonuç olarak, demir dikeni, yem katkı maddesi olarak farklı ekstraksiyon yöntemlerinin, kaplama metotlarının, dozlarının ve taşıyıcılarlarının denendiği çalışmalara ihtiyaç vardır. Anahtar sözcükler: Demir dikeni, Etlik civciv, Kan parametreleri, Performans, Lipid Oksidasyon İletişim (Correspondence) /1343 durumet@gmail.com

18 360 Effects of Dietary Puncture... INTRODUCTION As alternative medicine, medical and aromatic plants are getting popular in nutrition science and feed manufacturing sector since their appropriate usages have no any side effects on human and animal health. There have been a huge studies in animal nutrition for investigating the effects of plant extracts and powders on the performance of animals as well as on blood parameters in the World. However, there has been a limited commercial feed additives such as genex and origanum etc. As usually known that Turkey has a great potential for medical and aromatic plants and their raw materials have been exported to other countries and imported their prosessed secondary products to Turkey with higher prices for medicinal and agricultural purposes. For this reason, there has been a need to improve commercial alternative feed additives. Growth promoters as antibiotics and synthetic hormones have been banned in animal nutrition since they are harmfull for human health. Tribulus terrestris (TT) powder may be natural feed additive of broiler chicks by increasing testosterone level muscle mass and body strength 1-3, most likely due to LH production 4,5. Tribulus terrestris L. (Zygophyllaceae), called demir dikeni or çoban çökerten in Türkiye, is an annual herb. This herb as a weed is commonly distributed in agricultural lands as present in ecology naturally. This plant contains alkaloids, resin, peroxidase, diastase, flavonoids, carbonhydrate, protein, fructose, sucrose, sterodial saponins (protodioscin ( %) and protogracilin), glycosides and phytosteroids Tribulus terrestris powders or extracts have been commonly used in alternative medicine as diuretic, against colic pains, hypertension and hypercholesterolemia for treatment of erectile disfunction, diabetes, tumours, cardiovascular and respiratory diseases and control of blood pressure 13,14. Tribulus terrestris has also an antioxidative effect 15. Feed supplements containing TT extracts are also currently on sale in USA and Europe with claim of a general stimulating action 16. Adding Tribulus terrestris extract (10 mg/kg body weight) to drinking water in Brown Lohman hens, Guinea fowl and White Plymouth Rock-mini cocks was studied by several workers. TT extract decreased serum glucose level in Brown Lohman hens 17 and decreased serum cholesterol level in guinea fowl 18, while increased reproductive performance in White Plymouth Rock-mini cocks 19. Dietary TT extract (60 and 120 ppm, Ultimate Nutrition) did not decrease growh performance of broiler chicks when given to broiler chicks in commercial diet for 21 days suggesting that the higher TT dose trials are needed 20. Dietary 360 ppm TT extract decreased liver and intestine (duodenum, ileum + jejunum) weights of broiler chicks 21. Şahin 22 reported that TT powder (8 g) can be used as an alternative to antibiotics with respect to growth performance of broiler chicks. Up to now, the effects of dietary TT on shelf life of chicken meat have not been studied yet. There has been no study using carriers such as bentonite, cellulose and vegetable oil for plant extracts in poultry nutrition. Also, the effect of TT on protein, fat and mineral metabolism has not studied yet by determining blood parameters of broiler chicks. In this study, it was hypotesised that Tribulus terrestris powder would affect growth performance in broiler chicks because of absorbent feature of bentonite 23 and bounding feature of carboxymethylecellulose 24 and carrying feature of cotton oil for fat soluble substances in TT powder. For this reason, the effects of dietary TT powder carried in cotton oil, cellulose and bentonite on growth performance, carcass characteristics, thiobarbituric acid value (TBA) in breast meat and blood parameters of broiler chicks were investigated in detail. MATERIAL and METHODS The experiment was conducted by based on protocols by The University of Mustafa Kemal, Ethical Commission Report (No: /40). Basal diets were mainly based on corn and soybean. These diets included 3050 kcal kg -1 ME and 239 g kg -1 CP (for 1-10 days); 3150 kcal kg -1 ME and 229 g kg -1 CP (for days); 3289 kcal kg -1 ME and 209 g kg -1 CP (for days) (Table 1). Crude nutrients in feeds and experimental diets were analyzed using of AOAC 25 method. The levels of Metabolic Energy were calculated with the formula developed by TSE 26. Whole parts (leaf, stem and prick without flowers) of Tribulus terrestris L. (Zygophyllaceae) (TT) collected from Mustafa Kemal Universty campus area in Serinyol-Hatay on July-August 2009 were used after dryed and milled to get powder. Its fatty acids methyl ester composition was determined by using GC-MS (27) (Table 2). Tribulus terrestris powder was mixed with bentonit at 50%, with cellulose at 50% and with cotton oil at 10% in weight basis. These rates were determined on the basis of getting unique colour and full coverage. TT powder + bentonite, TT powder + cellulose and TT powder + cotton oil weighed in falcon tubes and centrifuged on rpm for 10 min after 10 min vortex vibration. Obtained feed supplement was observed in electron microscobe to control its uniformity in particular level (JEOL-JSM-5500LV/ Japan; Fig. 1). At the beginning of experiment, 192 day old male broiler chicks (Ross 308) were individually weighed and allocated into 12 experimental groups (control, 1 g TT, 2 g TT, 0.1 g cotton oil, 1 g TT with 0.1 g cotton oil, 2 g TT with 0.2 g

19 361 DURU, ŞAHİN Table 1. Chemical composition of experimental broiler diets Tablo 1. Denemede kullanılan etlik civciv ve piliç yemlerinin kimyasal kompozisyonu Feed Ingredients, % Starter (1-10. day) Grower ( day) Finisher ( day) Corn Full fat soy Soy bean meal (5% oil) Corn gluten meal Boncalit Chicken meal Meat-bone meal Vegetable oil Guar Flour DCP Lysine Methionine CaCO NaCl NaHCO Vitamin premix * Mineral premix ** Calculated Composition *** ME (kcal kg -1 ) Lysine, % Methionine + systine, % Ca, % P (available), % Analyzed Values, % Dry matter Crude protein Ether extract Crude fibre Crude ash * Provides per kg of diet: Vitamin A 8000 IU, Vitamin D IU, Vitamin E 15 mg, Vitamin K 3 2 mg, Vitamin B 2 mg, Vitamin B 4 mg, 1 2 Vitamin B mg, ** Provides per kg of diet: Mn 80 mg, Zn 60 mg, Fe 25 mg, Cu 15 mg, Co 0.25 mg, I 1 mg, Se 0.2 mg, Mo 1 mg, Mg 50 mg, *** Calculated cotton oil, 0.5 g cellulose, 1 g TT with 0.5 g cellulose, 2 g TT with 1 g cellulose, 0.5 g bentonite, 1 g TT with 0.5 g bentonite and 2 g TT with 1 g bentonite were added to per kg broiler diet) of equal mean body weight according to the experimental design given in Table 3. Each group included sixteen birds to make replications. Experiment lasted 42 days. The experimental chicks were kept in individual cages ( cm) with continous 24 h day light and C room temperature (a gradual decrease from 33 C from day old age to room temperature) in a poultry room. Feed Table 2. Some fatty acid compounds of plant powder of Tribulus terestris Tablo 2. Demir dikeni (Tribulus terrestris) bitki tozunun bazı yağ asidi bileşenleri % Area Compound C 16:0 Palmitic acid C 18:0 Stearic acid C 18:1 Omega 9 (Cis-9) Oleic asid C 18:2 Omega 6 (Cis-8,11,14) Linoleic asid C 18:3 Omega 3 (Cis-11,14,17) Linolenic asid Table 3. Experimental design Tablo 3. Deneme modeli Groups Treatment (g kg -1 in diet) 1. Group Feed without any carrier and supplement 2. Group Feed contains 1 g TT without any carriers 3. Group Feed contains 2 g TT without any carriers 4. Group Feed contains 0.1 g cotton oil 5. Group Feed contains 1 g TT with 0.1 g cotton oil 6. Group Feed contains 2 g TT with 0.2 g cotton oil 7. Group Feed contains 0.5 g cellulose 8. Group Feed contains 1 g TT with 0.5 g cellulose 9. Group Feed contains 2 g TT with 1 g cellulose 10. Group Feed contains 0.5 g bentonite 11. Group Feed contains 1 g TT with 0.5 g bentonite 12. Group Feed contains 2 g TT with 1 g bentonite * n=16 and water were available throughout the experimental period. Feed intake and body weight of broiler chicks were monitored weekly. Feed conversion ratio (g feed: g gain) were calculated for each individual bird for each week. At 41-d age, 8 chicks for each group were used to collect blood samples from their wing veins to determine blood metabolites. Serum was seperated from blood by centrifuge and kept -20ºC until analyzing. The levels of total protein, cholesterol, glucose, triglyceride and calcium in serum were determined by using their own commercial kits (Diasis Diagnostic Systems) for spectrophotometer (Shimadzu, UVmini-1240) reading. At 42 d-old, 8 birds from each group were slaughtered humanly for determination of the weights of body components (breast, leg, wing, abdominal fat pad, heart, liver, pancreas and duodenum) based on Ethical Commission Report (No: /40). Slaughtering weight, carcass weight, carcass yield (g carcass weight x 100: g slaughtering weight) of chicks were recorded. To determine oxidative deterioration in whole breast sample, the left part of breast meat was saved in +4ºC and the other right part saved -18ºC for TBA value analysis 3 rd day and 21 th day respectively 28.

20 362 Effects of Dietary Puncture... Tribulus terestris plant Tribulus powder with terestris bentonite plant powder with bentonite Tribulus terestris plant Tribulus powder with terestris cellulose plant powder with cellulose Tribulus terestris plant Tribulus powder with terestris oil plant powder with oil Fig 1. Images of Tribulus terestris plant powder with bentonite, cellulose and oil on electron microscope Şekil 1. Elektronmikroskopta bentonit, bentonit, selüloz ve yağ içinde Demir dikeni bitki tozunun görüntüsü The study design was a randomized factorial (4x3). Data were analysed using the GLM procedure of SAS 29 with Duncan s Multiple Range Test used to identify the significant differences between the respective means. Results are presented as means per bird with standard error of means (SEM) 30. RESULTS The results regarding growth performance, carcass characteristics and blood parameters of broiler chicks are shown in Table 4, 5 and 6. There was no effect of TT powder on feed intake, body weight gain and feed efficiency in broiler chicks during experimental period irrespective to carriers (P>0.05) (Table 4). Carcass, breast, wings, heart, liver, pancreas and duodenum yields and duodenum length were not affected by any treatment with respect to application, dose and application x dose interaction (P>0.05) (Table 5). As if slaughter weight seemed to different among groups, however, the highest slaughter weight (2508 g, 2 g TT with cotton oil) was not different than control group. Cotton oil, irrespective to TT doses, improved legs yield about 1.5% per bird (P<0.05). TT decreased the abdominal fat pad in broiler chicks, except TT doses in cellulose (P<0.01). In generally, TT powder, irrespective to carriers, tended to decrease in heart, liver and pancreas yields without any significancy. TBA value of breast meat was not affected by any treatments significantly (Table 5). Plasma glucose, calcium, cholesterole, total protein and trigliceride were not affected by any treatment significantly (P>0.05) (Table 6). Table 4. The effects of plant powder of Tribulus terestris with different carriers on the growth performance of broiler chicks Tablo 4. Rasyona farklı düzeylerde ve farklı materyallerle karıştırılarak eklenen Demir dikeni (Tribulus terrestris) bitki tozunun etlik civcivlerde büyüme performansı üzerine etkileri Puncture Vine (Tribulus terrestris) Powder Levels (g kg -1 ) Parameters Control Bentonite Cellulose Cotton Oil Dose SEM APP DOSE APP X DOSE IBW, g FI (0-3), g BWG (0-3), g FCR (0-3) FI (3-6), g BWG (3-6), g FCR (3-6) FI (0-6), g BWG (0-6), g FCR (0-6) IBW: Initial body weight, FI: Feed intake, BWG: Body weight gain, FCR: Feed conversion ratio, APP: Application

21 363 DURU, ŞAHİN Table 5. The effects of plant powder of Tribulus terestris with different carriers on the carcass characteristic and digestive parts of broiler chicks Tablo 5. Rasyona farklı düzeylerde ve farklı materyallerle karıştırılarak eklenen Demir dikeni (Tribulus terrestris) bitki tozunun etlik civcivlerde karkas özellikleri ve sindirim sistemi bölümleri üzerine etkileri Puncture Vine (Tribulus terrestris) Powder Levels (g kg -1 ) Parameters Control Bentonite Cellulose Cotton Oil Dose SEM APP DOSE APP X DOSE SW, g a abc c a abc abc bc abc a abc abc ab CY, % Breast, % Legs, % 19.8 ab 19.7 ab 20.7 ab 19.5 b 21.0 ab 20.2 ab 21.1 ab 21.4 a 20.8 ab 21.3 a 21.1 ab 20.2 ab Wings, % Abdominal fat pad, % 1.05 bcd 1.1 bc 1.02 cd 1.2 ab 1.3 a 0.9 d 1.02 cd 1.31 a 1.17 abc 1.01 cd 1.09 bcd 0.99 cd Heart, % Liver, % Pancreas, % Duodenum, % Duodenum, cm TBA (3 d) TBA (21 d) SW: Slaughter weight (g), CY: Carcass yield (%), TBA: Thiobarbituric acid (mgma/kg), APP: Application, a-e: with no common superscript show the significant differences between treatments in chicks (P<0.05), Percentage data were obtained according to slaughter weights Table 6. The effects of plant powder of Tribulus terestris with different carriers on the plasma glucose, calcium, cholesterole, total protein and trigliceride of broiler chicks Tablo 6. Rasyona farklı düzeylerde ve farklı materyallerle karıştırılarak eklenen Demir dikeni (Tribulus terrestris) bitki tozunun etlik civcivlerde plazma glukoz, kalsiyum, kolesterol, total protein ve trigliserid konsantrasyonları üzerine etkileri Puncture Vine (Tribulus terrestris) Powder Levels (g kg -1 ) Parameters Control Bentonite Cellulose Cotton Oil Dose SEM APP DOSE APP X DOSE Glucose, mg dl Calcium, mg dl Cholesterole, mg dl Total Protein, g dl Trigliceride, mg dl APP: Application

22 364 Effects of Dietary Puncture... DISCUSSION Our study was planned to try improve primitive alternative feed additives to gain this purpose. TT powder may be a candidate for being an alternative feed additive. Its usage in broiler diets have been tested in poultry but the obtained results were not clear enough. For this reason, TT was used with bentonite, cellulose and cotton oil to investigate the possible effects on growth performance and blood parameters of broiler chicks. However the present results are similar when compared to the previous studies on TT 20,21. These similar results may be explained as following; (a) the chosen carriers bentonite, cellulose and cotton oil may cover the possible effects of TT, (b) the effective substances in TT powder had not been released to intestine, (c) the chosen doses may be lower, (d) the age of broiler chicks were quite young and consequently the testosterone production of testes might be near to zero due to undeveloped testes as much as being affected by any dietary manipulation, and finally (e) the other constitutents of broiler diet and enviromental conditions were quite adequate without causing any dietary deficiencies. Slaugther weight and carcass yield were not affected by treatments (Table 4). 120 ppm TT powder tended to decrease in breast weight without affecting slaughter weight in broiler chicks 20 (P>0.05). There were no differences between treatment groups with respect to body components. However, cotton oil, irrespective to TT doses, improved legs yield about 1.5% (P<0.01). This might be related to the energy content of cotton oil with carrying effects of fat soluble vitamins to intestine. Abdominal fat pad was decreased by the high level dose of TT with bentonite and increased by low and high levels of TT carried with cellulose. It may be explained the cover effects of cellulose on TT since TT in other carriers decreased abdominal fat content. This is expectable due to its hypoglicemic and hypocholesteromic effects of TT. However, there has been a contradiction between blood parameters and the biochemical effects of TT 17,18. TT powder (360 ppm) decreased carcass, liver and heart weights in comparison to control 21. In the current study, TT powder did not affect carcass body components. In a previous study, it was tested that whether TT plant powder can be alternative for antibiotics in broiler chicks or not. Control diet consisted of 0.06% alfamine and 0.025% flavomycine and the other diets consisted of 4, 8 and 12 g TT plant powder. It was seen that carcass yield and feed conversion ratio were decreased but proventriculus, ileum and jejenum weights were increased by TT powder 22. When results compared, the effects of TT powders in different carriers have been still unclear. However, in the present study, no antibiotics were used and the performance of all experimental birds were similar as well as similarity with the previous studies in which antibiotics were used. In the present study, there was no difference with regard to blood cholesterol and glucose levels amoung treatment groups (P>0.05). The current TT doses did not affect the metabolism of animals. This may be explained that the absorbed substances of TT powder to blood stream was not enough to affect the metabolism of chicks. There has been a limited study in literature about investigating the effect of dietary plant extracts or powders on shelf life of TBA values. The effects of some medical and aromatic plants such as thyme, mint and fennel on TBA values of stored broiler meat 31. Even though TT has a antioxidative effect 15 TT powders did not affect TBA values in breast meat in the present study. This might be attributed to insufficient active substance in TT for antioxidant activity. Also, there has been no idea about the transfering of active chemicals to body parts. During or after absorption, the metabolic pathway of plant extracts, also, needs to be investigated in further in vivo and in situ studies. In general, the insignificant differences may be explained by chemical characteristics of soil collected from, chemical composition of TT, the current plant powder level and the characteristics of present carrier materials. It can be suggested that when decided to use any herb as feed additive, first of all, its chemical extracts have to be identified and determined in quantity. Otherwise, researchers always make speculations and assumptions whether they could find any positive effects of medical and aromatic plants. Finally, there has been still a need to investigate our huge variety of medical and aromatic plants to develop alternative feed supplements for animal nutrition. REFERENCES 1. Adimoelja A, Adaikan PG: Protodioscin from herbal plant Tribulus terrestris L. improves male sexual functions possibly via DHEA. Int J Impot Res, 9 (1): 64, Adaikan GP, Gauthaman K, Prasad RN, Ng CS: Proerektile pharmacological effects of Tr. Terrestris Extract on the rabbit corpus cavernosum. Ann Acad Med, 29 (1): 22-26, Gauthaman K, Adaikan PG, Prasad RNV: Aphrodisiac properties of Tribulus terrestris extract (Protodioscin) in normal and castrated rats. Life Sci, 71 (12): , Yeşil T: Tribulus terrestris L. (çoban çökerten) (zygophyllaceae) türü üzerinde farmasötik botanik yönünden araştırmalar. Yüksek Lisans Tezi, Ankara Üniv. Sağlık Bil. Enst., Ankara, Özen N: Hayvan Besleme Fizyolojisi ve Metabolizması. Genişletilmiş 2. Baskı, Akdeniz Üniversitesi Ziraat Fakültesi Zootekni Bölümü 343 s, Antalya, Tomova M: Tribestan. Farmatsya, 37 (6): 40-42, Wu G, Jiang F, Jiang S, Zhu D, Wu H, Jiang S: Steroidal glycosides from Tribulus terrestris. Phytochemistry, 42 (6): , Wang Y, Ohtani K, Kasai R, Yamasaki K: Steroidal saponins from fruits of Tribulus terrestris. Phytochemistry, 45 (4): , Wu TS, Shi LS, Kuo SC: Alkaloids and other constituents from Tribulus terrestris. Phytochemistry, 50 (8): , Ganzera M, Bedir E, Khan IA: Determination of steroidal saponins

23 365 DURU, ŞAHİN in Tribulus terrestris by reversed-phase high performance liquid chromatography and evaporative light scattering detection. J Pharm Sci, 90 (11): , Mutlu M: Tribulus terrestris (deve çökerten) (zygophyllaceae) bitkisinden elde edilen ekstraktların kimyasal içeriklerinin araştırılması. Yüksek Lisans Tezi, Süleyman Demirel Üniv. Fen Bil. Enst., Isparta, Sun W, Gao J, Tu G, Guo Z, Zhang Y: A new steroidal saponin from Tribulus terrestris Linn. Nat Prod Lett, 16 (4): , Aracasoy HB, Erenmemişoğlu A, Tekol Y, Kurucu S, Kartal M: Effect of Tribulus terrestris L. saponin mixture on some smooth muscle preparations: A preliminary study. Boll Chim Farm, 137 (11): , Grigorova S, Kashamov B, Sredkova V, Surdjiiska S, Zlatev H: Effect of Tribulus terrestris extract on semen quality and serum total cholesterol content in White Plymouth Rock-mini cocks. Biotech Anim Husb, 24 (3-4): , Asenov IV, Gusev CH, Kitanov G, Nikolov ST, Petkov T: Herb collecting, Biller, 368, Kostova I, Dinchev D: Saponins in Tribulus terrestris-chemistry and bioactivity. Phytochemistry Rev, 4 (2-3): , Grigorova S, Vasileva D, Kashamov B, Sredkova V, Surdjiiska S: Investigation of Tribulus terrestris extract on the biochemical parameters of eggs and blood serum in laying hens. Arch Zootech, 11 (1): 39-44, Grigorova S, Abadjieva D, Nikolova M, Penkov D: The effect of Tribulus terrestris extract on egg yolk lipids and serum cholesterol content in guinea fowls. Biotech Anim Husb, 25 (5-6): , Grigorova S, Kashamov B, Sredkova V, Surdjiiska S, Zlatev H: Effect of Tribulus terrestris extract on semen quality and serum total cholesterol content in White Plymouth Rock-mini cocks. Biotech Anim Husb, 24 (3-4): , Duru M: Yohimbe bark (Pausinystalia yohimbe) ve demir dikeni (Tribulus terrestris) ekstraktlarının etlik civcivlerde büyüme performansı ve vücut bilesimi üzerine etkilerinin araştırılması. Yüksek Lisans Tezi, Mustafa Kemal Üniv. Fen Bil. Enst., Hatay, Şahin A, Duru M: Effects of Tribulus terrestris (puncture vine) supplementation on performance and digestive system of broiler chicks. Tar Bil Der, 16 (4): , Şahin A: Effects of dietary Tribulus terrestris L. powder on growth performance, body components and digestive system of broiler chicks. J Appl Anim Res, 35 (2): , Pahsa TN, Farooq MU, Khattak FM, Jabbar MA, Khan AD: Effectiveness of sodium bentonite and two commercial products as aflatoxin absorbents in diets for broiler chickens. Anim Feed Sci Tech, 132 (1-2): , Heitner C, Min T: The effect of sulphite treatment on the brightness and bleachability of chemithermomechanical pulp. Cellul Chem Technol, 21 (3): , AOAC: Official methods of analysis of the association of official analytical chemist. 16th ed., Arlington, VA TSE: Hayvan Yemleri. Metabolik (çevrilebilir) enerji tayini (kimyasal metot). Türk Standartları Enstitüsü, TSE No: 9610, Özgüven M, Engin M: Bitki Fizyolojisi Uygulama Kılavuzu Ders Notları. Çukurova Üniversitesi, Tarla Bitkileri Bölümü, Adana, Tarladgis BG, Watts BM, Yonathan M, Dugan JR: A distillation method for the determination of malonaldehyde in rancid foods. J Am Oil Chem Soc, 37 (1): 44-48, SAS: SAS User s Guide: Statistics 1996 edit. SAS Institue Inc., Düzgüneş O, Kesici T, Kavuncu O, Gürbüz F: Araştırma ve Deneme Metodları (İstatistik Metodları-II). s. 381, Ankara Üniv. Ziraat Fak. Yayınları: 1021, Ders Kitabı, 295, Ankara, Taşkın A: Aromatik bitkilerin broyler et kalitesi ve tonik immobilite reaksiyonu üzerine etkileri. Doktora Tezi, Mustafa Kemal Üniv. Fen Bil. Enst., Hatay, 2009.

24 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Effects of Antioxidants Resveratrol, Catechin and Lipoic Acid and Carcinogen KBrO 3 on Lipophylic Vitamins and Cholesterol in Lung, Liver and Kidney of Wistar Rats [1] Summary The aim of this research is to examine effects of antioxidants resveratrol, lipoic acid, catechin and carcinogen potassium bromate on the level of lipophylic vitamins and cholesterol in liver, lung and kidney tissue of Wistar albino rats. In this study, total 50 Wistar rats were randomly divided into five groups: 1. Control (C), 2. KBrO 3 (K) (40 mg/kg two times per week), 3. Catechin (30 mg/kg four times per week) + KBrO 3 (40 mg/kg two times per week) (Cat), 4. Lipoic Acid (30 mg/kg four times per week) + KBrO 3 (40 mg/kg two times per week) (LA) and 5. Resveratrol (30 mg/kg four times per week) + KBrO 3 (40 mg/kg two times per week) (R). All treatments were continued for 5 weeks, after which time each experimental rat was decapitated and tissues were collected and stored in -85 C prior to biochemical analysis. In lung, liver and kidney, lipophylic vitamins and cholesterol were measured by HPLC. According to our results, while the cholesterol level was decreased in the K, Cat, LA and R groups, the α-tocopherol level was decreased in K and R groups of the lung tissue. α-tocopherol, cholesterol and retinol levels were increased in K, Cat, LA and R groups of the liver tissue. While the δ-tocopherol, vitamin D 2, vitamin D 3 and α-tocopherol levels were decreased in K, Cat, LA and R groups, the cholesterol level was increased in Cat, LA and R groups of kidney tissue. In conclusion, our results indicated that the applications of resveratrol, lipoic acid, catechin and potassium bromate influenced cholesterol and lipophylic vitamins levels and these applications can be affected cholesterol biosynthesis in Wistar albino rats. Keywords: Resveratrol, Potassium bromate, Catechin, Lipoic acid, Liver, Lung, Kidney Wistar Sıçanların Akciğer, Karaciğer ve Böbrek Dokularında Lipofilik Vitaminler ve Kolesterol Üzerinde Antioksidanlar Resveratrol, Kateşin ve Lipoik Asit ile Kanserojen KBrO 3 ın Etkileri Özet Serhat KESER * Okkes YILMAZ ** Mehmet TUZCU ** Orhan ERMAN ** Sevgi IRTEGUN ** [1] This research was supported by the DPT-2002K and DPT-2003K and FUBAP 1357 * Firat University, Faculty of Science, Chemistry Department, TR Elazig - TURKEY ** Firat University, Faculty of Science, Biology Department, TR Elazig - TURKEY Makale Kodu (Article Code): KVFD Bu çalışmanın amacı kanserojen KBrO 3 e karşı resveratrol, lipoik asit ve kateşin gibi antioksidanların Wistar ratların karaciğer, akciğer ve böbrek dokularında lipofilik vitaminler ve kolesterol üzerindeki etkilerini incelemektir. Bu çalışmada, toplam 50 Wistar sıçan rasgele beş gruba dağıtıldı: 1. Kontrol (C), 2. KBrO 3 (K), (40 mg/kg dozunda haftada iki kez), 3. Kateşin (30 mg/kg dozunda haftada dört kez) + KBrO 3 (40 mg/kg dozunda haftada iki kez) (Cat), 4. Lipoik Asit (30 mg/kg dozunda haftada dört kez) + KBrO 3 (40 mg/kg dozunda haftada iki kez) (LA) and 5. Resveratrol (30 mg/kg dozunda haftada dört kez) + KBrO 3 (40 mg/kg haftada iki kez) (R). Bütün uygulamalar 5 hafta boyunca sürdürüldü ve sonra her bir deney sıçanı dekapite edildi ve dokuları alınarak biyokimyasal analizlere kadar -85 C de saklandı. Akciğer, karaciğer ve böbrek dokularında lipofilik vitaminler ve kolesterol seviyeleri HPLC cihazıyla belirlendi. Sonuçlarımıza göre, akciğer dokusunda kolesterol seviyesi K, Cat, LA ve R gruplarında, α-tokoferol seviyesi ise K ve R gruplarında azalmıştır. Karaciğer dokusunda, α-tokoferol, retinol ve kolesterol seviyeleri K, Cat, LA ve R gruplarında artmıştır. Böbrek dokusunda, δ-tokoferol, vitamin D 2, vitamin D 3 ve α-tokoferol seviyeleri K, Cat, LA ve R gruplarında azalırken, kolesterol seviyesi Cat, LA ve R gruplarında artmıştır. Sonuç olarak, sonuçlarımız göstermiştir ki, resveratrol, lipoik asit, kateşin ve potasyum bromat uygulaması Wistar sıçanlarda lipofilik vitaminler ve kolesterol seviyelerini etkilemiştir ve bu uygulamalar sıçanlarda kolesterol biyosentezini etkilemiş olabilir. Anahtar sözcükler: Resveratrol, Potasyum bromat, Kateşin, Lipoik asit, Karaciğer, Akciğer, Böbrek İletişim (Correspondence) /3734 serhatkeser@gmail.com

25 368 Effects of Antioxidants... INTRODUCTION Resveratrol is a phytoalexin, first isolated from roots of Veratrum grandiflorum O. Loes (white hellebore) and then from Polygonum cuspidatum, but remained in obscurity for almost 50 years 1,2. It got into prominence in early nineties in the context of French paradox ; the phenomena where in certain population of France (and Greece), in spite of regular consumption of high fat diet, gets much less heart diseases 3. The apparent cardioprotection was attributed to the regular consumption of moderate doses of red wine rich in resveratrol 4. Initially resveratrol was characterized by its anti-platelet aggregation properties 5 and thereafter other beneficial effects such as vasorelaxation, antioxidant functions, etc., became apparent 6,7. In experimental animals, resveratrol is rapidly metabolized by the liver and its plasma half-life remains quite low with a concomitant decline in its concentrations in tissues like brain, lung, liver and kidney 8. α-lipoic acid is a disulfide compound that functions as a coenzyme in pyruvate dehydrogenase and α-ketoglutarate dehydrogenase mitochondrial reactions, leading to the production of cellular energy (ATP). α-lipoic acid and its reduced form, dihydrolipoic acid, reduce oxidative stress by scavenging a number of free radicals in both membrane and aqueous domains, by chelating transition metals in biological systems, by preventing membrane lipid peroxidation and protein damage through the redox regeneration of other antioxidants such as vitamins C and E, and by increasing intracellular glutathione Catechin, commonly known as the primary polyphenolic compounds in green tea, has been of great interest for its multiple health-promoting properties, such as antioxidant, anti-obesity, hypolipidemic, and anticarcinogeic activities KBrO 3 has been classified as a genotoxic carcinogen based on positive results in the Ames test 19, and chromosome aberration 20 and micronucleus tests 21. It has the potential to induce 8-hydroxy-2 -deoxyguanosine (8-OHdG) formation both in vitro and in vivo OHdG is the most abundant oxidative DNA adduct, can induce mutations such as GC to TA transversions upon replication by DNA polymerases 26. The aim of this study was to examine effects of antioxidants resveratrol, lipoic acid, catechin and carcinogen potassium bromate on the level of lipophylic vitamins and cholesterol in liver, lung and kidney tissue of Wistar albino rats. MATERIAL and METHODS Chemicals Resveratrol, lipoic acid, catechin, methanol and acetonitrile were obtained from Sigma Chemical Co. (USA). Isopropyl alcohol was obtained from Fluka BioChemica (Switzerland). Potassium bromate was obtained Merck (Germany). Animals and Treatment The following experiments were approved by the Ethical Committee of Firat University for the care and use of laboratory animals. In this study, total 50 old female Wistar rats were used. The animals were housed in cages where they had ad libitum rat chow and water in an airconditioned room with a 12-h light/12-h dark cycle, and were randomly divided into five groups; each group containing ten rats. The first group was used as a Control (C), the second group KBrO 3 (K), the third group Catechin + KBrO 3 (Cat), the fourth group Lipoic Acid + KBrO 3 (LA), and fifth group Resveratrol + KBrO 3 (R). Rats in the K, Cat, LA and R groups were injected intraperitoneally potassium bromate 40 mg/kg in the physiologic saline (0.9% NaCl) two times per week. Rats in the Cat group was injected intraperitoneally catechin 30 mg/kg, rats in the LA group was injected intraperitoneally lipoic acid 30 mg/kg, rats in the R group was injected intraperitoneally resveratrol 30 mg/kg in the physiologic saline four times per week. In addition, physiological saline was injected to C group rats. These treatments were continued for five weeks, after which time each experimental rat was decapitated and tissue samples were collected and stored in -85 C prior to biochemical analysis 27. Determination of Lipid Soluble Vitamins in Tissue Samples 500 mg lung, liver and kidney tissue sample was homogenized in 3 ml acetonitrile/methanol/isopropyl alcohol (2:1:1, v/v/v) containing tubes and the samples were vortexed for 30 s and centrifuged at g for 10 min at 4 C. Supernatants were transferred to autosampler vials of the HPLC instrument. For lipophylic vitamins, the mixture of acetonitrile/methanol (3:1, v/v) was used as the mobile phase and the elution was performed at a flowrate of 1 ml/min. The temperature of column was kept at 40 C. Supelcosil TM LC 18 DB column (250 x 4.6 mm, 5 mm; Sigma, USA) was used as the HPLC column and detection was performed at 320 nm for retinol (vitamin A), and 215 nm for δ-tocopherol, α-tocopherol, α-tocopherol acetate, vitamin D 2, D 3, K 1. Identification of the individual vitamins was performed by frequent comparison with authentic external standard mixtures analyzed under the same conditions. Quantification was carried out by external standardization using Class VP software. The results of analysis were expressed as μg/g 28,29. Total Cholesterol Analysis in Tissue Samples 500 mg lung, liver and kidney tissue sample in 3 ml acetonitrile/isopropyl alcohol (70:30, v/v) containing tubes and the mixture were vortexed for 30 s and centrifuged at

26 369 KESER, YILMAZ, TUZCU ERMAN, IRTEGUN g for 10 min at 4 C. Supernatants were transferred to autosampler vials of the HPLC instrument. Acetonitrileisopropyl alcohol (70:30 v/v) was used as mobile phase at a flow rate of 1 ml/min 30. Supelcosil LC 18 TM DB column (250 x 4.6 mm, 5 mm) was used as the HPLC column. Detection was performed by UV at 202 nm and 40 C column oven 31. Quantification was carried out by external standardization using Class VP software. The results were expressed as μg/g wet weight tissue. Statistical Analysis The experimental results were reported as mean ± S.E. Statistical analysis was performed using SPSS 15.0 Soft-ware. Analysis of variance (ANOVA) and an LSD test were used to compare the experimental groups with the controls RESULTS In Lung Tissue Retinol level was decreased (P<0.01) in Cat group, but its level was not different (P>0.05) between C group and the other groups. δ-tocopherol (K, Cat and R groups), α- tocopherol (all groups) levels were significantly decreased (P<0.001). Vitamin D 2 and α-tocopherol acetate (K, Cat and LA groups) levels were significantly increased (P<0.001). Vitamin D 3 level was increased (P<0.05) in K and R groups, but its level was significantly decreased (P<0.01, P<0.001, respectively) in Cat and LA groups. Vitamin K 1 level was significantly increased (P<0.001) in K group, but its level was significantly decreased in LA and R groups (P<0.001). Cholesterol level was significantly decreased (P<0.05, P<0.001, respectively) in K and R groups, but its level was not different (P>0.05) between C and other groups (Table 1). In Liver Tissue Retinol, cholesterol (all groups), δ-tocopherol (K, LA and R groups), α-tocopherol (K, Cat, LA and R groups), α-tocopherol acetate (Cat, LA and R groups) levels were significantly increased (P<0.001). Vitamin D 2 (all groups), Vitamin D 3 (K, Cat and R groups) levels were significantly decreased (P<0.001). Vitamin K 1 level was significantly decreased (P<0.001) in R group, but its level was significantly increased (P<0.001) in K, LA and R groups (Table 2). In Kidney Tissue Retinol level was decreased (P<0.05) in K and Cat groups, but its level was significantly increased (P<0.001, P<0.01, Table 1. Effects of KBrO 3 and antioxidants on lipophylic vitamins and cholesterol levels in lung Tablo 1. Akciğer dokusunda lipofilik vitaminler ve kolesterol seviyeleri üzerinde KBrO 3 ve antioksidanların etkileri Biochemical Parameters (µg/g) Control (C) KBrO 3 (K) Catechin+ KBrO 3 (Cat) Lipoic Acid+ KBrO 3 (LA) Resveratrol+ KBrO 3 (R) Retinol 1.44±0.04 a 1.47±0.10 a 0.94±0.04 c 1.16±0.07 a 1.20±0.13 a δ-tocopherol 21.25±1.17 a 13.31±0.70 d 4.46±0.09 d 10.47±0.05 d 19.49±0.73 a Vitamin D ±0.12 a 3.61±0.12 d 3.74±0.15 d 3.15±0.15 d 1.94±0.13 a Vitamin D ±0.43 a 15.08±0.64 b 10.84±0.37 c 10.54±0.06 d 15.40±0.47 b α-tocopherol 18.81±0.60 a 16.69±0.54 c 9.97±0.23 d 6.00±0.40 d 11.53±0.47 d α-tocopherol acetate 2.12±0.29 a 3.65±0.06 c 21.06±0.42 d 25.63±0.26 d 1.73±0.12 a Vitamin K ±0.27 a 9.75±0.23 d 3.49±0.10 a 1.15±0.08 d 1.02±0.08 d Cholesterol ±20.83 a ±24.67 b ±7.64 a ±20.69 a ±9.07 d a, b, c, and d letters indicate statistical significant between groups. a: P>0.05, b: P<0.05, c: P<0.01, d: P<0.001 Table 2. Effects of KBrO 3 and antioxidants on lipophylic vitamins and cholesterol levels in liver Tablo 2. Karaciğer dokusunda lipofilik vitaminler ve kolesterol seviyeleri üzerinde KBrO 3 ve antioksidanların etkileri Biochemical Parameters (µg/g) Control (C) KBrO 3 (K) Catechin+ KBrO 3 (Cat) Lipoic Acid+ KBrO 3 (LA) Resveratrol+ KBrO 3 (R) Retinol 18.74±1.36 a 30.98±0.30 d 26.36±0.85 c 43.86±2.65 d 24.03±0.34 b δ-tocopherol 15.40±0.21 a 24.33±0.55 d 14.23±0.47 a 45.80±0.54 d 19.45±0.15 d Vitamin D ±0.21 a 7.68±0.29 d 4.91±0.16 d 8.44±0.12 d 6.88±0.23 d Vitamin D ±1.22 a 84.09±2.17 d 78.93±1.47 d 98.52±0.57 a 73.49±0.41 d α-tocopherol ±8.13 a ±12.50 d ±16.51 d ±0.75 d ±0.56 d α-tocopherol acetate 20.83±0.83 a 21.76±1.20 a 25.62±0.89 c 35.36±0.38 d 29.56±0.17 d Vitamin K ±1.21 a ±1.64 d 56.86±1.34 d ±0.57 d 3.98±0.25 d Cholesterol 45.00±1.44 a ±8.16 d ±7.64 d ±0.42 d ±0.72 d a, b, c, and d letters indicate statistical significant between groups. a: P>0.05, b: P<0.05, c: P<0.01, d: P<0.001

27 370 Effects of Antioxidants... Table 3. Effects of KBrO 3 and antioxidants on lipophylic vitamins and cholesterol levels in kidney Tablo 3. Böbrek dokusunda lipofilik vitaminler ve kolesterol seviyeleri üzerinde KBrO 3 ve antioksidanların etkileri Biochemical Parameters (µg/g) Control (C) KBrO 3 (K) Catechin+ KBrO 3 (Cat) Lipoic Acid+ KBrO 3 (LA) Resveratrol+ KBrO 3 (R) Retinol 20.87±0.05 a 30.47±0.05 a 40.90±1.00 d ±0.91 d 63.42±0.83 d δ-tocopherol 27.10±0.64 a 34.98±0.89 d 4.90±0.08 d 20.56±0.18 d 3.79±0.13 d Vitamin D ±0.36 a 4.03±0.31 d 2.52±0.12 d 6.44±0.07 d 4.36±0.10 d Vitamin D ±0.81 a 39.71±0.69 d 27.47±0.58 d 88.25±0.57 d 46.13±0.53 d α-tocopherol 39.91±1.13 a 15.23±0.38 d 15.20±0.08 d 12.26±0.84 d 19.62±0.10 d Vitamin K ±2.04 a 13.75±0.39 d 9.80±0.11 d 31.84±1.03 b 7.90±0.14 d Cholesterol ±18.25 a ±23.07 a ±7.34 d ±8.10 d ±8.86 d a, b, c, and d letters indicate statistical significant between groups. a: P>0.05, b: P<0.05, c: P<0.01, d: P<0.001 respectively) in LA and R groups. Vitamin D 2 and D 3 (all groups), α-tocopherol (all groups) levels were significantly decreased (P<0.001). Vitamin K 1 level was significantly decreased (P<0.001) in K, Cat and R groups, but its level was increased (P<0.01) in LA group. δ-tocopherol level was significantly increased (P<0.001) in K group, but its level was decreased (P<0.001) in the other groups. Cholesterol level was significantly increased (P<0.001) in Cat, LA and R groups, but its level was not different (P>0.05) between the C and K groups (Table 3). DISCUSSION In lung tissue, α-tocopherol and cholesterol levels were significantly decreased in the K and R groups. In the R group, the reduction of cholesterol levels can be caused by the cholesterol-lowering properties of resveratrol. Keser et al. 36 showed that resveratrol administration was decreased the cholesterol level in muscle of Wistar rats. Keser et al. 37 has showed that cholesterol level was decreased in the heart and brain tissue of rats which administered resveratrol and potassium bromate. In addition these studies, we think that a molecular relationship cholesterol and α-tocopherol reduction. Laden and Porter 38 reported that the possibility that the protective effect of resveratrol on the development of cardiovascular disease may be explained in part by the inhibition of endogenous cholesterol biosynthesis. Decreasing of cholesterol level in the R group may be explained by a decline the squalene monooxygenase enzyme activity. Squalene monooxygenase is an enzyme in the endoplasmic reticulum of eukaryotic cells, catalyzes the epoxidation of squalene across a C=C double bond to yield 2,3-oxidosqualene in the first oxidative step of cholesterol biosynthesis 38. Regulation of sterol receptors occurs at the level of transcription, suggesting that α-tocopherol acts through specific receptors or tocopherol-responsive transcription factors 39. α-tocopherol similarly up-regulates the expression of α-tocopherol transfer protein (α-ttp), and thus plays a role in its own intracellular processing 40,41. These findings provide a link between vitamin E and the regulation of cholesterol synthesis that is independent of the antioxidant effects of vitamin E. Supernatant protein factor (SPF) is a recently cloned member of a family of cytosolic lipid-binding proteins that includes Sec14p, α-tocopherol transfer protein, and cellular retinal-binding protein. SPF stimulates the conversion of squalene to lanosterol in the downstream pathway for cholesterol biosynthesis, and overexpression of cloned SPF in hepatoma cells increases cholesterol synthesis. The recent identification of the SPF as α-tocopherol-associated protein (TAP) has called into question its long-standing association with the cholesterol biosynthesis. Unexpectedly, the sequence of TAP is identical to that SPF. TAP binds α-tocopherol, but not other isomers of tocopherol, with high affinity; in the presence of α-tocopherol TAP translocates to the nucleus and activates reporter gene transcription 42. TAP is a recently identified cytosolic protein thought to be involved in the intracellular distribution of α-tocopherol 43. Miura et al. 44 reported that hypocholesterolemic action of resveratrol is attributed, at least in part, to an increased excretion of neutral sterols and bile acids into feces. They have suggested that dietary resveratrol is hypolipidemic with a tendency for anti-tumor-growth and anti-metastasis effects in hepatoma-bearing rats. In the liver and kidney tissues, the cholesterol level was significantly increased in the K, Cat, LA and R groups. Increasing of cholesterol level may be caused application of KBrO 3 in the all groups. Yilmaz et al. 28 showed that application of KBrO 3 was increased the cholesterol level in serum of Wistar rats. Retinol and α-tocopherol levels were significantly increased in the all groups in liver tissue. We think that KBrO 3 administration was caused increasing of these vitamin levels in the liver tissue. Because, KBrO 3 administration was performed in all groups which increasing of retinol and α-tocopherol levels. It was observed that α-tocopherol level was significantly decreased in the all groups in the kidney tissue. This may be due to the application of potassium bromate. Because it was demonstrated to induce renal cell tumors in male and female F344 rats after oral administration for 2 years in the drinking water and usage of KBrO 3 as a food additive

28 371 KESER, YILMAZ, TUZCU ERMAN, IRTEGUN is now limited, so that exposure of humans via food is very low 45. Retinol level was increased in all groups of liver and kidney tissues. Vitamin D 2 and D 3 levels were decreased in all groups of liver and kidney tissues. The reason of these vitamin levels different may be application of KBrO 3 in these tissues when compared to control group. In conclusion, present results confirm that there can be a relationship between the decreasing of the cholesterol and α-tocopherol levels in the lung tissue. It can be speculated that resveratrol affected cholesterol biosynthesis in Wistar albino rats. And it was observed that the formation of lipid peroxidation in the kidney of old Wistar rats by induced a prooxidant and carcinogen chemical (KBrO 3 ) administration. REFERENCES 1. Nonomura S, Kanagawa H, Makimoto A: Chemical constituents of polygonaceous plants. I. Studies on the components of Ko-jo-kon (Polygonum cuspidatum Sieb. et Zucc.). Yaku Zass, 83, , Takaoka MJ: Of the phenolic substances of white hellebore (Veratrum grandiflorum Loes. fil.). J Fac Sci Hokk Imper Univ, 7, 8-9, Richard JL: Coronary risk factors The French paradox. Arch Mal Coeur Vaiss, 80, 17-21, Kopp P: Resveratrol a phytoestrogen found in red wine a possible explanation for the conundrum of the French paradox. Eur J Endocrinol, 138, , Pace-Asciak CR, Hahn S, Diamandis EP, Soleas G Goldberg DM: The red wine phenolics trans-resveratrol and quercetin block human platelet aggregation and eicosanoid synthesis: Implications for protection against coronary heart disease. Clin Chim Acta, 235, , Fitzpatrick DF, Hirschfield SL, Coffey RG: Endothelium-dependent vasorelaxing activity of wine and other grape products. Am J Physiol, 265, H , Frankel EN, Waterhouse AL, Kinsella JE: Inhibition of human LDL oxidation by resveratrol. Lancet, 341, , Asensi M, Medina I, Ortega A, Carretero J, Baño MC, Obrador E, Estrela JM: Inhibition of cancer growth by resveratrol is related to its low bioavailability. Free Radic Biol Med, 33, , Packer L: α-lipoic acid: A metabolic antioxidant which regulates NFkappa B signal transduction and protects against oxidative injury, Drug Metab Rev, 30, , Evans JL, Goldfine ID: α-lipoic acid: A multifunctional antioxidant that improves insulin sensitivity in patients with type 2 diabetes. Diab Technol Therapeut, 2, , Packer L, Witt EH, Tritschler HJ: α-lipoic acid as a biological antioxidant. Free Radic Biol Med, 19, , Çiftçi H, Özkaya A, Dayangaç A, Ölçücü A, Çelik S, Şahin Z, Ateş S: Effect of lipoic acid on the some elements in brain tissue of DMBAinduced Guinea Pigs. Kafkas Univ Vet Fak Derg, 15 (4): , Crespy V, Williamson G: A review of the health effects of green tea catechins in in vivo animal models. J Nutr, 134, 3431S-3440S, Koo MWL, Cho CH: Pharmacological effects of green tea on the gastrointestinal system. Eur J Pharmacol, 500, , Lin YL, Cheng CY, Lin YP, Lau YW, Juan IM, Lin JK: Hypolipidemic effect of green tea leaves through induction of antioxidant and phase II enzymes including superoxide dismutase, catalase, and glutathione S-transferase in rats. J Agric Food Chem, 46, , Seeram NP, Henning SM, Niu Y, Lee R, Scheuller HS, Heber D: Catechin and caffeine content of green tea dietary supplements and correlation with antioxidant capacity. J Agric Food Chem, 54, , Weisburger JH: Eat to live, not live to eat. Nutr, 16, , Yokozawa T, Nakagawa T, Kitani K: Antioxidative activity of green tea polyphenol in cholesterol-fed rats. J Agric Food Chem, 50, , Ishidate M, Sofuni T, Yoshikawa K, Hayashi M, Nohmi T, Sawada M, Matsuoka A: Primary mutagenicity screening of food additives currently used in Japan. Food Chem Toxicol, 22, , Ishidate M, Yoshikawa K: Chromosome aberration tests with Chinese hamster cells in vitro with and without metabolic activation-a comparative study on mutagens and carcinogens. Arch Toxicol Suppl, 4, 41-44, Hayashi M, Kishi M, Sofuni T, Ishidate M: Micronucleus tests in mice on 39 food additives and eight miscellaneous chemicals. Food Chem Toxicol, 26, , Parsons JL, Chipman JK: The role of glutathione in DNA damage by potassium bromate in vitro. Mutagenesis, 15, , Kasai H, Nishimura S, Kurokawa Y, Hayashi Y: Oral administration of the renal carcinogen, potassium bromate, specifically produces 8-hydroxydeoxyguanosine in rat target organ DNA. Carcinogenesis, 8, , Cadenas S, Barja G: Resveratrol, melatonin, vitamin E, and PBN protect against renal oxidative DNA damage induced by the kidney carcinogen KBrO 3. Free Radic Biol Med, 26, , Ballmaier D, Epe B: Oxidative DNA damage induced by potassium bromate under cell-free conditions and in mammalian cells. Carcinogenesis, 16, , Cheng KC, Cahill DS, Kasai H, Nishimura S, Loeb LA: 8-Hydroxyguanine, an abundant form of oxidative DNA damage, causes G-T and A-C substitutions. J Biol Chem, 267, , Keser S, Yilmaz O, Tuzcu M: Effects of resveratrol on fatty acid levels in serum and erythrocytes of rats administered potassium bromate. Asian J Chem, 22 (10): , Yilmaz O, Keser S, Tuzcu M, Cetintas B: Resveratrol (trans-3,4,5- trihydroxystilbene) decreases lipid peroxidation level and protects antioxidant capacity in sera and erythrocytes of old female Wistar rats induced by the kidney carcinogen potassium bromate. ETAP, 24 (2): 79-85, Özkaya A, Çelik S, Yüce A, Şahin Z, Yilmaz Ö: The effects of ellagic acid on some biochemical parameters in the liver of rats against oxidative stress induced by aluminum. Kafkas Univ Vet Fak Derg, 16 (2): , Bragagnolo N, Rodriguez-Amaya DB: Comparison of the cholesterol content of Brazilian chicken and quail eggs. J Food Comp Anal, 16 (2): , Katsanidis E, Addis PB: Novel HPLC analysis of tocopherols, and cholesterol in tissue. Free Radic Biol Med, 27 (11-12): , Ulkay MB, Aktaş A, Bozkurt HH: The effect of Trifolium pratense L. (red clover) on rat testes. Kafkas Univ Vet Fak Derg, 14 (2): , Kısmalı G: Effects of Coenzyme Q10 on blood biochemistry in rats. Kafkas Univ Vet Fak Derg, 15 (2): , Ergun G, Aktas S: ANOVA modellerinde kareler toplamı yöntemlerinin karşılaştırılması. Kafkas Univ Vet Fak Derg, 15 (3): , Akbay TT, Yarat A, Sacan O, Yanardag R: The effect of glurenorm (gliquidone) on Aorta in STZ induced diabetic rats. Kafkas Univ Vet Fak Derg, 17 (2): , Keser S, Yilmaz O, Tuzcu M, Erman O, Irtegun S: The effects of catechin, lipoic acid, resveratrol and potassium bromate on fatty acid, lipophylic vitamins and cholesterol levels in muscle of Wistar rats. J Chem Soc Pak, 34 (1): 89-93, Keser S, Yilmaz O, Tuzcu M: The effects of potassium bromate and resveratrol on cholesterol and vitamin E levels in heart, muscle and brain of Wistar rats. JABS, 4 (2): 40-45, 2010.

29 372 Effects of Antioxidants Laden BP, Porter TD: Resveratrol inhibits human squalene monooxygenase, Nutr Res, 21, , Azzi A, Breyer I, Feher M, Ricciarelli R, Stocker A, Zimmer S, Zingg J: Nonantioxidant functions of alpha-tocopherol in smooth muscle cells. J Nutrition, 131, , Fechner H, Schlame M, Guthmann F, Stevens PA, Rustow B: alpha and delta-tocopherol induce expression of hepatic alpha-tocopherol transfer-protein mrna. Biochem J, 331 (Pt 2), , Kim HS, Arai H, Arita M, Sato Y, Ogihara T, Inoue K, Mino M, Tamai H: Effect of alpha-tocopherol status on alpha-tocopherol transfer protein expression and its messenger RNA level in rat liver. Free Rad Res, 28, 87-92, Porter TD: Supernatant protein factor and tocopherol-associated protein: An unexpected link between cholesterol synthesis and vitamin E. J Nutr Biochem, 14, 3-6, Zimmer S, Stocker A, Sarbolouki MN, Spycher SE, Sassoon J, Azzi A: A novel human tocopherol-associated protein: Cloning, in vitro expression, and characterization. J Biol Chem, 275, , Miura D, Miura Y, Yagasaki K: Hypolipidemic action of dietary resveratrol, a phytoalexin in grapes and red wine, in hepatoma-bearing rats. Life Sci, 73 (11): , Kurokawa Y, Hayashi Y, Maekawa A, Takahashi M, Kokubo T: Induction of renal cell tumors in F-344 rats by oral administration of potassium bromate, a food additive. Gann, 73, , 1982.

30 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Etlik Piliçlerde Kısıtlı Yemlemenin Performans Özelliklerine Etkisi [1] A. Ahad SHADDEL TELLİ * Ömer Faruk ALARSLAN ** Çiğdem ALTINSAAT *** Naser MAHERİ SİS * Keyvan HATEFİ NAZHAD * Alireza AHMADZADEH * [1] Bu çalışma Shabestar Üniversitesi tarafından desteklenmiştir (Proje No: 16922) * Department of Animal Sciences, Shabestar Branch, Islamic Azad University, Shabestar - IRAN ** Ankara Üniversitesi, Ziraat Fakültesi, Zootekni Anabilim Dalı, TR Dışkapı, Ankara - TÜRKİYE *** Ankara Üniversitesi, Veteriner Fakültesi, Fizyoloji Anabilim Dalı, TR Dışkapı, Ankara - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışma kısıtlı yemlemenin etlik piliçlerde performans özellikleri üzerine olan etkilerini araştırmak amacı ile yapılmıştır. Araştırma 280 adet (Ross-308) ticari erkek etlik civciv üzerinde yürütülmüştür. Çalışma, civcivlerin rastgele yerleştirilmesi ile kontrol ve üç deneme grubu, 5 tekerrür şeklinde düzenlenmiştir. Kontrol grubunda ad-libitum olarak yemleme yapılırken, birinci, ikinci ve üçüncü deneme gruplarında, 15 ve 22. günler arasında günde sırasıyla 8, 16 ve 24 saat süreyle kısıtlı yemleme uygulanmıştır. Kesim öncesi (49. gün) ortalama canlı ağırlık, canlı ağırlık artışı, yem tüketimi, yaşama gücü ve verim indeksi bakımından kontrol ve deneme grupları arasında belirlenen farklılıkların istatistiki olarak önemli olmadığı saptanmıştır (P>0.01). Gruplar arasında yemden yararlanma oranındaki farklılıklar istatistiki olarak önemli bulunmuştur (P<0.05). Anahtar sözcükler: Etlik Piliç, Verim, Kısıtlı yemleme The Effects of Early Feed Restriction on Broiler Performance Summary This experiment was conducted to investigate the effects of feed restriction on broiler chickens performance. A total of 280 day-old commercial male broiler chicks from Ross-308 line were used in the experiment. The experiment was held with a randomly allocated control group and three treatment groups and five replicates. The birds were fed ad-libitum in the control group while the feed availability were restricted for 8, 16 and 24 hours per day in 1st, 2nd and 3rd treatments, respectively during 15th and 22th days of age. Average live body weight, body weight gain, feed consumption, livabilitiy and performance index did not differ between treatments (P>0.01), Cumulative feed conversion ratios to 49 d were significantly different among treatments (P<0.05). Keywords: Broiler, Performance, Feed restriction GİRİŞ Etlik piliçler genotipleri üzerinde hızlı gelişme yönünde yapılan seleksiyon çalışmaları ile gün gibi kısa bir sürede kesim ağırlığına ulaşmaktadır. Fakat hızlı gelişme ve artan canlı ağırlığa paralel olarak bir takım aksaklıklar meydana gelmiştir. Bunların başlıcaları iskelet sistemindeki deformasyonlar, ayak-bacak problemleri, ani ölümlerde artış, asites ve karkasta aşırı yağlanmadır. Asites nedeniyle artan ölüm oranı ve karkas kalitesindeki gerileme ekonomik kayıplara yol açmaktadır. Hızlı gelişmenin getirdiği fizyolojik stres ile birlikte çevre koşullarına duyarlılık artmaktadır 1-5. Etlik piliçlerde hızlı gelişmeyle ortaya çıkan metabolik aksaklıkları azaltmak için gelişmenin kontrol altına alınmasına yönelik yemleme ve aydınlatma sınırlamaları üzerinde durulmaktadır. Bu amaçla yem tüketimi doğrudan veya rasyon içeriğinde yapılacak sınırlamalarla ya da aydınlık süresini sınırlamak suretiyle kısıtlanmaktadır 4,6,7. Sınırlama ile oluşan gelişme geriliğinin sınırlama sonrası serbest yemleme döneminde telafi edici büyüme (com- İletişim (Correspondence) shaddel_a@yahoo.com

31 374 Etlik Piliçlerde Kısıtlı... pensatory growth) ile giderilmesi bu yöntemin esasını oluşturmaktadır. Böylece erken yaşta gelişme hızı yavaşlatılarak iskelet sistemi ve yaşamsal organların gelişimine öncelik verilmektedir 8. Erken yaşta (7-14 günler arası) yem tüketiminde sınırlamayı takiben telafi dönemine giren piliçlerde gelişim hızının yükselmesi, ancak artan oksijen ihtiyacının yüksek rakıma bağlı oksijen yetersizliği nedeni ile karşılanamaması sonucu kan hematokrit değerlerinde ve asites görülme oranında artış gözlenmektedir 9,10. Etlik piliç ve hindilerin kısa sürede kesim ağırlığına ulaşması için kullanılan serbest yemleme yönteminde hayvanlara tüketebildikleri kadar yem verilmektedir. Uygulaması kolay bir yöntem olmakla beraber tüketilen yem miktarının artması yemlerin sindirim kanalından geçiş hızını etkilemekte, yemler kısa süre sindirim kanalında kaldığı için sindirilme derecesi düşmekte ve yemden yararlanma olumsuz etkilenmektedir. Ayrıca besin madde içeriği yüksek rasyonlarla besleme sonucu hızlı büyüme sağlanırken vücutta yağ depolarının artması gözlenebilmektedir. Etlik piliçlerde bu olumsuzlukları önlemek amacıyla kısıtlı yemleme uygulanmaktadır. Hayvanların yem tüketimi sınırlandığında yemleri daha yüksek oranda sindirdiği ve yemden daha etkin bir şekilde yararlandığı düşünülmektedir Etlik piliçlerde yemleme zamanı üzerine yapılan bir çalışmada, geleneksel yöntem olarak bilinen serbest yemleme yöntemine kıyasla hayvanları aç bırakıp farklı yemleme uygulamanın performans değerleri açısından daha iyi sonuç verdiği bildirilmiştir 14. Bu çalışmada, etlik piliçlerde yem tüketim süresi kısıtlaması ile performans özelliklerinden canlı ağırlık, canlı ağırlık artışı, yem tüketimi, yemden yararlanma oranı, yaşama gücü ve verim indeksi üzerine etkilerini incelemek amaçlanmıştır. MATERYAL ve METOT Hayvan Materyali Bu araştırmada henüz kuluçkadan çıkan ve kanattan otoseks özelliğine sahip, toplam 280 adet Roos-308 günlük yaşta erkek etlik civciv kullanılmıştır. Araştırma 1996 Avrupa Konvansiyonunun kuralları (European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purpose 1996) doğrultusunda gerçekleştirilmiştir. Yem Materyali Deneme karma yemleri, yem ham maddelerinde yapılan ham besin maddelerinin analiz sonuçları dikkate alınarak hazırlanmıştır. Araştırmada hayvanlara verilecek rasyonlar NRC 15 önerileri ve Ross-308 hibrid kataloğunda belirtilen ihtiyaçları dikkate alınarak hazırlanmıştır (Tablo 1). Tablo1. Rasyonların yapısı ve besin maddeleri içeriği Table1. Nutrient composition of the diet Yem Ham Maddeleri Metot Başlangıç (0-10 gün) Büyütme (11-24 gün) Bitirme (25-49 gün) Mısır Bitkisel yağ Soya küspesi Et-kemik unu Balık unu Mermer tozu DCP DL-Metiyonin L-Lizin Min + Vit. Kar Tuz Toplam ME (kcal/kg) Ham protein (%) Ham Yağ (%) Ham Selüloz (%) Ca (%) P (%) Met + Sis (%) Metiyonin (%) Lizin (%) : vitamin ön karmanın 1 kg ı IU vitamin A, IU vitmin D 3, mg vitamin E, mg vitamin K 3, mg vitamin B 1, mg vitamin B 2, mg vitamin B 6, 40 mg vitamin B 12, mg Niasin, mg Kalsiyum -D-, mg Folik asit, 50 mg Biotin, mg vitamin C, mg Manganez, mg Çinko, mg Demir, mg Bakır,1.500 mg Iyot, 500 mg Kobalt, 200 mg Selenyum, mg Molibden içermektedir Bu araştırma, İran, İslami Azad Üniversitesi Şebester birimi Ziraat Fakültesi Zootekni Bölümü tavukçuluk tesislerinde 2009 yılı, Kasım ve Aralık aylarında yürütülmüştür (Pro. No: 16922). Denemede 4 grup, 5 tekerrür ve her tekerrürde 14 hayvan olmak üzere toplam 280 adet Ross- 308 erkek etlik civciv kullanılmıştır. Araştırmanın ilk 14 gününde tüm gruplara o dönem için hazırlanan rasyon serbest olarak verilmiştir. Kısıtlı yemleme uygulamaları 15. gün itibariyle başlatılmıştır. Birinci grup kısıtlı yemleme uygulanmadan serbest yemlenirken, 2. grupta günde 8 saat, 3. grupta günde 16 saat ve 4. grupta 24 saat (1 gün tok 1 gün aç) yem kısıtlama programı uygulanmıştır. Kısıtlamanın başlandığı bu dönemde etlik piliç büyütme rasyonu kullanılırken kısıtlama programı 1 hafta (7 gün) sürmüştür. Bu sürenin sonunda yani 22. günde kısıtlı yemleme programı sonlandırarak tüm gruplar serbest yemleme programına alınmıştır. Deneme süresince hayvanların önünde devamlı olarak temiz ve taze su bulundurulmuştur. Deneme boyunca kümeste 24 saat aydınlatma uygu-

32 375 SHADDEL TELLİ, ALARSLAN, ALTINSAAT MAHERİ SİS, HATEFİ NAZHAD, AHMADZADEH lanmıştır. Kümes içi sıcaklığı ilk hafta 32 o C, 2. hafta 30 o C civarında tutulmuş; sonraki her hafta sıcaklık 3 o C düşürülerek 22 o C ye ulaşılmış ve deneme sonuna kadar da bu sıcaklıkta sabit tutulmuştur. Denemede piliçlere bölge veteriner kurumu tarafından belirtilen programa göre 9. günde kuş gribi, Newcastle, bronşit için aşılama yapılmıştır. Performans Değerlerin Saptanması Deneme guruplarındaki civcivlerin canlı ağırlık ve yem tüketimleri her hafta sonu aynı saatlerde, 6 saat aç tutulduktan sonra tartılarak saptanmıştır. Toplam verilen yem miktarından, artan yem miktarı çıkartılarak yem tüketimleri belirlenmiştir. Canlı ağırlık artışı ve yemden yararlanma oranı ise elde edilen verilerden saptanmıştır. Yemden yararlanma oranı hesaplamasında aşağıdaki formül kullanılmıştır. Yemden yararlanma oranı = Haftalık yem tüketimi (g)/ Haftalık canlı ağırlık artışı (g). Deneme süresince gruplardaki ölümler günlük olarak tespit edilerek kaydedilmiştir. Verim indekslerinin (Vİ) hesaplanmasında ise Vİ = Ortalama canlı ağırlık (g) x Yaşama gücü (%)/Besi süresi x yemden yararlanma x 10 formülü kullanılmıştır 16. İstatistik Analizler İncelenen özelliklere Tesadüf Parselleri (CRD) Varyans Analizi uygulanmış, ortalamalar arasındaki farklılıklar Tukey Testi ile belirlenmiş ve analizler SAS bilgisayar paket programı ile yapılmıştır 17. Çalışmada yemden yararlanma verilerinin analizinde ise Kruskal-Wallis testi kullanılmıştır. BULGULAR Deneme gruplarının incelenen haftalara göre, ortalama canlı ağırlıklarına ait sonuçlar Tablo 2 de verilmiştir. Deneme başlangıcı canlı ağırlık ortalamaları arasında, istatistiksel olarak önemli farklıklar bulunmamıştır (P>0.05). Bu sonuçlardan, denemeye canlı ağırlık bakımından eşit koşullarda başlandığı anlaşılmaktadır. Denemede bir haftalık açlık programının bitiminde yapılan tartımlarda canlı ağırlık yönünden, yem kısıtlama süresinin gruplar arasında istatistiksel önemde farklıklar oluşturduğu görülmüştür (P<0.01). Denemenin 4, 5, 6 ve 7. haftalarında canlı ağırlık bakımından gruplar arasında farklılık saptanmamıştır (P>0.05). Üçüncü haftanın sonunda 16 ve 24 saat yem kısıtlaması yapılan gruplarda ortalama canlı ağırlık değerleri diğer gruplara göre daha düşük olmuştur. Bu canlı ağırlık farklılıkları diğer haftalarda ortadan kalkmıştır. Deneme gruplarının incelenen haftalara göre, ortalama canlı ağırlık artışlarına ait sonuçlar Tablo 3 te verilmiştir. Denemenin 3, 4 ve 6. haftalarında, 8, 16 ve 24 saat yem kısıtlama programı etlik civcivlerin canlı ağırlık artışı üzerine istatistiksel olarak önemli etki yapmıştır (P<0.01). Diğer haftalarda ve deneme boyunca (0-7. hafta) gruplar arasında farklıklar önemsiz bulunmuştur (P<0.05). Denemenin 3. haftasında canlı ağırlık artışı serbest yemlenen ve 8 saat kısıtlanan gruplarda daha yüksek, 16 ve 24 saat kısıtlanan gruplarda daha düşük olmuştur (Tablo 3). Denemenin 4. haftasında canlı ağırlık artışı bakımından gruplar arasında farklılıklar önemli bulunmuştur (P<0.01). Bu hafta, canlı ağırlık artışının 16 saat kısıtlanan grupta, serbest yemlenen ve 8 saat kısıtlama yapılan gruplara göre daha yüksek olduğu görülmüştür. Ancak 24 saat kısıtlanan grup ila diğer gruplar arasında farklılıklar önemsiz bulunmuştur. Denemenin 6. haftasında canlı ağırlık artışının, 24 saat kısıtlanan grupta diğer gruplara göre fazla olduğu saptanmıştır. Onaltı saat kısıtlama yapılan ve serbest yemlenen gruplara ait değerlerin benzer olduğu görülmüştür. Tablo 2. Etlik piliçlerde kısıtlı yemlemenin ortalama canlı ağırlık üzerine etkileri (g) Table 2. Effect of feed restriction on average body weight of broilers (g) Haftalar Gruplar Kontrol 8 Saat Kısıtlama 16 Saat Kısıtlama 24 Saat Kısıtlama P VK DB ± ± ± ±19.94 ab ± ± ± ± ± ± ± ±22.84 a ± ± ± ± ± ± ± ±34.37 b ± ± ± ± ± ± ± ±25.59 b ± ± ± ± a-b: Aynı satırda her bir etkiye ait ortalamalar için farklı harfle gösterilen değerler arasındaki farklılıklar istatistiksel olarak önemlidir, VK: Varyasyon katsayısı, DB: Deneme başı

33 376 Etlik Piliçlerde Kısıtlı... Tablo 3. Etlik piliçlerde kısıtlı yemlemenin ortalama canlı ağırlık artışı üzerine etkileri (g/piliç/hafta) Table 3. Effect of feed restriction on average body weight gain of broilers (g/broiler/week) Gruplar Haftalar Kontrol 8 Saat Kısıtlama 16 Saat Kısıtlama 24 Saat Kısıtlama P VK ± ± ±23.06 a ±16.11 b ± ±12.34 b ± ± ± ± ±11.56 a ±19.30 b ± ±23.31ab ± ± ± ± ±22.19 c ±26.67a ± ±27.86 b ± ± ± ± ±6.64 b ±26.60 ab ± ±18.94 a ± ± a-c: Aynı satırda her bir etkiye ait ortalamalar için farklı harfle gösterilen değerler arasındaki farklılıklar istatistik olarak önemlidir, VK: Varyasyon katsayısı Tablo 4. Etlik piliçlerde kısıtlı yemlemenin ortalama yemden yararlanma oranı üzerine etkileri (g yem tüketimi/g canlı ağırlık artışı) Table 4. Effect of feed restriction on average feed conversion ratios of broilers (g feed intake/g body weight gain) Gruplar Haftalar Kontrol 8 Saat Kısıtlama 16 Saat Kısıtlama 24 Saat Kısıtlama P (χ 2 ) ± ± ±0.09 ab 2.08±0.26 a 1.82± ± ± ±0.03 a 1.906± ± ±0.04 b 2.06±0.05 ab 1.92± ± ± ±0.04 ab 1.929± ± ±0.14 a 1.83±0.08 b 1.86± ± ± ±0.02 b 1.723± ± ±0.07 ab 1.94±0.08 ab 1.93± ± ± ±0.03 ab a-b: Aynı satırda her bir etkiye ait ortalamalar için farklı harfle gösterilen değerler arasındaki farklılıklar istatistik olarak önemlidir Tablo 5. Deneme sonu kısıtlı yemlemenin yaşama gücü ve verim indeksi üzerine etkileri Table 5. Effect of feed restriction on livability and performance index in at the end experiment Gruplar Özellikler Kontrol 8 Saat Kısıtlama 16 Saat Kısıtlama 24 Saat Kısıtlama P VK Ölen hay.sayısı Yaşama gücü (%) Verim indeksi ± ± ± ± VK: varyasyon katsayısı Deneme gruplarının haftalara göre, ortalama yem tüketimine ait sonuçlar Tablo 4 te verilmiştir. Denemenin 3. ve 4. haftalarında, 8, 16 ve 24 saat yem kısıtlama programı etlik civcivlerin yemden yararlanma oranı üzerine istatistiki olarak önemli etki yapmıştır (P<0.05). Bu özellik bakımından diğer haftalarda, gruplar arasında farklıklar önemsiz bulunmuştur (P>0.05). Yemden yararlanma oranı tüm haftalar (0-7. hafta) incelendiğinde, 16 saat kısıtlı yemlenen gruba ait değerin diğer gruplara göre düşük olduğu (1.99) ve bu kısıtlama süresinin olumlu etki yarattığı belirlenmiştir. Yaşama gücü ve verim indekslerine ait değerler Tablo 5 te verilmiştir. Çalışmada deneme gruplarında, yaşama gücü ve verim indeksi kontrol grubundan yüksek bulunmasına rağmen, deneme ve kontrol grupları arasındaki bu fark istatistiksel olarak önemsiz bulunmuştur. TARTIŞMA ve SONUÇ Bu çalışmada günler arasında 16 ve 24 saat kısıtlama yapılan gruplarda, 8 saat kısıtlama yapılan gruba göre canlı ağırlık ve canlı ağırlık artışlarında önemli düşüşler meydana gelmiş ancak deneme sonu (49. gün) canlı ağırlık

34 377 SHADDEL TELLİ, ALARSLAN, ALTINSAAT MAHERİ SİS, HATEFİ NAZHAD, AHMADZADEH artışı bakımından gruplar arasında önemli fark olmadığı görülmüştür (Tablo 3). Bu sonuç Yu ve ark. 14, Ballay ve ark. 18 ve Rahimi ve ark. nın 19 yaptıkları çalışmaların bulguları ile benzerlik göstermektedir. Kısıtlı yemleme programı canlı ağırlık artışını olumsuz yönde etkilemiş ancak serbest yemlemeye dönüldükten sonra telafi edildiği saptanmıştır. Yapılan çalışmada, 8 saat kısıtlı yemlenen etlik piliçlerde 3. hafta yemden yararlanma oranı diğer gruplara göre daha düşük bulunmuştur. Yirmi iki ila kırk dokuzuncu günler arası yemden yararlanma oranı, uygulanan kısıtlama programına bağlı olarak değişim göstermemiştir (P>0.05). Ancak denemenin 0-7. haftaları dikkate alındığında 16 saat kısıtlı yemleme programı serbest yemlenen gruba göre daha iyi sonuç göstermiş ve olumlu etki yaratmıştır (P<0.05). Elde edilen sonuçlar kısıtlı yemlemenin, yemden yararlanma oranı üzerine olumsuz bir etki oluşturmadığını göstermiştir. Benzer şekilde Zulkifli 20 kısıtlı yemlemenin, yemden yararlanma oranı üzerine olumsuz bir etkisi olmadığını bildirmiştir. Araştırma bulguları Altan ve ark. 8, Shariatmadari ve ark.21 ve Rahimi ve ark. nın 16 yaptıkları çalışmalarda elde edilen sonuçlar ile benzerlik göstermektedir. Kısıtlı yemlemenin sonrasında ortaya çıkan performansı etkileyen başlıca etmenler; kısıtlama süresi, kısıtlama şiddeti, sınırlı yemlemenin başlama yaşı ve genotiptir 22 Zulkifli 20 erken yaşta başlatılan kısıtlı yemleme ile telafi edici büyümenin sağlanabildiğini ileri sürerken, Camacho ve ark. 23 ise kısıtlı yemlemeye başlama yaşının telafi edici büyüme üzerinde etkili olmadığını bildirmektedirler. Sonuç olarak, etlik civcivlerde yedi gün boyunca uygulanan 16 ve 24 saatlik kısıtlı yemleme 3. hafta sonundaki canlı ağırlık, canlı ağırlık artışı ve yem tüketimini önemli derecede düşürmüştür. Ancak 8 saat kısıtlı yemleme yapılan grup, bahsedilen özellikler bakımından etkilenmemiş ve serbest yemlenen grubuna göre hiç bir farklılık saptanmamıştır. Kısıtlı yemlemenin neden olduğu canlı ağırlık, canlı ağırlık artışı ve yem tüketimindeki azalmaların, deneme sonu (49. gün) ortadan kalktığı görülmüştür. Deneme sonu yemden yararlanma oranının 16 saat kısıtlı yemlenen grupta diğer gruplara göre daha iyi sonuç verdiği saptanmıştır (1.99). Gruplar arasında verim indeksi bakımından önemli bir farklık bulunamamıştır. KAYNAKLAR 1. Mitchell MA, Kettlewell PJ, Maxwel MH: Physiological stress in broilers chickens during transport. 9th European Poultry Conference Proceeding, 2, , Túmova E, Skrivan M, Skrivanova V, Kacerovska L: Effect of early feed restriction on growth in broiler chickens, turkeys and rabbits. J Anim Sci, 47, , Washburn KW, Bandari K: Effect of timing and duration of restricted feeding on compensatory growth of broiler. Poult Sci, 57, , Arce J, Berger M, Coello CL: Control of ascites syndrome by feed restriction techniques. J Appl Poult Res, 1, 1-5, Julian RJ: Physiological, management and environmental triggers of the ascites syndrome: a review. Avian Pathol, 29, , Buys N, Buyse J, Hassanzadeh M, Decuypere E: Intermittent lighting reduces the incidence of ascites inbroilers: An interaction with protein content of feed on performance and the endocrine system. Poult Sci, 77, 54-56, Fedde MR, Weigle GE, Wideman RF: Infulence of feed deprivation on ventilation and gas exchange in broilers: Relationship to pulmonary hypertension syndrome. Poult Sci, 77, , Altan Ö, Özkan S, Yalçın S: Etlik piliçlerde gelişmenin geciktirilmesi: değişik sınırlı yemleme Programlarının etlik piliç performansı ve karkas özelliklerine etkileri. Tr J Vet Anim Sci, 22, , Özkan S, Plavnik I, Yahav S: Effects of early feed restriction on performance and ascites development in broiler chickens subsequently raised at low ambient temperature. J Appl Poult Res, 15, 9-19, Maxwell MH, Robertson JW, McCorquodale CC: Whole blood and plasma viscosity values in normal and ascitic broiler chickens. Br Poult Sci, 33, , Konca Y, Yazgan O, Bahtiyarca Y, Şengül T: Sıcak şartlarda kısıtlı yemleme yaşı ve süresinin broyler piliçlerde performans ve abdominal yağlanmaya etkisi. International Animal Nutrition Congress, Bildiriler Kitabı, , Leeson S, Summers JD: Some nutritional implications of leg problems with poultry. Br Vet J, 144, 81-92, Monsi A, Ayodele AO: Bioeconomic effects of feed restriction on broiler chickens in Nigeria s Humid Southern Environment. Discov Innov, 2, 73-79, Yu MW, Robinson FE, Clandinin MT, Bodnar L: Growth and body composition of broiler chickens in response to different regimens of feed restriction. Poult Sci, 69, , NRC: Nutrient requirements of poultry. National Academic Press, Washington DC, Türkoğlu M, Sarıca M: Tavukçuluk Bilimi (Yetiştirme, Besleme ve Hastalıklar). 3. Basım, Bey Ofset Matbaacılık, Ankara, Anonim: SAS User s Guide (Release 7,0). SAS Ins, Inc, Cary, Ballay M, Dunnington EA, Gross WB, Siegel PB: Restricted feeding and broiler performance: Ageat initation and length of restriction. Poult Sci, 71, , Rahimi G, Rezaei H, Haffzian H, Saiyahzadeh H: The effect of intermittent lighting schedule on broiler performance. Poult Sci, 4, , Zulkifli İ: Heterophil/Lymhocyte response and performance of feed and water restricted broiler chickens under tropical conditions. J Anim Sci, 12 (6): , Shariatmadari F, Hosseni SH: Effect of time of feed restriction on the performance of broiler chickens. Br Poult Sci, 42, 106, Yu MW, Robinson FE: The application of short term feed restriction to broiler chicken production: A review. J Appl Poult Res, 1, , Camacho MA, Sua rez ME, Herrera JG, Cuca JM, Garcı a-bojalil CM: Effect of age of feed restriction and microelement supplementation to control ascites on production and carcass characteristics of broilers. Poult Sci, 83, , 2004.

35 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Stereological Measurement of Testicular Volume in Kivircik Rams Nazan GEZER İNCE * Gülsün PAZVANT * Çağdaş OTO ** Oya KAHVECİOĞLU * * Department of Anatomy, Faculty of Veterinary Medicine, University of Istanbul, TR Avcılar, Istanbul - TURKEY ** Department of Anatomy, Faculty of Veterinary Medicine, University of Ankara, TR Dışkapı, Ankara - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, measurement of testis volume by stereology in Kivircik rams, Turkey s traditional sheep breed, was purposed. Right and left testes with epididymis were taken from a total of 42 Kivircik rams whose carcass weights were measured previously. Fifteen, 14, and 13 of them were 5, 6, and 7 months old, respectively. Weights and morphometric measurements (length, width, and thickness) of the testis and epididymis were taken. Theirs volumes were estimated according to the Archimedes principle. According to Cavalier s principle, 0.6 cm thick 8-11 parallel sections were taken. In these sections for whole testis (testis + epididymis) volume 0.8 cm, and for testis and epididymis volumes, grids with 0.4 cm intervals randomly placed on sections and convergent points were counted. By using Microsoft Excel (XP version), contained volume, volume ratio and coefficient error estimation formulas were used for estimating values automatically. In the study, statistical difference was not observed (P>0.05) between right and left testes volumes values acquired from Archimedes and Cavalier s methods. The highest increase in epididymis, testis, and whole testis volumes, which were measured separately, was observed between rams at 6-7 months of age. In correlation analyses, estimated according to months by using mean values, it was recorded that there was a correlation between carcass weight and epididymis volume (P<0.05). Correlation was observed by ratio of P<0.01 between epididymis volume and testis thickness for 7 months old rams. Although there was no correlation observed between testis volume and epididymis volume for 7 months old rams. Instead of above evaluations, correlation ratio of P<0.01 was observed between morphometric measurements and stereological data of all analysis. Regarding features, showed higher correlations, regression analyses were made. In the presence of some morphometric data, regression equations, which required us to get stereological data, were calculated. Our thought is the collected data of this study can support the further experimental animal studies. Keywords: Epididymis, Kivircik rams, Stereology, Testis, Testicular volume Özet Kıvırcık Koçlarında Testis Hacminin Stereolojik Ölçümleri Türkiye nin ulusal bir koyun ırkı olan Kıvırcık koçlarında testis hacmini stereolojik bir yöntemle hesaplama amaçlandı. Karkas ağırlıkları alınmış 15 adet 5 aylık, 14 adet 6 aylık, 13 adet 7 aylık olmak üzere 42 adet Kıvırcık koçtan sağ ve sol testisler epididymis ile birlikte alındı. Testislerin ağırlık ve morfometrik ölçümleri (uzunluk, genişlik, kalınlık) alındı. Testis ve epididymis lerin Arşimet prensibine göre hacimleri hesaplandı. Cavalieri prensibine göre 0.6 cm kalınlığında olmak üzere 8 ile 11 adet paralel kesitler alındı. Bu kesitlerde tüm testis (testis+epididymis) hacmi için 0.8; testis ve epididymis hacmi için 0.4 cm sonda aralıklı gridler kesitler üzerine rastgele atılarak üzerinde çakışan noktalar sayıldı. Hacim, hacim oranı ve hata katsayısı hesaplama formüllerini içeren Microsoft Excel (XP sürümü) programı kullanılarak değerler otomatik olarak hesaplandı. Çalışmada Arşimet ve Cavalieri metotları kullanılarak elde edilen hacim değerleri ile sağ ve sol testis hacim değerleri arasında istatistiksel fark gözlenmedi (P>0.05). Cavalieri metodu kullanılarak aylara göre ayrı ayrı hesaplanan epididymis, testis ve tüm testis hacimlerindeki en hızlı artış 6 aylık ile 7 aylık koçlar arasında gözlendi. Ortalama değerler kullanılarak aylara göre yapılan korelasyon analizinde 6 aylık koçlarda karkas ağırlığının epididymis hacmi ile korelasyon gösterdiği saptandı (P<0.05). 7 aylık koçlarda ise epididymis hacminin testis kalınlığı ile arasında P<0.01 oranında korelasyon tespit edildi. 7 aylık koçların testis hacmi ile epididymis hacmi arasında ise korelasyon görülmediği tespit edildi. Bu değerlendirmeler dışında tüm morfometrik ölçümler ile stereolojik veriler arası analizde P<0.01 oranında korelasyonların olduğu gözlendi. Aralarında yüksek korelasyonların bulunduğu özellikler dikkate alınarak regresyon analizleri yapıldı. Testislerin bazı morfometrik verilerinin bilinmesi halinde stereolojik verilerini elde edebileceğimiz regresyon denklemleri hesaplandı. Bu çalışmadan elde edilen tüm verilerin yapılacak olan deneysel hayvan çalışmalarına katkı sağlayacağını düşünmekteyiz. Anahtar sözcükler: Epididymis, Kıvırcık koç, Stereoloji, Testis, Testis hacmi İletişim (Correspondence) /17193 nazan@istanbul.edu.tr

36 380 Stereological Measurement of... INTRODUCTION Kivircik is a national sheep breed raised in Turkey and constitutes 6-7% of Turkey s sheep population 1. This breed, which has pretty good meat and milk yield, is the main sheep breed of the Thracia region 2. In rams, puberty begins with increased libido and the production of sperm cells having the capacity of fertilization. These kind of sperm cells are produced in days and this period may change with nutrition, climate, body weight and race 3. Testicular volume measurement is a significant criterion in spermatogenesis prediction and evaluating testis functions in human 4-6. Because testis volume is composed of tubuli seminiferi contorti and tubuli seminiferi recti, any change in testis measures reflects the changes in this tissue mass and also spermatogenesis 6. (testis length, width, and thickness) were taken by calipper (Mitutoya, Eng). Testis length were taken from extremitas capitata to extremitas caudata of testis, testis widht were taken from margo medialis to margo lateralis at the widest point of the testis and also testis thickness were taken from margo epididymalis to margo liber at the widest point of the testis.then, according to Archimedes principle, the volume of testis and epididymis were calculated regarding the volume raised in a graduated bowl. Afterwards, with slicer (Bosch), 0.6 cm parallel sections were obtained (Fig. 1). For volume estimation, according to testis size 8-11 sections were sliced. These sections were superimposed by providing the same direction sides upwards and then sections were enumerated. Besides human studies 4-8, there are also many testis volume studies had been conducted on stallion 9, donkey 10, dog 11,12 and a couple of rams included Chios and Serres rams 13, Awassi rams 14, Libyan fat-tailed rams 15. Rams have great importance in the improvement of the fertility of a sheep herd. Consequently, knowing testis measurements and spermatologic properties of rams that are going to be selected as breeding purposes takes an important place in evaluating highly productive breeds and providing continuance of genotypes produced 16. Because the relation between the size of the testis and reproductive activity is important, biometric analyses on testis are also significant in young rams. Every study on testis helps in the better understanding of this organ and system, and accordingly assists in going one step forward in genetic studies. In this study, our purpose is to report the relationship between the volumetric enlarging of testes and epididymis, and the morphometric measures of whole testes in Kivircik rams by using the stereological method, to be a contributor to veterinary and other experimental studies of animals. MATERIAL and METHODS In our study, right and left testes with epididymis were taken from 42 Kivircik rams from Cekmece Meat and Integrated Plant and their carcass weights were also recorded. Fifteen, 14, and 13 of the Kivircik rams were 5, 6, and 7 months of age, respectively (born in August- September-October). Fixation of taken materials was provided by steeping in 10% formalin solution at 10 days. After pulling out the solution, membranes of testes were peeled and ductus deferens was removed. The whole testis (testis and epididymis) were weighed on 1 mg digital assay balance. After this process, morphometric measures Fig 1. The whole testis (testis and epididymis) slices cut in paralel sections Şekil 1. Tüm testis in (testis ve epididymis) paralel dilimlere ayrılmış kesitleri Volume Estimation In order to estimate whole testis volume, and testis and epididymis volumes, the following procedure was undertaken. Grids with 0.8 cm prob intervals for whole testis and grids with 0.4 cm prob intervals for testis and epididymis were randomly put on sections and the points fall on the related sections that belong to material volumes we measure were counted (Fig. 2) and testis volume estimated via following formula. V = t x a (p) x P V : Volume t : Section thickness (0.6 cm) a (p) : Area represented by each point on pointed area measurement ruler (0.64 cm 2 for whole testis, 0.16 cm 2 for testis and epididymis) P : Total point count on section surface area Volume Fraction Estimation The area measurement ruler, as shown in Fig. 2, was thrown on section cites randomly. Circled points hit on the whole testis, and small points hit on testis and epididymis, were counted. Since the small points/big points proportion

37 381 GEZER İNCE, PAZVANT OTO, KAHVECİOĞLU Volumetric and Volumetric Fraction Data By ignoring the age variation, the mean value of whole testis volume estimation of rams used in this study (calculated according to Archimedes principle) was found as 70.5±32.9 cm 3 (right: 71.4±34.6 cm 3, left: 69.6±31.6 cm 3 ). Stereologically, the mean value of whole testis volume was 67.00±32.9 cm 3 (right: 67.7±34.0 cm 3, left: 66.2±32.3 cm 3 ). A statistical difference was not observed between values obtained using Archimedes and Cavalier s principles (P>0.05) (Table 1). A statistical difference was not determined between right and left testis volumes, which were obtained from Archimedes and Cavalier s principles (P>0.05). Fig 2. Superimposition of the grid covering testis and epididymis slice Şekil 2. Testis ve epididymis kesitlerinin üzerine noktalı alan ölçüm cetvelinin atılması was 4/1, testis or epididymis volume/whole testis ratio was calculated by the formula below. Volume ratio varies between 1 and 0, and generally expressed as (%) percentage 17. In order to question the sufficiency of the quantity of sections and point frequency on pointed area measurement ruler that used in this study, CE was calculated according to method reported by Gundersen and Jensen 18. In the study, statistical differences evaluated by months between the right and left testis were examined by Archimedes and Cavalier s principles. By ignoring carcass weight, correlation analysis was applied monthly between morphometric measurement values of testis and stereological data. By referring to data obtained from correlation analyses, on the basis of highly correlated properties, regression analyses was carried out. In order to control the significance of difference between mean values of all measurements, a Student-t test was performed. In statistical data estimation (mean value, standard deviation, correlation, and regression analyses), SPSS 8.0 and Minitab 12 programs were used. Nomina Anatomica Veterinaria was used for the anatomical nomenclature 19. RESULTS P testis or epididymis V V ( whole testis) 4 P whole testis Mean carcass weights of rams used in the current study were 15.9±1.45 kg, 19.5±1.23 kg, and 24.9±2.47 kg for 5, 6 and 7 month-old rams, respectively. Table 1. Total volume of whole testis (cm 3 ) using Archimedes and Cavalier s principles Tablo 1. Arşimet ve Cavalier prensibi kullanılarak hesaplanan tüm testisin (cm 3 ) toplam hacmi Features Section n Mean±SD Whole testis (Archimedean Principle) Whole testis (Cavalier s Principle) Whole testis parts (testis and epididymis) values obtained by using Cavalier s principle were shown in Table 2. There was no statistical difference between right and left values of testis and epididymis volumes, estimated month-tomonth according to Cavalier s principle (P>0.05). Besides, for 5 months, mean testis volume was 41.6±22.1 cm 3 (88%); for 6 months it was 52.6±26.3 cm 3 (88%); and for 7 months it was 90.2±19.9 cm 3 (90%). For epididymis the values were 4.82±1.36 cm 3 (12%); 6.02±2.17 cm 3 (12%); and 9.45±2.38 cm 3 (10%), respectively. According to Cavalier s principle, coefficients of error for whole testis, testis and epididymis, were 2%, 4%, and 1%, respectively. Correlation Data Right Left Total Right Left Total Correlation ratio of P<0.05 was observed between carcass weight and epididymis volume for 6 months old rams where correlation analysis was evaluated according to months by using mean values but no other correlations were observed for carcass weight with neither morphometric nor stereological values for other months. Epididiymis volume of 7 months old rams showed correlation (P<0.01) with only testis thickness in all other morphometric measurements. Again while there was no correlation between epididiymis volume and testis volume of stereological datas, correlation ratio of P<0.01 was ± ± ± ± ± ±32.9

38 382 Stereological Measurement of... observed for other morphometric an stereological datas at 7 months old rams. Instead of above evaluations, correlation ratio of P<0.01 observed between morphometric measurements and stereological data of all analysis (Table 3). Regression Analyses By using correlation analyses, regression analyses, based on highly related properties, was evaluated. Thus, regression equations, maintaining stereological data under available morphometric data, were estimated (Table 4). DISCUSSION Although use of technically improved equipment and methods, for comparing testis and epididymis volumes and confirming the results, direct measurement and estimations are needed. Because of this, we thought and followed a different way of direct measurement by using stereological methods on testis and epididymis of Kivircik rams. Sakamoto et al. 4 and Karaman et al. 5 indicated that Table 2. Right, left and mean volumes and volume percentages of testis and epididymis Tablo 2. Sağ, sol ve ortalama testis ve epididymis hacim ve hacim oranları Component Testis volume (cm 3 ) Section Right Left Total 5 Month (n=15) 6 Month (n=14) 7 Month (n=13) Mean±SD % Mean±SD % Mean±SD % ± ± ± ± ± ± ± ± ±19.9 Right 4.70± ± ± Epididymis volume (cm 3 ) Left 4.95± ± ± Total 4.82± ± ± Table 3. Correlation analyses according to month between morphometric measurement values of testis and stereological data Tablo 3. Testisin morfometrik ölçüm değerleri ile stereolojik veriler arasında aylara göre yapılan korelasyon analizleri Features Age (Month) Carcass Weight Testis Weight Testis Length Testis Width Testis Thickness Whole Testis Volume Epididymis Volume Testis Volume NS Testis weight NS NS NS 0.85 ** Testis length NS 0.86 ** NS 0.94 ** NS 0.93 ** 0.89 ** Testis width NS 0.98 ** 0.91 ** NS 0.94 ** 0.95 ** NS 0.97 ** 0.86 ** 0.94 ** Testis thickness NS 0.99 ** 0.85 ** 0.98 ** NS 0.90 ** 0.82 ** 0.83 ** NS 1.00 ** 0.84 ** 0.93 ** 0.98 ** Whole testis volume NS 1.00 ** 0.85 ** 0.98 ** 0.99 ** NS 0.99 ** 0.95 ** 0.93 ** 0.89 ** NS 0.87 ** 0.84 ** 0.86 ** 0.88 ** 0.88 ** Epididymis volume * 0.91 ** 0.73 ** 0.88 ** 0.87 ** 0.90 ** NS 0.52 NS 0.51 NS 0.48 NS 0.69 ** 0.51 NS NS 1.00 ** 0.83 ** 0.92 ** 0.98 ** 1.00 ** 0.87 ** Testis volume NS 1.00 ** 0.85 ** 0.98 ** 0.99 ** 1.00 ** 0.89 ** NS 0.98 ** 0.95 ** 0.92 ** 0.86 ** 1.00 ** 0.42 NS NS Not significant, * P<0.05, ** P<0.01

39 383 GEZER İNCE, PAZVANT OTO, KAHVECİOĞLU Table 4. Regression analyses on highly related properties Tablo 4. Yüksek ilişkinin bulunduğu özellikler üzerinde yapılan regresyon analizleri Testis Regression Equations R 2 P Whole testis volume = (0.74 x Testis weight) R 2 = 99.5% P<0.001 Whole testis volume = (2.28 x Testis lenght) R 2 = 86.1% P<0.001 Whole testis volume Testis volume Epididymis volume Whole testis volume = (3.75 x Testis thickness) R 2 = 94.9% P<0.001 Whole testis volume = (3.77 x Testis width) R 2 = 93.3% P<0.001 Whole testis volume = (1.07 x Testis volume) R 2 = 99.8% P<0.001 Testis volume = (0.69 x Testis weight) R 2 = 99.3% P<0.001 Testis volume = (2.11 x Testis lenght) R 2 = 85.8% P<0.001 Testis volume = (3.48 x Testis width) R 2 = 94.5% P<0.001 Testis volume = (0.93 x Whole testis volume) R 2 = 99.8% P<0.001 Epididymis volume = (0.27 x Testis widht) R 2 = 72.4% P<0.001 Epididymis volume = (0.07 x Whole testis volume) R 2 = 75.3% P<0.001 testicular volume measurement enable the estimation of spermatogenesis and testicular functions. Many measuring methods, such as compass 9, orchidometer 4-7,11, ultrasonography 4,6,7,9,12, have use for the estimation of testis volume. Karaman et al. 5 indicated that the Prader orchidometer is an objective, reliable, and cheap measuring method. But Paltiel et al. 11 reported that the ultrasound (US) method give more faultless and correct measures than Prader and Rochester orchidometers. All above mentioned methods are practicaly used methods on live animals and human beings. However by using stereological technique in our research, we tried to determine the most realistic volume values by direct measurement on testes and epididymis of animals. Although the stereological technique is not a method used in clinic practice, it has been one of the preferred method used in volumetric evaluation of materials study by pathology and anatomy and obtained images by imaging techniques as it gives reliable results both for human and veterinary usage. The volumetric contraction might occur about 5%-15% by the effect of fixation liquids used 20. In this study, testes and epididymides were collected from slaughterhouses and instantly placed in fixation liquid (10% formalin) in order not to putrify, and were kept 10 days in the solution. The amount of volumetric contraction in testis and epididymis was not determined. In experimental studies, Avdi et al. 13, who report that the seasonal variations in testis volume, indicated that testis volumes of Chios rams and Serres rams are minimum in March and April, and in February and March respectively. They have also reported that testis volumes are maximum for both breeds in July and August. Nipken and Wrobel 10 have report that testis volume changes according to age between the adolescence and senescence period. In their study, they indicate that tubular volume, and thus related testis volume show rapid increase (approximately 3-fold) until the middle of the sexual maturity period, and later phase out in the regression period. In our study, since only volume estimation was planned to be examined, testis volume variations of Kivircik rams (obtained in March) were not determined. Rapid enlargement of testes indicates mitosis in the germinal epithelium and the beginning of spermatogenic activity, and rams reach puberty in this period. In Awassi rams, highest values are measured between the 7th and 9th months 14. Even in Libyan fat-tailed rams, the most rapid growth occurre between 85 and days of age 15. In our study, the volume of testis and epididymis showed a rapid increase between the 6th and 7th months. As a result it was concluded that puberty began during this period in Kivircik rams. In order to estimate the testes volumes by special computer programs containing mathematical equations and formulas, volumes as cm 3, volume rates, and coefficients of error were easily and rapidly acquired 20. In stereological methods, estimation of the coefficient error is effective in deciding the appropriate point density on grids. In a study, a coefficient error smaller than 5% is an acceptable ratio 8,18,21. With the computer program used in our study, coefficients of error for whole testis, testis and epididymis volumes were found as 2%, 4%, and 1%, respectively. In this study, by concluding the sufficiency of sections count and point frequency on a pointed area measurement ruler, the reliability of study was presented. Including of epididymis measures in the testis volume measurements, for estimations, caused volumetric increase errors. Since it is impossible to ignore the measures of skin and epididymis in measurements especially held by the Prader orchidometer, testis volume is observed greater than it is. Kabay 8 reported that US and MRI methods give more appropriate results than the Prader orchido-

40 384 Stereological Measurement of... meter, depending on the testis and epididymis tissue differentiation properties. In our study, we easily estimated the volumes and volume ratios in sections acquired by the stereological technique. REFERENCES 1. Kaymakcı M, Oğuz I, Un C, Bilgen G, Yaskın T: Basic characteristics of some Turkish indigenous sheep breeds. Pak J Biol Sci, 4, , Aytug CN, Alacam E, Ozkoc U, Yalçın CB, Türker H, Gökcen H: Koyun- Keçi Hastalıkları ve Yetiştiriciliği. Tüm-Vet Hayvancılık Hizmetleri Press, İstanbul, Türkiye, Kaymakcı M: Üreme Biyolojisi. Ege Üniversitesi Yayınları, İzmir, Türkiye, Sakamato H, Saito K, Oohta M, Inoue K, Ogawa Y, Yoshida H: Testicular volume measurement: Comparison of ultrasonography, orchidometry and water displacement. Urology, 69, , Karaman MI, Kaya C, Caskurlu T, Güney S, Ergenekon E: Measurement of pediatric testicular volume with Prader orchidometer: comparison of different hands. Pediatr Surg Int, 21, , Al Salim A, Murchison PJT, Rana A, Elton RA, Hargreave TB: Evaluation of testicular volume by three orchidometers compared with ultrasonographic measurements. Br J Urol, 76, , Schiff JD, Li PS, Goldsteın M: Correlation of ultrasonographic and orchidometer measurements of testis volume in adults. BJUI, 93, , Kabay S, Yucel M, Ozden H, Yaylak F, Ozbek O, Gumusalan Y: Magnetic resonance imaging is a complementary method to stereological measurement of testicular volume. Urology, 73, , Love C, Garcia MC, Riera FR, Kenney RM: Evaluation of measures taken by ultrasonography and calipper to estimate testicular volume and predict daily sperm output in the stallion. J Reprod Fertil, 44, (abstr.), Nipken C, Wrobel KH: A quantitative morphological study of agerelated changes in the donkey testis in the period between puberty and senium. Andrologia, 29, , Paltiel HJ, Diamond DA, Di Canzio J, Zurakowski D, Borer JG, Atala A: Testicular volume: Comparison of orchidometer and US measurements in dogs. Radiology, 222 (1): , Eilts BE, Williams DB, Moser EB: Ultrasonic measurement of canine testes. Theriogenology, 40, (abstr.), Avdi M, Banos G, Stefos K, Chemineau P: Seasonal variation in testicular volume and sexual behavior of Chios and Serres rams. Theriogenology, 62, , Salhab SA, Zarkawi M, Wardeh MF, Al-Masri MR, Kassem R: Development of testicular dimensions and size and their relationship to age, body weight and parental size in growing Awassi ram lambs. Small Rumin Res, 40 (2): , Madani MOK, Rahal MS, Zawia MT, Eluwhaishi BA: Puberty and early sexual development in Libyan fat-tailed ram lambs. Br Vet J, 145, , Koyuncu M, Kara Uzun S, Ozis S, Duru S: Kıvırcık kuzularında bazı testis özellikleri. Tarım Bil Derg, 11, 7-11, Howard CV, Reed MG: Unbiased stereology. Three-dimensional measurement in microscopy. Bios, Oxford, 55-68, Gundersen HJ, Jensen EB: The efficiency of systematic sampling in stereology and its prediction. J Microsc, 147, , International Committee on Veterinary Gross Anatomical Nomenclature: Nomina Anatomica Veterinaria. 5th ed., Gent, Weibel ER, Knight BW: A morphometric study on the thickness of the pulmonary air-blood barrier. J Cell Biol, 21, , Pazvant G, Sahin B, Kahvecioglu KO, Günes H, Gezer Ince N, Bacinoglu D: The volume fraction method for the evaluation of kidney: A stereological study. Ankara Univ Vet Fak Derg, 56, , 2009.

41 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Identification of β-lactoglobulin Gene SacII Polymorphism in Honamli, Hair and Saanen Goat Breeds Reared in Burdur Vicinity [1] Özgecan KORKMAZ AĞAOĞLU * Bengi ÇINAR KUL ** Bilal AKYÜZ *** Özkan ELMAZ * Mahiye ÖZÇELİK METİN * Mustafa SAATCI * Okan ERTUĞRUL ** [1] The project was supported by Scientific Research Projects Council of Mehmet Akif Ersoy University (Project no: 106-NAP-10) * Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Department of Animal Science, TR Burdur - TURKEY ** Ankara University, Faculty of Veterinary Medicine, Department of Genetics, TR Ankara - TURKEY *** Erciyes University, Faculty of Veterinary Medicine, Department of Genetics, TR Kayseri - TURKIYE Summary This study was conducted to determine DNA-polymorphism of a SacII RFLP at exon 7 of the β-lactoglobulin (β-lg) gene in Honamli (31), Hair (39) and Saanen (41) goat breeds. A total of 111 goats were genotyped for the β-lactoglobulin-sacii polymorphism by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). In the studied breeds, digestion of amplification product with SacII restriction enzyme revealed two alleles namely, A and B and three genotypes (AA, BB and AB). Allelic frequencies for Hair, Saanen and Honamli breeds were 0.42, 0.37 and 0.53 respectively for A allele; 0.58, 0.63 and 0.47 respectively for B allele, while genotypic frequencies were 0.13, 0.12 and 0.19 for AA, 0.28, 0.39 and 0.13 for BB, and 0.59, 0.49 and 0.68 for AB respectively. Deviation from Hardy-Weinberg equilibrium was not observed in the studied breeds. As a result, this study provided information on the polymorphism of β-lactoglobulin in three goat breeds. Additionally, this study reported the existence of a genetic polymorphism at β-lg gene in Honamli goat breed for the first time. Keywords: β-lactoglobulin, Goat, Honamli, Polymorphism Özet Makale Kodu (Article Code): KVFD Burdur İli ve Civarında Yetiştirilen Honamlı, Kıl ve Saanen Keçi Irklarında β-lactoglobulin Geni SacII Polimorfizminin Belirlenmesi Bu çalışma Kıl (39), Saanen (41) ve Honamlı (31) keçi ırklarında β-lactoglobulin geninin 7. ekzonunun SacII RFLP polimorfizminin incelenmesi amacıyla yapılmıştır. β-lactoglobulin-sacii polimorfizmi için toplam 111 baş keçi PZR-RFLP (Polimeraz Zincir Reaksiyonu ve Restriksiyon Parça Uzunluk Polimorfizmi) ile genotiplendirilmiştir. İncelenen ırklarda SacII enzim kesimi sonucu iki allel (A ve B) ve üç genotip (AA, BB ve AB) belirlenmiştir. Kıl, Saanen ve Honamlı keçi ırkları için allel frekansları; A alleli için sırasıyla 0.42, 0.37 ve 0.53; B alleli için sırasıyla 0.58, 0.63 ve 0.47 bulunmuştur. Genotipik frekanslar ise AA genotipi için sırasıyla 0.13, 0.12 ve 0.19; BB genotipi için 0.28, 0.39 ve 0.13; AB genotipi için ise; 0.59, 0.49 ve 0.68 bulunmuştur. Çalışılan ırklarda Hardy-Weinberg dengesinden sapma görülmemiştir. Sonuç olarak, bu çalışmada üç keçi ırkında β-lactoglobulin gen polimorfizmi hakkında bilgi verilmiştir. Ayrıca, bu çalışma ile Honamlı keçisinde β-lactoglobulin gen polimorfizmi varlığı ilk defa bildirilmiştir. Anahtar sözcükler: β-lactoglobulin, Keçi, Honamlı, Polimorfizm INTRODUCTION Goat is a significant resource in developing countries like Turkey due to high quality meat, milk, hair and leather 1. Goat breeding provides an important source of animal protein in Turkey, especially for those living in rural areas. İletişim (Correspondence) ozgecanagaoglu@mehmetakif.edu.tr

42 386 Identification of β-lactoglobulin... Several goat breeds such as the Angora, Kilis, Honamli, Hair, Norduz, Saanen are reared in different regions of the Turkey. Hair goat, also known as black goat, is a major goat breed of the Turkey. This goat breed is a multipurpose animal in terms of meat, milk and hair 2. Saanen goat is a breed of Switzerland and known worldwide for high milk yield 2. Honamli goat breed is widespread throughout the slopes of Taurus Mountains, provinces of Burdur, Antalya, Isparta and Konya for both milk and meat yields 3. Polymorphisms in milk protein genes are used as markers for milk yield. Milk protein polymorphisms have been studied intensively because of their effect on the yield and processing properties of milk and its products. Betalactoglobulin (β-lg) is one of the two major whey proteins identified in the milk of animals including cattle, sheep, goat, dogs, and pigs. On the other hand, this protein is not identified in human, mice, lagomorphs and other some mammalian species 4. Genetic polymorphisms identified in β-lg gene lead to the formation of its different variants within and between various species 5. The relationship between genetic variants of the β-lg and milk composition, milk yield and cheese-making ability has been reported in cow (Shiwal and Tharparkar cattle 6 and Najdi cattle 7 ), goat (Indian goats) 4 and sheep (Manchega sheep 8 and Massese ewes 9 ). β-lg was the first milk protein in which polymorphism was identified by protein electrophoresis of bovine milk 10. Then, genetic polymorphisms in β-lg have been described both at protein level and DNA level in farm animals. The electrophoretic pattern of the β-lg gene in domestic goats has been analyzed for the first time by SDS-PAGE 4. Additionally, two genetic variants (A and B) of β-lg were reported in goat milk 17 at protein level. Then, β-lg gene polymorphism has been analyzed by PCR- RFLP 4. Polymorphisms in both exon 7 and the proximal promoter region of β-lg gene in Spanish and French goats were investigated, and two novel genetic variants were reported 18,19. β-lg polymorphism was reported in different goat populations at protein and DNA 23,24 level in Turkey. However, no information has been reported for especially Honamli goats regarding β-lg polimorphisms at the DNA level. The aim of the present paper was to investigate genetic polymorphism of a SacII RFLP at Exon 7 of the β-lg gene in Hair, Honamli and Saanen goat breeds by PCR-RFLP. MATERIAL and METHODS Samples and DNA isolation A total of 111 blood samples were collected from three different goat breeds around Burdur region in their natural habitats. The animal material included 39 Hair goats, 41 Saanen goats and 31 Honamli goats. Blood samples from the goats were placed into an EDTA tubes for DNA isolation. Genomic DNA was isolated using Genomic DNA Isolation kit (Qiagen QIAamp DNA Blood Mini Kit) following the manufacturer s protocol. The quality of DNA was checked on 0.8% agarose gels and stained with ethidium bromide. DNA Amplification and Genotyping Genotyping for β-lg-sacii polymorphism was performed by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) as proposed by Pena et al. 18. The sequences of the forward and reverse primers for the amplification of the β-lactoglobulin gene (accession number Z ) were: forward 5 -CGG GAG CCT TGG CCC TCT GG-3 ; reverse 5 -CCT TTG TCG AGT TTG GGT GT-3. PCR for the β-lactoglobulin gene was performed in a 25 µl reaction mixture, containing 1.5 mm MgCl 2, 200 µm of each dntps, 200 µm of each primer, 1 X PCR buffer, 1U Taq polymerase and 100 ng of genomic DNA template. The reaction mixture was placed in a DNA Amplitronyx 6 thermal cycler. Thermal cycling conditions included: an initial denaturation step at 95 C for 5 min followed by 35 cycles of 95 C for 30 s, 65 C for 60 s, 72 C for 60 s and a final extension at 72 C for 5 min. The PCR products were digested with 10 U of SacII restriction endonuclease (Fermentas) at 37 C for at least 3 h. PCR products and restriction fragments were electrophoresed on 2% and 3% agarose gels respectively and stained with ethidium bromide. Statistical Analysis Direct counting was used to estimate genotype and allele frequencies of β-lg gene SacII genetic variants. Chi-square statistic (χ 2 ) was used to check whether the populations were Hardy-Weinberg equilibrium. All statistical analyses were performed using PopGene32 software 25. RESULT The β-lg gene (exon 7 to the 3 flanking region) of Hair, Honamli and Saanen goat was investigated by PCR-RFLP method. A fragment of 426 bp was successfully amplified (Fig. 1) and digested with SacII restriction enzymes to detect the presence of A or B variants. PCR-RFLP with the SacII enzyme revealed the polymorphic site, which was produced by a single nucleotide substitution in position As a result of amplification product with SacII digestion, two alleles, A and B, were observed. Restriction digestion of 426bp PCR products with SacII enzymes revealed three genotypes (Fig. 2) of AA (426 bp), BB (349 and 77 bp) and AB (426, 349 and 77 bp). The allelic and genotypic frequencies of the β-lg gene polymorphism for the Hair, Saanen and Honamli goats were given in Table 1. The results of Chi-square statistic reflected that breeds were in Hardy-Weinberg equilibrium. Allelic frequencies for Hair, Saanen and Honamli breeds were determined as 0.42, 0.37 and 0.53 respectively for A allele; 0.58, 0.63 and 0.47 respectively for B allele, whereas genotypic frequencies were 0.13, 0.12 and 0.19 for AA,

43 387 KORKMAZ AĞAOĞLU, ÇINAR KUL, AKYÜZ, ELMAZ ÖZÇELİK METİN, SAATCI, ERTUĞRUL Fig 1. PCR amplifications of β-lg gene (426bp, lanes 1-2). Lane M, molecular size marker (100 bp DNA ladder) Sekil 1. β-lg geninin PZR ürünleri (426bp, hat 1-2). Hat M, moleküler büyüklük belirteci (100 bç DNA ladder) Fig 2. Electrophoresis of RFLP of caprine β-lg gene after digestion by SacII of animals with AA (Lane 2,5; 426bp), AB (Lane 4,6; 426bp/349bp/77bp, BB (Lane 1,3; 349bp/77bp) genotypes. Lane M, molecular size marker (100 bp DNA ladder) Sekil 2. Keçi β-lg geninin SacII enzim kesim ürünlerinin agaroz jeldeki fotografı. Hat 2,5 AA (426bç); Hat 4,6 AB (426bç/349bç/77bç); Hat 1,3 BB (349bç/77bç) genotipleri. Hat M, molekülür büyüklük belirteçi (100 bç DNA merdiveni) Table 1. Allele and genotype frequencies of β-lg gene for SacII site in Hair, Saanen and Honamli goat breeds Tablo 1. Kıl, Saanen ve Honamli keçi ırklarında β-lg geninin SacII bölgesinin allel ve genotip frekansları Genotype Allele Frequency Breed n AA AB BB Obs (Exp) F. Obs (Exp) F. Obs (Exp) F. A B χ 2 (df=1) p-value Hair 39 5 (6.857) (19.286) (12.857) NS Saanen 41 5 (5.370) (19.259) (16.370) NS Honamli 31 6 (8.656) (15.689) (6.656) NS All breeds (20.634) (54.733) (35.634) NS F: Frequency; NS : Non significant 0.28, 0.39 and 0.13 for BB, and 0.59, 0.49 and 0.68 for AB respectively. A significant deviation from Hardy-Weinberg equilibrium was not observed in the investigated breeds. DISCUSSION In the present study, genetic polymorphism of the β-lg gene in Hair, Honamli and Saanen goat breeds were investigated. The 426 bp product of exon 7 to the 3 flanking region of the β-lg gene was digested with restriction endonucleas SacII in three goat breeds. For SacII site two alleles (A and B) were found and three genotypes (AA, AB and BB) were detected. Regarding polymorphism of β-lg locus eight variants have been reported at the DNA level at the bovine β-lg locus, however, alleles A and B are the most frequent 26 and allele B was associated with a lower whey protein content and a higher casein content in milk 26. In sheep, three variants (A, B and C) have been reported 27. Polymorphisms in both exon 7 and the proximal promoter region of β-lg gene in Spanish and French goats were investigated, and two novel genetic variants were reported 18,19. Two genetic variants (A and B) of β-lg were reported in goat milk at protein 17 and DNA 4,18,19 level. The presence of β-lga and β-lgb at this locus was reported in Alpine and Saanen goats 28 and in Jamunapari, Sirohi, Barbari and Jakhrana breeds 11. Similar results were observed in all studied breeds. Similarly, three genotypes were observed in Hair, Saanen and Honamli goats at the β-lg locus. AB genotype was the most frequent genotype in the entire studied sample. Goat β-lg polymorphism has been investigated with 233 Hair goat breeds by Elmaci et al. 24 They revealed that the frequency of AA (S2S2, 0.11) genotype was found to be lower than BB (S1S1, 0.45) and AB (S1S2, 0.44) genotypes and then the genotypic frequencies of BB and AB genotypes were very close. Additionally Elmaci et al. 24 showed that the frequency of S2 (A) allele at β-lg locus was lower compared to the frequency of S1 (B) allele. This was consistent with the result of the present study in exception with Honamli goat. Previously, polymorphism studies about β-lg locus for Barki, Damascus and their cross breeds 14 showed lower frequencies of B allele in comparison with the present study (all breeds). Kumar et al. 4 reported the frequency of S2S2 (BB) genotype with a large range of 0.42 to 1.00 in the population and S2 (B) allele frequency higher than S1 (A) allele frequency 4. This was consistent with Hair and Saanen goat breeds, but not Honamli goat. Garg et al. 12 reported the presence of two genetic variants at β-lactoglobulin locus (A and B) and the gene frequencies of β-lga and β-lgb were and 0.090, respectively. This

44 388 Identification of β-lactoglobulin... was consistent with Honamli goat, but not Hair and Saanen goat breeds. Kumar et al. 11 and Boulanger 28 were studied this locus and indicated that variant A was dominant over variant B, which is corroborated with Garg et al. 12 findings. But this was consistent with the result of the present study in exception with Honamli goat. In the present study, it was reported that Hair, Honamli and Saanen goat breeds from Burdur have genetic polymorphism in β-lg gene. Especially, this study showed the existence of a genetic polymorphism at β-lg gene in Honamli goats for the first time. Further evaluation is required to confirm the correlation with milk yield. In addition, it is very crucial to investigate further goat breeds for determining the polymorphism at proximal promoter region of β-lg gene and other genes to generate results of the present study. Finally data showed that PCR-RFLP is an appropriate tool for investigating genetic polymorphism. Also, the results of β-lg gene polymorphism can be reliably used in genetic characterization of Turkish native goat breeds, determination of biodiversity and evolution in world goat breeds. Acknowledgements The authors would like to thank to Associate Professor Hilal ÖZDAĞ, who kindly checked the English grammar of the manuscript. REFERENCE 1. Akçapınar H: Keçi Yetiştiriciliği Ders Notu. Ankara Üniv. Vet. Fak. Zootekni Anabilim Dalı, Porter V: Goats of the World. Farming Press, Ipswich, UK, Soysal Mİ: Honamli Goat (2007). honamli_sunu.pdf. Accessed: Kumar A, Rout PK, Roy R: Polymorphism of β -lacto globulin gene in Indian goats and its effect on milk yield. J Appl Genet, 47 (1): 49-53, Patel RK, Chauhan JB, Singh KM, Soni KJ: Allelic frequency of kappacasein and beta-lactoglobulin in Indian crossbred (Bos taurus Bos indicus) dairy bulls. Turk J Vet Anim Sci, 31 (6): , Rachagani S, Gupta ID, Gupta N, Gupta SC: Genotyping of β-lactoglobulin gene by PCR-RFLP in Sahiwal and Tharparkar cattle breeds. BMC Genetics, 7, 31 doi: / , Karimi K, Beigi Nassiri MT, Mirzadeh KH, Ashayerizadeh A, Roushanfekr H, Fayyazi J: Polymorphism of the β-lactoglobulin gene and its association with milk production traits in Iranian Najdi cattle. Int J Biotechnol, 7 (2): 82-85, Garzon AI, Martinez J: β-lactoglobulin in Manchenga sheep bred: relationship with milk technological indexes in handcraft manufacture of Manchengo cheese. Anim Genet, 23 (Suppl. 1): 106, Melea M, Conte G, Serra A, Buccion A, Secchiari P: Relationship between beta-lactoglobulin polymorphism and milk fatty acid composition in milk of Massese dairy ewes. Small Rumin Res, 73, 37-44, Aschaffenburg R, Drewry J: Occurrence of different β-lactoglobulins in cow s milk. Nature, 176, , Kumar P, Rout PK, Shukla SN, Mandal A, Roy R: Genetics of milk protein variants in different Indian goats. X th International Congress Asian- Australian Association of Animal Production Societies (AAAP), Sept , New Delhi: 168, Garg N, Singh SK, Rout PK, Mandal A: Genetic Polymorphism of Milk Proteins in Barbari Goats. Trop Subtrop Agroecosyst, 11, , Baranyi M, Kerekes A, Hiripi L, Bősze Z: Preliminary data on betalactoglobulin genetic polymorphisms in Hungarian Awassi and Racka sheep. Anim Sci Biotechnol, 43 (1): 1-4, El-Hanafy AA, El-Saadani MA, Eissa M, Maharem GM, Khalifa ZA: Polymorphism of β-lactoglobulin gene in Barki and Damascus and their cross bred goats in relation to milk yield. Biotechnol Anim Husbandry, 26 (1-2): 1-12, Elyasi G, Shodja J, Nassiry MR, Tahmasebi A, Pirahary O, Javanmard A: Polymorphism of β-lactoglobulin gene in Iranian sheep breeds using PCR-RFLP. J Molecular Genetics, 2 (1): 6-9, Öner Y, Pullu M, Akın O, Elmacı C: Bursa bölgesinde yetiştirilen İsviçre Esmeri ve Siyah Alaca ırkı sığırlarda beta laktoglobulin (β-lg) ve büyüme hormonu (bgh) gen polimorfizmlerinin HaeIII ve MspI restriksiyon enzimleri kullanilarak incelenmesi. Kafkas Univ Vet Fak Derg 17 (3): , Moili B, Pilla F, Tripaldi C: Detection of milk protein genetic polymorphism in order to improve dairy traits in sheep and goats: A review. Small Rumin Res, 27, , Pena RN, Sanchez A, Folch JM: Characterization of genetic polymorphism in the goat beta-lactoglobulin gene. J Dairy Res, 67, , Yahyaoui MH, Pena RN, Sanchez A, Folch JM: Rapid communication: polymorphism in the goat beta-lactoglobulin proximal promoter region. J Anim Sci, 78, , Ozdil F, Asal S: The Polymorphism of β-lactoglobulin. Proceedings of the 3 rd Annual Meeting on Animal Science September, 14-16, Ankara, Turkey, Turkyilmaz O: The milk protein polymorphism in Saanen goats with high milk yielding. PhD Thesis. Uludag Univ. Institute of Health Sci, Bursa, Turkey, Gurcan N: The polymorphism of B- lactoglobulin in some Angora and Hair goat populations. MSc Thesis. Ankara University, Graduate School of Natural and Applied Science, Ankara, Turkey, Elmaci C, Oner Y, Koyuncu M: Saanen keçilerinde β-laktoglobulin genotiplerinin PCR-RFLP yöntemi ile belirlenmesi. Hayvansal Üretim, 49 (1): 1-4, Elmaci C, Oner Y, Koyuncu M: Allelic frequencies of a SacII RFLP at exon 7 of the β-lactoglobulin gene in Turkish hair goat breed. Asian J Anim Vet Adv, 4 (3): , Yeh F, Yang RC, Boyle T: Popgene (v.1.32), Microsoft Windows-based freeware for Population Genetic Analysis, ca/~fyeh/pop32.exe. Accessed: Ng-Kwai-Hang KF: Genetic polymorphism of milk proteins: Relationships with production traits, milk composition and technological properties. Can J Anim Sci, 78, , Erhardt G: Evidence for a third allele at the beta-lactoglobulin (beta- Lg) locus of sheep milk and its occurrence in different breeds. Anim Genet, 20, , Boulanger A: Etude Biochimique et Genetique des Proteins du Lait de Chevre (Capra hircus). Thesis, University of Paris VII, 1976.

45 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE [1] * Growth Performance and Body Composition in Mirror Carp (Cyprinus carpio) Fed Culban Seed (Vicia peregrina) with Different Heat Treatments [1] Hakan Murat BÜYÜKÇAPAR * This study was supported by the Research Fund of the University of Kahramanmaras Sutcuimam University (Project No: 2011/4-7M) Department of Fisheries, Faculty of Agricultural, University of KSU, TR Kahramanmaras - TURKEY Makale Kodu (Article Code): KVFD Summary This study was conducted to determine the potential nutritional value of differently heat-treated (121 o C 10, 20, 30 min) culban (Vicia peregrina) seed at different levels (0, 20, 30, 40%) in diet as a plant protein source for mirror carp (Cyprinus carpio). Fish fingerlings were randomly allocated at a stocking rate of 12 fish per aquaria with three replicate aquariums under each dietary treatment. The fish were hand fed twice a day at 8.30 am and pm at 3% of their body weight during the experimental period of 60 days. The fish fed experimental diets grew from an initial body weight of 7 g to final body weight of 20 g for rearing during the course of the experiment. Growth parameters, feed utilization and whole body proximate composition were found similar in all experimental groups. It is concluded that heat-treated culban seed can be successfully used as an inexpensive plant protein source a level of 40% (121 o C min) in mirror carp diets without adverse effect on fish performance. Keywords: Mirror carp, Cyprinus carpio, Heated culban, Vicia peregrina, Growth Farklı Sürelerde Isıtılmış Culban (Vicia peregrina) Tohumuyla Beslenen Aynalı Sazanlarda (Cyprinus carpio) Büyüme Performansı ve Vücut Kompozisyonu Özet Bu çalışma, bitkisel protein kaynağı olarak farklı seviyelerde (%20, 30, 40) aynalı sazan diyetlerine, farklı sürelerde ısıtılarak (121 o C de 10, 20, 30 dk) katılmış culbanın (Vicia peregrina) besin değerinin belirlenmesi amacıyla düzenlenmiştir. Balıklar rastgele her akvaryuma 12 adet ve 3 tekerrürlü olarak stoklanmıştır. Balıklar günde iki kez sabahları 8.30, akşamları ise da vücut ağırlığının %3 ü oranında 60 gün süreyle elle yemlenmiştir. 60 günlük deneme süresince balıklar 7 g dan 20 g ağırlığa ulamışlardır. Bütün deneme gruplarında, büyüme parametreleri, yem tüketimi ve tüm balık vücut kompozisyonları bakımından benzer bulunmuştur. Sonuç olarak ucuz bir bitkisel protein kaynağı olarak ısıtılmış culbanın (121 o C dk) yemlerde %40 oranında katılması balık performansına herhangi bir olumsuz etki göstermediği belirlenmiştir. Anahtar sözcükler: Aynalı sazan, Cyprinu carpio, Culban, Vicia peregrina, Büyüme INTRODUCTION Research investigating cheaper alternative protein and energy feedstuffs for the development of low-cost pelleted feeds suitable for use by the small-scale farmers has become priorty in developing countries. Locally available plants are often less expensive sources of energy and protein for commercial feed formulations. Meals made from peas are intermediate in terms of both a good energy source and a reasonable amount of protein to the ration 1. However, inclusion levels in feed formulations needs to be tempered by cost, processing consideration, nutrient İletişim (Correspondence) hakanmurat@ksu.edu.tr

46 390 Growth Performance and... availability as well as palatability of the meal to target species. As a result, information related to nutrient availability and the biological response of the target species is essential to the successful utilization of a given ingredient 2. Alternative plant 3-5 and animal proteins 6,7 have been studied by fish nutritionists and feed industries. Grain legumes have no been extensively used in fish feeds, although they represent a good source of dietary protein and energy 8. The acceptability of grain legumes such as lupin 9,10, Cassia fistula 11, Vicia peregrinea 12, feed pea 13, Sesbenia aculeate 14, Vicia narbonensis 15, Pisum elatius 16, Lathyrus sativus 17. The use of grain legumes in aquaculture diets is potentially restricted by inadequacies in protein composition, relatively high levels of carbohydrates, the presence of anti-nutritional factors, and/or reduced palatability 18,19. Trypsin inhibitors are generally considered as the most important anti-nutritional factor in plant proteins. Triypsin inhibitors and some other anti-nutritional factors are heat lable and are inactive by heat treatments 20. In general, the extent to which trypsin inhibitor is destroyed by heating, particle size and moisture conditions 21. At 100 o C, however, nearly all of the trypsin inhibitor activity is destroyed after 10 min 22. Culban (Vicia peregrina), a pea is a legume crop widely available and abundant in region of south Mediterranean of Turkey. Its seeds contain 25% protein with a partially balanced amino acid and fatty acid profile (Table 1). Little is known about the dietary effects of duration of heat treatment of culban seed meal in mirror carp. Buyukcapar and Kamalak 12 who stated that raw and heated (only 121 o C 10 min) culban could be supplemented up to levels of 10 and 30% respectively. Optimization of heat treatments is necessary because over processing reduces protein availability 23. This study was conducted to determine the effects of duration of heat treatment of culban seed at different levels in diet as a plant protein source for mirror carp (Cyprinus carpio). MATERIAL and METHODS Mirror carp (Cyprinus carpio) fingerlings were obtained from the brood stock maintained at the State Hydraulic Works in Adana, Turkey. The fish (about 5 g) were transferred to the Department of Fisheries, Faculty of Agriculture, University of Kahramanmaras Sutcu Imam. Mirror carp reared and acclimatized for 10 days in a 250-L fiberglass tank at 28.2±0.2 o C. During this period they were fed with a diet containing approximately 350 g/kg protein, 80 g/kg lipid, 7 g/kg ash and energy content of MJ/kg dry matters until they reached a body weight of approximately 7 g. Fish fingerlings were randomly allocated at a stocking rate of 12 fish per aquaria with three replicate aquariums under each dietary treatment. The fish were hand fed twice a day at 8.30 am and pm at 3% of their body weight during the experimental period of 60 days. They were individually weighed at the beginning of the experiment (day 0) and at day 20 40, and 60. At the beginning of the experiment 10 fish from the same stock were sampled to determine the whole body composition. At the end of the experiment, 5 fish per aquarium were sampled to determine the whole body composition in groups. Heated culban was included in the diets at different levels (0, 200, 300, 400 for diets Control, Ht 2, Ht 3 and Ht 4, respectively). The growth parameters of fish fed the experimental diets were compared to fish fed a fish meal and soyabean meal based control diet. The control diet contained 40% fish meal and 15% of soybean meal as main protein sources. In a recirculation system containing a set of aquaria, each with a capacity of approximately 80-L and water depth 50 cm, water quality was monitored throughout the experiment. Temperature, ph and dissolved oxygen were recorded daily. Mean temperature, ph and dissolved oxygen were 27.1±0.02 o C, 7.5±0.08 and 6.9±0.05 mg L -1. respectively. Water quality was controlled by biologic filter and electronic heater. Water was re-circulated through the filter at a rate of 5 L/min. Additional aeration was provided by an air pump. Culban seed was sun dried and ground into powder to pass a 1 mm sieve. Ground culban was heat-treated in autoclave at 121 o C for 10, 20, 30 min to eliminate the possible detrimental effect of anti-nutritional factors 24. The chemical composition of Fish meal, soybean meal, and culban are given in Table 1. Growth performances were evaluated by body weight gain (BWG), feed conversion ratio (FCR), feed intake (g) per fish (FI), specific growth rate (SGR %) and protein efficiency ratio (PER). Body weight gain (BWG) (g) = [final body weight (W 2 ) (g) - initial weight (W 1 ) (g)] Feed conversion ratio (FCR) = [dry feed consumed (g)/live body weight (g)] Specific growth rate (SGR %) = [(lnw 2 -lnw 1 )/ days] X 100 Feed intake (g) per fish = [Total feed consumption (g) per aquaria]/(number of fish per aquaria) Protein efficiency ratio (PER) = [body weight gain (g)/protein fed (g)] In the feeding experiment fish meal was replaced with heat-treated culban on a dry matter basis to maintain crude protein and energy levels. The composition of the experimental diets is given in Table 2. Ingredients were mixed, formed into a moist pellet about 2 mm in diameter and then dried in a forced-air oven at 45 o C. Ten isonitrogenous and isoenergetic diets were formulated to evaluate nutrition value of heated culban for carp fingerling (Table 2). Culban, experimental

47 391 BÜYÜKÇAPAR Table 1. Proximate compositions, amino acids and fatty acids profiles and condensed tannin amount (on as dry basis) in culban seed meal Tablo1. Culban tohumu ununun kimyasal kompozisyonu, aminoasit ve yağ asit kompozisyonu ve Kondense tanin miktarı (kuru maddede) Items Amount Fatty acids (%) Amount Proximate composition (g/kg) Crude protein (C14:0) 0.58 Crude fat 15.3 (C15:0) 0.25 Dry matter (C15:1) 0.12 Crude ash 38.9 (C16:0) Fiber 80.0 (C16:1) 0.24 Essantial amino acids (g/kg) (C17:0) 0.26 Methionine 10.8 (C17:1) 0.11 Valine 10.6 (C18:0) 4.94 Isoleucine 9.5 (C18:1n9c ) leucine 16.8 (C18:2n6c) Tyrosine 6.4 (C20:0) 1.31 Phenylalanine 10.1 ( C18:3n3) 6.41 Histidine 14.9 C20:1n9) 0.13 Lysine 16.3 (C21:0) 0.29 Threonine 8.8 (C20:2) 0.25 Non-essantial amino acids (g/kg) (C22:0) 0.49 Alanine 10.0 (C22:1n9) 0.48 Aspartic Acid 36.4 (C23:0) 0.18 Glutamic acid 40.2 (C24:0) 0.33 Glycine 8.4 (C24:1n9) 0.13 Proline 9.7 Undefined FA (%) 4.49 Serine 11.7 Saturated FA (%) Hydroxiproline 0.0 Monounsaturated FA (%) Polyunsaturated (%) Antinutritional factor Raw Heated (10 min) Heated (20 min) Heated (30 min) Condensed Tannin (g/kg) diets and fish samples were analyzed for their proximate composition according to the methods of AOAC 25. Table 2 shows the formulation, proximate composition of the 10 diets. Condensed tannin was determined by butanol- HCl method as described by Makkar et al. 26. Amino acids composition of culban was determined by GC-ID at Scientific and Technology Research Council of Turkey (MAM) using Phenomox EZ Feast GC-FID Hydrolyzed Amino acid analyses Kit. Fatty acids analysis was performed on culban seed meal. The fatty acids in the total lipids were saponifed into the free form by saponification with 0.5 N methanolic NaOH, followed by esterification with 14%BF 3 (w/v) in methanol. All samples were analysed using using a Thermo quest Trace gas chromatograph equipped with a Supelco- SP-2330 fused-silica capillary column (30 m x 0.25 mm i.d., 0.20 µm film thickness of polyethylene glycol) (Supeco Inc., Bellefonte, PA, USA) and a Flame-Ionization Detector (FID). Helium (30 ml/min) was used as the carrier gas. The samples were injected at 120 o C. After 2 min the temperature was raised at 5 o C min -1 to 220 o C, where it was kept for 8 extra min. The temperatures of the injector and the detector were set 240 and 250 o C, respectively The fatty acids methyl esters were identified by comparison of their retention times with those of chromatographic standards (Sigma Chemical Company; the fatty acid methyl mixture No ). The analyses were carried out in duplicate. A completely randomized design was adopted with three replicates per diets. One-way analysis of variance (ANOVA) was carried out to determine the effect of diets on growth and whole body composition parameters using General Linear Model (GLM) of Statistical for windows (1993). Significance between individual means was identified using the Duncan s multiple comparison tests. Mean differences were considered significant at P<0.05. One-way analysis of variance (ANOVA) was applied to determine whether the effects of the diets on growth and whole body composition parameters using SPSS 11 for

48 392 Growth Performance and... Table 2. Formulation and proximate composition of experimental diets Tablo 2. Deneme diyetlerinin kimyasal kompozisyonu ve formülasyonu Dose of Culban Dose of Culban Dose of Culban Ingredients (g/kg) 200 g/kg (20%) 300 g/kg (30%) 400 g/kg (40%) Duration Duration Duration Control 10 min 20 min 30 min 10 min 20 min 30 min 10 min 20 min 30 min Fish Meal Soybean meal Culban Maize flour Sunflower oil DCP Vit-min Salt Methionine Lysine Total Composition (g/kg) Crude protein Crude Fat Crude ash Crude fibre Dry Matter Gross energy (MJ/kg) Di calcium Phosphate 2 Per 5 kg vitamin-mineral premix: IU vitamin A, IU vitamin D 3, mg vitamin E, mg vitamin K 3, mg vitamin B 1, mg vitamin B 2, mg niacin, mg Ca-panthothenate, mg vitamin B 50 mg vitamin B 6, 12, 500 mg D-biotin, mg folic acid, mg vitamin C and mg inositol mg cholin chloride, mg manganese, mg Zinc, 800 mg Copper, mg iodine, 150 mg Selenium, mg magnesium. 3 Gross energy was estimated using the following coefficients: 23.6 KJ/g for crude protein; 39.5 KJ/g for crude fat and 17.2 KJ/g for carbohydrates (NRC, 1993) windows Significance differences between individual means were evaluated using the Duncan s multiple comparison tests when a significant (P<0.05) effect was detected. RESULTS All fish grew normally and no specific signs of disease were observed throughout the experiment period. Fish weight increased over three fold at the end of the feeding trial of 60 days (Table 3). All diets were accepted equally well by the fish. Final weight among experimental groups varied from g, specific growth rate from %, feed conversion rate from and protein efficiency ratio from (Table 3). However, in terms of both growth parameters and feed utilization, no significant differences were found among the experimental groups (P>0.05). The effect of diets on the whole body composition of mirror carp (Cyprinus carpio) fingerlings at the end of the feeding trials are given in Table 4. The final protein, fat, ash and DM contents of fish were higher than the initial levels. No significant differences among the experimental groups (Table 4). DISCUSSION The critical levels of dietary peas which retard growth have been determined to range in various fish species 1,11,12,15-17, Higher inclusion level (40%) of culban in the study was used. The reason of this can be caused by several factors; processing technology of dietary feed material is very important as it may have strong effects on some antinutritional components and nutrient digestibility of fish diets. Yanar et al. 1 who found similar result with ours but in different fish species, declared that the use of culban up to a level of 30% in tilapia diet was due to heating processes (121 o C 10 min) of culban. Elevated levels of dietary cellulose have been reported to affect adversely nutrient digestibility 30 and growth 31 in fish. However, since culban contains relatively low level (8%) of cellulose, cellulose amount among experimental

49 393 BÜYÜKÇAPAR Table 3. Growth parameters of mirror carp obtained in Experiment (n = 36) Tablo 3. Denemede saptanan aynalı sazana ait büyüme parametreleri (n = 36) Dose of Culban Dose of Culban Dose of Culban Parameters 200 g/kg (20%) 300g/kg (30%) 400 g/kg (40%) Duration Duration Duration Control 10 min 20 min 30 min 10 min 20 min 30 min 10 min 20 min 30 min Initial weight (g)* 7.18± ± ± ± ± ± ± ± ± ±0.42 Final weight (g)* a ± a ± a ± a ± ± ± ± ± ± ±2.77 Body weight gain (g)* 13.45± ± ± ± ± ± ± ± ± ±0.81 Feed intake (g)* 18.88± ± ± ± ± ± ± ± ± ±3.93 Feed conversion ratio* 1.42± ± ± ± ± ± ± ± ± ±0.10 Specific growth rate (%)* 1.75± ± ± ± ± ± ± ± ± ±0.12 Protein efficiency ratio* 1.76± ± ± ± ± ± ± ± ± ±0.13 Survival rate (%) * All between-group differences were not significant (P>0.05) Table 4. The whole body composition analyses (%) (on wet weight basis) of mirror carp fed test diets (n = 15) Tablo 4. Deneme diyetleri ile beslenen aynalı sazanın tüm vücut kompozisyonu (%) (yaş maddede) (n = 15) Dose of Culban Dose of Culban Dose of Culban Parameters 200 g/kg (20%) 300g/kg (30%) 400 g/kg (40%) Duration Duration Duration Initial Control 10 min 20 min 30 min 10 min 20 min 30 min 10 min 20 min 30 min Protein* 9.37± ± ± ± ± ± ± ± ± ± ±0.24 Fat* 3.57± ± ± ± ± ± ± ± ± ± ±0.33 Ash* 2.07± ± ± ± ± ± ± ± ± ± ±0.24 DM* 19.02± ± ± ± ± ± ± ± ± ± ±0.72 * All between-group differences were not significant (P>0.05) diets showed a little change (from 4-4.5%). Moreover, as mirror carp has a relatively long digestive tract which may allow for more efficient digestion of plant ingredients, this fish could easily tolerate this increase in cellulose level in the diets 1. It would be essential to present sufficient information about anti-nutritive factors in culban seed to allow adequate interpretation of the result and comparison to the other research. This is particularly important in the current experiment. However, no information is available on antinutritive factors except for condensed tannin in the culban seed used in this experiment. The growth performance of mirror carp fingerlings fed diets containing up to 40% of heat-treated culban was comparable with control diets (Table 3) possible due to reduction in condensed tannin in culban by heat treatment (Table 1). Makkar et al. 32 indicated that the presence of tannin and trypsin growth inhibition was related to their lower nutritive value. Although peas are considered to contain relatively low levels of anti-nutritive factors, performance of the fish could nevertheless be impaired by them 33. Extrusion decreases the efficiency of the majority of these 34. In the present study, results of proximate composition analysis indicated that protein, lipid, moisture and ash in whole body of mirror carp were not affected by the dietary inclusion of culban seeds. Similarly, many researchers reported that addition of plant protein sources in fish diets did not affect generally proximate composition of fish body 1, Culban has been used in mirror carp diets by Buyukcapar and Kamalak 12 who stated that heated (only 121 o C 10 min) culban could be supplemented up to level of 30% in mirror carp diets. However, the present results indicate that heated culban can be successfully used as an alternative plant protein source a level of 40% in mirror carp diets without adverse affects on growth or feed utilization. Based on the positive results of these studies fish feed industry can be encouraged to evaluate the use of pea meals in trial formulations and long term growth trials. However, because culban inclusion over 40% levels in diets was not tested in this study, additional experiments are required to test over the tested level.

50 394 Growth Performance and... REFERENCES 1. Yanar M, Büyükçapar HM, Erçen Z, Erdogan E: The evaluation of heated culban, Vicia peregrina as a partial replacement for fish meal in diets of Nile tilapia, Oreochromis niloticus. JAVA, 9 (6): , Davis DA, Arnold CR, McCallum I: Nutritional value of feed peas (Pisum sativum) in practical diet formulations for Litopenaeus vannamei. Aquaculture Nutr, 8, 87-94, El-Seedy DMS, Gaber MMA: Replacement of fish meal with a mixture of different plant protein source in juvenile Nile tilapia diets. Aquatic Res, 34, 1-9, Büyükçapar H.M, Kamalak A: Partial replacement of fish soyabean meal protein in mirror carp (Cyprinus carpio) diets by protein in hazelnut meal. SAJAS, 37 (1): 35-44, Yıldırım Ö, Ergün S, Yaman S, Türker A: Effects of two seaweeds (Ulva lactuca and Enteromorpho linza) as a feed additive in dets on growth performence, feed utilization, and body composition of rainbow trout (Oncorhynchus mykiss). Kafkas Univ Vet Fak Derg, 15 (3): , Hu M, Wang Y, Luo Z, Zhao M, Xiong B, Qian X, Zhao Y: Evaluation pf rendered animal protein ingredients for replacement of fish meal I practical diets for gibel carp, Carassius auratus gibello (Bloch). Aquatic Res, 39, , Gümüş E, Erdogan F: Effects of partial substitution of fish meal with Tuna liver meal on the fatty acid profil of Nile tilapia fry, Oreochromis niloticus. Kafkas Univ Vet Fak Derg, 16 (Suppl-B): S283-S290, Siddhuraju P, Becker K: Preliminary nutritional evaluation of mucuna seed meal (Mucuna pruriens var. utilis) in common carp (Cyprinus carpio L.): an assessment by growth performance and feed utilisation. Aquaculture, 196, , Sudaryona A, Tsvetnenko E, Evans IH: Evaluation of potential of lupin meal as an alternative to fish meal in juvenile (Penaeus monodon) diets Aquaculture Nutr, 5, , Glencross B, Currow J, Hhawkins W, Kissil G, Peterson D: Evaluation of the feed value of a transgenic strain of the narrow-leaf lupin (Lupinius angustifolis) in the diet of marine fish (Pagrus auratus). Aquaculture Nutr. 9, , Adebayo OT, Fagbenro OA, Jedege T: Evaluation of Cassia fisculata meal as a replacement for soybean meal in practical diets of Oreochromis niloticus fingerlings. Aquaculture Nutr, 10, , Buyukcapar HM, Kamalak A: Raw and heat-treated culban (Vicia peregrina) seed as protein source for Mirror carp (Cyprinus carpio) fingerlings. SAJAS, 36 (4): , Borlongan IG, Eusebia P, Welsh T: Potential of feed pea (Pisum sativum) meal as a protein source in practical diets for milkfish (Chanos chanos Forsskal). Aquaculture, 225, 89-98, Hossain MA, Focken U, Becker K: Nutritional evaluation of dhaincha (Sesbania aculeate) seeds as dietary protein source for tilapia Oreochromis niloticus. Aquaculture Res, 33, , Büyükçapar HM, Mezdeği I, Kamalak A: Nutritive value of narbon bean (Vicia narbonensis) seed as ingredients in practical diet for Tilapia (Oreochromis niloticus) fingerlings. JAAR, 37, , Büyükçapar HM, Kamalak A: Nutritive value of wild pea (Pisum elatius) seeds as dietary protein source for Mirror carp, Cyprinus carpio, fingerlings. IJA, 62 (4): , Ramachandran SA, Bairagi A, Ray AK: Improvement of nutritive value of grass pea (Lathyrus sativus) seed meal in the formulates diets for rohu, Lobio rohito (Hamilton) fingerling after fermentation with a fish gut bacterium. Biosour Technol, 96, , Gomes EF, Corraze G, Kaushik S: Effects of dietary incorporation of a co-extruded plant protein (rapessed and peas) on growth, nutrient utilization and muscle fatty acid composition of rainbow trout (Oncorhynchus mycoses). Aquaculture, 13, , Booth MA, Allan GL, Francis J, Parkinson S: Replacement of fish meal in diets for Australian silver perch, Bidyanus bidyanus, IV. Effects of dehulling and protein concentration on digestibility of grain legumes. Aquaculture, 196, Hendrics JD, Bailey GS: Adventitious toxins. In, Fish Nutrition. 2th ed., pp Academic Press. San Diego, USA, Liener IE: Implications of antinutritional components in soybean foods. Critical Reviews in Food Science and Nutrition, 34, 31-67, Racks TVR, Wolf WJ, Baker EC: Protease in plant foods content and inactivation. In, Preidman M (Ed): Nutritional and Toxicological Significance of Enzyme Inhibitors in Foods. pp , Plenium Press. New York, USA, Adewumi AB, Olaleye V, Adusulu EA: Swim-up fry production in the African Catfish Clarias gariepinus (Burchell) broodstocks fed with differently heated soybean-based diets. Aquaculture Research, 17, Rehman Z, Salariya AM: The effects of hydrothermal processing on antinutritiens, protein and starch digestibility of food legumes. Int J Food Sci Technol, 40, AOAC: Official Methods of Analysis. 15th ed., pp Association of Official Analytical Chemists, Washington, D.C., USA Makkar HPS, Blümmel M, Becker K: Formation of complexes between polyvinyl pyrrolidones or polyethylene glycols and their implication in gas production and true digestibility in vitro techniques. Br J Nut, 73, , Hossain MA, Focken U, Becker K: Evaluation of an unconventional legume seed, Sesbenia aculeata, as a dietary protein source for common carp, Cyprinus carpio L. Aquaculture 198, , Hossain MA, Focken U, Becker K: Nutritional evaluation of dhaincha (Sesbania aculeate) seeds as dietary protein source for tilapia Oreochromis niloticus. Aquaculture Res, 33, , Borlongan IG, Eusebia P, Welsh T: Potential of feed pea (Pisum sativum) meal as a protein source in practical diets for milkfish (Chanos chanos Forsskal). Aquaculture, 225, 89-98, Kirchgessener M, Kürzinger H, Schwartz FJ: Digestibility of crude nutrients in different feed sand estimation of their energy contents for carp (Cyprinus carpio L.) Aquaculture, 58, , Dioundick OB, Stom DI: Effect of dietary a cellulose levels on the juvenile tilapia, Oreochromis mosambicus. Aquaculture, 91, , Makkar HPS, Singh B, Dawra KK: Tannin nutrient interactions. Inter J Anim Sci, 2, , Francis G, Makkar HPS, Becker K: Anti-nutritional factors present in plant-derived alternate fish feed ingredients and their effects in fish. Aquaculture, 199, , Rumsey GL, Hughes SG, Winfree RA: Chemical and nutritional evaluation of soybean protein preparations as primary nitrogen sources for rainbow trout (Oncorhynchus mykiss). Anim Feed Sci Technol, 40, , Francisco-Javier M, Gabriel C, De La Higuera M: Nutritive value of diets containing high percentage of vegetable protein for trout, Oncorhynchus mykiss. Aquat Living Resour, 5, 23-29, Regost C, Arzel J, Kaushik SJ: Partial or total replacement of fish meal by corn gluten meal in diet for turbot, Psetta maxima Aquaculture, 180, , Zhou QC, Mai KS, Tan BP, Liu YJ: Partial replacement of fish meal by soybean meal in diets for Juvenie cobia (Rachycentron canadum). Aquac Nutr, 11, , 2005.

51 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE [1] * ** Ham Petrolün Poecilia sphenops (Valenciennes, 1846) (Cyprinidae, Teleostei) Deri Histolojisi Üzerine Etkileri [1] Özlem ÖNEN *,** Burak GÖKÇE * Gürsel ERGEN * Sema İŞİSAĞ ÜÇÜNCÜ * Bu çalışma Ege Üniversitesi Eczacılık Fakültesi tarafından hazırlanan Deney Hayvanları İçin Etik Kurul Kararlarına göre ve Ege Üniversitesi Tıp Fakültesi Hayvan Etik Kurulu Sayılı Raporu uyarınca yürütülmüştür Ege Üniversitesi, Fen Fakültesi, Biyoloji Bölümü, Zooloji Anabilim Dalı, TR Bornova, İzmir - TÜRKİYE Kafkas Üniversitesi, Fen Edebiyat Fakültesi, Biyoloji Bölümü, Zooloji Anabilim Dalı, TR Kars - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Günümüzde endüstriyel teknolojinin gelişmesinde temel enerji kaynağı olan ham petrol, ekotoksikant olarak geniş çapta araştırılmaktadır. Ham petrolün teleostlarda deri üzerine etkilerini ortaya koymak için Poecilia sphenops örnekleri, ham petrolün suda çözünebilen kısımlarına dört farklı etki süresince (24, 48, 72, 96 saat) üç ayrı konsantrasyonuna (%10, %20, %40) maruz bırakılmış ve histolojik değişiklikler belirtilmiştir. Düşük konsantrasyon, kısa uygulama süresinde epidermiste hafif aşınma ve dermiste melanofor birikimi gözlenmiştir. Beklenildiği üzere dermis bozulması, subkutanöz kas tabakasında nekrotik alanların oluşumu ve fibrozis gibi ham petrolün çarpıcı etkileri, artan uygulama süresi ve konsantrasyona paralellik göstermiştir. Anahtar sözcükler: Ham petrol, Poecilia sphenops, Deri, Histopatoloji The Effects of Crude Oil on Skin Histology of Poecilia sphenops (Valenciennes, 1846) (Cyprinidae, Teleostei) Summary As being the main energy source that is needed for all of the industrial processes, crude oil is evaluated as a widely investigated ecotoxicant. In order to identify the effects of crude oil on the skin of teleosts, Poecilia sphenops specimens were exposed to three different concentration of soluble part of crude oil (10%, 20%, 40%) at four different exposure time (24, 48, 72, 96 h); and the histopathological changes were reported. A slight epidermis corrosion and melanophore aggregation in dermis were observed at low concentration and short exposure time. As estimated, the striking effects of the crude oil; such as dermis disintegration, necrotic areas and fibrosis in subcutaneous muscle layer; were extended prominently in parallel with increasing concentrations and exposure time. Keywords: Crude oil, Poecilia sphenops, Skin, Histopathology GİRİŞ Özellikle petrol arama ve çıkarma çalışmaları sırasında oluşabilecek kazalar ve ayrıca rafinerizasyon süreçleri, kullanım ve depolama aşamalarında sucul çevreye yayılma olasılığı yüksek bir fosil yakıt olan ham petrolün suda çözünebilen kısımlarında bulunan ve toksik özellik gösteren hidrokarbon bileşikleri, biyolojik birikim mekanizmalarıyla en üst organizmalara kadar ulaşabilirler 1,2. Ham petrol içeriğinde bulunan poliaromatik hidrokarbonların çeşitli biyolojik süreçlerdeki olumsuz etkilerine ilişkin çok sayıda araştırma vardır Sucul omurgalılar petrol kirliliğinin doğal çevreye etkilerinin belirlenmesinde çok yaygın kullanılan organizmalardır 13. Çok özelleşmemiş ve ince yapısıyla deri ve hemen altında yer alan subkütanöz kas tabakası bütün sucul omurgalılarda olduğu gibi teleostlarda da, herhangi bir toksik maddeye maruz kalındığında çeşitli düzeylerde patolojik oluşumlar sergiler 14. Sucul ortamda bulunan toksik maddelerle ilk olarak karşılaşan bu yapılarda izlenen histopatolojik değişimler, metabolik etkilenme süreçlerine ilişkin önemli ön veriler olarak değerlendirilir 15. İletişim (Correspondence) ozlem.onen@ege.edu.tr, ozlem.onen@hotmail.com

52 396 Ham Petrolün Poecilia sphenops... Bu çalışmada, ham petrolün suda çözünebilen kısımlarından hazırlanan farklı konsantrasyonlarının, iyi bilinen bir akvaryum balığı olan Poecilia sphenops (ay moli) derisinde oluşturduğu histolojik değişimlerin ortaya konması amaçlanmıştır. MATERYAL ve METOT Ticari akvaryumculardan sağlanan toplam 20 adet Poecilia sphenops örneği, dört adet 10 litrelik cam akvaryumlarda dinlendirilmiş Bornova şehir suyunda ve doğal fotoperiyotta iki hafta süreyle tutularak laboratuvar koşullarına alıştırılmıştır. Adaptasyon süresi bitiminde balıklar beşer örnekten oluşan %10, %20 ve %40 konsantrasyonlardaki üç deneme grubu ve bir kontrol grubuna ayrılmış ve bütün gruplar ticari balık yemleriyle (Sera-San) beslenerek su parametreleri (ph: 7,5-8; oksijen: 3,5-4 mg/l; sıcaklık: 22±2 C) sürekli denetlenmiştir. Ham petrol örneği Tüpraş A.Ş. den temin edilmiştir. Deneme gruplarına manyetik karıştırıcı aracılığı ile 1/9 oranında suda çözülerek hazırlanan ham petrol çözeltisi belirtilen konsantrasyonlarda uygulanmıştır. Her deneme grubu ve kontrol grubu için 24, 48, 72, 96 saatlik uygulama sürelerinin sonunda alınan balıklar, eter kullanılarak bayıltıldıktan sonra alınan deri örnekleri Bouin sıvısında tespit edilerek parafine gömülmüş ve 5-7 µm kalınlığında kesitler alınarak Hematoksilen-Eosin ile boyanıp ışık mikroskobunda incelenip fotoğrafları çekilmiştir. dermis sıraları ayrıca izlenebilir. Dermisde çok koyu renkli melanoforlar kolayca ayırt edilir. Subkütanöz tabaka aralarında boşluklar bulunan çizgili kas demetlerinden oluşur. %10 konsantrasyon grubunda 24 saatlik uygulama grubunda belirgin bir değişim olmamakla birlikte (Şekil 2.a) izlenen ilk değişim olan epidermis aşınması 48 saatlik uygulama gruplarında görülmektedir (Şekil 2.b). Ayrıca 48 saat uygulama grubunda dermis tabakasının üst kısımlarında melanofor yığılmaları izlenmeye başlamış, dermis tabakasının hemen altında küçük çapta fibrozis oluşumları görülmüştür (Şekil 2.b). 72 saat uygulama grubunda ise epidermis tabakası tam olarak ayırt edilememekle birlikte BULGULAR Kontrol grubunda (Şekil 1) birkaç hücre sırasından oluşan epidermis tabakasının hemen altında iki-üç sıra halinde şeritler oluşturan pullar ve homojen görünümlü dermis tabakası yer alır. Her bir pul sırasının üzerinde epi- Şekil 1. Deri kontrol kesiti, ep- epidermis tabakası, p- pullar, d- dermis, sk- subkutanöz kas tabakası Fig 1. Skin control section, ep- epidermis layer, p- scales, d- dermis layer, sk- subcutaneus muscle layer Şekil 2. a- %10 konsantrasyon 24 saat uygulama, başlangıç aşamasındaki hemorajik bölgeler (1 nolu ok), başlangıç aşamasındaki nekrotik alanlar (2 nolu ok), b- %10 konsantrasyon 48 saat uygulama, dermis altındaki fibrilasyon (daire), hemoraji görülen bölgeler (1 nolu oklar), nekrotik alanlar (2 nolu oklar), c- %10 konsantrasyon 72 saat uygulama, dermis altındaki devam eden fibrilasyon (daire), hemoraji (1 nolu ok), nekrotik bölgeler (2 nolu ok), d- %10 konsantrasyon 96 saat uygulama, fibrilasyon (daire), hemorajik bölgeler (1 nolu ok), nekrotik alanlar (2 nolu ok) Fig 2. a- 10% concentration, 24 h exposure, fibrilation under dermis (round), necrotic areas (horizontal arrows); b- 48 h exposure, fibrilation (round), necrotic areas (horizontal arrows); c- 72 h exposure, fibrilation under dermis (round), hemoragic and necrotic vesicules (horizontal arrows); d- 96 h exposure, pigmentation (vertical arrows), change orientation of dermis and increasing of fibrilation (round), pigmentation (vertical arrows)

53 397 ÖNEN, GÖKÇE ERGEN, İŞİSAĞ ÜÇÜNCÜ dermis tabakasının hemen altında fibrozis izlenmekte, ve genişleyen nekrotik alanlar göze çarpmaktadır (Şekil 2.c). Bunun yanında çok belirgin olmasa da ayırt edilebilen hemoraji elde edilen bulgular arasında yer almaktadır (Şekil 2.c). 96 saat uygulama grubunda ise epidermis 24 saatlik grupta elde edilen bulgularla paralellik göstermektedir. Dermis tabakasında fibriler yapıda bozulmalar gözlenmekte, ayrıca fibroblast nükleusları seçilememektedir (Şekil 2.d). Sayıları artan melanoforlar kalın ve dalgalı bir tabaka halinde izlenmektedir. Aralarında makrofajlarında izlendiği fibrotik ve nekrotik alanların genişlediği görülmekte, hemorajinin devam ettiği izlenmektedir (Şekil 2.d). %20 konsantrasyon 24 saat uygulama grubunda ise ilk olarak; %10 konsantrasyon 24 saatte dejenere olmaya başlamış olan epidermis tabakası, artık sadece tek hücre sırası olarak görülmekte hatta yer yer tamamiyle kaybolduğu anlaşılmaktadır (Şekil 3.a). Dermis yer yer parçalanmış ve bu parçalanan kısımlarda melanofor birikimleri izlenmektedir. Subkutanöz tabakada fibrozis oluşumu ayrı alanlar halinde değil, hemoraji izlenen bölgelerde yayılmış olarak izlenmektedir. Nekrotik alanlar yaygın olarak yer almaktadır (Şekil 3.a). 48 saat uygulama grubunda ise epidermis aynı şekilde ayırt edilememektedir. Dermis tabakasında yoğun melanofor birikimi gözlenmektedir (Şekil 3.b). Subkutanöz tabakada hem geniş alanlarda, hem de kas demetleri arasında tipik fibrözis izlenmekte ve nekrotik oluşumlar devam etmektedir (Şekil 3.b). 72 ve 96 saatlik gruplarda gözlenen bulgular 24 ve 48 saatlik bulgulara paralellik göstermekte belirgin bir değişiklik izlenmemektedir (Şekil 3.c,d). %40 konsantrasyon 24 saat uygulama grubunda daha önceki gruplara nazaran belirgin bir bulgu farklılığı olma- Şekil 3. a- %20 konsantrasyon 24 saat uygulama, pigmentasyon (dikey oklar), kas tabakası seperasyonu ve nekrotik alanlar, dermis altında fibrozis oluşumu (daire), b- 48 saat uygulama, kas tabakası nekrotik alanlarda fibrilasyon (yatay oklar), fibrozis (daire), c- 72 saat uygulama, kas tabakası fibrillerinde düzensizleşme (yatay oklar) ve fibrozis (daire), d- 96 saat uygulama, kas tabakası nekrotik alanlar ve fibrilasyon (yatay oklar) ve dermis tabakası altında yayılmış halde fibrozis (daire) Fig 3. a- 20% concentration, 24 h exposure, pigmentation (vertical arrows), seperation of mucle fibriles and necrotic areas (horizontal arrows), fibrosis under dermis layer (round); b- 48 h exposure, fibrilation between muscle fibriles and necrotic areas (horizontal arrows), fibrosis (round); c- 72 h exposure, disorders of muscle fibriles, seperations and necrotic areas (horizontal arrows), fibrosis (round); d- 96 h exposure, fibrilation between muscle fibriles and necrotic areas (horizontal arrows), fibrosis under dermis layer (round) Şekil 4. a- %40 konsantrasyon, 24 saat uygulama, kas fibrillerinde seperasyon ve nekrotik alanlar (oklar), b- 48 saat uygulama, dermis tabakasında düzensizleşme ve nekrotik alanlar (oklar), c- 72 saat uygulama, kas tabakası arasında nekrotik alanlar ve dağılım halinde fibrilasyon (oklar), d- 96 saat uygulama, belirgin fibrozis ve kas tabakası hasarı (daire) Fig 4. a- 40% concentration, 24 h exposure, seperation of muscle fibriles, necrotic areas between muscle fibriles (arrows), b- 48 h exposure, defect of dermis (arrows), c- 72 h exposure, dispersed fibrilaton between muscle layer and necrotic areas (arrows), d- 96 h exposure, marked fibrilation and muscle layer injury (round)

54 398 Ham Petrolün Poecilia sphenops... masına karşın 48 saat uygulama grubunda farklı olarak dermiste yer yer ayrılmalar izlenmektedir (Şekil 4.a,b). Kas tabakasında ise en belirgin değişiklik fibrotik oluşumların kist benzeri yapılar halinde izlenmesidir (Şekil 4.b). Bununla birlikte kas tabakasındaki nekrotik alanlar yaygın halde devam etmektedir (Şekil 4.b). 72 saat uygulama grubunda da önceki bulgulardan farklı bir bulgu izlenmemektedir (Şekil 4.c). 96 saat uygulama grubunda dermis yapısında çarpıcı bir şekilde bozulmalar izlenmektedir (Şekil 4.d). Melanoforlarda çok yaygın infiltrasyon izlenmektedir (Şekil 4.d). Kas tabakasında ise fibrotik oluşumlar etrafları boşlukla çevrili tipik kistik görünümdedir ve kas demetleri arasında nekrotik alanlar izlenmeye devam etmektedir (Şekil 4.d). Ayrıca kasların fibriler yapısında belirgin bozulmalar söz konusudur (Şekil 4.d). TARTIŞMA ve SONUÇ Teleostlarda deri, solungaçlarla beraber toksik maddeyle ilk temasın sağlandığı doku olması açısından etki derecelenmesinde öncelikle incelenmesi gereken yapılardandır. Bu çerçevede çeşitli toksik maddelerin deri üzerindeki etkileri farklı araştırmalara konu olmuştur 16. Ancak ulaşılabilen kaynaklarda ham petrolün deri üzerindeki etkilerine yönelik herhangi bir araştırmaya rastlanmaması, bulguların karşılaştırılmasını zorlaştırmaktadır. Ham petrol içeriğinde bulunan kimyasallara ilk olarak karşı karşıya gelen yüzey olan epidermis tabakasının, sunulan çalışmada kullanılan en düşük uygulama konsantrasyonunda ve en kısa sürede incelip neredeyse yok olması; tahmin edilen bir sonuç olarak Oreochromis niloticus operkulum epitelinde 16 ; Poecilia sphenops barsak epitelinde 17 ; Oncorhynchus gorbuscha, Prochilodus scrofa, Mugil sp., Cyprinus carpio, Barbus sp., Metynnis roosevelti ve Astyanax sp. gibi birçok türde de solungaç epitelinde 15,18,19 kaydedilen bulgulara uygundur. Dermiste toksik madde uygulaması sonucunda kaydedilen başlıca histolojik bozulmalar nekrotik alan ve fibrozis oluşumları olarak kaydedilmiştir 19,20. Bazı Salmonidae üyelerinde fenolik bileşenlerin uygulanması sonucunda deride rapor edilen ülseratif oluşumlara 16,21 çalışmamızda rastlanmamıştır. Ham petrol uygulaması sonucunda gözlenen histolojik deformasyonlar genel anlamda önceki araştırmaların sonuçlarına benzemektedir, ancak diğer raporlardan farklı olarak dermiste yoğun bir pigment birikimi not edilmiştir. Özellikle mukoz membranlara özgü ve çok iyi tanımlanmış bir olgu olan prekanseröz melanosis 22,23, ham petrolün teleostlardaki ekotoksikolojik etkileri konusunda çok daha dikkatli olunması gerektiğinin bir işareti olarak düşünülmelidir. Bu durumun, yapılan uygulama ile epidermisin neredeyse yok olmuş olmasıyla bağlantılı olabileceği öne sürülebilir, hatta ham petrolün pigment oluşumfarklılaşma - birikim mekanizmalarını düzenleyen nöroendokrin sistem üzerinde de etkili olduğu da akla gelebilir. Ancak bu varsayımların kanıtlanabilmesi için çok daha ayrıntılı araştırmalar gerekmektedir. Dermiste konsantrasyon ve maruziyet süresi bağlamında giderek artan şiddette izlenen fibrozis oluşumuna dair herhangi bir rapora ulaşılamamıştır. Bu oluşumların onarıcı yapılaşmalar olarak değerlendirilip değerlendirilemeyecekleri, bir diğer deyişle kronik maruziyette nasıl bir seyir izleyecekleri, özellikle incelenmesi gereken bir konudur. Araştırmamızda özellikle subkütanöz tabakada giderek genişleyen nekrotik alanların varlığı, ham petrol çözeltisinin sitolojik açıdan güçlü toksik etkisi hakkında bir diğer önemli histolojik kanıt olarak değerlendirilmiştir. Toksik maddelerin, hücre zarları geçirgenliğini değiştirerek sitosol ph ı ve mitokondriyal enzim aktivasyonunundaki değişimlere yol açabilecekleri, böylece nekroz oluşumunu tetikledikleri öne sürülmektedir 23. Bu görüşün sadece histolojik bulgularla değerlendirilmesi elbette olası değildir, ancak artan konsantrasyon ve uzayan uygulama süresinin, nekrotik alanlarda çok belirgin genişlemeye yol açtığı net olarak söylenebilir. Ham petrol uygulaması sonucunda subkutanöz kas tabakasında ortaya çıkan ve giderek belirgin ölçüde genişleyen nekrotik alanların varlığı, dermomyositis olgusunu düşündürecek boyuttadır. Dermomyositis, enflamatuvar myopati ailesinin bir alt grubu olarak sınıflandırılan otoimmün bir bağ doku hastalığıdır. Bu hastalık endotel duvarlarının hasarına bağlı olarak ortaya çıkar ve endomisyumu da etkiler. Endotel hücrelerin şişmesi ve sınırlarının değişmesine bağlı olarak gelişir, çünkü hücrelerde mikrovakuol oluşumları artar. Ayrıca düz endoplazmik retikulum yok olabilir veya gelişimi gerileyebilir. Tüm bu etmenler vasküler nekrozla sonuçlanan bir dizi patolojik durumu tetikler 19,23. Çizgili kaslar birçok ilaç ve toksik maddeden kolayca etkilenebilen bir dokudur. Herhangi bir nedenle kas doku fibrillerinde oluşan hasar kalsiyum iyonu salınmasına yol açarak miyosit membranlarında bozulmalara neden olur 20. Doku tahribatı makroskobik ve mikroskobik lezyonların yanı sıra fizyolojik olarak da lenfosit miktarını arttırmaktadır 21. Uygulama sonuçlarımızda subkütanöz tabakada izlenen bir diğer histopatoloji ise kas demetlerinde fibriler yapının kaybolmaya yüz tutmasıdır. Bu durum da polimyositis olarak nitelendirilebilir. Fibriler yapıda nekroz oluşumu olarak da tanımlanabilen, sitotoksisiteye bağlı olarak gelişebileceği bildirilen polimiyositisde T hücrelerinin rol oynayabileceği, ayrıca makrofaj sayısının ve CD 8 reseptör ifadesinin arttığı kaydedilmektedir 23. Yukarıda da belirtildiği üzere hem polimiyositis, hem de dermomyositis olgularının sitotoksisiteyle ilgili olabilecekleri öne sürülse de, sebepleri konusunda henüz tam bir açıklık olmadığını belirtmek gerekir 19,22,23. Bu noktada

55 399 ÖNEN, GÖKÇE ERGEN, İŞİSAĞ ÜÇÜNCÜ her iki hastalığın mekanizmaları da bilindiği kadarıyla aktarılmıştır. Ancak bulgularımız, ham petrol etkisinin sadece deri ile sınırlı kalmayacağını ve subkütanöz tabaka üzerinden sistemik etki gösterebileceğini kuvvetle düşündürmektedir. KAYNAKLAR 1. Marty GD, Hoffmann A, Okihiro MS, Hepler K, Hanes D: Retrospective analysis: bile hydrocarbons and histopathology of demersal rockfish in Prince William Sound, Alaska, after the Exxon Valdez oil spill. Mar Environ Res, 56, , Fent K: Ecotoxicological effects at contaminated sites. Toxicology, 205 (3): , Carls MG, Rice SD, Hose JE: Sensitivity of fish embryos to weathered crude oil: Part I. Low-level exposure during incubation causes malformations, genetic damage, and mortality in larval Pacific herring (Clupea pallasi). Environ Toxicol Chem, 18 (3): , Heintz RA, Short JW, Rice SD: Sensitivity of fish embryos to weathered crude oil: Part II. Increased mortality of pink salmon (Oncorhynchus gorbuscha) embryos incubating downstream from weathered Exxon Valdez crude oil. Environ Toxicol Chem, 18 (3): , Heintz RA, Rice SD, Wertheimer AC, Bradshaw R, Thrower FP, Joyce JE, Short JW: Delayed effects on growth and marine survival of pink salmon Oncorhynchus gorbuscha after exposure to crude oil during embryonic development. Mar Ecol Prog Ser, 208, , Peterson CH, Rice SD, Short JW, Esler D, Bodkin JL, Ballachey BE, Irons DB: Long-term ecosystem response to the Exxon Valdez oil spill. Science, 302 (5653): , Incardona JP, Carls MG, Teraoka H, Brown DW, Collier TK, Scholz NL: Aryl hydrocarbon receptor-independent toxicity of weathered crude oil during fish development. Environ Health Perspect, 113 (12): , Incardona JP, Collier TK, Scholz NL: Defects in cardiac function precede morphological abnormalities in fish embryos exposed to polycyclic aromatic hydrocarbons. Toxicol Appl Pharmacol, 196 (2): , Berdougo E, Coleman H, Lee DH, Stainier DY, Yelon D: Mutation of weak atrium/atrial myosin heavy chain disrupts atrial function and influences ventricular morphogenesis in zebrafish. Development, 130 (24): , Joseph EM: Zebrafish IRX1b in the embryonic cardiac ventricle. Dev Dyn, 231(4): 720-6, Scott KK, Norris RA, Potter SS, Norrington DW, Baybo MA, Hicklin DM, Kern MJ: GeneChip microarrays facilitate identification of Protease Nexin-1 as a target gene of the Prx2 (S8) homeoprotein. Cell Biol, 22 (2): , Cowart LA, Okamoto Y, Pinto FR, Gandy JL, Almeida JS, Hannun YA: Roles for sphingolipid biosynthesis in mediation of specific programs of the heat stress response determined through gene expression profiling. J Biol Chem, 278 (32): , Brand DG, Fink R, Bengeyfield W, Birtwell IK, Mcallister CD: Salt water-acclimated pink salmon fry (Oncorhynchus gorbuscha) develop stress-related visceral lesions after 10-day exposure to sublethal concentrations of thewater-soluble fraction of north slope crude oil. Toxicol Pathol, 29 (5): , Machado M R, Fanta E: Effects of Organophosphorus Metyl Parathion on the Branchial Epithelium of a Freshwater Fish Metynnis roosevelti. Braz Arch Biol Technol, 46(3): , Akaishi FM, Silva de Assis HC, Jakobi SCG, Eiras-Stofella DR, St- Jean SD, Courtenay SC, Lima EF, Wagener ALR, Scofield AL, Oliveira Ribeiro CA: Morphological and neurotoxicological findings in Tropical Freshwater fish (Astyanax sp.) after waterborne and acute exposure to Water Soluble Fraction (WSF) of crude oil. Arch Environ Contam Toxicol, 46: , Law M: Differential diagnosis of ulcerative lessions in fish. Environ Health Perspect, 109 (Suppl. l5): , Önen Ö, Gündüz Ö, İşisağ Üçüncü S: Ham petrolün suda çözünebilen kısımlarının Pelvicachromis pulcher (Boulenger, 1901) (Cichlidae, Teleostei) bağırsak ve karaciğeri üzerindeki etkileri. Kafkas Univ Vet Fak Derg, 17 (Suppl-A): S105-S110, Baumann PC: The use of tumors in wild fish to assess ecosystem health. Aquat Ecosyst Health, 1: , Engel AG, Arahata K: Mononuclear cells in myopathies: quantitation of functionally distinct subsets, recognition of antigenspecific cellmediated cytotoxicity in some diseases, and implications for the pathogenesis of the different inflammatory myopathies. Hum Pathol, 17, , Jerusalem F, Rakusa M, Engel AG, MacDonald RD: Morphometric analysis of skeletal muscle capillary ultrastructure in inflammatory myopathies. J Neurol Sci, 23, , Whitaker JN, Engel WK: Vascular deposits of immunoglobulin and complement in idiopathic inflammatory myopathy. N Engl J Med, 286, , Illa I, Nath A, Dalakas MC: Immunocytochemical and virological characteristics of HIV-associated inflammatory myopathies: similarities with seronegative polymyositis. Ann Neurol, 49, , Emslie-Smith AM, Arahata K, Engel AG: Major histocompatibility complex class-i antigen expression, immunolocalization of interferon subtypes and T-cell-mediated cytotoxicity in myopathies. Hum Pathol, 20, , 1989.

56 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Identifying the Bacteria Causing Ovine Gangrenous Mastitis and Detection of Staphylococcus aureus in Gangrenous Milk by PCR Osman Yaşar TEL * Faruk BOZKAYA ** * Harran University, Faculty of Veterinary Medicine, Department of Microbiology, TR Sanliurfa - TURKEY ** Harran University, Faculty of Veterinary Medicine, Department of Genetics, TR Sanliurfa - TURKEY Makale Kodu (Article Code): KVFD Summary The objective of this study was to identify bacteria causing gangrenous ovine mastitis as well as to detect and genotype Staphylococcus aureus in milk samples by using polymerase chain reaction (PCR) amplification and restriction fragment length polymorphism (RFLP) of coagulase gene. A total of 264 milk samples were collected from Awassi sheep with gangrenous mastitis raised in Sanliurfa province of Turkey. By using bacteriological examination Staphylococcus aureus (75%), Mannheimia haemolytica (7.2%), coagulase negative staphylococci (6.43%), Escherichia coli (4.55%), Corynebacterium spp. (0.76%) and Actinomyces pyogenes (0.76%) were identified. Bacterial DNA was isolated from 155 randomly selected milk sample. By PCR amplification of coagulase gene S. aureus was detected in 91.6% of the milk samples. Three different amplicons of 420 (0.7%), 580 (65.3%) and 780 (34%) bp band sizes, each showing a specific RFLP profile were observed. In conclusion, S. aureus was found to be mostly responsible for gangrenous mastitis in sheep raised in this region. S. aureus in milk samples could be more rapidly detected by PCR method. Two coa genotype of S. aureus were found to be common suggesting that limited number of strains were responsible for most cases of gangrenous mastitis in the region under the study. Keywords: Coa gene, Gangrenous mastitis, PCR, Sheep Staphylococcus aureus Özet Koyunlarda Gangrenöz Mastitise Neden Olan Bakterilerin İdentifikayonu ve Gangrenli Sütlerdeki Staphylococcus aureus un PCR ile Tespit Edilmesi Bu çalışmanın amacı, koyun gangrenöz mastitisine neden olan bakterilerin identifiye edilmesi ve süt örneklerindeki Staphylococcus aureus un polimeraz zincir reaksiyonu (PCR) ile tespit edilerek, koagülaz geni yönünden restriksiyon fragman uzunluğu polimorfizminin (RFLP) belirlenmesidir. Bu amaçla Şanlıurfa ilinde yetiştirilmekte olan gangrenöz mastitisli İvesi koyunlarından 264 adet süt örneği toplanmıştır. Bakteriyolojik incelemede Staphylococcus aureus (%75), Mannheimia haemolytica (%7.2), koagulaz negatif stafilakok (%6.43), Escherichia coli (%4.55), Corynebacterium spp. (%0.76) ve Actinomyces pyogenes (%0.76) identifiye edildi. Tesadüfi olarak seçilen 155 süt örneğinden bakteriyel DNA izole edildi. Koagulaz geni kullanılarak yapılan PCR amplifikasyonu ile örneklerin %91.6 sında S. aureus tespit edildi. Herbiri spesifik RFLP profili gösteren 420 (%0.7), 580 (%65.3) ve 780 (%34) baz çifti uzunluğunda 3 farklı PCR ürünü gözlendi. Sonuç olarak, S. aureus un, bölgede yetiştirilen koyunlarda gangrenöz mastitislerden büyük oranda sorumlu olduğu bulunmuştur. S. aureus un süt örneklerinden izole edilen DNA kullanılarak PCR metoduyla kolaylıkla tespit edilebileceği, iki coa genotipinin yaygın olduğu ve sınırlı sayıda suşun bölgedeki gangrenöz mastitis olgularının çoğundan sorumlu olduğu kanaatine varılmıştır. Anahtar sözcükler: Coa gen, Gangrenöz mastitis, Koyun, PCR, Staphylococcus aureus INTRODUCTION Mastitis, which is caused by several etiological agents is considered one of the most important diseases of sheep. S. aureus is recognized as the most common aetiological agent of ovine mastitis, followed by minor occurrence of İletişim (Correspondence) oyasar@gmail.com

57 400 Identifying the Bacteria... Mannheimia (Pasteurella) haemolytica, Escherichia coli, Clostridium perfringens, Streptococcus, Pseudomonas and Nocardia genera 1,2. In sheep production, mastitis has a major economical impact due to reduced milk yield and quality as well as increased use of drugs and veterinary services 3. Mastitis also negatively effects animal welfare. The annual incidence of clinical mastitis in dairy sheep is generally lower than 5%, but in some herds the incidence may exceed 50%, causing mortality or culling of up to 70% of individuals with gangrenous mastitis 4. Rapid detection of pathogens causing mastitis is important to control the rate of the infection and reduces the time required for return to normal milk production, thereby enhances animal welfare when coupled with appropriate antimicrobial therapy 5. Currently, the mammary gland pathogens are identified by in vitro culture, which is considered the gold standard. However, this technique requires two or three days for growing, isolation and identification of the pathogen, therefore is labor intensive and time consuming 6. Polymerase chain reaction (PCR) based molecular methods have been demonstrated to provide very efficient tools for identification of pathogens in human and different animal species. By means of PCR technique, it is possible to rapidly and easily detect nanograms of pathogens DNA in animal products or tissues with high specifity and sensitivity 6,7. Numerous molecular techniques have been used for identification of S. aureus isolates in epidemiological studies 8. Coagulase gene typing has been proven to be a simple and effective tool for identifying and genotyping of coagulase positive S. aureus isolates from both human and animal sources Specifity and sensitivity of PCR-based detection methods have been reported to be 100% and up to 10 2 colony forming unit/ml, respectively The amplified DNA fragments of different sizes can be further discriminated by digestion with restriction enzymes such as AluI 15. PCR -based genotyping method provides a more detailed epidemiological information on S. aureus 16,17. Numerous studies have been carried out on the molecular epidemiology of subclinical and clinical mastitis in sheep 18,19. However only two studies have been reported on the molecular epidemiology of S. aureus isolated from subclinical and ganrenous ovine mastitis in Turkey 20,21. To our knowledge no information is available on molecular epidemiology of S. aureus isolated from sheep with gangrenous mastitis in Turkey. Therefore the objective of this study was to identify bacteria in milk samples from sheep with gangrenous mastitis in Sanliurfa province of Turkey. In addition, the study was carried out to detect S. aureus in milk samples of sheep with gangrenous mastitis by using coagulase gene based PCR assay and to compare the results with those of bacteriological examination. Amplified fragments of coagulase gene were digested with AluI for further genotyping in order to determine variations among isolates. MATERIAL and METHODS Collection of Milk Samples A total of 264 milk samples were collected from Awassi sheep with gangrenous mastitis between in seven different flocks each consisting of dairy sheep in Sanliurfa, Turkey. All flocks were grazed, with some additional concentrate during spring, summer, and fall. Ewes lambed between December and January, and lambs were kept with their dams for 6-8 weeks. Clinical examinations were performed during full lactation between December and April, when mastitis was most frequently observed. Gangrenous mastitis was diagnosed with clinical examination by observing a cold and blue colored skin of udder and teat as well as presence of blood in the milk sample. A minimum of 5 ml of milk sample was collected from one affected udder lobe in a sterile container, after cleaning the teat with denatured 90% ethanol and discarding the first milk drops. Samples were subjected to microbiological examination in the laboratory within 24 h after collection. Bacteriological Examination Milk samples were cultured on 5% defibrinated sheep blood agar and MacConkey agar (Oxoid, Hampshire, England), incubated under aerobic conditions at 37 o C for 48 h. Presence of less than five colonies of the same type on the plates was considered contaminant and these colonies were not used for further bacteriological examination while colonies of the same type observed more than five were considered infective agent and used for furthe bacteriological examination 22. Microorganisms isolated were identified based on macro and microscopical morphology by Gram staining, culture characteristics and biochemical profile 23. The staphylococcal isolates were identified as S. aureus and coagulase negative staphylococci (CNS) by using catalase, tube coagulase, and fermentation test for acid production from glucose, mannitol, and maltose. Escherichia coli was identified by catalase, oxidase, growth on MacConkey agar, IMVIC test and metallic sheen on EMB agar. Corynebacterium spp. were identified by nitrate reduction, urease activity and the presence of hemolysis on blood agar. Mannheimia haemolytica was identified by using the CAMP reaction, the indole, mannitol, sorbitol, trehalose, dulcitol, oxidase and beta-galactosidase tests and presence of haemolysis on blood agar. Arcanobacterium pyogenes was identified by Gram staining and the presence of pinpoint colonies surrounded by a narrow zone of clear haemolysis at 48 h. DNA Extraction of Bacterial DNA from Milk A total of 155 randomly selected milk samples were used for DNA extraction. One ml of each sample was transferred into a microtube and centrifuged at rpm for 4 min. The supernatant was discarded and the pellet

58 403 TEL, BOZKAYA was resuspended and washed 2-3 times with TES buffer (Tris-HCL 10 mm; EDTA 1 mm, SDS 1% (w/v), ph 8.0) until a clear solution was obtained. Pellets were resuspended in 500 µl of TES buffer and 0.3 mg of proteinase K (Fermentas Life Sciences, Burlington, Ontario, Canada) was added. The samples were incubated on a water bath at 56 C for 2-3 h. DNA was extracted using phenol/chloroform method, followed by an isopropanol precipitation described by Sambrook et al. 24. DNA pellets were finally solved in 100 μl of TE buffer (10 mm Tris-Hcl, 1 mm EDTA, ph 8,0). Polymerase Chain Reaction Assay (PCR) and Restriction Fragment Length Polymorphism Analysis (RFLP) Coagulase gene typing was carried out by using the procedure described by Hookey et al. 16. The 3 -end region of the coa gene was amplified with use of the following primer pairs: 5 -ATAGAGATGCTGGTACAGG-3 (bases ); and 5 -GCTTCCGATTGTTCGATGC-3 (bases ). The PCR reaction was carried out in 25 µl of reaction volume containing 2.5 µl of 10X reaction buffer, 0.6 µm of each primer, 60 µm of each dntp, 3 mm MgCl 2, 1,25 U of Taq- DNA polymerase (Fermentas, Vilnius, Lithuania) and 2 µl of extracted DNA. As positive control S. aureus ATCC was used. As template for negative control sterile water was added. Amplification was performed with a thermocycler (Takara, Otsu, Japan) by using the following program: 45 s at 94 o C, followed by 30 cycles of 20 s at 94 o C, 15 s at 57 o C, and 15 s at 70 o C with a final step at 72 o C for 2 min. Amplified products were separated by 2% agarose gel electrophoresis stained by ethidium bromide and visualized by using a UV transilluminator. For RFLP analysis 10 µl of PCR products were digested with AluI (Fermentas, Vilnius, Lituania) according to instructions of the manufacturer. Fifteen microliters of the digestion products were electrophoresed on 2% agarose gel, and visualized under UV illumination. The sensitivity of PCR was tested by using 10-fold serial dilutions (CFU/mL) of a S. aureus strain isolated in UHT milk. Specificity of the PCR was checked by using DNA isolated from the strains of CNS, M. haemolytica and E. coli isolated in this study. RESULTS Bacterial Identifications A total of 264 milk samples was subjected to bacteriological examination, and 250 (94.7%) samples showed bacterial growth while 14 (5.3%) samples showed no bacterial growth on blood agar. The bacteria species isolated and identified from these milk samples are shown in Table 1. Results of PCR The detection limit of the PCR assay was 6x10 2 cfu/ ml of S. aureus. All strains used for the specificity of the PCR test gave negative results. Amplification of the coa gene yielded a single product in 141 of 155 (91%) milk samples, while no amplification product was obtained in 14 samples (9%) (Fig. 1). All samples from which only S. aureus was isolated with bacteriological examination (109 of 155 samples) yielded a PCR amplicon for coagulase gene. On the other hand a PCR product was obtained in 32 of 46 samples from which S. aureus was not isolated. There were no culture positive samples that were negative by using PCR method. By using PCR amplification of coa gene S. aureus was detected in 29.3% further samples in comparison to bacteriological examination. Furthermore by using PCR S. aureus was detected in 27 of 37 samples (73%) from which other bacteria were isolated (Table 2). The three types of PCR products observed were as follows: A (420±20 bp, n=1) B (580±20 bp, n=92), C (780±20 bp, n=48) (Fig. 2). Three distinct RFLP patterns were observed among the 141 isolates examined after AluI digestion of the PCR products. Only PCR amplicons of 780 bp band size were cutable giving three distinct bands, while the amplicons of 420 and 680 bp band size were not cutable with AluI giving only one band (Table 3). Table 1. Bacteria isolated by using bacteriological examination and samples positive for S. aureus by PCR of coa gene Tablo 1. Bakteriyolojik incelemede izole edilen bakteriler ve PCR yöntemiyle tespit edilen S. aureus pozitif örneklerin sayısı Species Number of Isolates (Frequency %) Samples Used for PCR Samples Positive for S. aureus by PCR S. aureus 198 (75) M. haemolytica 19 (7.2) CNS 17 (6.43) 5 5 E. coli 12 (4.55) 10 9 Corynebacterium spp. 2 (0.76) 2 1 A. pyogenes 2 (0.76) 2 0 No growth 14 (5.3) 10 5 Total

59 404 Identifying the Bacteria M Fig 1 Coagulase gene PCR products of S. aureus DN type A; lanes 2-3, type B; lanes 4-5, type C, lane M, M Şekil 1. Süt örneklerinden izole edilen S. aureus DNA tip A; 2-3, tip B; 4-5, tip C, M, Moleküler markör ( M Fig 1. Coagulase gene PCR products of S. aureus DNA isolated from milk samples. Lane 1, type A; lanes 2-3, type B; lanes 4-5, type C, lane M, Molecular marker (100 bp ladder) Fig 1 Coagulase gene PCR products of S. aureus DNA isolated from milk samples. Lane 1, type A; lanes 2-3, type B; lanes 4-5, type C, lane M, Molecular Fig 2. Restriction marker fragments (100 bp ladder) of PCR products genera Şekil 1. Süt örneklerinden izole edilen S. aureus DNA sına ait koagulaz geni PCR ürünleri. 1, tip A; 2-3, tip B; 4-5, tip C, M, Moleküler markör (100 bp ladder) 1, profil I; 2-3, Şekil 1. Süt örneklerinden izole edilen S. aureus DNA sına I; profil lanes II; 4-5, ait 2-3, profil koagulaz profile III; M, moleküler II; geni lane markör PCR 4-5, (100 ürünleri. profile bp ladder) III; 1, lane M, mo tip A; 2-3, tip B; 4-5, tip C, M, Moleküler markör (100 Şekil bp ladder) 2. PCR ürünlerinin AluI ile kesimi sonucu or Table 2. Comparison of bacteriological and PCR examination Tablo 2. Bakteriyolojik inceleme ve PCR sonuçlarının karşılaştırılması M Fig 2. Restriction fragments of PCR products generated by cutting with AluI. Lane 1, profile I; lanes 2-3, profile II; lane 4-5, profile III; lane M, molecular marker (100 bp ladder) Şekil 2. PCR ürünlerinin AluI ile kesimi sonucu ortaya çıkan fragmentler. profil II; 4-5, profil III; M, moleküler markör (100 bp Bacteriological Examination PCR Examination S. aureus Positive S. aureus Negative Total (Frequency) PCR positive (91%) PCR negative (9%) Total 109 (70%) 46 (30%) 155 (100%) Table 3. PCR and RFLP patterns of coagulase gene of S. aureus Tablo 3. S. aureus koagulaz geninin PCR ve RFLP profilleri Coagulase Genotype PCR Type Code (Approx. bp) RFLP Profile (Approx. bp) No. of Samples Frequency (%) A 420±20 I 420± B 580±20 II 580± C 780±20 III Fig 2. Restriction fragments of PCR products DISCUSSION of the generated samples by by using cutting bacterial with examination. AluI. Lane Culture 1, profile of I; lanes 2-3, profile II; lane 4-5, profile III; lane bacteria M, in molecular milk samples marker from (100 infected bp animals ladder) may yield Ovine mastitis is an endemic problem which is hardly no growth due to low numbers of bacteria, the presence of treated and Şekil controlled. 2. PCR To ürünlerinin determine the AluI appropriate ile kesimi leukocytes sonucu ortaya and residual çıkan therapeutic fragmentler. antibiotics 1, profil inhibiting I; 2-3, treatment and control measures it is important to rapidly the growth of bacteria 6,7. profil II; 4-5, profil III; M, moleküler markör (100 bp ladder) detect the aetiological agents of the disease. Production of coagulase is an important phenotypic S. aureus has been reported to be the most common feature used worldwide to identify S. aureus 29,30. aetiological agent causing clinical mastitis (29-65% of Amplification of coagulase gene by PCR has been used isolated bacteria) while CNS (3-19%), E. coli (3-19%) and for identification and genotyping of S. aureus isolated M. haemolytica ( %) have also been less frequently from different animal species with mastitis 12,31. By means observed 2, In the present study also S. aureus was of PCR amplification of coa gene S. aureus was detected found to be the most frequently isolated species while in all samples assigned as S. aureus positive (n=109) and other bacteria species such as M. haemolytica, CNS and in 32 milk samples assigned as S. aureus negative with E. coli was isolated less frequently in agreement with bacteriological examination. Therefore by using PCR method those reported by other researchers 2,25,28. In the present S. aureus was detected in 29.3% more samples compared study no growth of bacteria could be detected in 5.3% to bacteriological examination. By using PCR S. aureus was 14

60 405 TEL, BOZKAYA detected in 73% of the samples from which other bacteria were isolated, suggesting a mixed infection caused by S. aureus and other bacteria. A high specificity of the PCR method has also been reported by several authors 12,16. The sensitivity of the PCR method used in this study was comparable to those reported by Kumar 32 and Riffon et al. 6. Three different PCR amplicons having band sizes of 420, 580 and 780 bp were observed. The amplicon of 420 bp band size was observed in one sample. Amplicons of similar band sizes have also been reported by other authors 18,20,28,33. However, several researchers have observed four 18, to nine 20 different PCR amplicons of S. aureus strains isolated from sheep with mastitis. Moroni et al. 19 have found only a single amplicon of 760 bp of coa gene in S.aureus from milk of alpine goats. Da Silva et al. 34 reported 10 amplicons of different sizes ranging from 480 to 1080 bp for S. aureus isolates from goats with mastitis in Brazilian dairy herds. In the present study, 580 and 780 bp amplicons were observed for 99% of the isolates included into PCR amplification. In different studies amplicons of similar fragment lengths (580±20 and 820±20 bp) were accounted for 67% 18 and 88.9% 31 of S. aureus strains isolated from bovine mastitic milk. However prevalence of amplicons of similar fragment lengths varied from 10.2% 33 to 20% 18 of S. aureus strains isolated from sheep milk or milk products. On the other hand amplicon of 660 bp fragment length has been reported to be the most frequent one in sheep 18,33. Different RFLP patterns of S. aureus strains have been reported by several researchers 18,31,33. The RFLP pattern of type B, which was not cutable by AluI in the present study was similar to type B1 found by Katsuda et al. 31 in cows. The frequency of the type B (65.3%) in this study was comparable to that found by Katsuda et al. 31 for the type B1 (59.6%) which had the same fragment length as the type B in this study. The results indicated a predominance of two coa genotypes, suggesting that limited number of closely related S. aureus strains were responsible for most cases of gangrenous mastitis in the region under the study. These findings are consistent with those reported about bovine mastitis by other researchers who have reported the presence of a limited number of predominated types within each herd and country 10,11,35. The predominance of the two coagulase genotypes of S. aureus observed in this study might be due to their resistance to environmental conditions or immun response of the host. Su et al. 11 have reported that predominant genotypes of S. aureus are more resistant to neutrophil killing than the rare types. In conclusion, S. aureus was found to be mostly responsible for gangrenous mastitis in sheep raised in the region under the study. The presence of S. aureus in the milk samples from sheep with gangrenous mastitis could be detected more rapidly by PCR than bacteriological examination studied. By using PCR and RFLP method two coa genotype of S. aureus found to be common in the region studied suggesting that limited number of closely related strains were responsible for most cases of gangrenous mastitis in the region under the study. Further studies are required to determine the epidemiological distribution of different S. aureus strains in milk samples collected from sheep with gangrenous mastitis in other regions of Turkey. Investigation on the distribution of S. aureus strains with different coa genotypes isolated from subclinical and clinical mastitis cases might give valuable information on the epidemiology of gangrenous mastitis in the region. REFERENCES 1. Bergonier D, De Cremoux R, Rupp R, Lagriffoul G, Berthelot X: Mastitis in dairy small ruminants. Vet Res, 34, , Mork T, Waage S, Tollersrud T, Kvitle B, Sviland S: Clinical mastitis in ewes: Bacteriology, epidemiology and clinical features. Acta Vet Scan, 49, 23, Watkins GH, Jones JET: Mastitis and contagious agalactia. In, Aitken ID (Ed): Diseases of Sheep. 4th ed., pp , Blackwell Publishing Ltd, Oxford, UK, Bergonier D, Berthelot X: New advances in epizootiology and control of ewe mastitis. Livest Prod Sci, 79, 1-16, Milner P, Page KI, Hillerton JE: The effects of early antibiotic treatment following diagnosis of mastitis detected by a change in the electrical conductivity of milk. J Dairy Sci, 80, , Riffon R, Sayasith K, Khalil H, Dubreuil P, Drolet M, Lagace J: Development of a rapid and sensitive test for identification of major pathogens in bovine mastitis by PCR. J Clin Microbiol, 39, , Phuektes P, Mansell PD, Browning GF: Multiplex polymerase chain reaction assay for simultaneous detection of and Streptococcal causes of bovine mastitis. J Dairy Sci, 84, , Saei HD, Ahmadi M, Mardani K, Batavani RA: Molecular typing of Staphylococcus aureus isolated from bovine mastitis based on polymorphism of the coagulase gene in the north west of Iran. Vet Microbiol, 137, , Aarestrup FM, Dangler CA, Sordillo LM: Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis. Can J Vet Res, 59, , Schlegelova J, Dendis M, Benedik J, Babak V, Rysanek D: Staphylococcus aureus isolates from dairy cows and humans on a farm differ in coagulase genotype. Vet Microbiol, 92, , Su C, Kanevsky I, Jayarao BM, Sordillo LM: Phylogenetic relationships of Staphylococcus aureus from bovine mastitis based on coagulase gene polymorphism. Vet Microbiol, 71, 53-58, Ahmadi M, Rohani SMR, Ayremlou N: Detection of Staphylococcus aureus in milk by PCR. Comp Clin Pathol, 19, 91-94, Cremonesi P, Castiglion B, Malferrari G, Biunno I, Vimercati C, Moroni P, Morandi S, Luzanna M: Technical Note: Improved method for rapid DNA extraction of mastitis pathogens directly from milk. J Dairy Sci, 89, , Sindhu N, Sharma A, Jain VK: Coagulase gene based molecular detection of Staphylococcus aureus directly from mastitic milk samples of Murrah buffalo. Buffalo Bulletin, 29, 52-59, Goh S, Byrne SK, Zhang JL, Chow AW: Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J Clin Microbiol, 30, , Hookey JV, Richardson JF, Cookson BD: Molecular typing of Staphylococcus aureus based on PCR restriction fragment length polymorphism and DNA sequence analysis of the coagulase gene. J Clin Microbiol, 36, , 1998.

61 406 Identifying the Bacteria Schwarzkopf A, Karch H: Genetic variation in Staphylococcus aureus coagulase genes: Potential and limits for use as epidemiological marker. J Clin Microbiol, 32, , Vimercati C, Cremonesi P, Castiglioni B, Pisoni G, Boettcher PJ, Stella A, Vicenzoni G, Moroni P: Molecular typing of Staphylococcus aureus isolated from cows, goats and sheep with intramammary infections on the basis of gene polymorphisms and toxins genes. J Vet Med B, 53, , Moroni P, Pisoni G, Vimercati C, Rinaldi M, Castiglioni B, Cremonesi P, Boettcher P: Characterization of Staphylococcus aureus isolated from chronically infected dairy goats. J Dairy Sci, 88, , Ciftci A, Onuk EE, Findik A, Yildirim T, Unlu-Sogut M: Molecular typing of Staphylococcus aureus strains from ovine mastitis by pulsed-field gel electrophoresis and polymerase chain reaction based on coagulase and protein A gene polymorphisms. J Vet Diagn Invest, 21, , Tel OY, Aslantas O, Keskin O, Yilmaz ES, Demir C: Investigation of toxin genes of Staphylococcus aureus strains isolated from gangrenous mastitis in ewes. Kafkas Univ Vet Fak Derg, 17 (5): , McDougall S, Pankey W, Delaney C, Barlow J, Murdough PA, Scruton D: Prevalence and incidence of subclinical mastitis in goats and dairy ewes in Vermont, USA. Small Ruminant Res, 46, , Quinn PJ, Carter ME, Markey BK, Carter GR: Clinical Veterinary Microbiology. 5th ed., Harcourt Publishers Limited, Spain, Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., Fthenakis GC, Jones JET: Incidence and aetiology of clinical ovine mastitis in flocks in central Macedonia (Greece). Deh Ellen Kten Etair, 41, , Kryzanowski J, Wawron W, Malinowski V, Gluszak J, Orlik S: Bacteria flora isolated from the secretion of mastitic udders of ewes and their sensitivity to antibiotics. Med Vet, 39, , Lafi SQ, Al Majali AM, Rousan MD, Alawneh JM: Epidemiological studies of clinical and subclinical ovine mastitis in Awassi sheep in northern Jordan. Prev Vet Med, 33, , Burriel AR: Isolation of coagulase-negative staphylococci from the milk and environment of sheep. J Dairy Res, 65, , Aslantas O, Demir C, Turutoğlu H, Cantekin Z, Ergun Y, Dogruer G: Coagulase gene polymorphism of Staphylococcus aureus isolated from subclinical bovine mastitis. Turk J Vet Anim Sci, 31, , Da Silva ER, Da Silva N: Coagulase gene typing of Staphylococcus aureus isolated from cows with mastitis in Southeastern Brazil. Can J Vet Res, 69, , Katsuda K, Hata E, Kobayashi H, Kohmoto M, Kawashıma K, Tsunemitsu H, Eguchi M: Molecular typing of Staphylococcus aureus isolated from bovine mastitic milk on the basis of toxin genes and coagulase gene polymorphisms. Vet Microbiol, 105, , Kumar PA: Evaluation of PCR test for detecting major pathogens of bubaline mastitis directly from mastitic milk samples of buffaloes. Trop Anim Health Prod, 41, , Maslankova J, Pilıpcincova I, Tkacikova L: Pheno and genotyping of Staphylococcus aureus isolates of sheep origin. Acta Vet Brno, 78, , Da Silva ER, Boechat JUD, Da Silva N: Coagulase gene polymorphism of Staphylococcus aureus isolated from goat mastitis in Brazilian dairy herds. Lett Appl Microbiol, 42, 30-34, Akineden O, Annemuller C, Hassan AA, Lammler C, Wolter W, Zschock M: Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis. Clin Diagn Lab Immunol, 8, , 2001.

62 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE The Effect of Amniotic Membrane on Serum Biochemical Parameters in Experimentally Induced Non-Sterile Clean Wound Inflammation Şahver Ege HİŞMİOĞULLARI * Adnan Adil HİŞMİOĞULLARI * İsmail YAMAN *** Özlem YAVUZ ** Kamil SEYREK ** Ömür KARACA **** Cemal KARA ***** Armağan HAYIRLI ****** * ** *** **** ***** ****** Department of Pharmacology and Toxicology, School of Veterinary Medicine, Balıkesir University, TR Balıkesir - TURKEY Department of Biochemistry, School of Medicine, Balıkesir University, TR Balıkesir - TURKEY Department of General Surgery, School of Medicine, Balıkesir University, TR Balıkesir - TURKEY Department of Anatomy, School of Medicine, Balıkesir University, TR Balıkesir - TURKEY Surgical Clinic of Karsıyaka Hospital TR İzmir - TURKEY Department of Animal Nutrition, School of Veterinary Medicine, Atatürk University, TR Erzurum - TURKEY Makale Kodu (Article Code): KVFD Summary The effect of amniotic membrane on biochemical parameters was investigated in response to experimentally induced non-sterile clean wound inflammation. In addition, the effort was made to find out the biochemical compounds of human placenta extract. Thirty male Wistar-Albino rats weighing g were used and randomly divided into three groups of 10. The control group, subjected to no operation; sham-operated group, subjected to experimental clean wound inflammation; and amniotic membrane group, subjected to experimental clean wound inflammation and received Human Amniotic Membrane (HAM) treatment. All rats had free access to standard laboratory diet and water. In the sham-operated and amniotic membrane groups, a 4 cm-incision was made on the median line in order to create a wound. The abdominal fascia of the amniotic membrane group was then covered with amniotic membrane whilst the abdominal fascia of the sham-operated group was uncovered with a material. At the end of 14 days, the animals were sacrificed and blood samples were obtained and analyzed for biochemical parameters. Amniotic membrane with whole placenta extracts that were rich in enzymes as lactate dehydrogenase (LDH), alanine aminotransferase (ALP) and aspartate aminotransferase (AST), and elements including Fe, Na and Cl. The amniotic membrane group had significantly lower in the mean values of serum C-reactive protein (CRP), LDH and AST whilst this group had significantly higher in the mean concentration of serum albumin and iron compared to sham-operated values (P<0.05). Similarly, the mean values of serum albumin, iron, AST were significantly lower in amniotic membrane group whereas the activity of GGT was higher in this group compared to control values. These results may indicate that amniotic membrane exerts anti-inflammatory effect and may decrease severity of tissue damage and accelerate healing process in rats with experimentally induced non-sterile clean wound inflammation. Keywords: Amniotic membrane, Inflammation, Biochemical parameters, Wound Amniyotik Membranın Deneysel Olarak İndüklenmiş Steril Olmayan Temiz Yara İnflamasyonunda Serum Biyokimyasal Parametreler Üzerine Etkisi Özet Deneysel olarak indüklenmiş steril olmayan temiz yara inflammasyonuna cevap olarak, amniyotik membranın, biyokimyasal parametreler üzerine etkisi incelendi. Ayrıca insan plasenta ekstraktının biyokimyasal bileşenleri de araştırıldı. Ağırlıkları g arasında değişen, 30 adet, erkek Wistar- Albino sıçanları kullanıldı ve rastgele 10 arlı 3 grup oluşturuldu. Kontrol grubu hiçbir operasyon geçirmezken, sham-operasyonlu grup, deneysel temiz yara inflammasyonuna maruz kaldı ve amniyotik membran grubu da deneysel temiz yara inflammasyonuna maruz kalıp HAM sağaltımı aldı. Sıçanların hepsi, standart laboratuvar diyeti ve suya serbest ulaşıma sahiptiler. Sham-operasyonlu ve amniyotik membran gruplarında, yara oluşturmak için median hat boyunca 4 cm lik bir ensizyon yapıldı. Sonrasında, amniyotik membran grubunun abdominal fasiyası, amniyotik membran ile kapatılırken, sham-operasyonlu grubun abdominal fasiyası amniyotik membran eklenmeden kapatıldı. Ondördüncü günün sonunda, hayvanlar öldürüldü ve kan numuneleri alınarak biyokimyasal parametreler yönünden analiz edildi. Tüm plasenta ekstraktlı amniyotik membran; laktat dehidrojenaz (LDH), alanin aminotransferaz (ALP) ve aspartate aminotransferaz; (AST) enzimleri ile Fe, Na ve Cl elementleri yönünden zengindi. Amniyotik membran grubunun C-reactive protein (CRP), LDH ve AST serum ortalama değerleri, belirgin olarak düşük iken, yine bu grubun albumin ve demir serum ortalama konsantrasyonları, sham-operasyonlu grubun değerleriyle karşılaştırıldığında, belirgin olarak daha yüksekti (P<0.05). Benzer şekilde, amniyotik membran grubunun albumin, demir ve AST serum ortalama değerleri belirgin olarak düşük iken, bu grubun GGT aktivitesi, kontrol grubunun değerleriyle karşılaştırıldığında, daha yüksekti. Bu sonuçlar, amniyotik membranın anti-inflammatuvar etkiye sahip olduğunu ve deneysel olarak indüklenmiş steril olmayan temiz yara inflammasyonuna sahip sıçanlarda, doku hasarının ciddiyetini azaltabileceğini ve iyileşmeyi hızlandırabileceğini göstermektedir. Anahtar sözcükler: Amniyotik membran, İnflammasyon, Biyokimyasal parametreler, Yara İletişim (Correspondence) ahismiogullari@gmail.com

63 408 The Effect of Amniotic Membrane... INTRODUCTION In response to major tissue injury due to surgical trauma, a highly complex inflammation and healing process take places, which are modulated by numerous cells and their products such as cytokines, especially tumor necrosis factor-α (TNF- α), interleukin (IL)-1β, and IL-1b 1,2. Wound healing is a complex insult-initiated biologic process that involves inflammation, new tissue formation and remodeling 3,4. Inflammation, constituting part of the acute response, results in a coordinated influx of neutrophils at the wound site. These cells, through their characteristic respiratory burst activity, produce oxidant, which is well known criterion for defense against bacteria and other pathogens 5. The amniotic membrane (AM) is a thin avascular membrane composed of an epithelial layer and an inner mesodermal tissue. Amniotic membrane with whole placenta is rich in enzymes, vitamins, amino acids, steroids, fatty acids and elements including Na, K, Ca, Mg, Cu, Fe, P, and Si 6. All these components may possess multiple biological activities. It has reported that the AM mezoderm can suppress the expression of potent proinflammatory cytokines though the mechanism of action by which AM inhibits inflammation is not clear 7,8. The potent antiinflammatory effects 9 of HAM in regards to regeneration and new tissue formation 3 have also been demonstrated. It has been suggested that human amniotic membrane (HAM) releases of soluble factors such as (IL-10, IL-6) and angiogenic factors by cells and molecules bound to the collagenous stromal matrix of the HAM patch. This, in turn, exerts paracrine mechanisms to support survival, differentiation and proliferation of host cells 8. Human amniotic membrane (HAM) has important clinical application, such as a material to accelerate wound healing 10, reconstruct damaged organs 11-13, treat burn lesion 14, cover surgical wounds to avoid collusion 15, and induce keratocyte expression 16. This experiment was therefore conducted to investigate the biochemical profile in response to HAM treatment in a state of inflammation induced experimentally by the non-sterile clean wound technique. MATERIAL and METHODS Animals Upon the approval of the experimental protocol by the Animal Ethics Committee of the Balikesir University, animals were cared in accordance with National Institutes of Health Guide for the Care and Use of Laboratory Animals. Thirty male Wistar-Albino rats at age of five months and weighing g were housed in separate cages at 25 C and subjected to a 12:12-h light:dark cycle. The rats were randomly divided into three groups: Control group (Group 1), subjected to no operation; sham-operated group (Group 2), subjected to experimental clean wound inflammation; and amniotic membrane group (Group 3), subjected to experimental clean wound inflammation and received HAM treatment. All animals fed ad libitum consumption a standard laboratory diet and had free access to water during the experimental period. Preparation of the Amniotic Membrane Human amniotic membranes (38 weeks old) were obtained from caesarean deliveries of patients (n = 10) with negative test results for HBsAg, HCV, HIV, syphilis and no histories of premature membrane ruptures, endometritis or meconium ileus. Placentas were transferred in a container under sterile conditions at 4 C to the laboratory. At the processing site, the amnion was separated from the rest of the chorion by blunt dissection, then rinsed and soaked in saline and Dakin s solutions (0.25% sodium hypochloride solution) for 10 min in order to remove blood and other contaminants. The amnions were then stored in saline solution containing 50 μg/ml penicillin, 50 μg/ ml streptomycin, 100 μg/ml neomycin, and 2.5 μg/ml amphotericin B for 10 min. Finally, amnions were carefully flattened onto sterile nitrocellulose paper with the epithelium facing up. The nitrocellulose paper containing adherent membranes was then cut into 20-mm wide segments. Operation Procedure The rats were anaesthetized with intramuscular injection of 60 mg/kg of ketamin hydrochloride (Ketalar, Eczacibasi, Warner-Lambert Laboratories, Istanbul, Turkey) and 10 mg/ kg of xylazine hydrochloride (Rompun, Bayer Laboratories, Istanbul, Turkey). All procedures were performed under clean but non-sterile conditions and the animals were allowed to breath spontaneously during the surgery. The body temperature was maintained around 37 C by the use of a heating lamp. After shaving and scrubbing the abdominal skin with a povidone-iodine, a 4 cm-long midline incision was made. Immediately, the abdominal fascia was closed by a continuous suture (silk 3/0) in the HAM and sham-operated groups. Following that the fascia of the study group was covered by HAM while the fascia of the sham-operated group was covered no material. Finally, skin of these groups were closed by a continuous suture (silk 3/0). All animals were sacrificed 14 days after surgery administering an overdose of sodium pentobarbital (300 mg/kg, intraperitoneal). Prior to sacrifice, cardiac blood samples were collected into vacutainers. Preparation of the Placenta Extract Placenta samples (1 g) was transferred to 9 vol. (w/v) of ice-cold buffered sucrose (0.25 M containing 1 mm HEPES ph 7.4.). The placenta was cut into several large pieces and swirled around in the buffer to remove blood as much as possible. The placenta was minced finely with a sharp

64 409 HİŞMİOĞULLARI, HİŞMİOĞULLARI, YAMAN YAVUZ, SEYREK, KARACA, KARA, HAYIRLI scissors and transferred to ice-cold homogenising vessel and were finally homogenised with about six strokes of the pestle at full speed. The homogenate was made up to 10 vol. (w/v) with sucrose buffer solution. A sample of homogenate (3-4 ml) was centrifuged in a fixed angle rotor at 4 C for 10 min at хg to obtain supernatant. The supernatant was used for biochemical analysis. Biochemical Analysis Serum was separated by centrifuging at 825 xg for 10 min for analyses of urea, creatinine, cholesterol, triglyceride, high density lipoprotein-cholesterol (HDL-C), total protein and C-reactive protein (CRP) as well as alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), and alkaline phosphatase (ALP) activities using commercially available kits in an autoanalyzer (Cobas Integra 800; Roche Diagnostics GmbH; Mannheim, Germany). Serum levels of tumor necrosis factor-alpha (TNF-α) were determined by enzyme-linked immunosorbent assay (ELISA) using commercially available kits (ebioscience, Rat TNF-α Platinum ELISA, Austria) in a diagnostic instrument (BioTek, ELx 800, USA). Statistical Analysis After determining normality, data were subjected to one-way ANOVA (SPSS, version 11.0, Chicago, IL). Group mean differences were attained using the Bonferoni posthoc test option. The data were expressed as mean ± SE and differences were considered significant when the p value was less than RESULTS Human Placenta Extracts The biochemical parameters were expressed as biochemical values per gram placenta extract protein for standardization and accuracy. The placental LDH, ALP, and AST activities were more pronounceable as compared to the placental ALT and GGT activities (Table 1). Moreover, the placental extract were relatively rich in Fe, Na, Cl, and P, whereas poor in K (Table 1). The other biochemical parameters which were present in placenta extracts were glucose (12.14 mg/g protein), cholesterol (14.25 mg/g protein), and triglycerides (26.42 mg/g protein/g protein) as well as CRP (0.55 mg/g protein) (Table 1). Amniotic Membrane Treatment Table 2 summarizes biochemical parameters in response to the (HAM) treatment in rats induced experimentally non-sterile clean wound inflammation. Induction of nonsterile clean wound inflammation causes a 36% elevation in CRP level, which was reduced by the HAM treatment (Group 3) to the control level (Group 1). However, there were no differences in TNF-α across the experimental groups. As compared with the control group (Group 1), Table 1. Biochemical profile of the human placenta extracts (n = 10) Tablo 1. İnsan plasenta ekstraktlarının biyokimyasal profili (n = 10) Parameter sham operation (Group 2) decreased serum Fe concentration by 40%. Although the HAM treatment (Group 3) increased serum Fe concentration by 21% as compared to the sham-operated group (Group 2), it did not reach the control group (Group 1) level. Alterations in serum albumin concentration in response to experimental groups were similar to those in serum Fe concentrations. The activities of enzymes in response to the experimental groups were variable. The serum LDH activity increased by 4.1-fold in the shame operated group and this elevation was depressed by the HAM treatment (Group 3). The sham-operation (Group 2 did not affect the serum AST activity, whereas the HAM treatment decreased the serum AST activity as compared with the control and shamoperated groups. The serum ALT activity did not differ by the experimental groups. The sham-operation caused a 186% elevation in the serum GGT activities in comparison with the control group and the HAM treatment failed to reduce this elevation. DISCUSSION Mean±SD Glucose (mg/g protein) 12.14±2.14 Triglyceride (mg/g protein) 26.42±4.46 Cholesterol (mg/g protein) 14.28±4.14 ALP (IU/g protein) 347.0±74.16 ALT (IU/g protein) 2.71±0.42 AST (IU/g protein) 53.78±9.67 LDH (IU/g protein) ±77.67 GGT (IU/g protein) 8.20±0.8 CRP (mg/g protein) 0.55±0.01 Fe (µg/g protein) 92.75±21.36 Na (mmol/g protein) 15.71±2.02 K (mmol/g protein) 0.48±0.07 Cl (mg/g protein) 15.71±2.02 P (mg/g protein) 4.5±0.70 The placenta extracts were analysed for glucose, triglyceride, cholesterol, ALP, ALT, AST, LDH, GGT, CRP, Fe, Na, K, Cl and P ALT: alanine aminotransferase; AST: aspartate aminotransferase; LDH: lactate dehydrogenase; CRP: C-reactive protein; GGT: gamma-glutamyl transferase; ALP: alkaline phosphatase; SD: standard deviation Plasenta ekstraktından glukoz, triglyiserid, kolesterol, ALP, ALT, AST, LDH, GGT, CRP, Fe, Na, K, Cl ve P analizleri gerçekleştirildi ALT: alanin aminotransferaz; AST: aspartat aminotransferaz; LDH: laktat dehidrojenaz; CRP: C-reaktif protein; GGT: gamma-glutamil transferaz; ALP: alkalin fosfataz; SD: standard sapma Placenta extract with HAM has been used for a long time as a wound healer and a cosmetic in many countries 17. It is rich in enzymes such as AST and ALT; nucleic acids,

65 410 The Effect of Amniotic Membrane... Table 2. Serum biochemical parameters in response to the human amniotic membrane (HAM) treatment in rats induced experimentally non-sterile clean wound inflammation (n = 10) * Tablo 2. Deneysel steril olmayan temiz yara inflammasyonuyla indüklenmiş sıçanlarda, insan amniyotik membran (HAM) sağaltımına cevap olarak serum biyokimyasal parametreler (n =10) * Groups CRP (mg/dl) TNF-α (pg/ml) Iron (mg/dl) Albumin (mg/dl) LDH (IU/dL) AST (IU/dL) ALT (IU/dL) GGT (IU/dL) Group 2 (HAM) Group 1 (Control) Group 3 (Sham-treated) 0.005±0.002 b 41.4± ±10 b 2.89±0.05 b 384±197 b 98±7 b 67.1± ±0.25 a 0.011±0.003 ab 41.2± ±13 a 4.27±0.06 a 487±235 b 131±9 a 70.0± ±0.30 b 0.015±0.002 a 42.4± ±10 c 2.60±0.05 c 1898±197 a 138±7 a 60.5± ±0.25 a The sera were analysed for CRP, TNF-α, iron, albumin, LDH, AST, ALT and GGT * The data are expressed as mean ± SE 1 Control: rats that were not operated; Sham-operated: rats that were subjected to experimental clean wound inflammation; HAM-treated: rats that were subjected to experimental clean wound inflammation and received HAM treatment Different superscripts within the same rows differ (P<0.05). CRP: C-reactive protein; TNF-α: tumor necrosis factor-alpha; LDH: lactate dehydrogenase; AST: aspartate aminotransferase; ALT: alanine aminotransferase; GGT: gamma-glutamyl transferase Serumlardan CRP, TNF-α, demir, albumin, LDH, AST, ALT ve GGT analizleri gerçekleştirildi * Veriler, ortalama ± SE olarak gösterildi 1 Kontrol: sıçanları, operasyon geçirmediler; Sham-operasyonlu: sıçanlar, deneysel temiz yara inflammasyonuna maruz kaldılar; HAM-maruziyetli sıçanlar, deneysel temiz yara inflammasyonuna maruz kaldılar ve HAM sağaltımı aldılar Aynı satırdaki farklı üst-simgeler, farklıdır (P<0.05). CRP: C-reaktif protein; TNF-α: tümör nekroz faktör-alfa; LDH: laktat dehidrojenaz; AST: aspartat aminotransferaz; ALT: alanin aminotransferaz; GGT: gamma-glutamil transferaz vitamins, amino acids, steroids, fatty acids and minerals (Table 1). These biochemical molecules may have multiple biological effects, some of which are anti-inflammatory, immunotrophic and anti-oxidative 18. To our knowledge, very few studies have dealt with the effects of AM in long term. Therefore, the attempt was to investigate effects of HAM on metabolism on 14 th day 14,19. In the current experiment, serum biochemistry tests were used to assess the effects of HAM on inflammation induced experimentally by the non-sterile clean wound technique. The human amniotic membrane enhances epithelization 20-23, through secreting anti-inflammatory cytokines and suppressing TGF-β signaling at the transcriptional level, leading to down-regulation of several downstream genes that are responsible for scar formation 24,25. In general, HAM causes release of potent immune-modulatory and anti-inflammatory cytokines (IL-10, IL-6) 26 through a direct suppressive effect of amniotic membrane matrix on the expression of two of the most potent proinflammatory cytokines, IL-1α and IL-1β, at both protein and mrna levels 13,27 indicated that HAM possesses an immunosuppressor effect on human peripheral blood mononuclear cells, including apoptosis, and inhibiting proliferation in response to a polyclonal stimulus, as well as inhibiting the synthesis and secretion of pro-inflammatory cytokines on exposure to lypopolysaccharide. Similarly, it has been shown that HAM s anti-inflammatory actions may be mediated in part by its secretion of anti-inflammatory cytokines such as IL- 10, inhibin, activin, and IL-1 receptor antagonist as well as anti-inflammatory protease inhibitors such as a1-anti-trysin inhibitor and inter-a-trysin inhibitor 28. Moreover, HAM suppresses innate immunity by trapping both mononuclear and polymorphonuclear granulocytes within its stromal matrix and inducing them to undergo apoptosis 29. Tseng 30 has reported that HAM modulates acquired immunity by suppressing alloreactive responses and down regulate production of Th1 and Th2 cytokines. C-reactive protein is a well-known acute-phase protein and a marker of systemic inflammation in the body 31. In the present study, a lower level of CRP occurred in the HAM-treated group when compared with the sham-operated group (Table 2). The reduction in CRP level may indicate that HAM could facilitate wound healing by inhibiting inflammation. However, lacking difference in serum TNF-α levels (Table 2) may suggest that TNF-α acts locally rather than systematically. To our knowledge, the HAM effects on the activity of enzymes have not been studied in detail. Aspartate aminotransferase, one of the transaminase enzymes, is regarded as markers of muscular dystrophy and cell damage 32. The decreased activity of AST in the serum of the HAMtreated group may be due to restoration of muscular and cell damages induced by the non-sterile clean wound inflammation. Lactate dehydrogenase, an intracellular enzyme, increases in serum in case of cell damage and/ or death 33. The HAM treatment (Group 3) reduced the serum LDH activity which increased drastically in response to the sham operation (Table 2). Overall, enzyme activity responses may suggest that HAM may benefit to alleviate tissue damage. Additionally, decreased serum Fe and albumin concentration seem directly to be related to trauma induction. The partial restoration of these two parameters in the HAM-treated group (Group 3) could be related to having HAM served as a reservoir for these compounds (Table 2).

66 411 HİŞMİOĞULLARI, HİŞMİOĞULLARI, YAMAN YAVUZ, SEYREK, KARACA, KARA, HAYIRLI In conclusion, sham-operation resulted in tissue damage. The HAM treatment alleviated tissue damage as reflected by decreases in CRP and the serum LDH and AST activities. It also served as metabolite supplement for tissue restoration. Namely, the AM attenuates indicators of inflammation and tissue injury in experimental induced non-sterile clean wound inflammation. Acknowledgements The authors are grateful to Eren KIRDAR, Zeynep ATALAY and Selim YIRIK for their technical assistance. REFERENCES 1. Aller MA, Arias JI, Alonso-Poza A, Arias J: A review of metabolic staging in severely injured patients. Scan J Trauma Resusc Emerg Med, 18, 27-39, Yücel O, Güler A, Gamsızkan M, Ersöz N, Eken A, Şirin YS, Balkan M, Genç O: Protective effects of proanthocyanidin on allograft renal oxidative stress: An experimental study. Kafkas Univ Vet Fak Derg, 16 (1): 7-12, Singer AJ, Clark RA: Cutaneous wound healing. New Engl J Med, 341, , Atalay G, Demirkan İ, Yaman H, Cihan M, Önder F, Sözmen M: Effect of topical kefir application on open wound healing: An in vivo study. Kafkas Univ Vet Fak Derg, 9 (1): 43-47, Babior BM: Oxygen-dependent microbial killing by phagocytes (second of two parts). N Engl J Med, 298, , Ansari KU, Gupta N, Bapat SK: An experimental and clinical evaluation of immunomodulating potential of human placental extracts. Indian J Pharmacol, 26, , Solomon A, Rosenblatt M, Monray D, Ji Z, Pflugfelder SC, Tseng SC: Suppression of interleukin 1a and interleukin 1β in human limbal epithelial cells cultured on the amniotic membrane stromal matrix. Br J Ophthalmol, 85, , Manuelpillai U, Moodley Y, Borlongan CV, Parolini O: Amniotic membrane and amniotic cell: Potential therapeutic tools to combat tissue inflammation and fibrosis? Placenta, S320-S325, Garfias Y, Zago-Clavellina V, Vadillo-Ortega F, Osorio M, Jimenez- Martinez MC: Amniotic membrane is an immunosuppressor of peripheral blood mononuclear cells. Immunol Invest, 40, , Gomes MF, Dos Anjos MJ, Nogueira, TO, Guiaraes SA: Histological evaluation of the osteoinductive property of autogenous demineralized dentin matrix on surgical bone defects in rabbit skull using human amniotic membrane for guided bone regeneration. Int J Oral Maxillofac Implant, 16, , Kim JS, Kim JC, Na BK, Jeong JM, Song CY: Amniotic membrane patching promotes healing and inhibits proteinase activity on wound healing following acute corneal alkali burn. Exp Eye Res, 70, , Lee SH, Tseng SC: Amniotic membrane transplantation for persistent epithelial defect with ulceration. Am J Ophthalmol, 123, , Shimazaki J, Yang HY, Tsubota K: Amniotic membrane transplantation for ocular surface reconstruction in patients with chemical and thermal burns. Ophthalmology, 104, , Choi JA, Choi JS, Joo CK: Effects of amniotic membrane suspension in the rat alkali burn model. Molecular Vision, 17, , Toda A, Okabe M, Yoshida T, Nikaido T: The potential of amniotic membrane/amnion-derived cells for regeneration of various tissues. J Pharmacol Sci, 105, , Espana EM, He H, Kawakita T, Di Pascuale MA, Raju VK, Liu CY, Tseng SC: Human keratocytes cultured on amniotic membrane stroma preserve morphology and Express keratocan. Invest. Ophthalmol Vis Sci, 44, , Tonello G, Daglio M, Zaccarelli N, Sottofattori E, Mazzei M, Balbi A: Characterization and quantitation of the active polynucleotide fraction (PDRN) from human placenta, a tissue repair stimulating agent. J Pharm Biomed Anal, 14, , Watanabe S, Togashi S, Takahashi N, Fukui T: L-tryptophan as an antioxidant in human placenta extract. J Nutr Sci Vitaminol (Tokyo), 48, 36-39, Rinastiti M, Harijadi, Santoso ALS, Sosroseno W: Histological evaluation of rabbit gingival wound healing transplanted with human amniotic membrane. Int J Oral Maxillofac Surg, 35, Deprest JA, Van Ballaer PP, Evrard VA, Peers KH, Spitz B, Steegers EA, Vandenberghe K: Experience with fetoscopic cord ligation. Eur J Obstet Gynecol Reprod Biol, 81, , Devlieger R, Deprest JA, Gratacos E, Pijnenborg R, Leask R, Riley SC: Matrix metalloproteinases-2 and -9 and their endogenous tissue inhibitors in fetal membrane repair following fetoscopy in a rabbit model. Mol Hum Reprod, 6, , Fortunato SJ, Menon R: Distinct molecular events suggest different pathways for preterm labor and premature rupture of membranes. Am J Obstet Gynecol, 184, , Choi, JA, Jin HJ, Jung S, Yang E, Choi JS, Chung SH, Joo CK: Effects of amniotic membrane suspension in human corneal wound healing in vitro. Mol Vis, 15, , Letko E, Papaliodis DN, Papaliodis GN, Daoud YJ, Ahmed AR, Foster CS: Stevens-Johnson syndrome and toxic epidermal necrolysis: A review of the literature. Ann Allergy Asthma Immunol, 94, , Tseng SC, Li DQ, Ma X: Suppression of transforming growth factor isoform, TGF-b receptor II, and myofibroblast differentiation in cultured human corneal and limbal fibroblasts by amniotic membrane matrix. J Cell Physiol, 179, , Paradowska E, Blach-Olszewska Z, Gejdel E: Constitutive and induced cytokine production by human placenta and amniotic membrane at term. Placenta, 18, 441-6, Chang YJ, Hwang SM, Tseng CP, Cheng FC, Huang SH, Hsu LF, Hsu LW, Tsai MS: Isolation of mesenchymal stem cells with neurogenic potential from the mesoderm of the amniotic membrane. Cells Tissues Organs, 192, , Shimmura S, Shimazaki J, Ohashi Y, Tsubota K: Anti-inflammatory effects of amniotic membrane transplantation in ocular surface disorders. Cornea, 20, , Solomon A, Wajngarten M, Alviano F, Anteby, I, Elchalal U, Pe er, J, Levi-Schaffer F: Suppression of inflammatory and fibrotic responses in allergic inflammation by the amniotic membrane stromal matrix. Clin Exp Allergy, 35, , Tseng SC: Amniotic membrane transplantation for ocular surface reconstruction. Biosci Rep, 21, , Gabay C, Kushner I: Acute-phase proteins and other systemic responses to inflammation. N Engl J Med, 340, , Kaplan A, Szabo LL, Opheim KE: Clinical Chemistry: Interpretation and Techniques, 3rd ed., pp , Lea and Febiger, Philadelphia, USA, Prabhu R, Balasubramanian KA: Effect of oxidants on small intestinal brush border membranes and colonic apical membrane- a comparative study. Comp Biochem Physiol C Toxicol Pharmacol, 134, , 2003.

67 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Changes in Hematological and Biochemical Parameters of European Chub (Squalius cephalus L.) in Unpolluted Reservoir and Polluted Creek [1] Ekrem Şanver ÇELİK * Hasan KAYA * Sevdan YILMAZ ** [1] This project was partially by TUBITAK (Turkish Scientific and Technical Research Council) Grant, Project No: 104Y186- CAYDAG * Çanakkale Onsekiz Mart University, Faculty of Fisheries, Department of Basic Sciences, TR Çanakkale - TURKEY ** Çanakkale Onsekiz Mart University, Faculty of Fisheries, Department of Aquaculture, TR Çanakkale - TURKEY Makale Kodu (Article Code): KVFD Summary This study investigates the surface water quality parameters of the Atikhisar Reservoir and Sarıçay Creek, both of which are located in Çanakkale, the north-west part of Turkey. The conductivity, COD, BOD, TP, TN, and TSS content of water in Sarıçay Creek were higher than in Atikhisar Reservoir (P<0.05), however; water DO content in Sarıçay Creek was less than in Atikhisar Reservoir (P<0.05). Chl-a concentration, temperature, salinity and ph of water were not statistically significant in both of the resources (P>0.05). The quality of surface water samples of Atikhisar Reservoir and Sarıçay Creek were accepted first quality and third quality, respectively. The blood samples of European chub (Squalius cephalus L.) caught in the Atikhisar Reservoir (unpolluted) and Sarıçay Creek (polluted) provided the data to compare the hemato-chemical effects of pollution. The WBC, MCV, MCH, Ht, Hb, GLC, TP, and GLO levels of fish in Sarıçay Creek were significantly higher than those in Atikhisar Reservoir (P<0.05). The RBC, TBIL, CHOL, AST, and ALT levels of fish in Sarıçay were lower than the ones in Atikhisar Reservoir (P<0.05). There were no statistically significant differences in the MCHC, TG, ALB, Ca, and P values among the fish samples of Atikhisar Reservoir and Sarıçay (P>0.05). In conclusion, the data analyses infer that blood parameters can be used as an indicator of the fish health in general. On the other hand, the blood test can be used to determine fish stress due to water pollution. Keywords: European Chub, Pollution, Hematology, Blood, Biochemistry, Metabolite, Electrolyte Avrupa Tatlısu Kefali (Squalius cephalus L.) nin Temiz Baraj ve Kirli Çay daki Hematolojik ve Biyokimyasal Parametrelerindeki Değişimler Özet Bu çalışmada, Turkiye nin batısında yeralan Marmara bölgesi ndeki Atikhisar barajı ve Sarıçay ın yüzey suyu kalite kriterleri 2006 Ağustos ayı boyunca incelenmiştir. Sarıçay ın iletkenlik, COD, BOD, TP, TN ve TSS içeriği Atikhisar barajından yüksek bulunmuş (P<0.05), fakat; Sarçay ın DO içeriği Atikhisar barajına göre daha düşük tespit edilmiştir (P<0.05). Chl-a konsantrasyonu, sıcaklık, tuzluluk ve ph ise her iki alanda farksız bulunmuştur (P>0.05). Yüzey su kalitesi Atikhisar ve Sarıçay ın sırasıyla 1. kalite ve 3. kalite olarak kabul edilmiştir. Kirleticilerin hemato-kimyasal etkisinin karşılaştırılması için Atikhisar barajı (temiz) ve Sarıçay (kirli) dan yakalanan Avrupa tatlısu kefali (Squalius cephalus L.) nden alınan kan örnekleri incelenmiştir. WBC, MCV, MCH, Ht, Hb, GLC, TP ve GLO düzeyleri Sarıçay dan yakalanan balıklarda Atikhisar barajına göre daha yüksek çıkmıştır (P<0.05). RBC, TBIL, CHOL, AST ve ALT miktarları Sarıçay da yakalanan balıklarda Atikhisar barajından daha düşük bulunmuştur (P<0.05). Atikhisar barajı ve Sarıçay dan yakalanan balıkların MCHC, TG, ALB, Ca and P değerleri arasında fark çıkmamıştır (P>0.05). Bu sonuçlar, kan parametrelerinin genel balık sağlığının indikatörü olarak kullanılabileceğini göstermektedir. Ayrıca, balıklarda su kirliliğinden dolayı oluşan stresin tespitinde kan parametreleri kullanılabilir. Anahtar sözcükler: Avrupa tatlısu kefali, Kirlilik, Hematoloji, Kan, Biyokimya, Metabolit, Elektrolit İletişim (Correspondence) /1559 sanver_celik@comu.edu.tr

68 414 Changes in Hematological and... INTRODUCTION In a well-balanced aquatic ecosystem, the quality of water has a primary function between organisms and environment. It is also very important for the health of the ecosystem. Aquatic life is directly affected by ambient environment in rivers and reservoirs that are often contaminated by physical, chemical, biological and radioactive pollutants. For the habitat of fish, environmental factors are of particular importance. For example, freshwater fish are affected by a large number of environmental factors, such as temperature, salinity, conductivity, dissolved oxygen content, ph, photoperiod, chemical toxicants, nitrogen, phosphorus compounds, and other limiting factors 1. Failing to meet the optimal environmental conditions for fish can cause some major physiological effects. One of the dysfunctional effects and adaptive responses of abnormal environmental factors is the negatively efects in their blood. Indeed, the blood parameters are regarded as pathophysiological indicators of the whole body, and therefore; they are important in diagnosing the structural and functional status of fish, exposed to deleterious factors such as diseases, radioactive effects, chemical toxicants, carcinogens, and other environmental stressors. Atikhisar Reservoir and Sarıçay Creek supply drinking and irrigation waters for Çanakkale city. There are multiple factors threatening water quality of Sarıçay Creek such as sewage and agricultural wastewater 2. The objectives of this study were in two-fold: (1) to investigate some water quality parameters of Atikhisar Reservoir and Sarıçay Creek, and (2) to determine the possible characteristic changes of hemato-chemical parameters of European chub (Squalius cephalus L.) in Atikhisar Reservoir and Sarıçay Creek. MATERIAL and METHODS The water quality parameters such as temperature (T), salinity (Sal), ph, dissolved oxygen (DO), conductivity (C), total nitrogen (TN), total phosphorus (TP), chlorophyll-a (Chl-a), biochemical oxygen demand (BOD), chemical oxygen demand (COD) and total suspended solids (TSS) were measured in August The samples were collected from Atikhisar Reservoir and Sarıçay Creek, which are located in Çanakkale, in the north-western part of Turkey. The sampling technique as outlined by the Standard Methods for the Examinations of Water and Wastewater 3 was used in the collection, preservation, and storage of the samples. One and two litter polyethylene bottles were used to determine the chemical properties of the water. The bottles were kept at 4 C and analyzed within 24 h upon their collection Fishing expeditions were carried for European chub (Squalius cephalus L.) by using gillnet at a depth of 1.5 m to investigate the possible effects on hematological and biochemical indices. A total of 60 fish were caught as 30 European chub from each station of Atikhisar Reservoir and 30 from Sarıçay Creek. The body of each fish was weighed, and total length was measured. Their blood analyses were carried out to compare the blood parameters. About 4 ml of blood was drawn from each sample by caudal vein puncture and it was immediately placed in individual 2-mL silicone-coated Vacutainer Tubes (Becton Dickinson; not containing EDTA) and 2-mL tubes containing EDTA (ethylene diamine tetra acetic acid). The blood in coated Vacutainer Tubes was centrifuged promptly at g for 10 min, and then its serum was removed with a disposable transfer pipette. The concentrations of phosphate (P), calcium (Ca), total protein (TP), albumin (ALB), globulin (GLO), total bilirubin (TBIL), glucose (GLC), cholesterol (CHOL), triglyceride (TG), aspartate aminotransferase (glutamate oxaloacetate transaminase; AST = GOT), and alanine aminotransferase (glutamate pyruvate transaminase; ALT = GPT) were determined spectrophotometrically (AWARNES-Stat Fax 1904) by using Spinreact kits. The hematological analysis was conducted as by following the guidelines 4. Count of leucocytes (WBC) and erythrocytes (RBC) in the blood samples were counted with Natt-Herrick solution on a Neubauer counting chamber. Hemoglobin (Hb) concentrations were determined with Sahli-Hellige method (by using Drabkin s reagent), and hematocrit (Ht) values were determined with microhematocrit method. The values of mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH) and mean corpuscular hemoglobin concentration (MCHC) were calculated. The mean weight (WF), and length (LF) of the fish were calculated according to the methods 5 described and the statical comparison was conducted by using t-test analysis 6. The data obtained from blood analyses of fish and water parameters were subjected to t-test by using the Minitab - User Guide program 6. In these statistical comparisons, a value of P<0.05 (i.e. 95% Confidence Interval) was considered significant. RESULTS Conductivity, chemical oxygen demand (COD) and biochemical oxygen demand (BOD), total phosphorus, total nitrogen and total suspended solid (TSS) content of water in Sarıçay Creek were higher than in Atikhisar Reservoir however water dissolved oxygen content in Sarıçay Creek was less than in Atikhisar Reservoir (P<0.05) (Table 1). Chlorophyll-a concentrations, temperature, salinity (two resources are freshwater) and ph of water were not statistically significant in two resources (P<0.05) (Table 1). Means of body weight and length of European chub

69 415 ÇELİK, KAYA, YILMAZ Table 1. Physico-chemical parameters for surface waters of Atikhisar Reservoir and Sarıçay Creek in August 2006 Tablo 1. Atikhisar Barajı ve Sarıçay ın Ağustos 2006 da yüzey suyu fiziko-kimyasal parametreleri Station T C DO COD BOD TP TN Sal ph Cl-a TSS Atikhisar Reservoir Sarıçay Creek 27.70± ± ± ± ± ± ± ± ± ± ± ± ±10.50* 5.60±0.56* 16.00±1.28* 25.15±2.15* 0.14±0.05* 24.50±2.14* 0.35± ± ± ±0.002* n = 6, mean±s.e. Value along a column with asterisk was significantly different from other value in column; * P<0.05, Temperature = T ( C), Conductivity = C (µs/cm), Dissolved Oxygen = DO (mg/l), Chemical Oxygen Demand = COD (mg/l), Biochemical Oxygen Demand = BOD (mg/l), Total Phosphorus = TP (mg/l), Total Nitrogen = TN (mg/l), Salinity = Sal (ppt), ph (ph units), Chlorophyl-a = Chl-a (mg/l) and Total Suspended Solids = TSS (mg/l) Table 2. Mean weight (±SE) (WF) and length (LF) data of European chub (Squalius cephalus L.) in polluted Sarıçay Creek and unpolluted Atikhisar Reservoir Tablo 2. Kirli Sarıçay ve temiz Atikhisar Barajı ndaki Avrupa Tatlısu Kefali (Squalius cephalus L.) ın ortalama ağırlık (±SE) (WF) ve boy (LF) verileri Fish Size Water Resource n Mean±SE WF LF Atikhisar Reservoir ±18.24 Sarıçay Creek ±8.04 Atikhisar Reservoir ±0.64 Sarıçay Creek ±0.24 were not significantly different (P>0.05) in Atikhisar Reservoir and Sarıçay Creek (Table 2). The biochemical blood parameters are shown in Fig. 1a-k and the hematological parameters are shown in Fig. 2a-g. Serum-glucose, total protein and globulin concentrations of fish in Sarıçay Creek were significantly greater than those in Atikhisar Reservoir (P<0.05) (Fig. 1a, d, f). However, the fish sample in Sarıçay showed lower serum total bilirubin, cholesterol, AST, and ALT levels as opposed to the fish sample of Atikhisar Reservoir (P<0.05) (Fig. 1b, g, h, i). There were no significant differences in triglyceride, albumin, calcium and phosphate values between the fish samples of Atikhisar Reservoir and Sarıçay Creek * a ** b c ** d 2 0 GLC (mgdl -1 ) e 2 0 CHOL (mgdl -1 ) f * 0 2 TG (mgdl -1 ) g ** TP (gdl -1 ) * h Value along a column with asterisk was significantly different from other value in column; * P<0.05, ** P<0.01, n = 30, mean±s.e. Atikhisar Reservoir, Sarıçay Creek 1 0 ALB (gdl -1 ) * GLO (gdl -1 ) i TBIL (mgdl -1 ) j AST (IUL -1 ) k Fig 1. Serum biochemical parameters of European chub caught from unpolluted Atikhisar Reservoir and polluted Sarıçay Creek Şekil 1. Kirli Sarıçay ve temiz Atikhisar Barajı ndan yakalanan Avrupa Tatlısu Kefali nin serum biyokimyasal parametreleri 0 A LT (IUL -1 ) 0 Ca (mgdl -1 ) 0 P2O5 P (mgdl (mgdl -1 ) -1 )

70 416 Changes in Hematological and * Ht (%) a * Hb (gdl -1 ) b c d 30 * 20 * 10 0 RBCx10 6 (mm -3 ) WBCx10 3 (mm -3 ) Value along a column with asterisk was significantly different from other value in column; * P<0.05, ** P<0.01, n = 30, mean±s.e. Atikhisar Reservoir, Sarıçay Creek ** e ** f g Fig 2. Hematological parameters of European chub caught from unpolluted Atikhisar Reservoir and polluted Sarıçay Creek Şekil 2. Kirli Sarıçay ve temiz Atikhisar Barajı ndan yakalanan Avrupa Tatlısu Kefali nin hematolojik parametreleri 0 MCV (µm 3 ) 0 MCH (pg) 0 MCHC (gdl -1 ) (P>0.05) (Fig. 1c, e, j, k). Leucocyte count, mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), hematocrit and hemoglobin concentrations in blood of the fish in Sarıçay Creek were statistically significantly higher than the fish sample of Atikhisar Reservoir (P<0.05) (Fig. 2a, b, d, e, f). Blood erythrocyte count of the fish sample in Sarıçay Creek was significantly less than that the Atikhisar Reservoir s fish (P<0.05) (Fig. 2c). No significant differences were observed mean corpuscular hemoglobin concentrations (MCHC) between both of the fish samples from the research sites (P>0.05) (Fig. 2g). DISCUSSION The assessment of water quality is generally determined by employing the analysis of physico-chemical parameters. Conductivity, total suspended solids, chlorophyll-a, temperature and ph values of freshwater in both Atikhisar Reservoir and Sarıçay Creek were within the normal limits of quality standards indicated for surface waters adapted warm freshwater fish 1,7-9. However, higher conductivity and total suspended solids in Sarıçay Creek was observed because of the pollution (i.e. domestic waste and agricultural runoff). Besides, the freshwater of Sarıçay Creek has been found to have higher values of BOD and COD in comparison with the levels in Atikhisar Reservoir, thus; it indicates the polluted water of Sarıçay. Hence, in the direction of pollution analysis marking, Sarıçay as the most oxygen demanding suggests the existence of pollution state. When BOD level is high, it means the dissolved oxygen level in water decreases because the oxygen is basically consumed by bacteria 10, and other microorganisms. In accordance with this, the decrease in dissolved oxygen value found in Sarıçay freshwater sample is inversely related and corroborate well with the BOD value of the present study. Atikhisar Reservoir was classified the first degree in terms of the dissolved oxygen, salinity, total nitrogen, total phosphorus, total suspended solid, BOD, and COD values while Sarıçay Creek was third class in terms of these parameters 11,12. Thus, Atikhisar Reservoir is assumed as unpolluted surface water, but Sarıçay Creek is assumed surface water. Water pollutants in Sarıçay Creek elevated serum glucose concentrations in chronic stress impact upon European chub. The increased glucose level in the serum of fish in Sarıçay could be a result of hyperglycemia induced by lifelong exposure to environmental stressors such as hypoxia, high salinity, total nitrogen, total phosphorus, total suspended solid, BOD, COD. Indeed, hyperglycemia (high blood glucose) in teleost was believed to be caused by a wide range of environmental stress factors 13-17, nephritis, hepatic disorder 18 and muscle tissue dysfunction 19. The elevated serum/plasma glucose is an indicative of disrupted carbohydrate metabolism, which may be mainly due to the enhanced breakdown of liver glycogen 18. In this study, these theories may be supported by the results of serum enzyme analyses showing a statistically significant decreased AST and ALT levels of the fish in Sarıçay Creek. The decreased serum AST and ALT values of the fish might be observed in pollutant exposure 15 as seen in this study. The AST and ALT activities represent protein metabolism, which are the aminotransferases, catalyzing the intermolecular transfer of amino groups between amino acids and α-ketoacidosis 20. Lower AST activity shows that oxaloacetate and glutamate are not available to Krebs cycle through this route of transamination. The decreased serum AST and ALT activities signal liver cell insufficiency. The enzyme-abundant tissues contribute to the aspect of the circulating enzyme pattern in the serum. If damage occurs in the enzyme-abundant tissue, some enzymes

71 417 ÇELİK, KAYA, YILMAZ may leak from injured cells and thus the activities of serum enzymes would change. Serum s total protein and globulin concentrations of fish in Sarıçay Creek were higher than those of in Atikhisar Reservoir. Exposure to pollutants had a detrimental effect on the immunological response in fish 21. The significance of the increased globulin levels to meet the immunotoxic challenges lends evidence to the differential response of the constituent plasma protein. Total protein is used to evaluate protein metabolism. Hyperproteinemia, seen with hemoconcentration and shock, contributed to the elevated osmolality 13 and nutritional status 16. In addition, increased concentrations of total protein can be caused by structural liver alterations reducing aminotransferase activity, (as observed as a reduction of AST and ALT levels in this study) with concurrent reduced deamination capacity 17 and impaired control of fluid balance 22. Also, bilirubin is the predominant bile pigment found in the circulation in fish derived from disruption of hemoglobin 23. In this study, the less value of bilirubin in European chub of Sarıçay Creek was a consequence of the increased level of hemoglobin. Bilirubin is a breakdown product of hemoglobin and could be logically expected to decrease adversely with increasing levels of hemoglobin. Total bilirubin comes to the muscle and liver by binding it to the albumin and globulin in the serum through filtering by kidney. Serum bilirubin levels of fish can change with hepatic and nephritic diseases 24. In this work, low concentration of cholesterol (hypocholesterolemia) in serum of European chub in Sarıçay Creek may have come from the effect of pollution. It is known that cholesterol and lipoproteins values are related with each other, and these are connected with the metabolism of lipids and functions of the liver and kidney. Serum cholesterol level of fish can be affected from nutritional factors 25, nephritic syndrome, glycogen storage disease, seasonal changes, physiological activity and toxic agents 19,25,26. Increased leucocyte count in blood of European chub establishes leucocytosis, which is considered to be of adaptive value for the tissue under pollution-induced chronic stress. This also helps in the removal of cellular debris of necrosed tissue. In the presence of foreign substances or under pathological conditions leukocytosis in fish can be the consequence of direct stimulation of immunological defense 18. The MCV, MCH, hemoglobin and hematocrit increased considerably in blood of fish in polluted Sarıçay Creek compared to the fish of Atikhisar Reservoir. These high values indicate an adaptation to polluted condition where more oxygen is needed for metabolic processes. These alterations in European chub of Sarıçay Creek were attributed to direct or feedback responses of structural damage to erythrocyte membranes resulting in hemolysis and impairment in hemoglobin synthesis, stress-related release of erythrocytes from the spleen and hypoxia, induced by exposure to pollution as been reported for several other fish species 16,27. Hemoglobin levels in the blood of Cyprinion watsoni were significantly increased when the fish were exposed to hypoxia 28. Furthermore, different study showed that an increased ability of hemoglobin to bind with oxygen 29. The significant reduction of erythrocyte count and elevation of MCV in blood of fish in polluted Sarıçay Creek may be attributed to endocrinopathy, however; to what extent this endocrinopathy occurs in fish with water pollution requires further investigations. The phenomenon of physiological macrocytosis under polluted environmental condition, as evidenced by an increase in the MCV level, was seen in this study as well. In conclusion, the blood leucocyte, erythrocyte, hematocrit, hemoglobin, MCV and MCH levels and the serum total protein, globulin, total bilirubin, cholesterol, glucose, AST and ALT concentrations in European chub could be useful to evaluate the physiological effects of water pollution, but the application of these findings to prepare laboratory diagnostics will need more elaborated investigations and must be validated in situ before establishing them as biomarkers. REFERENCES 1. Martins CIM, Ochola D, Ende SSW, Eding EH, Verreth JAJ: Is growth retardation present in Nile tilapia Oreochromis niloticus cultured in low water exchange recirculating aquaculture systems? Aquaculture, 298 (1-4): 43-50, Akbulut M, Kaya H, Celik ES, Odabasi DA, Odabasi SS, Selvi K: Assessment of surface water quality in the Atikhisar Reservoir and Sarıçay Creek (Canakkale, Turkey). Ecology, 19 (74): , APHA, AWWA, WEF: Standard Methods for the Examination of Water and Wastewater. 18th ed. APHA, AWWA, WPCF, Washington DC, Bullock AM: Laboratory methods. In, Roberts RJ (Ed): Fish Pathology. 1st ed., pp , Baillière & Tindall, London, Busacker GP, Adelman IR, Goolish EM: Growth. In, Schreck CB Moyle PB (Eds): Methods for Fish Biology. 1st ed., pp , American Fisheries Society, Bethesda, Statistically Analytical System: Statistical graphics system: By Statistical Graphics Corporation, User s Guide-Reference. STCS, Inc, Schendel EK, Nordström SE, Lavkulich LM: Floc and sediment properties and their environmental distribution from a marine fish farm. Aquac Res, 35 (5): , Azim ME, Little DC: The biofloc technology (BFT) in indoor tanks: water quality, biofloc composition, and growth and welfare of Nile tilapia (Oreochomis niloticus). Aquaculture, 283 (1-4): 29-35, Vanderploeg HA, Ludsin SA, Cavaletto JF, Höök TO, Pothoven SA, Brandt SB, Liebig JR, Lang GA: Hypoxic zonesas habitat for zooplankton in Lake Erie: refuges from predation or exclusion zones. J Exp Mar Biol Ecol, 381 (1): , Padmini E, Rani MU: Evaluation of oxidative stress biomarkers in hepatocytes of grey mullet inhabiting natural and polluted estuaries. Sci Total Environ, 407 (15): , WHO: Guidelines for Drinking-Water Quality. WHO, Geneva, Switzerland, 2004.

72 418 Changes in Hematological and WPCR: Water Pollution Control Regulation dated official newspaper, Ankara, Turkey, Noga EJ, Wang C, Grindem CB: Comparative clinicophathological responses of stripped bass and palmetto bass to acute stress. T Am Fish Soc, 128 (4): , Adham KG: Sublethal effects of aquatic pollution in Lake Maryût on African sharptooth catfish, Clarias gariepinus (Burchell, 1822). J Appl Ichthyol, 18 (2): 87-94, Adham KG, İbrahim HM, Hamed SS, Saleh RA: Blood chemistry of the Nile tilapia, Oreochromis niloticus (Linnaeus, 1757). Aquat Ecol, 36 (4): , Aride PHR, Roubach R, Val AL: Tolerance response of tambaqui Colossoma macropomum (Cuvier) to water ph. Aquac Res, 38 (6): , Zhou X, Li M, Abbas K, Wang W: Comparison of haematology and serum biochemistry of cultured and wild Dojo loach Misgurnus anguillicaudatus. Fish Physiol Biochem, 35 (3): , John PJ: Alteration of certain blood parameters of freshwater teleost Mystus vittatus after chronic exposure to Metasystox and Sevin. Fish Physiol Biochem, 33 (1): 15-20, Yang JL, Chen HC: Effects of gallium on common carp (Cyprinus carpio): Acute test, serum biochemistry, and erythrocyte morphology. Chemosphere, 53 (8): , Jee JH, Park KH, Keum YH, Kang JC: Effects of 7, 12-dimethylbenz(a) anthracene on growth and haematological parameters in Korean rockfish, Sebastes schlegeli (Hilgendorf). Aquac Res, 37 (5): , Gopal V, Parvathy S, Balasubramanian RS: Effect of heavy metals on the blood protein biochemistry of the fish Cyprinus carpio and its use as a bio-indicator of pollution stress. Environ Monit Assess, 48 (2): , Coz-Rakovac R, Strunjak-Perovic I, Hacmanjek M, Topic PN, Lipej Z, Sostaric B: Blood chemistry and histopathological properties of wild and cultured sea bass (Dicentrarchus labrax) in the north Adriatic Sea. Vet Res Commun, 29 (8): , Cornelius CE: Bile pigments in fishes: A review. Vet Clin Path, 20 (4): , Pepelinjak S, Petrinec Z, Kovacic S, Segvic M: Screening toxicity study in young carp (Cyprinus carpio L.) on feed amended with fumonisin B 1. Mycopathologia, 156 (2): , Bernet D, Schmidt H, Wahli T, Burkhardi-Holm P: Effluent from a sewage treatment works causes changes in serum chemistry of brown trout (Salmo trutta L.). Ecotox Environ Safe, 48 (2): , Chen Y, Wooster GA, Getchell RG, Bowser PR, Timmons MB: Blood chemistry of healthy, nephrocalcinosis-affected and ozone-treated tilapia in a recirculation system, with application of discriminant analysis. Aquaculture, 218 (1-4): , Shah SL: Haematological parameters in tench, Tinca tinca after short term exposure to lead. J Appl Toxicol, 26 (3): , Qureshi IZ, Hafeez MA, Shaikh SA: Hematological response of the fish, Cyprinus watsoni, to hypoxia, anemia and hyperthermia. Pak J Zool, 27, , Val A, Lessard J, Randall DJ: Effects of hypoxia on rainbow trout (Oncorhynchus mykiss) - intraerythrocytic phosphates. J Exp Biol, 198 (2): , 1995.

73 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Determination of Potential Nutritive Value of Exotic Tree Leaves in Turkey Önder CANBOLAT * * Uludag University, Faculty of Agriculture, Department of Animal Nutrition, TR Bursa - TURKEY Makale Kodu (Article Code): KVFD Summary The aim of this study was to determine the effects of plant species on the potential nutritive value of introduced tree leaves using the chemical composition and in vitro gas production. Gas productions of the introduced tree leaves were determined at 3, 6, 12, 24, 48, 72 and 96 h incubation times and their gas production kinetics were described using the equation y=a (1-exp -ct ). Plant species had a significant effect on the chemical composition, in vitro gas production, metabolisable energy (ME) and organic matter digestibility (OMD) of the introduced tree leaves. The crude protein content of leaves ranged from to 21.92%. The crude protein content of leaves from Robinia poseudoecacia umbraculifera was significantly (P<0.001) higher than those of other legume trees. The NDF and ADF content of legume trees ranged from to and to 28.06% respectively. NDF content of leaves from Gladitsia triacanthos was significantly (P<0.05) higher than those of other legume trees. Although the gas production rate (c) of leaves Albiza julibrissin was significantly (P<0.05) higher than those of Gladitsia triacanthos and Robinia poseudoecacia umbraculifera. The potential gas production of Albiza julibrissin was significantly higher than those for Gladitsia triacanthos and Robinia poseudoecacia. The ME and OMD contents of introduced tree leaves ranged from 9.49 to MJ/kg DM and from to 70.3% respectively. In conclusion, the species had a significant effect on the potential nutritive value of introduced legume tree leaves. However the tree leaves studied in the current study would be effective protein resource for ruminant animals and may correct the deficient nitrogen in basal roughages with low protein during critical period of year when feed shortage occurred. However leaves obtained from Robinia pseudoecacia umbraculifera, Gladitsia triacanthos, and Robinia psedoecacia should be supplemented with polyethylene glycol or treated with alkali to reduce the detrimental effect of condensed tannin. Condensed tannin (CT) contents of legume trees ranged from 1.70 to 18.35%. Keywords: Exotic plants, Chemical composition, Metabolisable energy, Organic matter digestibility, Condensed tannin Türkiye deki Bazı Egzotik Ağaç Yapraklarının Potansiyel Besleme Değerinin Belirlenmesi Özet Bu çalışmanın amacı, bazı egzotik ağaç yapraklarının potansiyel besleme değerlerini kimyasal kompozisyon ve in vitro gaz üretim tekniği kullanarak belirlemektir. Egzotik ağaç yapraklarının in vitro gaz ölçümleri fermantasyonun 3, 6, 12, 24, 48, 72 ve 96 ıncı saatlerinde yapılmıştır. Gaz üretimine ait parametreler y=a(1-exp -ct ) fonksiyonu ile belirlenmiştir. Egzotik ağaç yaprakların kimyasal kompozisyonu, in vitro gaz üretimi, metabolik enerji (ME) içeriği, organik madde sindirim derecesi (OMSD) üzerine önemli etkisinin olduğu saptanmıştır. Egzotik ağaç yaprakların protein içeriği %14.16 ile arasında değişmiştir. Top akasya (Robinia pseudoecacia umbraculifera) yaprağının protein içeriği ise diğer ağaçların yapraklarının protein içeriğinden daha yüksek bulunmuştur. Egzotik ağaç yapraklarının NDF ve ADF içerikleri sırasıyla %30.42 ile ve ile arasında değişmiştir. Gladiçya ağaç yaprağının NDF içeriği diğer ağaç yapraklarının NDF içeriğinden daha yüksek saptanmıştır. Gülibrişim (Albizia julibrissin) ağaç yaprağının gaz üretim hızı, gladiçya (Gladitsia triacanthos) ve top akasya (Robinia pseudoecacia umbraculifera) ağacı yaprağından önemli derecede daha yüksek bulunmasına rağmen, potansiyel gaz üretim miktarı yalnızca gladiçya ve adi akasya yaprağından daha yüksek bulunmuştur. Metabolik enerji (ME) ve organik madde sindirim derecesi (OMS) sırasıyla 9.49 ile MJ/kg KM ve %64.42 ile 70.3 arasında değişmiştir (P<0.001). Sonuç olarak, ağaç yapraklarının potansiyel besleme değeri üzerine ağaç türünün önemli etkisi olmuştur. Bununla birlikte, bu çalışmada yer alan ağaç yaprakları ruminant hayvanların beslenmesinde kullanılabilecek etkin bir protein kaynağı olabilir. Kritik zamanlarda düşük protein içerikli rasyonların protein açığını kapatmada kullanılabilir. Bununla birlikte, kondense tanenin olumsuz etkisini azaltmak için top akasya, gladiçya ve yalancı akasya (Robinia psedoecacia) yaprakları polietilen glikol veya alkali ile muamele edilerek verilmelidir. Egzotik ağaç yapraklarının kondense tanen içerikleri %1.70 ile arasında değişmiştir. Anahtar sözcükler: Egzotik ağaçlar, Kimyasal kompozisyon, Metabolik enerji, Organik madde sindirim derecesi, Kondense tanen İletişim (Correspondence) canbolat@uludag.edu.tr

74 420 Determination of Potential... INTRODUCTION It was well established that tree leaves are important components of diets for goats, cattle, deer, game and sheep 1,2 and have an important role in nutrition of herbivores in areas where few or no alternatives are available 3,4. Some legume trees such Robinia pseudoecacia umbraculifera; Gladitsia triacanthos, Albizia julibrissin and Robinia psedoecacia were well adapted to the most parts of Turkey. Recently there has been increasing interest in using the leaves of these exotic trees during dry seasons when there is a feed shortage. It was reported that tree legumes with their high crude protein contents DM have potential as CP supplements in ruminant rations. However condensed tannin content in tree leaves is the primary factors affecting the utilization of CP in leaves in ruminant diets when fed at high levels, due to their adverse effects on feed digestibility and nutrient availability 5. Condensed tannin in leaves can form complexes with proteins and carbohydrates and reduce the ruminant availability 6. Condensed tannin may also results in decrease the proteolysis and ammonia production in the rumen. As a result of this the microbial activity may be decreased 7,8. Chemical compositions, in combination with in vitro gas production, OMD and ME content were widely used to determine potential nutritive values of forages Although the most of the native trees and shrubs were evaluated in terms of chemical composition, in vitro and in situ technique there is limited information on the chemical composition and nutritive value of exotic tree leaves in Turkey. Therefore the aim of the current study was to determine potential nutritive value of the introduced tree leaves by chemical composition and in vitro gas production. MATERIAL and METHODS Tree Leaves Leaves from Robinia pseudoecacia umbraculifera, Gladitsia triacanthos, Albiza julibrissin and Robinia psedoecacia were hand harvested from at least 10 different trees in dry season (July, 2010) in the vicinity of city, Bursa, in the west of Turkey. The harvested leaves pooled and oven dried at 60 o C. Chemical Analysis Dry matter (DM) was determined by drying the samples at 105 o C overnight while total ash was determined by igniting the samples in muffle furnace at 525 o C for 8 h. Nitrogen (N) content was measured by the Kjeldahl method 16. Crude protein of tree leaves was calculated as N x Cell wall contents (NDF and ADF) of tree leaves were determined using the method described by Van Soest et al. 17. Condensed tannin of tree leaves was determined by butanol-hcl method as described by Makkar et al. 18. All chemical analyses were carried out in triplicate. In vitro Gas Production Grounded tree leave samples (0.2 g DM) were incubated in vitro with diluted rumen fluid (10 ml rumen fluid + 20 ml culture medium) in calibrated glass syringes of 100 ml following the procedures of Menke and Steingass 19. All incubations were carried out in triplicate. Rumen fluid was obtained using stomach tube from two lactating and pregnant cows fed a daily ration containing 20 kg maize silage and 10 kg concentrates (%18 CP and 2750 kcal ME/kg) The cows had free access to water throughout the experiment. Rumen samples were collected before the morning feeding in the thermos flaks and taken immediately to the laboratory where it was strained through 4 layers of cheesecloth and kept at 39 o C. Gas production was determined at 3, 6, 12, 24, 48, 72 and 96 h after incubation. Total gas production was corrected for blank gas production. Cumulative gas production data were fitted to non-linear exponential model as: Y = A (1 exp ct ) Where Y is gas production at time t, A is the potential gas production (ml/200 mg DM), c is the gas production rate constant (h 1 ) and t is the incubation time (h). ME (MJ/kg DM) content of tree leaves was calculated using equation of Menke et al. 20 as follows: ME (MJ/kg DM) = GP CP where GP = 24 h net gas production (ml/200 mg); CP = Crude protein Organic matter digestibility (%) of tree leaves was calculated using equation of Menke et al. 20 as follows: OMD (%) = GP CP XA where XA: ash content (%) One-way analysis of variance (ANOVA) was used to determine the effect of plant species on chemical composition, gas production kinetics, and some estimated parameters such as ME and OMD of introduced tree leaves. Significance between individual means was identified using the Tukey s multiple range tests. Mean differences were considered significant at (P<0.05). A simple correlation analysis was used to establish the relationship between chemical composition and in vitro gas production kinetics or estimated parameters 21. RESULTS The effect of plant species on the chemical composition

75 421 CANBOLAT of leaves is given in Table 1. The effect of species on in vitro gas production of leaves is given in Fig. 1. The effect of plant species on in vitro gas production kinetics, ME and OMD is given in Table 2 and correlation coefficients of chemical composition and in vitro gas production kinetics or estimated parameters are given in Table 3. Table 1. Chemical composition of some introduced tree leaves in Turkey Tablo 1. Türkiye de yetişen bazı ağaç yapraklarının kimyasal bileşimleri, % Chemical Composition Tree Leaves R. pseudoecacia umbraculifera Gladitsia triacanthos Albiza julibrissin Robinia pseudoecacia SEM P DM NS Ash d b c a 0.08 *** CP a d b c 0.20 *** NDF c a b d 0.30 *** ADF c a b c 0.38 *** CT b ab 4.13 c a 1.70 *** a,b,c Row means with common superscripts do not differ (P>0.05); s.e.m: standard error mean, Sig.: significance level, DM: Dry matter %, CP: Crude protein, NDF: Neutral detergent fiber, ADF: Acid detergent fiber, CT: Condensed tannin, NS: Non-significant, *** P<0.001 Table 2. In vitro gas production kinetics, metabolisable energy and organic matter digestibility of some introduced tree leaves in Turkey Tablo 2. Türkiye de yetişen bazı ağaç yapraklarının in vitro gaz üretimi kinetikleri, metabolik enerji ve organik madde sindirimi Parameter Tree Leaves R. pseudoecacia umbraculifera Gladitsia triacanthos Albiza julibrissin Robinia pseudoecacia c c b a ab *** A ab b a b *** ME a 9.49 b a 9.63 b *** OMD a b a b *** a,b,c Row means with common superscripts do not differ (P>0.05); s.e.m.: standard error mean; Sig.: significance level;, c: gas production rate (%), A: potential gas production (ml), ME: Metabolisable energy (MJ /Kg DM), OMD: Organic matter digestibility %, *** P<0.001 SEM Sig Table 3. Correlation coefficient of chemical composition and in vitro gas production kinetics or estimated parameters. Tablo 3. İn vitro gaz üretim kinetikleri ile kimyasal kompozisyonlar arasındaki korelasyonlar Parameter c A OMD ME 50 CP NS NS 0.672** 0.626** NDF NS NS NS NS Gas production (ml) Robina pseudoecacia umbraculifera Gladitsia triacanthos Albiza julibrissin ADF NS NS NS NS CT NS *** *** *** CP: Crude protein, NDF: Neutral detergent fiber, ADF: Acid detergent fiber, CT: Condensed tannin, c: gas production rate (%); A: potential gas production (ml), ME: Metabolisable energy (MJ /Kg DM, OMD: Organic matter digestibility %, NS: Non-significant, ** P<0.01,*** P< Robinia pseudoecacia DISCUSSION 10 Chemical Composition Incubation time (hour) Fig 1. In vitro gas production of some introduced tree leaves in Turkey Şekil 1. Türkiye de yetişen bazı ağaç yapraklarının in vitro gaz üretimleri The effect of species on chemical composition of leaves is given in Table 1. Except for dry matter content, the species had a significant (P<0.001) effect on chemical composition. The crude protein content ranged from to 21.92%. The crude protein content of leaves from Robinia poseudoecacia umbraculifera was significantly (P<0.001) higher than those

76 422 Determination of Potential... of other legume trees. Rubanza et al. 22 suggested that differences in crude protein content between different tree species could be mainly to variations in factors controlling protein accumulation in forages during growth process. Although the crude protein content of Robinia poseudoecacia was comparable with those reported by Chen et al. 23, was considerable lower than the value reported by Rakesh et al. 24 and Burner et al. 25. On the other hand the crude protein content of Albizia julibrissin was similar to the content reported by Burner et al. 25. Although CP and ADF contents of Gladitsia triacanthos were comparable with those reported by Buergler et al. 25 NDF content was considerably lower than that reported by Buergler et al. 26. These differences between various different studies in nutrient composition was possibly due to differences in harvesting time and climatic condition of tree species. Buergler et al. 26 showed that chemical compositions were significantly influenced by harvesting time, species and tree density. The NDF and ADF content of legume trees ranged from to and from to 28.06%, respectively. NDF content of leaves from Gladitsia triacanthos was significantly higher than those of other legume trees. The tree leaves studied in the current study can be considered as good quality roughage sources since fibrous feeds with NDF content of less than 45% of DM were classified as high quality roughage feeds 27. The NDF and ADF contents of Robinia poseudoecacia were considerably higher than that reported by Chen et al. 23 whereas NDF and ADF content of Robinia poseudoecacia were considerably lower than those reported by Rakesh et al. 24. CT content of introduced tree leaves ranged from 4.13 to 18.35% of dry matter. CT content of Albiza julibrissin was significantly lower than those of other introduced tree leaves. Van Soest 28 indicated that crude protein content of browse species should be higher than the minimum level of 7-8% of DM for optimum rumen function and feed intake in ruminant animals. In the current study, the all legume species provided the leaves with crude protein which is higher than that minimum level of 7-8% of DM. Therefore these tree leaves from different legume species may form potential feed resources mainly as protein supplements to ruminant animals and may correct the deficient nitrogen in basal roughages with low protein during critical period of year when feed shortage occurred. However the efficiency of protein utilization in tree leaves is dependent on the soluble phenolic compounds such as tannins and insoluble proanthocyanidins 29. High level of CT (more than 5% of DM) limited the nutrients utilization in ration through chemical formations. Tannin also inhibits the microbial activity and enzymes However in ruminants, dietary condensed tannins (2-3% of DM) were shown to have beneficial effects because they reduce the protein degradation in the rumen by formation of a protein-tannin complex 36. Albiza julibrissin had lower CT contents than 5% of DM. Therefore optimal utilization of CP in leaves obtained from Albiza julibrissin could not be restricted by CT. On the other hand CT contents of other introduced tree leaves were higher than 5% of DM. Therefore optimal utilization of CP in leaves obtained from other introduced tree leaves may be hampered by CT. Therefore leaves obtained from Robinia pseudoecacia umbraculifera, Gladitsia triacanthos, and Robinia psedoecacia should be supplemented with polyethylene glycol (PEG) or treated with alkali to reduce the detrimental effect of condensed tannin. In vitro Gas Production and Estimated Parameters The effect of plant species on Egzotik ağaç yapraklarının in vitro gas production of leaves is given in Fig. 1. The effect of plant species on in vitro gas production kinetics, ME and OMD of leaves of the introduced legume trees is given in Table 2. The species had a significant (P<0.001) effect on in vitro gas production kinetics, ME and OMD. Although the gas production rate of leaves Albiza julibrissin was significantly higher than those of Gladitsia triacanthos and Robinia poseudoecacia umbraculifera. The potential gas production of Albiza julibrissin was significantly higher than those for Gladitsia triacanthos and Robinia poseudoecacia. The plant species had also significant (P<0.001) effect on the ME and OMD contents. The ME and OMD contents of introduced tree leaves ranged from 9.49 to MJ/kg DM and to 70.3% respectively. Although the OMD of Albiza julibrissin was comparable with that reported by Burner et al. 25, the OMD of Robinia poseudoecacia was considerably lower than that reported by Burner et al. 25. The correlation coefficient of chemical composition and in vitro gas production kinetics or estimated parameters is given in Table 3. Although the CP content was positively correlated with OMD and ME content of tree leaves, CT content is negatively correlated with potential gas production, OMD and ME content of leaves. These results are consistent with finding of Kamalak 37 who suggested that the increase in CT content decreased the ME and OMD contents of leaves from Glycyrrhiza glabra. The species had a significant effect on potential nutritive value of introduced legume tree leaves. The tree leaves studied in the current study would be effective protein supplements for ruminant animals and may correct the deficient nitrogen in basal roughages with low protein during critical period of year when feed shortage occurred. However leaves obtained from Robinia pseudoecacia umbraculifera, Gladitsia triacanthos, and Robinia psedoecacia should be supplemented with polyethylene glycol (PEG) or treated with alkali to reduce the detrimental effect of condensed tannin.

77 423 CANBOLAT REFERENCES 1. Holechek JL: Comparative contribution of grasses, forbs, and shrubs to the nutrition range ungulates. Rangelands, 6, , Papachristou TG, Nastis AS: Influence of deciduous broadleaved woody species in goat nutrition during the dry season in Northern Greece. Small Rum Res, 20, 15-22, Meuret M, Boza J, Narjisse N, Nastis A: Evaluation and utilization of rangeland feeds by goats. In, Morand-Fehr P (Ed): Goat Nutrition. pp , PUDOC. Wageningen, The Netherlands, Temel S, Tan M: Akdeniz bölgesi makiliklerdeki çalı türlerinin rakım ve yöneye bağlı olarak yaprak verimleri ve oranlarının belirlenmesi. Kafkas Univ Vet Fak Derg, 17 (2): , Rubanza CDK, Shem MN, Otsyina R, Bakengesa SS, Ichinohe T, Fujihara T: Polyphenolics and tannins effects on in vitro digestibility of selected Acacia species leaves. Anim Feed Sci and Tech, 119, , Butter NL, Dawson JM, Buttery PJ: Effects of dietary tannins on ruminants. In, Caygill JC, Mueller-Harvey I (Eds): Secondary Plant Products. Antinutritional and Beneficial Actions in Animal Feeding. pp , Nottingham University Press, UK, Bae HD, McAllister TA, Yanke J, Cheng KJ, Muir AD: Effect of condensed tannins on endoglucanase activity and filter paper digestion by Fibrobacyer succinogens S85. App Environ Microbiol, 59, , McAllister TA, Bae HD, Jones GA, Cheng KJ: Microbial attachment and feed digestion in the rumen. J Anim Sci, 72, , Kamalak A, Canbolat O, Gurbuz Y, Erol A, Ozay O: Effect of maturity stage on chemical composition, in vitro and in situ dry matter degradation of tumbleweed hay (Gundelia tournetortii L.) Small Rum Res, 58, , Kamalak A, Canbolat O, Gurbuz Y, Ozkan CO, Kiz ilsimsek M: Determination of nutritive value of wild mustard, Sinapsis arvensis harvested at different matu rity stages using in situ and in vitro measurements. Asian Australas J Anim Sci, 18 (9): , Kamalak A: Determination of potential nutritive value of Polygonum aviculare hay harvested at three maturity stages. J Appl Anim Sci, 38, 69-71, Kamalak A, Canbolat O: Determination of nutritive value of wild narrow-leaved clover (Trifolium angustifolium) hay harvested at three maturity stages using chemical composition and in vitro gas production. Trop Grassland, 44, , Kamalak A, Canbolat O, Ozay O, Aktas S: Nutritive value of oak (Quercus spp.) leaves. Small Rum Res, 53, , Kamalak A, Canbolat O, Gurbuz Y, Ozay O, Ozköse E: Chemical composition and its relationship to in vitro gas production of several tannin containing trees and shrub leaves. Asian Australas J Anim Sci, 18 (2): Kamalak A, Canbolat O, Atalay AI, Kaplan M: Determination of potential nutritive value of young, old and senescent leaves of Arbutus andrachne tree. J Appl Anim Sci, 37 (2): , AOAC: Official Method of Analysis. 15 th ed., pp , Association of Official Analytical Chemist, Washington, DC, USA, Van Soest PJ, Robertson JD, Lewis BA: Methods for dietary fibre, and neutral detergent fibre and non-starch polysaccharides in relation to animals nutrition. J Dairy Sci, 74, , Makkar HPS, Blummel M, Becker K: Formation of complexes between polyvinyl pyrrolidones or polyethylene glycols and their implication in gas production and true digestibility in vitro techniques. Brit J Nut, 73, , Menke HH, Steingass H: Estimation of the energetic feed value obtained from chemical analysis and in vitro gas production using rumen fluid. Anim Res Dev, 28, 7-55, Menke KH, Raab L, Salewski A, Steingass H, Fritz D, Schneider W: The estimation of the digestibility and metabolizable energy content of ruminant feedingstuffs from the gas production when they are incubated with rumen liquor in vitro. J Agric Sci Camb, 93, , Mendeş M, Akkartal E: Comparison of ANOVA F and WELCH Tests with their respective permutation versions in terms of Type I error rates and test power. Kafkas Univ Vet Fak Derg, 16 (5): , Rubanza CDK, Shem MN, Otsyina R, Ichinohe T, Fujihara T: Nutritive evaluation of some browse tree legume foliages native to semi-arid areas in Western Tanzania. Asian Australas J Anim Sci, 16 (10): , Chen Y, Zhao Y, Fu Z, Ma ZW, Qian FC, Aibibuli A, Yang B, Abula R, Xu XL, Aniwaer A: Chemical composition and in vitro ruminal fermentation characteristics of tetraploid black locust (Robinia pseudoacacia L.). Asian J Anim Vet Adv, 6, , Rakesh DD, Bahat TK, Sing B: Effect of funfal treatment on composition, tannin levels and digestibility of black locust (Robinia pseudoacacia) leaves. J Gen Appl Microbiol, 46, , Burner DM, Carrier D, Belesky DP, Pote DH, Ares A, Clausen EC: Yield components and nutritive value of Robinia pseudoacacia and Albizia julibrissin in Arkansas, USA. Agroforestry System, 72, 51-62, Buergler AL, Fike JH, Burger JA, Feldhake CM, McKenna JR, Teutsch CD: Forage nutritive value in an emulated silvipasture. Agronomy J, 98, , Singh GP, Oosting SJ: A model for describing the energy value of straws. Indian Dairyman XLIV, 44, , Van Soest PJ: Nutritional Ecology of Ruminants. 2nd ed., Cornell University Press. Ithaca, New York. USA Woodward A, Reeds JD: Nitrogen metabolism of sheep and goats consuming Acacia brevispica and Sesbania sesban. J Anim Sci, 75, , Singleton VL: Naturally occurring food toxicants: Phenolic substances of plant origin common in foods. Adv Food Res, 27, , Lohan OP, Lall D, Vaid J, Negi SS: Utilization of oak tree fodder in cattle ration and fate of oak leaf tannins in the ruminant system. Ind J Anim Sci, 53, , Barry TN, Duncan SJ: The role of condensed tannins in the nutritional value of Lotus pedunculatus for sheep. I. Voluntary intake. British J Nutr, 65, , Makkar HPS, Singh B, Negi SS: Relationship of rumen degradability with microbial colonization, cell wall constituents and tannin levels in some tree leaves. Anim Prod, 49, , Silanikove N, Nitsan Z, Perevolotsky Z: Effect of polyethylene glycol supplementation on intake and digestion of tannin containing leaves (Ceratonia siliqua) by sheep. J Agric Food Chem, 42, , Silanikove N, Gilboa N, Nir I, Perevolotsky Z, Nitsan Z: Effect of a daily supplementation of polyethylene glycol on intake and digestion of tannin-containing leaves (Quercus calliprinos, Pistica lentiscus, Ceratonia siliqua) by goats. J Agric Food Chem, 44, , Barry TN: Secondary compounds of foragesi. In, Hacker JB, Ternouth JH (Eds): The Nutrition of Herbivores. pp , Academic Press, Sydney, Kamalak A: Determination of nutritive value of leaves of a native grown shrub Glycyrrhiza glabra L. using in vitro and in situ measurement. Small Rum Res, 64, , 2006.

78 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Effects of Mass Selection Based on Phenotype and Early Feed Restriction on the Performance and Carcass Characteristics in Japanese Quails [1] Summary This study included Japanese quail flock subjected to mass selection for four generations to increase live-weight and a control flock that randomly mated for four generations. The effects of selection and early feed restriction on live-weight, feed consumption, feed conversion and carcass traits were investigated. In terms of live-weight, higher mean values were observed for quail flock subjected to selection in all weeks. It was detected that feed restriction has no effect on weekly live-weight and feed consumption. In addition, restrictedly fed quails more effectively benefitted from feeds in the 3rd and 4th weeks. Carcass, edible inner organ, and abdominal fat weight of quails subjected to selection were found as , 8.94, and 1.17 g, respectively. The same traits were determined for quails in control group as , 7.89, and 1.08 g, respectively. It was concluded that feed restriction by producers for species like quails of which the sexual maturity age and cutting age were close to each other would not yield any economic gain, and short-term mass selection could increase carcass weight by around 20%. Keywords: Japanese quail, Mass selection, Feed restriction, Carcass characteristics Japon Bıldırcınlarında Kitle Seleksiyonunun ve Erken Dönem Yem Kısıtlamasının Performans ve Karkas Özelliklerine Etkileri Özet Doğan NARİNÇ * Tülin AKSOY * [1] The research with the project number of was supported by the Akdeniz University Scientific Research Projects Management * Akdeniz Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR Antalya - TÜRKİYE Makale Kodu (Article Code): KVFD Bu çalışmada, 4 kuşak canlı ağırlığı arttırma amacıyla kitle seleksiyonu uygulanmış bir Japon bıldırcını sürüsü ile 4 kuşak rastgele çiftleşmiş bir kontrol sürüsü kullanılmıştır. Sürülerde seleksiyonun ve erken dönemde uygulanan yem sınırlamasının canlı ağırlık, yem tüketimi, yemden yararlanma ve karkas özelliklerine etkileri araştırılmıştır. Canlı ağırlık bakımından tüm haftalarda seleksiyon uygulanmış bıldırcınlar için daha yüksek ortalamalar tespit edilmiştir. Yem kısıtlama uygulamasının haftalık canlı ağırlık ve yem tüketimi üzerine herhangi bir etkisi bulunmamıştır. Bunun yanında kısıtlı yemlenen bıldırcınlar 3. ve 4. haftalarda yemden daha etkin yararlanmıştır. Karkas, yenilebilir iç organ, abdominal yağ ağırlıkları seleksiyon yapılmış bıldırcınlarda sırasıyla , 8.94, 1.17 g olarak tespit edilmiştir. Aynı özellikler kontrol grubu bıldırcınlarda sırasıyla , 7.89, 1.08 g olarak bulunmuştur. Bıldırcın gibi eşeysel olgunluk yaşı ile kesim yaşı birbirine çok yakın olan bir türde yem kısıtlamasının üreticiler tarafından uygulanmasının herhangi bir ekonomik getiri sağlamayacağı, bunun yanında 4 kuşaklık kısa dönemli kitle seleksiyonunun karkas ağırlığını yaklaşık %20 arttırılabileceği ortaya konulmuştur. Anahtar sözcükler: Japon bıldırcını, Kitle seleksiyonu, Yem kısıtlaması, Karkas özellikleri INTRODUCTION Some of the studies on Japanese quails aimed to obtain information that might be utilized in production in terms of the improvement of the characteristics with economic significance, whereas some of them aimed to elucidate the basic issues that will also apply to other domestic poultry. Considering the stimulation of various sources of production to meet the need of societies for animal food, quail production has been seriously considered in the recent İletişim (Correspondence) zootekni@akdeniz.edu.tr

79 426 Effects of Mass Selection... years. In Japanese quails, environmental requirements are few and production costs are rather low. The quails with quite good meat and egg yields are generally reared for egg yield in the Far Eastern and Asian countries and primarily for meat production in Europe and the U.S.A. 1. In some countries like Turkey, Japanese quails are reared for meat production generally at family type small-scale enterprises in villages. At these enterprises, quails are not priced according to their weights but per piece and then offered to the market 2. Thus, without grown much, quails are slaughtered at young ages like at 4-5 weeks of age and sold. Unlike this case, consumers do not prefer quails with a low carcass weight and wish to purchase heavier quails. Due to competition, some enterprises slaughter the quails at older ages; however, this causes an increase in feed consumption. Consequently, producers experience loss because of pricing per piece. It is possible to obtain good results in a short period of time through appropriate breeding strategies to increase carcass weight and to improve carcass quality. In a study carried out in the Antalya province of Turkey, it was determined that no breeding activities were performed in the breeder flocks the villagers used in production and that these flocks consisted of randombred animals 2. However, it is rather difficult to keep pedigree records, to estimate genetic parameters and to apply selection by obtaining breeding values with modern methods, such as BLUP or selection index, in the breeder flocks belonging to the small-scale enterprises in villages and consisting of few quails. Instead, the producers in rural areas are recommended to apply mass selection through the use of phenotypic values as the breeding values. The breeding values obtained using phenotypic values particularly for the characteristics with a high degree of heritability, such as body weight and carcass weight, are found quite close to the values obtained with the BLUP method 3. To reduce the problems, such as bone deformation, articular fracture, ligament rupture, sudden death syndrome and excessive fat deposition, that take place as a result of the genetic improvement studies applied in the poultry for the body weight and slaughter characteristics, feed restriction aiming to control development is applied 4-6. Besides, in some studies it was reported that when feed restriction was applied, compensatory growth was observed and as a result of this, improvement was observed in some characteristics, such as feed efficiency and carcass yield 4. Even though there are numerous studies where the effect of feed restriction on the performances of broilers and turkeys is investigated, the number of studies on quails is rather small. A quail flock treated with mass selection to increase body weight for 4 generations and a control flock randombred for 4 generations were used in this study. The effects of selection and feed restriction applied in the early period on the body weight, feed consumption, feed efficiency and carcass characteristics were investigated in the flocks concerned. Therefore, it was aimed to make recommendations to the family enterprises producing quails under village conditions. MATERIAL and METHODS An experiment was carried out in a curtained quail coop located at the Research and Application Unit in Department of Animal Science, Faculty of Agriculture, Akdeniz University. The management and handling of the birds were performed according to the practices as required by the Akdeniz University and by the European Convention for the Protection of Animals Kept for Farming Purposes. In the study, the 4 th week body weight was used as the selection criterion, and a selection flock (S line) selected for 4 generations as well as a control flock (C line) randombred for 4 generations were used. In the selection flock, phenotypic values were used for the breeding values and 30% of the females with the highest value and 10% of the males with the highest value in each generation were selected as the parents of the next generation. Some 60 chicks from each of the S and C lines in mixed sexes were randomly selected from the incubator; wing numbers were attached; and they were placed in the growing cages. Illumination based on the natural day length was applied in the experimental unit for compliance with the producers conditions (14 h light, 10 h dark), and the ambient temperature and the humidity were measured as 26 C and 60%, respectively. The cages used in the experiment contained a stocking area of 160 cm 2, a nipple drinker and a feeder per quail. The birds were fed a diet containing 240 g of CP and 12.1 MJ ME/kg feed ad libitum. For the application of feed restriction, some 30 quails from each of both flocks were unfed for 5 hours between 8 a.m. and 1 p.m. only on the 9 th, 10 th, 11 th, 12 th and 13 th days. The other 60 quails were fed ad libitum throughout the whole experiment and the groups treated with feed restriction were fed ad libitum except for the above-mentioned days. During the experiment, the individual body weights were weighed weekly, whereas feed was weighed daily. At four weeks of age the all birds were sent to the slaughterhouse. After weighing each quail, they were killed by hand and their blood was drained, and procedures including wet plucking and evisceration were applied by hand. Subsequently, the weights of the hot carcasses, edible inner organs and abdominal fat, were determined. The data obtained from the experiment were analyzed by using PROC GLM of SAS software with analysis of variance (ANOVA). Following model was used for determination of the effect of treatment groups on studied traits.

80 427 NARİNÇ, AKSOY Y ijk =µ+l i +F j +( L*F) +e ij ijk : represents the studied traits Y ij L i F j : effect of i th line : effect of j th feeding L*F ij : interaction effect of i th line and j th feeding e ijk : error term Because feed restriction was applied in the 2 nd week, analyses were made by excluding the effect of feeding from the model above in the statistical analysis of the characteristics measured previously. Significant differences among the group means (C line-ad libitum, C line-restricted, S line-ad libitum, S line-restricted) were seperated using Duncan s multiple range test with a 1% probability. RESULTS The effects of selection-feed restriction on weekly body weight, feed intake, and feed conversion ratio of Japanese quail are summarized in Table 1. In terms of body weight, higher averages were detected in the S line in all weeks than in the C line (P<0.01). The body weight averages were found as 7.40, 23.44, 67.98, and g in the C line in the 1 st, 2 nd, 3 rd and 4 th weeks, respectively, while they were found as 9.22, 33.18, 83.73, and g in the S line, respectively. The application of feed restriction had no effect on the weekly body weight and feed consumption. The selected quails consumed more feed than the C line in all weeks other than the week, when feed restriction was applied (P<0.01). Also when the total feed consumption was examined, it was determined that the S line had a higher average than the C line (P<0.01). The feed efficiency rates of quails were calculated as 1.73, 2.04, 2.49 and 3.47 in the S line in the 1 st, 2 nd, 3 rd and 4 th weeks, respectively, whereas they were computed as 2.12, 2.34, 2.61 and 3.66 in the C line, respectively. It was determined that in terms of both weekly and cumulative feed efficiency rates, the selected quails benefited from feed more efficiently (P<0.01). Those quails which were fed ad libitum in the 3 rd and 4 th weeks following feed restriction had feed conversion ratios of 2.62 and 3.64, whereas the feed conversion ratios were calculated as 2.48 and 3.49 in the quails treated with feed restriction. This difference was found statistically significant (P<0.01). However, restricted feeding had no effect in terms of cumulative feed efficiency. The carcass, edible internal organ and abdominal fat weights of the quails and their values proportioned to body weight are presented in Table 2. The effect of interaction between the selection and feeding variables was found significant for none of the characteristics. The carcass, edible internal organ and abdominal fat weights were detected as , 8.94 and 1.17 g in the selected quails, respectively. Table 1. Means of weekly body weights, feed intakes and feed conversion ratios of groups Tablo 1. Grupların haftalık canlı ağırlık, yem tüketimi ve yem dönüşüm oranlarının ortalamaları Week C Line S Line Significance of Effects SEM Adl Fr Adl Fr Selection Feeding S*F Body Weight (g) H* 7.40 b 7.39 b 9.27 a 9.17 a b b a a b b a a b b a a NS NS b b a a NS NS Feed Intake (g) b b a a NS b b a a NS NS b b a a NS NS b b a a NS NS Feed Conversion Ratio a 2.08 a 1.78 b 1.67 b ab 2.41 a 1.98 b 2.09 b a 2.53 b 2.54 b 2.43 c NS a 3.60 b 3.56 b 3.38 c NS a 2.75 a 2.53 b 2.48 b NS NS * H = Hatching, C = Control, S = Selection, Adl = Ad-libitum, Fr = Feed restriction a-c = Means within the same row with different superscripts are significantly different (P<0.01)

81 428 Effects of Mass Selection... Table 2. Group means of the slaughter traits under consideration Tablo 2. Üzerinde durulan kesim özelliklerinin grup ortalamaları Trait C Line S Line Significance of Effects SEM Adl Fr Adl Fr Selection Feeding S*F Weighted (g) Carcass b b a a NS NS Edible inner organs 7.91 b 7.88 b 8.92 a 8.96 a NS NS Abdominal fat 1.10 b 1.06 b 1.18 a 1.17 a NS NS Proportioned (% body weight) Carcass NS NS NS Edible inner organs NS NS NS Abdominal fat NS NS NS * C = Control, S = Selection, Adl = Ad-libitum, Fr = Feed restriction a-b = Means within the same row with different superscripts are significantly different (P<0.01) On the other hand, the same characteristics were recorded as , 7.89 and 1.08 g in the C line, respectively. For each of the three characteristics, the differences among the averages of the S and C lines were found statistically significant (P<0.01). No statistically significant difference was found among the averages calculated in the S and C lines for the carcass, edible internal organ and abdominal fat rates. The application of feed restriction had no effect on either weight or proportional values of the carcass characteristics. DISCUSSION The weekly body weight averages detected in both C and S lines in the research are in agreement with the results of similar studies where short-term selection is applied 7-9. Due to the short-term mass selection, 25%, 42%, 23%, 20% and 18% increases occurred in terms of hatching, the 1 st, 2 nd, 3 rd and 4 th week body weights, respectively. The finding of differences in the hatching weight and in the ages of the first three weeks as a result of the selection applied for the fourth week body weight occurs due to the positive high genetic correlation among the weekly body weights 10. The 4 th week body weight averages, the selection criteria, were determined as g and g in the C and S lines. Oguz et al. 11, who applied selection for 5 generations according to the fourth week body weight, reported that a 19.5% increase occurred in the 4 th week body weight (control line: g and selection line: g). Reddish 12 and Aggrey 13 detected similar results in their selection studies. In addition, Marks 13, who applied selection for 51 generations in terms of the fourth week body weight, reported the body weight averages of the control and selection groups as g and g. These results reveal that the short-term mass selection carried out for the 4 th week body weight led to a significant increase in the body weight averages. In the study it was determined that the quails in the S line consumed more feed than the quails in the C line in all weeks other than the 2 nd week. It was found that also in terms of the cumulative feed consumption, the quails in the S line consumed 6% more feed. In many studies it was reported that the selected quails with a high body weight consumed more feed Positive effects of selection were also detected in terms of feed efficiency. Better results were found for the quails in the S line in all weeks and in terms of the cumulative feed efficiency as compared to those in the C line. In agreement with this research, in a study by Marks 15 the long-term selected quail line for the 4 th week body weight and the randombred control line were fed feed with different protein contents and it was reported that feed efficiencies for four weeks ranged from 2.34 to 2.41 in the selection line and from 2.72 to 2.91 in the control line. The effect of short-term mass selection for increasing the body weight on the carcass, edible internal organ and abdominal fat weights was found significant. These findings are in agreement with the reports by Caron et al. 17, Marks 18, Oguz and Turkmut 8 and Oguz 19. However, the effect of increasing the body weight with short-term selection on the proportional values of the characteristics concerned was found insignificant. Yolcu et al. 20 suggested that selection carried out to increase the body weight also caused an increase in the proportional values of the carcass and the carcass sections. Similar results were obtained in a study by Caron et al. 17 ; however, the researchers suggested that this resulted from the fact that the selection line found to have a high carcass yield had a low abdominal fat rate. No effect of feed restriction on the weekly body weight and feed consumption characteristics was detected in the research. Gebhard-Henrich and Marks 21, who applied 30% feed restriction in a long-term selected line and a randombred line, reported that feed restriction led to significant decreases in the body weight averages of the quails in both lines. Likewise, in their research, Kalpak and

82 429 NARİNÇ, AKSOY Sogut 22 reported that the 4 th week body weights of the quails treated with 20% and 30% feed restrictions were lower than those of the quails fed ad libitum. In the same research, it was stated that there was also a negative significant difference in terms of total feed consumption, but no difference was observed in terms of feed efficiency. In the long-term applications in which little feed is provided, a decrease in body weights is an expected situation. It is thought that the situation concerned does not have any economic contribution to the quails to be slaughtered at 4 weeks of age. In the research, feed restriction had a positive effect on feed efficiency only in the 3 rd and 4 th weeks at the end of the restriction time. This supports the opinion of Plavnik and Hurwitz 23. It is considered that the improvement in feed efficiency without any difference between body weight and feed consumption in the period concerned occurred with compensatory growth. Plavnik and Hurwitz 23, who applied feed restriction in broiler chicks, reported that the period of maintenance commenced following the feed restriction, which increased feed efficiency. Nevertheless, the effect of feed restriction on the quail groups in terms of cumulative feed efficiency was found insignificant in the study. It is rather difficult that the effects of feed restriction in the early period on the quails that reach sexual maturity in a short period of time as approximately 6 weeks be similar to those of the species, such as chicken or turkey, reaching sexual maturity in a longer period of time. Similar results were obtained in another study where a similar method to that of this study was applied 24. In the broilers unfed for 4 hours for 14 days in the early period, the effect of restriction on the weekly body weight, feed consumption, cumulative feed efficiency, carcass yield and abdominal fat characteristics was found insignificant 24. In commercial broiler and turkey production, feed restriction is an effective environmental method that has long been applied. Besides, selection is a genetic instrument that has been applied in modern poultry breeding for more than 100 years. In this study where both methods were applied in the Japanese quails, no significant effects of feed restriction were detected on the yield characteristics considered. Failure to detect the effects of the application of feed restriction on a species like quail, the sexual maturity age and the slaughter age of which are very close, is an expected situation. It is considered that its application by producers will not cause any economic contribution. However, mass selection is a method where phenotypic values are used as breeding values, which do not require complicated mathematical operations such as those in the BLUP and index methods, and which the producers can easily apply. With short-term mass selection, quail producers can perform selection for 4 generations in about a year. In the study it was determined that the carcass weight might be increased by 18.45% with the same method. It is considered that in countries where the carcasses are priced per piece, producers following such a way will improve the product quality, which will enhance customer satisfaction. REFERENCES 1. Minvielle F: The future of Japanese quail for research and production. World Poultry Sci J, 60, , Yapici N, Aksoy T, Narinc D: Looking at the quail production in Turkey: The case of Antalya. XII. European Symposium an the Quality of Eggs and Eggs Products, Verona, Italy, Proceeding Book, 1, 456, Morris AJ, Pollott GE: Comparison of selection based on phenotype, selection index and best linear unbiased prediction using data from a closed broiler line. Brit Poultry Sci, 38, , Altan O, Ozkan S, Yalcin S: Etlik piliçlerde gelişmenin geciktirilmesi: değişik sınırlı yemleme programlarının etlik piliç performansı ve karkas özelliklerine etkileri. Turk J Vet Anim Sci, 22, , Balog J, Anthony MB, Cooper MA, Kid DB, Huff GR, Huff WE, Rath NC: Ascites syndrome and related pothologies in feed restricted broilers raised in a hypobaric chamber. Poultry Sci, 79, , Lee KH, Leeson S: Performance of broilers feed limited quantities of feed or nutrients during seven to fourteen days of age. Poultry Sci, 80, , Antony NB, Nestor KE, Marks, HL: Short-term selection for four-week body weight in Japanese quail. Poultry Sci, 71, , Oguz İ, Turkmut L: Japon bıldırcınlarında (Coturnix coturnix japonica) canlı ağırlık için yapılan seleksiyonun bazı parametrelere etkisi. 2. Verim özellikleri ve genetik değişmeler. Turk J Vet Anim Sci, 23, , Balcioglu MS, Kizilkaya K, Yolcu HI, Karabag K: Analysis of growth characteristics in short-term divergently selected Japanese quail. S Afr J Anim Sci, 35, 83-89, Narinc D, Aksoy T, Karaman E: Genetic parameters of growth curve parameters and weekly body weights in Japanese quail (Coturnix coturnix japonica). J Anim Vet Adv, 9 (3): , Oguz I, Altan O, Kirkpinar F, Settar P: Body weights, carcase characteristics, organ weights, abdominal fat, and lipid content of liver and carcase in two lines of Japanese quail (Coturnix coturnix japonica), unselected and selected for four week body weight. Brit Poultry Sci, 37, , Reddish JM, Nestor KE, Lilburn MS: Effect of selection for growth on onset of sexual maturity in randombred and growth-selected lines of Japanese quail. Poultry Sci, 82, , Aggrey SE, Ankra-Badu BA, Marks HL: Effect of long-term divergent selection on growth characteristics in Japanese quail. Poultry Sci, 82, , Marks HL: Divergent selection for growth in Japanese quail under split and complete nutritional environments. 5. Feed intake and efficiency patterns following nineteen generations of selection. Poultry Sci, 70 (5): , Marks HL: Feed efficiency of selected and nonselected Japanese quail lines. Poultry Sci, 59 (1): 6-10, Darden JR, Marks HL: Divergent selection for growth in Japanese quail under split and complete nutritional environments. 2. Water and feed intake patterns and abdominal fat and carcass lipid characteristics. Poultry Sci, 67 (8): , Caron N, Minvielle F, Desmarais M, Poste LM: Mass selection for 45-day body weight in Japanese quail: Selection Response, carcass composition, cooking properties, and sensory characteristics. Poultry Sci, 69, , Marks HL: Carcass composition, feed intake and feed efficiency following long-term selection for four-week body weight in Japanese quail. Poultry Sci, 72 (6): , Oguz, I: The inheritance of carcass and meat quality of Japanese quail (Coturnix coturnix Japonica): A Review. J Anim Prod, 46, 34-38, 2005.

83 430 Effects of Mass Selection Yolcu HI, Balcıoglu MS, Karabag K, Sahin E: Japon bıldırcınlarında canlı ağırlık için yapılan iki yönlü seleksiyonun ve cinsiyetin karkas ve bazı organ ağırlıklarına etkileri. Akdeniz Üniv Ziraat Fak Dergisi, 19 (2): , Gebhardt-Henrich SG, Marks HL: Effects of feed restriction on growth and reproduction in randombred and selected lines of Japanese quail. Poultry Sci, 74 (2): , Kalpak O, Sogut B: Effect of feed restriction on growth performance of Japanese quail (Coturnix coturnix japonica). J Anim Vet Adv, 8, , Plavnik I, Hurwitz S: The performance of broiler chicks during and following a severe feed restriction at an early age. Poultry Sci, 64, , Onbasilar EE, Yalcin S, Torlak E, Ozdemir P: Effects of early feed restriction on live performance, carcass characteristics,meat and liver composition, some blood parameters, heterophillymphocyteratio, antibody production and tonic immobility duration. Trop Anim Health Pro, 41, , 2009.

84 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Excision Arthroplasty of the Hip Joint in Dogs: The Role of Age, Weight, Degenerative Joint Disease on the Outcome Hamidreza FATTAHIAN * Hamid MOHYEDDIN ** Alireza HOSEINZADEH *** Hesam AKBAREIN **** Roozbeh MORIDPOUR * * Department of Surgery, Faculty of Specialized Veterinary Sciences, Science and Research Branch, Islamic Azad University, Tehran - IRAN ** Department of Clinical Sciences, Faculty of Veterinary Medicine, Garmsar Branch, Islamic Azad University, Garmsar - IRAN *** Pardis Small Animal Private Clinic, Tehran - IRAN **** Department of Food Hygiene, Division of Epidemiology and Zoonoses, Faculty of Veterinary Medicine, University of Tehran, Tahran - IRAN Makale Kodu (Article Code): KVFD Summary The present clinical study was to evaluate the relationship between weight, degenerative joint disease (DJD) and age on the outcome in dogs underwent excision arthroplasty operation. 105 dogs have been referred to clinic with lameness on hindlimb. Dogs were younger than 1 year (50 dogs), 1 to 5 years (24) and older than 5 years (31). The rest of them were less than 10kg and the rest were heavier than 10kg. Lameness during walking was scored between zero to 5. Radiographic findings were showed that degenerative joint change, hip dysplasia and luxation. Excision arthroplasty of the hip joint was performed. Walking status was examined postoperatively. Intra-group data showed in dogs younger than 1 year, weight was not an effective factor, and association between DJD and the outcome was statistically significant in both weights. DJD had effective role in dogs more than 10kg in comparison to less than 10kg. The association between DJD and the outcome wasn t statistically significant in dogs 1 to 5 years in both weights. In elder dogs, weight wasn t a main factor, and association between DJD and outcome was statistically significant in both weights. In latter group, DJD had effective role on the outcome in dogs less than 10 kg in comparison with more than 10 kg. The authors suggest the weight is not as much effective as age among groups of study after Excision arthroplasty of the hip joint. Keywords: Excision arthroplasty, Degenerative Joint Disease, Age, Weight Köpeklerde Kalça Eklemi Eksizyonu Artroplastisi: Yaş, Ağırlık ve Dejeneratif Eklem Hastalığının Sonuç Üzerine Etkisi Özet Bu klinik çalışma, köpeklerde kalça eklemi eksizyonu artroplastisi geçiren hastalarda yaş, ağırlık ve dejeneratif eklem hastalığı (DEH) arasındaki ilişkinin sonuç üzerine etkisini değerlendirmektedir. Arka ayaklarında topallık şikayeti ile kliniğe sevk edilen 105 adet köpek kullanılmıştır. Köpeklerin yaş dağılımı, 1 yaşından genç (50 köpek), 1 ile 5 yaşlı (24) ve 5 yıldan yaşlı (31) şeklindeydi. Bunlardan geri kalanlar, 10 kg dan az ve diğer geri kalanı ise 10 kg dan daha ağır hayvanlardı. Yürüyüş sırasında topallığa sıfır ile 5 arasında skor verildi. Radyografik bulgular ile dejeneratif eklem değişikliği, kalça displazisi ve çıkık belirledi. Kalça ekleminin eksizyon artroplastisi yapıldı ve yürüme durumlarının takibi gerçekleştirildi. Grup içi veriler, 1 yaşından genç köpeklerde ağırlığın etkili bir faktör olmadığını ve DEH ile sonuç arasındaki ilişkinin her iki ağırlıkta istatistiksel olarak anlamlı olduğunu gösterdi. DEH in 10 kg dan daha az köpeklerde 10 kg dan daha fazla olanlara göre etkili bir role sahip olduğu görüldü. DEH ile sonuç arasındaki ilişkinin her iki ağırlıktaki 1-5 yaş arası köpeklerde istatistiksel olarak anlamlı olmadığı gözlemlendi. Daha yaşlı köpeklerde, ağırlığın başlıca faktör olmadığı ve DEH ile sonuç arasındaki ilişkinin ilişkinin her iki ağırlıkta da istatistiksel olarak anlamlı olduğu belirlendi. Sonraki grupta, DEH in 10 kg dan daha az köpeklerde 10 kg dan daha fazla olanlarla karşılaştırıldığında sonuç üzerine etkili bir role sahip olduğu gözlemlendi. Sonuç olarak, kalça ekleminin eksizyon artroplastisi sonrası yapılan çalışma gruplarında ağırlığın yaş kadar etkili bir faktör olmadığı düşünülmektedir. Anahtar sözcükler: Eksizyon artroplastisi, Dejeneratif eklem hastalığı, Yaş, Ağırlık İletişim (Correspondence) GSM hrfattahian@srbiau.ac.ir; hrfattahian@yahoo.com

85 432 Excision Arthroplasty of... INTRODUCTION Coxo-femoral joint diseases are caused by trauma and congenital disorders 1-3. Sub-luxation and luxation were induced by trauma and congenital disorders such as dysplasia 4,5. These conditions result in osteoarthrosis and the following changes such as the reduction of range of motion, pain, lameness, capsular hypertrophy, schiatic nerve injury, change in anatomic patellar position and osteoarthritis in distal and proximal joints 6. The clinical signs and lameness depend on velocity of trauma, ethiology, and the degree of arthritis, age, and weight 5. The anchor suture, toggle fixation, transarticular pin, dorsal capsulorraphy, transposition of the greater trochanter, triple pelvic osteotomy, femoral head and neck ostectomy (FHO) and total hip replacement (THR) are surgical options in managing acute trauma and chronic diseases of joint 2. Since the equipments and required prosthesis for total hip replacement are unavailable in majority of clinics and some countries and it is also an expensive technique (patient restriction for at least 8 weeks and the FHO, the latter procedure is suggested. In some studies, outcome of FHO in dogs over 10 kg is questionable. Many investigations showed that the influential factors in prognosis are history, age, post-operative care, weight, and co-existing disease 5,7,8. The majority of literature has shown that weight has the main role in prognosis following FHO among the other mentioned factors. For this reason, using FHO is limited for dogs under 10 kg and cats. Therefore, this clinical investigation was conducted to evaluate the role of age, weight, DJD and their comparison to each other in prognosis after excision arthroplasty. In present study, the findings have been based on subjective gait analysis at walk and variable evaluation of clinical finding was lameness. MATERIAL and METHODS One hundred and five, small and large breed clientowned dogs (Table 1) had been referred to small animal clinics with history of congenital, acute trauma, chronic changes of hip joint and signs as lameness, pain and impaired function on hindlimb (Tables 2, 3, 4). Dogs were less than 1 year (Group I, 50 dogs), between 1 to 5 years (Group II, 24 dogs) and more than 5 years (Group III, 31 dogs). Fifty-two dogs out of 105 were less than 10 kg/body weight and the rest over than 10 kg/bodyweight. Then lameness at walk was scored between zero (normal walk) to 5 (continuous non-weight bearing lameness). Hindlimbs and hip joint radiographs were taken ventrodorsally (hip joint), and laterally (hindlimb and hip joint) and craniocaudally (hindlimb). Degenerative joint changes (DJD), coxo-femoral luxation and different grade of hip dysplasia were seen radiographically. Surgical Treatment After physical restraint, dogs received dextrose-saline solution at (20 ml/kg/h) preoperative medication with atropine sulfate (0.03 mg/kg, SC) half an hour before anesthesia. Cefazoline (22 mg/kg, IV) was administrated as a prophylactic antibiotic before operation. Diazepam and ketamine hydrochloride combination (0.27 mg/kg and 5.5 mg/kg, IV) were administrated as an induction and propofol (7.5 mg/kg, IV) for maintenance of anesthesia. Table 1. The distribution of cases Table 1. Olguların dağılımı Lameness Score Weight Total Zero 1 2 ф 3 Ө 4 ג 5 Ų < 10kg > 10kg Total Walk normally Slight lameness ф Obvious weight-bearing lameness Ө Severe weight-bearing lameness ג Intermittent non-weight-bearing lameness Ų Continuous non- weight-bearing lameness Table 2. Evaluation at a walk for lameness scoring in dogs less than 1 year before operation Table 2. Bir yaşından genç köpeklerde operasyon öncesi yürüyüş üzerine topallık skorlarının değerlendirilmesi Bodyweight Joint Changes Lameness Scoring Zero 1 2 ф 3 Ө 4 ג 5 Ų Non-DJD (A.T.) < 10 kg DJD (C.D.) Non-DJD (A.T.) > 10 kg DJD (C.D.) Walk normally Slight lameness ф Obvious weight-bearing lameness Ө Severe weight-bearing lameness ג Intermittent non-weight-bearing lameness Ų Continuous non- weight-bearing lameness, AT, Acute trauma; CD, Chronic disease Total

86 433 FATTAHIAN, MOHYEDDIN, HOSEINZADEH AKBAREIN, MORIDPOUR The animals were positioned in lateral recumbency, and the leg is prepared from the lumbar to the tarsal joint. A craniolateral approach was made and hip was luxated, if the round ligament was intact, it was incised. For incising the round ligament, lateral traction was placed on the greater trochanter with bone-holding forceps and the femoral head was subluxated. This maneuver allowed the curved scissors to be placed into the joint to cut the round ligament. Then ostectomy was performed by externally rotating the limb to where the joint line of stifle is parallel to the operating table at the junction of the femoral neck and the femoral metaphysic. The accuracy of the bony cut line, a series three holes was predrilled along the line of osteotome and mallet to complete the cut. Once the femoral head and neck have been removed, irregularities of the cut surface of femoral neck were removed with rangeurs and electrical high speed hand-piece. In case the joint capsule existed, the suturing was done. The muscles, subcutaneous tissue and skin were closed using standard methods. Post-operative cares included antibiotic therapy with Cefazoline (22 mg/kg, q 12 h, IV) for three days, Tramadol as pain management for three days (2 mg/kg, q 12 h, IM), passive range of motion (10 min twice a day) to achieve maximum rehabilitation for two weeks. Patient s activity was restricted for four weeks. Subjective gait analysis was done while the patients at all gaits walk toward and away from examiner; also in the sides and at a stand position. Then the outcome (lameness scoring) was divided into six scoring of zero to 5 (Tables 5, 6, 7). The follow up was done at the end of the third month after the surgery. Statistical Analyses Data was analyzed using SPSS version 16.0 and Chi square test. Significant level was considered 0.05%. RESULTS All dogs tolerated femoral head and neck ostectomy (FHO) with no postoperative complications. The patients returned to normal or near-normal function utmost till the end of third months (Table 5, 6, 7). Data analyzed showed that in dogs less than I year, weight was not an effective factor, and association between traumatic DJD and prognosis was statistically significant in dogs less than 10 kg (X 2 =9.42, P=0.024) and over 10 kg (X 2 = 22.75, P<0.001) (Table 5), so dogs less than 10 kg showed less statistical correlation with DJD and outcome in comparison to dogs over 10 kg. Therefore, DJD has a more effective role in prognosis in dogs more than 10 kg in comparison to the ones less than 10 kg. The association between DJD and prognosis was not statistically significant in dogs 1 to 5 years either weighting less than 10 kg (X 2 =5.69, P>0.05) or more than 10 kg (X 2 =3.18, P>0.05) (Table 6). In elder dogs (older than 5 years), weight was not a main factor, and association between DJD and prognosis was statistically significant in dogs less than 10 kg (X 2 =13, P=0.004) and more than 10 kg (X 2 =10, P=0.019), so dogs less than 10 kg showed more statistical correlation with DJD and outcome in comparison to dogs over 10 kg. Table 3. Evaluation at a walk for lameness scoring in dogs between 1 to 5 years before operation Table 3. Birden beş yaşa kadar olan köpeklerde operasyon öncesi yürüyüş üzerine topallık skorlarının değerlendirilmesi Lameness Scoring Bodyweight Joint Changes Zero 1 2 ф 3 Ө 4 ג 5 Ų Total < 10 kg Non-DJD (A.T.) DJD (C.D.) Non-DJD (A.T.) > 10 kg DJD (C.D.) Walk normally Slight lameness ф Obvious weight-bearing lameness Ө Severe weight-bearing lameness ג Intermittent non-weight-bearing lameness Ų Continuous non- weight-bearing lameness, AT, Acute trauma; CD, Chronic disease Table 4. Evaluation at a walk for lameness scoring in dogs more than 5 years before operation Table 4. Beş yaş üzeri olan köpeklerde operasyon öncesi yürüyüş üzerine topallık skorlarının değerlendirilmesi Lameness Scoring Bodyweight Joint Changes Zero 1 2 ф 3 Ө 4 ג 5 Ų Total Non-DJD (A.T.) < 10 kg DJD (C.D.) Non-DJD (A.T.) > 10 kg DJD (C.D.) Walk normally Slight lameness ф Obvious weight-bearing lameness Ө Severe weight-bearing lameness ג Intermittent non-weight-bearing lameness Ų Continuous non- weight-bearing lameness, AT, Acute trauma; CD, Chronic disease

87 434 Excision Arthroplasty of... Table 5. Evaluation at a walk for lameness scoring in dogs less than 1 year three months after FHO Table 5. Femur başı ve boynu ostektomisinden (FHO) üç ay sonra, bir yaştan genç köpeklerde yürüyüş üzerine topallık skorlarının değerlendirilmesi Lameness Scoring Bodyweight Joint Changes Total Zero 1 2 ф 3 Ө 4 ג 5 Ų SS < 10 kg Non-DJD (A.T.) DJD (C.D.) Non-DJD (A.T.) > 10 kg *** DJD (C.D.) Walk normally Slight lameness ф Obvious weight-bearing lameness Ө Severe weight-bearing lameness ג Intermittent non-weight-bearing lameness Ų Continuous non- weight-bearing lameness, AT, Acute trauma; CD, Chronic disease; FHO, Femoral head and neck ostectomy; Significantly different; * P <0.05; ** P <0.01; *** P <0.001; SS, Statistical significant * Table 6. Evaluation at a walk for lameness scoring in dogs between I to 5 years three months after FHO Table 6. FHO dan üç ay sonra, 1 5 yaş arası köpeklerde yürüyüş üzerine topallık skorlarının değerlendirilmesi Lameness Scoring Bodyweight Joint Changes Zero 1 2 ф 3 Ө 4 ג 5 Ų Total SS < 10 kg Non-DJD (A.T.) DJD (C.D.) Non-DJD (A.T.) > 10 kg NS DJD (C.D.) Walk normally Slight lameness ф Obvious weight-bearing lameness Ө Severe weight-bearing lameness ג Intermittent non- weight-bearing lameness Ų Continuous non- weight-bearing lameness, AT, Acute trauma; CD, Chronic disease; FHO, Femoral head and neck ostectomy; Significantly different; * P <0.05; ** P <0.01; *** P <0.001; SS, Statistical significant; NS, Non-significant NS Table 7. Evaluation at a walk for lameness scoring in dogs more than 5 year three months after FHO Table 7. FHO dan üç ay sonra, 5 yaş üzeri köpeklerde yürüyüş üzerine topallık skorlarının değerlendirilmesi Lameness Scoring Bodyweight Joint Changes Zero 1 2 ф 3 Ө 4 ג 5 Ų Total SS < 10 kg Non-DJD (A.T.) DJD (C.D.) *** Non-DJD (A.T.) > 10 kg * DJD (C.D.) Walk normally Slight lameness ф Obvious weight-bearing lameness Ө Severe weight-bearing lameness ג Intermittent non- weight-bearing lameness Ų Continuous non- weight-bearing lameness, AT, Acute trauma; CD, Chronic disease; FHO, Femoral head and neck ostectomy; Significantly different; * P <0.05; ** P <0.01; *** P <0.001; SS, Statistical significant DISCUSSION Coxo-femoral diseases (CFD) are very common in dogs and cats 5. The surgery was carried out for treatment of CFD 5. The common surgical procedure for CFDS treatment is femoral head and neck resection 5,9. Excision athroplasty of coxo-femoral joint be the appropriate, simple and inexpensive technique with the omission of bone-bone contact in patients with hip dysplasia, DJD, morbondlegg-calve-perthes disease, fracture of head and neck of femur or acetabulum, coxo-femoral luxation and failed total hip replacement procedures 1, Some factors such as weight, history, age and post-operative care could affect the outcome of excision arthroplasty. In present study, it has been evaluated the role of each factor and their relationship with each other intra group and among groups. We have found that DJD had correlation with outcome, but weight had no correlation with the outcome of group I (Table 5). Latter finding was in agreement with the results of Off and Matis 15. Therefore in group I, arthritis (pre-operative lameness and its duration due to DJD had correlation with the results of Off and Matis 15. In group II, weight and DJD had no effect on the outcome. In fact, in these dogs, the outcome was favorable (Table 6). There are few data about the role of the latter factor in prognosis in veterinary literature, hence authors of the study presume that volume mass, strength of muscle, body condition, anisotropic characteristic of bone

88 435 FATTAHIAN, MOHYEDDIN, HOSEINZADEH AKBAREIN, MORIDPOUR and supportive structure peripheral of joint, and maturity are the probable reasons of better outcome similar to human literature in young and aged patients in comparison with group II. Investigators reported that the patient with muscle atrophy was slower to return to function than the patients with acute lameness that supports our recent findings. In the other hand, age had an effective role on group II. This finding was not in agreement with the results of other investigation. The outcome was reported favorable (96%) by subjective owner s evaluation such as duration of preoperative signs, postoperative convalescence, weight bearing on the affected limb at slow and fast and strenuous exercise during cold or wet weather, and finally subjective assessment of the patient. These findings were not supported by results of objective clinical data. Off and Matis reported that the outcome of FHO was favorable and age and weight had no determinant role 15. In group III (elder dogs), our findings showed that body weight had no correlation with the outcome but DJD had correlation with outcome (Table 7). There is little difference between group I and group III statistically, so we found less statistical correlation between the body weight and the outcome in dogs less than 10kg in group I (Table 5) in comparison to the ones over 10 kg in the same group (Table 5) and vice versa of group III. In group III, it is presumed that hyperactivity of toy breeds even in aged patients in comparison to the large dog is likely to play a noticeable role and could support our findings about DJD and its effect on the outcome. Some investigations indicated that good return to active limb function after FHO depends on whether the length of time the pathologic hip joint condition is present and on also the severity of the degenerative changes. In majority of the studies, it has been pointed that weight is a key and risk factor in prognosis 5,16 but other study revealed that there was no correlation between body weight and functional outcome statistically 15. Our study also indicated weight has no effect on the outcome of group II and is effective in both lower and the ending ranges. It is obvious clear that weight increases the load placed on the pseudo joints and recurrence is expected and weight is a clear risk factor for prognosis after FHO 17,18. Investigation showed that dogs lighter than 10 kg have a good to excellent prognosis, when compared to heavier dogs 3 and population-based study has consistently shown a link between the age or weight or DJD and prognosis after FHO 3. The present clinical study revealed that weight and DJD were not the influential factors in the prognosis of 1 to 5 year old dogs, but there was an statistical association between the age and DJD with the outcome, so the outcome in younger and elder dogs were not as good as dogs between 1 to 5 years. Therefore, regardless of the subjective data analyzed, authors showed that age would have an effective role on the outcome and weight is not as important as age in this regard. The present study suggests the need for further identification and elucidation of physiologic and pathophysiologic risk factors influencing the prognosis. Acknowledgements The authors thank Dr. Farrokhreza KABIR, Dr. Hooman MOLOOKPOUR, Dr. Nima VAZIR, Bahareh KARIMI and Dr. Ahmet UNVER for their help. REFERENCES 1. Nunamaker DM: Fractures and dislocations of the hip joint. In, Newton CD, Nunamaker DM (Eds): Textbook of Small Animal Orthopedics. pp , Lippincott, Philadelphia, Denny HR, Butterworth SJ: A Guide to Canine and Feline Orthopaedic Surgery. 4 th ed., pp , Blackwell Science, London, Fossum TW, Hedlund CS, Hulse DA, Johnson AL, Seim HB, Willard MD, Carroll GL: Small Animal Surgery. 3rd ed., pp , Mosby, St. Louis, Slocum B, Slocum TD: Hip. In, Bojrab MJ, Ellison GW (Eds): Current Techniques in Small Animal Surgery. 2 nd ed., pp , Williams and Wilkins, Baltimore, Schulz KS, Dejardin LM: Surgical treatment of canine hip displacement. In, Slatter D (Ed): Textbook of Small Animal Surgery. 3 rd ed., pp , W.B. Saunders Co, Philadelphia, Skurla CT, Egger EL, Schwarz PD, James SP: Owner assessment of the outcome of total hip arthroplasty in dogs. J Am Vet Med Assoc, 217 (7): , Penwik RC: The variables that influence the success of femoral head and neck excision in dogs. Vet Med, 87 (4): , Braden TD, Olivier NB, Blaiset MA, Averill SM, Bolliger C, DeCamp CE: Objective evaluation of total hip replacement in 127 dogs utilizing force plate analysis. Vet Comp Orthop Traumatol, 17, 78-81, Montgomery RD, Milton JL, Horne RD, Coble RH, Williams JC: A retrospective comparison of three techniques for femoral head and neck excision in dogs. Vet Surg, 16 (6): , Lewis DD: Postoperative examination of the biceps femoris muscle sling used in excision of the femoral head and neck in dogs. Vet Surg, 17 (5): , Van Hagen MAE, Ducro BJ, Van den Broek J, Knol BW: Incidence, risk factors, and heritability estimates of hind limb lameness caused by hip dysplasia in a birth cohort of Boxers. Am J Vet Res, 66 (2): , Lopez MJ, Quinn MM, Markel MD: Associations between canine juvenile weight gain and coxofemoral joint laxity at 16 weeks of age. Vet Surg, 35 (3): , Comhaire FH, Snaps F: Comparison of two canine registry databases on the prevalence of hip dysplasia by breed and the relationship of dysplasia with body weight and height. Am J Vet Res, 69 (3): , Mann FA, Tangner CH, Wagner-Mann C, Read WK, Hulse DA, Puglisi TA, Hobson HP: A comparison of standard femoral head and neck excision and femoral haed and neck excision using a biceps femoris muscle flap in the dog. Vet Surg, 16 (3): , Off M, Matis U: Excision arthroplasty of the hip joint in dogs and cats. Clinical, radiographic and gait analysis findings from the Department of Surgery, Veterinary Faculty of the Ludwig-Maximillians-University of Munich, Germany, Vet Comp Orthop Traumatol, 23 (5): , Smith GK, Popovitch CA, Gregor TP, Shofer FS: Evaluation of risk factors for degenerative joint disease associated with hip dysplasia in dogs. J Am Vet Med Assoc, 206 (5): , 1995.

89 436 Excision Arthroplasty of Impellizzeri JA, Tetrick MA, Muir P: Effect of weight reduction on clinical signs of lameness in dogs with hip osteoarthritis. J Am Vet Med Assoc, 216 (7): , Rawson EA, Arosohn MG, Burk RL: Simultaneous bilateral femoral head and neck ostetomy for the treatment of canine hip dysplasia. J Am Anim Hosp Assoc, 41 (3): , 2005.

90 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Ördeklerin Kesim ve Karkas Özelliklerine Cinsiyet ve Irkın Etkisi Mehmet SARI * Kadir ÖNK ** Muammer TİLKİ * Ali Rıza AKSOY * * Kafkas Üniversitesi, Veteriner Fakültesi, Zootekni Anabilim Dalı, TR Kars - TÜRKİYE ** Kafkas Üniversitesi, Kars Meslek Yüksekokulu, TR Kars - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışma ördeklerin kesim ve karkas özelliklerine cinsiyet ve ırkın etkisini belirlemek amacıyla yapılmıştır. Çalışma, Kars merkeze bağlı Paşaçayırı Mahallesi nde gerçekleştirilmiştir. Çalışmanın hayvan materyalini 64 adet yerli, 75 adet Pekin olmak üzere toplam 139 adet ördek oluşturmuştur. Sıcak karkas, baş, karaciğer, bağırsak ile göğüs ve kanat ağırlığına cinsiyetin etkisi istatistiki olarak önemli bulunmuştur (P<0.05, P<0.001). Kesim özelliklerinden sadece kalp ağırlığına ırkın etkisinin istatistiki olarak önemli olduğu tespit edilmiştir (P<0.05). Yine kalp ve karaciğer ağırlığı ile karkas randımanı, kalp, karaciğer, göğüs ve boyun oranına cinsiyet ve ırkın interaktif etkisinin istatistiki olarak önemli olduğu belirlenmiştir (P<0.05, P<0.001). Kesim ve sıcak karkas ağırlığı erkek ördeklerde dişi ördeklerden, Pekin ördeklerinde yerli ördeklerden yüksek bulunmuştur. Bu çalışma yetiştirici koşullarında yetiştirilen ördeklerin kesim ve karkas özellikleri üzerine cinsiyet ve ırkın etkisinin belirlenmesi açısından önemlidir. Ayrıca Kars İli nde yetiştirici koşullarında yetiştirilen ördeklerde ilk defa yapılmış bir çalışma olması bakımından da önemlidir. Anahtar sözcükler: Ördek, Kesim ve karkas özellikleri, Cinsiyet, Irk Effects of Sex and Breed on Slaughter and Carcass Traits in Ducks Summary The present study aimed to determine the properties of slaughter and carcass traits and the effects of sex and breed on these properties. The study was performed in Paşaçayır district affiliated to central province of Kars. The total of 139 ducks consisting of 64 native Turkish duck and 75 Pekin duck were used in the study. The effect of sex on hot carcass, head, liver, intestine, breast and wing weight were found to be statistically significant (P<0.05, P<0.001). Only, the effects of breed on heart weight was found to be statistically significant (P<0.05). Nevertheless, the interactive effects of sex and breed on heart and liver weight and carcass yield and heart, liver, breast and neck ratio were determined to be statistically significant (P<0.05, P<0.001). Slaughter and hot carcass weights of the male ducks were higher than that of female ducks. At the same time, slaughter and hot carcass weights of the Pekin ducks were higher than that of native Turkish ducks. This study is important to determine the effects of sex and breed on slaughter and carcass traits of ducks reared breeder conditions. In addition, for the first time of ducks reared breeder conditions in Kars province is also important. Keywords: Duck, Slaughter and carcass traits, Sex, Breed GİRİŞ Et üretimi için kaynakların etkin şekilde kullanılmasına yönelik birçok araştırma bulunmaktadır. İnsan beslenmesinde kanatlı hayvanlardan elde edilen proteinli kaynakların önemi büyüktür. İnsanların iyi beslenmesi için diğer kanatlı etlerinin yanı sıra ördek eti üretim kaynaklarının da geliştirilmesi ve bu kaynakların daha ekonomik olarak üretilmesine yönelik araştırmalara da ihtiyaç vardır. Türkiye de yetiştirilen kanatlı türleri içerisinde en başta tavuk gelmekle beraber, az da olsa ördek yetiştiriciliği de yapılmaktadır. Bazı yörelerde ise daha çok ördek yetiştiriciliği ön planda tutulmaktadır. Ördeğin tercih nedeni yetiştiriciliğinin kolay olmasıdır 1. Ayrıca ördekler farklı çevre ve doğa şartlarında yetiştirilmesi ve adaptasyonu ile beraber Marek, enfeksiyöz bronşitis vb. solunum yolu hastalıklarına karşı diğer kanatlılara göre daha dirençlidirler. Bu yüzden ördek üretiminin önemi daha da artmaktadır 2,3. İletişim (Correspondence) /5115 msari_40@hotmail.com

91 438 Ördeklerin Kesim ve Karkas... Türkiye de ki ördek sayısı 2010 verilerine göre adet, 2009 verilerine göre kesilen ördek sayısı ise adet ve elde edilen et ise 68 ton dur. Türkiye de ördek yetiştiriciliğine her bölgede rastlamak mümkündür. İl olarak en yaygın Muş, Balıkesir, Kütahya, Kars, Edirne, Diyarbakır, Tekirdağ ve Yozgat sayılabilir. Kars İli nde toplam ördek sayısı 2010 yılı verilerine göre adettir 4. Kars ta ördek yetiştiriciliği yerli ve Pekin ördeklerinde doğal kuluçka yöntemi ile yapılmaktadır. Ördek yetiştiriciliği yapan aileler, kazlarda olduğu gibi kış aylarında 3-4 adet dişi ve 1 adet erkek ördeği damızlık olarak ayırmaktadır. Kuluçkadan çıkan civcivlere ilk birkaç gün şerbet ve süt, sonraki günlerde ise civciv yemi, ıslatılmış ekmek ve taze yeşil ot verilmektedir. Yaklaşık 2-3 hafta evde tutulmakta, uygun havalarda meraya çıkarılmaktadır. Çoğunlukla ördekler havuzsuz yarı entansif şekilde yetiştirilmektedir. Ördekler ilk kar yağışından kısa bir süre sonra kesilmektedir. Kesilen ördeklerin eti, karaciğeri, tüy, baş ve ayakları değerlendirilmektedir. Kesimden sonra bir kısmı taze olarak tüketilmekte, bir kısmı da sonradan kullanılmak üzere tuzlanıp kurutulmaktadır. Tüyü ise yastık ve yorgan yapımında kullanılmaktadır 5,6. Ördeklerde kesim ve karkas özelliklerinin belirlenmesi amacı ile birçok araştırma yapılmıştır 3,7-11. Bu araştırmalar ile ördeklerin kesim ve karkas özelliklerine birçok faktörün etkili olduğu belirlenmiştir. Bu faktörlerin başında ırk/orjin, cinsiyet, yaş, besi süresi ve besi yöntemi gelmektedir. Bu çalışma ile ilk defa Kars İli nde yetiştirici koşullarında yerli ve Pekin ördeklerin kesim ve karkas özellikleri ortaya konulmuştur. Sonuçta yerli ve Pekin ördeklerin kesim ve karkas özellikleri üzerine cinsiyet ve ırkın etkisi belirlenmiştir. Ayrıca ördekler ile ilgili sınırlı olan literatür bilgisi de geliştirilmeye çalışılmıştır. MATERYAL ve METOT Çalışma, Kars merkeze bağlı Paşaçayırı Mahallesi nde gerçekleştirilmiştir. Çalışmanın hayvan materyalini 64 adet Yerli, 75 adet Pekin olmak üzere toplamda 139 adet (65 erkek, 74 dişi) ördek oluşturmuştur. Kars İli nde ördek civcivleri yumurtadan genellikle Nisan-Mayıs aylarında çıkmaktadır. Çalışmada kullanılan ördeklerin bakım ve beslenmesine ilave olarak herhangi bir özel bakım ve besleme uygulanmamıştır. Ördeklere kanat numarası takılmış, yaklaşık 20 haftalık yaşta canlı ağırlıkları alındıktan sonra kesilmiştir. Kesimden sonra; karkas ağırlıkları ile baş, ayak, tüy, boyun, karaciğer, taşlık, kalp, bağırsak ağırlıkları tartılarak kaydedilmiştir. İç, abdominal ve deri altı yağ ağırlıkları karkasa dahil edilmiştir. Tartımlar 0.01 grama hassas terazi ile gerçekleştirilmiştir. İncelenen özellikler üzerine cinsiyetin ve ırkın etkisini tespit etmek amacıyla SPSS istatistik paket programı kullanılmıştır. Bu amaçla En Küçük Kareler Metodundan faydalanılmıştır. Bu metoda göre; Y ijk = µ + a i + b j + (a + b) ij + e ijk denklemi oluşturulmuştur. Modelde; Y ijk : Herhangi bir ördeğin incelenen verim özelliği değeri, µ : Beklenen ortalama, a i : Cinsiyetin etkisi (i: 1, 2; Erkek ve Dişi), b j : Irkın etkisi (j: 1, 2; Yerli ve Pekin), (a + b) ij : Cinsiyet ve ırkın interaktif etkisi, : Hata payı. e ijk BULGULAR Kesim, sıcak karkas, tüy, baş, ayak, kalp, karaciğer, taşlık ve bağırsak ağırlığına cinsiyet ve ırkın etkisi Tablo 1 de gösterilmiştir. Bu özelliklerden sıcak karkas, baş, karaciğer ve bağırsak ağırlığına cinsiyetin etkisi istatistiki olarak önemli bulunmuştur (P<0.05, P<0.001). Kalp ağırlığına ise ırkın etkisi istatistiki olarak önemli belirlenmiştir (P<0.05). İncelenen kesim özelliklerinden karaciğer ve bağırsak ağırlığı hariç diğer tüm özelliklerde erkekler dişilerden yüksek tespit edilmiştir. Kesim, sıcak karkas, tüy ve ayak ağırlığı bakımından Pekin ördeklerinin erkekleri; Pekin dişi ile yerli ördeklerin erkek ve dişilerinden yüksek ağırlığa sahiptir. Sadece kalp ve karaciğer ağırlığına cinsiyet ve ırkın interaktif etkisi önemli olarak belirlenmiştir (P<0.05, P<0.001). But, göğüs, kanat, sırt ve boyun ağırlığına cinsiyet ve ırkın etkisi Tablo 2 de verilmiştir. İncelenen bu özellikler üzerine ırkın etkisi istatistiki olarak önemsiz tespit edilirken (P>0.05), cinsiyetin etkisinin göğüs ve kanat ağırlığı üzerine istatistiki olarak önemli olduğu belirlenmiştir (P<0.05, P<0.001). İncelenen karkas özelliklerinde erkek ördeklerin ağırlığı dişi ördeklerden yüksek tespit edilmiştir. Kanat ve boyun ağırlığı hariç diğer özelliklerde Pekin ördekleri yerli ördeklerden yüksek ağırlığa sahiptir. Tablo 2 ye göre karkas özellikleri üzerine cinsiyet ve ırkın interaktif etkisinin önemsiz olduğu tespit edilmiştir (P>0.05). But, göğüs ve sırt ağırlığı bakımından Pekin ördeklerinin erkekleri; Pekin ördeklerinin dişileri ile yerli ördeklerin erkek ve dişilerinden yüksek ağırlığa sahip olduğu belirlenmiştir. Karkas randımanı, tüy, baş, ayak, kalp, karaciğer, taşlık ve bağırsak oranı Tablo 3 te gösterilmiştir. Baş, karaciğer ve bağırsak oranına cinsiyetin etkisinin (P<0.001); baş ve kalp oranına da ırkın etkisinin istatistiki olarak önemli olduğu belirlenmiştir (P<0.05, P<0.01). Karkas randımanı, kalp ve karaciğer oranına ise cinsiyet ve ırkın interaktif etkisi istatistiki olarak önemli bulunmuştur (P<0.05, P<0.001). Tablo 4 te but, göğüs, kanat, sırt ve boyun oranına cinsiyet ve ırkın etkisi verilmiştir. But ve kanat oranına hem cinsiyetin hem de ırkın etkisi istatistiki olarak önemli iken (P<0.05, P<0.01, P<0.001); sırt ve boyun oranına ise sadece ırkın etkisinin istatistiki olarak önemli olduğu görülmüştür (P<0.01). Göğüs ve boyun oranına ise cinsiyet ve ırkın inter-

92 439 SARI, ÖNK TİLKİ, AKSOY Tablo 1. Ördeklerin kesim ve karkas özelliklerine (g) cinsiyet ve ırkın etkisi Table 1. Effect of sex and breed on slaughter and carcass traits (g) of ducks Özellikler Kesim Ağırlığı Sıcak Karkas Ağırlığı Tüy Ağırlığı Baş Ağırlığı Ayak Ağırlığı Kalp Ağırlığı Karaciğer Ağırlığı Taşlık Ağırlığı Bağırsak Ağırlığı Cinsiyet Erkek 2479± ± ± ± ± ± ± ± ±3.07 Dişi 2366± ± ± ± ± ± ± ± ±2.88 Irk Yerli 2401± ± ± ± ± ± ± ± ±3.09 Pekin 2444± ± ± ± ± ± ± ± ±2.86 İnteraktif Etkiler Erkek Yerli 2457± ± ± ± ± ± ± ± ±4.51 Pekin 2502± ± ± ± ± ± ± ± ±4.18 Dişi Yerli 2346± ± ± ± ± ± ± ± ±4.24 Pekin 2386± ± ± ± ± ± ± ± ±3.91 Cinsiyet ÖD * ÖD *** ÖD ÖD *** ÖD *** Irk ÖD ÖD ÖD ÖD ÖD * ÖD ÖD ÖD Cinsiyet* Irk ÖD ÖD ÖD ÖD ÖD * *** ÖD ÖD ÖD (Önemli değil): P>0.05; * : P<0.05; *** : P<0.001 Tablo 2. Ördeklerin karkas özelliklerine (g) cinsiyet ve ırkın etkisi Table 2. Effect of sex and breed on carcass traits (g) of ducks Özellikler But Ağırlığı Göğüs Ağırlığı Kanat Ağırlığı Sırt Ağırlığı Boyun Ağırlığı Cinsiyet Erkek ± ± ± ± ±5.31 Dişi ± ± ± ± ±4.98 Irk Yerli ± ± ± ± ±5.34 Pekin ± ± ± ± ±4.94 İnteraktif Etkiler Erkek Yerli ± ± ± ± ±7.79 Pekin ± ± ± ± ±7.21 Dişi Yerli ± ± ± ± ±7.32 Pekin ± ± ± ± ±6.75 Cinsiyet ÖD * *** ÖD ÖD Irk ÖD ÖD ÖD ÖD ÖD Cinsiyet* Irk ÖD ÖD ÖD ÖD ÖD ÖD (Önemli değil): P>0.05; * : P<0.05; *** : P<0.001 aktif etkisinin istatistiki olarak önemli olduğu tespit edilmiştir (P<0.05, P<0.01). TARTIŞMA ve SONUÇ Çalışmada ördekler ortalama 20. haftada kesilmişlerdir. Ördeklerin kesim yaşının bu kadar uzun olmasının nedeni yetiştiricinin kazlarda yaptığı gibi havanın soğuması ve ilk karın yağmasını beklemesi ile ilgilidir. Yetiştiricinin bu zamanı seçmesinin nedeni ise kesilen ördeklerin muhafazasının kışın daha iyi olacağı düşüncesidir. Çalışmada yerli ördeklerinin erkek ve dişilerinin kesim ağırlıkları 2457 ve 2346 g, Pekin ördeklerin erkek ve dişilerinin kesim ağırlıkları 2502 ve 2386 g olarak tespit edilmiştir. Yerli ördeklerde kesim ağırlığı için tespit edilen bu değerler İşgüzar ve ark. nın 9 Kara, Yeşilbaş, Boz renkli yerli ördeklerin erkek ve dişilerinin kesim ağırlığı değerinden yüksek tespit edilmiştir. Pekin ördeklerinde kesim ağırlığı için belirlenen bu değerler İşgüzar ve ark. 9 ile Omojola nın 12 Pekin ördeklerinin erkek ve dişileri için belirlediği kesim ağırlığı değerlerinden yüksek belirlenmiştir. Yine bu çalışmada yerli ördekler için bulunan kesim ağırlığı değeri Arslan ve ark. nın 13 yerli ördeklerin kontrol grubunda belirlediği kesim ağırlığı değerinden yüksek, Pekin ördekleri için belirlenen kesim ağırlığı değeri ise Karima ve ark. nın 14 Pekin ördeklerinde belirlediği değerden yüksek bulunmuştur. Çalışmada sıcak karkas ağırlığına cinsiyetin etkisinin istatistiki olarak önemli, ırkın etkisi ile cinsiyet ve ırkın interaktif etkisinin önemsiz olduğu belirlenmiştir. Erkek ördeklerin sıcak karkas ağırlığı dişi ördeklerden 100 g, Pekin

93 440 Ördeklerin Kesim ve Karkas... Tablo 3. Ördeklerin kesim ve karkas özelliklerine (%) cinsiyet ve ırkın etkisi Table 3. Effect of sex and breed on slaughter and carcass traits (%) of ducks Özellikler Karkas Randımanı Tüy Oranı Baş Oranı Ayak Oranı Kalp Oranı Karaciğer Oranı Taşlık Oranı Bağırsak Oranı Cinsiyet Erkek 65.36± ± ± ± ± ± ± ±0.14 Dişi 64.06± ± ± ± ± ± ± ±0.13 Irk Yerli 64.42± ± ± ± ± ± ± ±0.14 Pekin 65.00± ± ± ± ± ± ± ±0.13 İnteraktif Etkiler Erkek Yerli 65.78± ± ± ± ± ± ± ±0.20 Pekin 64.95± ± ± ± ± ± ± ±0.19 Dişi Yerli 63.07± ± ± ± ± ± ± ±0.19 Pekin 65.04± ± ± ± ± ± ± ±0.18 Cinsiyet ÖD ÖD *** ÖD ÖD *** ÖD *** Irk ÖD ÖD ** ÖD *** ÖD ÖD ÖD Cinsiyet* Irk * ÖD ÖD ÖD * *** ÖD ÖD ÖD (Önemli değil): P>0.05; * : P<0.05; **: P<0.01; ***: P<0.001 Tablo 4. Ördeklerin karkas özelliklerine (%) cinsiyet ve ırkın etkisi Table 4. Effect of sex and breed on carcass traits (%) of ducks Özellikler But Oranı Göğüs Oranı Kanat Oranı Sırt Oranı Boyun Oranı Cinsiyet Erkek 23.20± ± ± ± ±0.18 Dişi 23.78± ± ± ± ±0.16 Irk Yerli 23.26± ± ± ± ±0.18 Pekin 23.72± ± ± ± ±0.16 İnteraktif Etkiler Erkek Yerli 22.90± ± ± ± ±0.26 Pekin 23.49± ± ± ± ±0.24 Dişi Yerli 23.61± ± ± ± ±0.24 Pekin 23.94± ± ± ± ±0.22 Cinsiyet ** ÖD *** ÖD ÖD Irk * ÖD *** *** ** Cinsiyet* Irk ÖD ** ÖD ÖD * ÖD (Önemli değil): P>0.05; * : P<0.05; **: P<0.01; *** : P<0.001 ördeklerinin karkas ağırlığı da yerli ördeklerden 37 g yüksek belirlenmiştir. Bu çalışmada yerli ördeklerden elde edilen sıcak karkas ağırlığı Arslan ve ark. nın 13 yerli ördeklerin kontrol grubunda belirlediği sıcak karkas ağırlığı değerinden yüksek bulunmuştur. Ancak Pekin ördeklerinden elde edilen sıcak karkas ağırlığı Farhat ve Chavez 15 ile Farhat ve ark. nın 16 Pekin ördeklerinde bildirdiği değerden düşük bulunmuştur. Yine bu çalışmada Pekin ördeklerinin sıcak karkas ağırlığı Demir ve ark. nın 17 havuzsuz yarı entansif sistemde 7, 8 ve 9 haftalık yaşta bildirdiği karkas ağırlığı değerlerinden düşük bulunmuştur. Çalışmada elde edilen kesim ve sıcak karkas ağırlığı değerlerinin diğer çalışmalardan farklı olmasının nedeni ırk/orjin, cinsiyet, kesim yaşı ile bakım ve besleme yöntemlerinin farklı olmasından kaynaklanabilir. Her ne kadar karkas randımanı bakımından erkek ve dişi ile yerli ve Pekin ördekleri arasında istatistiki olarak önemli bir fark bulunmamasına rağmen, cinsiyet ve ırkın interaktif etkisinin istatistiki olarak önemli olduğu tespit edilmiştir. Bu çalışmada yerli ördekler için belirlenen karkas randımanı ortalaması Arslan ve ark. nın 13 yerli ördeklerin kontrol grubunda tespit ettiği karkas randımanı ortalamasına benzer bulunmuştur. Hem yerli ördeklerin erkek ve dişileri hem de Pekin ördeklerinin erkek ve dişileri için belirlenen karkas randımanı ise İşgüzar ve ark. nın 9 belirlediği değerlerden düşük bulunmuştur. Yine Pekin ördeklerinin erkek ve dişileri için belirlenen değerler, Witak ın 18 9 haftalık yaşta kesilen Pekin ördeklerinin erkek ve dişileri için belirlediği karkas randımanı ortalamasına benzer bulunmuştur. Ancak Pekin ördeklerinde belirlenen karkas randımanı Erişir ve

94 441 SARI, ÖNK TİLKİ, AKSOY ark. 10, Farhat ve ark. 16 ile Bhuiyan ve ark. nın 19 Pekin ördeklerinde belirlediği karkas randımanı değerlerinden düşük bulunmuştur. Ördek yetiştiriciliğinde elde edilen önemli ürünlerden biri de tüy ve yenilebilir iç organlardır (karaciğer, taşlık ve kalp). Tüy, yöredeki yetiştiriciler tarafından yorgan ve yastık yapımında kullanılmaktadır. Yenilebilir iç organlar ticari olarak değerlendirilmemekle birlikte kesimden sonra tüketilmektedir. Çalışmada Pekin ördeklerinden elde edilen tüy oranı Alpay ın 20 bildirdiği araştırma sonucuna benzer, Omojola nın 12 Pekin ördeklerinde bildirdiği değerlerden yüksek bulunmuştur. Bu çalışmada yerli ve Pekin ördeklerinin erkek ve dişilerinden elde edilen karaciğer, taşlık ve kalp oranı İşgüzar ve ark. nın 9 yerli ve Pekin ördeklerinin erkek ve dişilerinde bildirdiği değerlerden düşük bulunmuştur. Ancak Pekin ördeklerinden elde edilen karaciğer ve kalp oranı Alpay ın 20 Pekin ördeklerinde bildirdiği araştırma sonucuna benzer, taşlık oranından ise yüksek bulunmuştur. Genel olarak, cinsiyet ve ırkın karkas özelliklerine etkisinin istatistiki olarak önemsiz, karkas oranlarına etkisinin ise istatistiki olarak önemli olduğu tespit edilmiştir. Bu çalışmada yerli ve Pekin ördeklerinin erkek ve dişileri için belirlenen karkas oranlarına ait değerlerden but ve göğüs oranı İşgüzar ve ark. nın 9 yerli ve Pekin ördeklerinin erkek ve dişilerinde bildirdiği değerlerden yüksek belirlenmiştir. Yine bu çalışmada belirlenen göğüs oranı Arslan ve ark. nın 13 yerli ördeklerin kontrol grubunda bildirdiği göğüs oranından yüksek, but, kanat, boyun ve sırt oranından ise düşük tespit edilmiştir. Yerli ördeklerde kesim ve karkas özelliklerinin belirlenmesine ait çalışmalar sınırlı olduğundan dolayı etraflı bir şekilde karşılaştırma yapılamamıştır. Bu çalışma ile yetiştirici koşullarında yetiştirilen ördeklerin genel olarak kesim ve karkas özelliklerinin erkek ördeklerde dişi ördeklere göre yüksek, kesim ve sıcak karkas ağırlığı bakımından Pekin ördeklerinin yerli ördeklere göre yüksek olduğu sonucuna varılmıştır. Bu çalışma Kars İli nde yetiştirici koşullarında yetiştirilen ördeklerde ilk defa yapılmış bir çalışma olması bakımından ve yetiştirici koşullarında yetiştirilen ördeklerin kesim ve karkas özellikleri üzerine cinsiyet ve ırkın etkisinin belirlenmesi açısından önemlidir. Ayrıca bu çalışma, yerli ördekler için sınırlı olan literatür bilgisine katkı sağlaması ve daha sonra yapılacak araştırmalara kaynak teşkil etmesi açısından da önemlidir. KAYNAKLAR 1. Selçuk E, Akyurt İ: Ördek Yetiştiriciliği. Tarım ve Köyişleri Bakanlığı Teşkilatlanma ve Destekleme Genel Müdürlüğü, Yayın No: 8, Ensminger ME: Poultry Sciences. 3rd ed., Danville, Illinois, Interstate Publishers, INC. ISBN: , Solomon JKQ, Austin R, Cumberbatch RN, Gonsalves J, Seaforth E: A comparison of live weight and carcass gain Pekin, Kunshan and Muscovy ducks on a commercial ration. Livest Res Rural Develop, 18 (11): Accessed: 09/08/ TUİK: Hayvansal Üretim İstatistikleri. Erişim Tarihi: Tilki M, Saatcı M, Kırmızıbayrak T, Aksoy AR: Kars ili Boğazköy de yetiştirilen kazların kesim ve karkas özellikleri. Kafkas Univ Vet Fak Derg, 10 (2): , Tilki M, Yazıcı K, Sarı M, Işık S, Saatcı M: Yerli Türk kazlarında çıkım ayı ve cinsiyetin kesim ve karkas özelliklerine etkisi. Kafkas Univ Vet Fak Derg, 17 (5): , Leeson S, Summers JO, Proulx J: Production and carcass characteristics of duck. Poult Sci, 61, , Campbell RG, Karunajeewa H, Bagot I: Influence of food intake and sex on growth and carcass composition of Pekin Ducks. Br Poult Sci, 26, 43-50, İşgüzar E, Koçak Ç, Pingel H: Growth, carcass traits and meat quality of different local ducks and Turkish Pekins (short communication). Arch Tierz Dummerstorf, 45 (4): , Erişir Z, Poyraz O, Onbaşılar EE, Erdem E, Öksüztepe GA: Effects of housing system, swimming pool and slaughter age on duck performance, carcass and meat characteristics. J Anim Vet Adv, 8 (9): , Laçin E, Aras MS: Farklı yetiştirme metotlarının Pekin ördeklerinde besi performansı, kesim ve karkas özellikleri üzerine etkisi. Hasad Hayvancılık Dergisi, 23 (273): 50-54, Omojola AB: Carcass and organoleptic characteristics of duck meat as influenced by bred and sex. Int J Poult Sci, 6 (5): , Arslan C, Çitil M, Saatcı M: Effects of L-Carnitine administration on growth performance, carcass traits, blood serum parameters and abdominal fatty acid composition of ducks. Arch Anim Nutr, 57 (5): , Karima AS, Ahmed RS, Omar YA, S Kamal S: Effects of genetic control of subcutaneous fat deposition via using restricted selection indexes on live performance and carcass characteristics of pekin ducklings. Arch Tierz Dummerstorf, 43 (1): 69-77, Farhat A, Chavez ER: Comparative performance, blood chemistry, and carcass composition of two lines of pekin ducks reared mixed or separated by sex. Poult Sci, 79, , Farhat A, Normand L, Chavez ER, Touchburn SP: Comparison of growth performance, carcass yield and composition, and fatty acid profiles of Pekin and Muscovy ducklings fed diets based on food wastes. Can J Anim Sci, 81, , Demir P, Erişir Z, Poyraz Ö, Onbaşılar EE, Erdem E: Farklı barındırma sistemleri ve kesim yaşına göre Pekin ördeği besisinin fayda-maliyet analizi. Kafkas Univ Vet Fak Derg, 16 (3): , Witak B: Tissue composition of carcass, meat quality and fatty acid content of ducks of acommercial breeding line at different age. Arch Tierz Dummerstorf, 51 (3): , Bhuiyan MM, Khan MH, Khan MAH, Das BC, Lucky NS, Uddin MB: A study on the comparative performance of different breeds of broiler ducks under farmer s condition at farming system research and development (Fsrd) Site, Sylhet, Bangladesh. Int J Poult Sci, 4 (8): , Alpay F: Ördeklerde kuluçkalık yumurta ağırlığı ve depolama süresinin kuluçka sonuçları, civcivlerde büyüme performansı ile kesim ve karkas özellikleri üzerine etkisi. Doktora Tezi. Uludağ Üniv. Sağlık Bil. Enst., 2008.

95 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Effect of Salting and Packaging Treatments on Fresh Rainbow Trout (Oncorhynchus mykiss) Fillets During Storage at Refrigerator Temperatures Pınar OĞUZHAN * Simay ANGİŞ ** * Ardahan University, The Faculty of Engineering, Food Engineering Department, TR Ardahan - TURKEY ** Ataturk University, The Faculty of Agriculture, Fisheries Department, TR Erzurum - TURKEY Makale Kodu (Article Code): KVFD Summary In research was investigated for effect of salting and packaging treatments on the chemical and microbiological properties of rainbow trout fillets stored 25 d at 4±1ºC and packaged in vacuum or modified atmosphere (50% CO % N 2 ) and salted (dry salting and brine salting) with 20% NaCl. Fillets were subjected to microbiological (total aerobic mesophilic bacteria, psychrotrophic bacteria, Pseudomonas, lactic acid bacteria, Enterobacteriaceae, yeast and mould) and chemical (ph, thiobarbituric acid reactive substances-tbars, total volatile base nitrogen-tvb-n) analyzes on certain days (0, 5, 10, 15, 20 and 25 th days) of storage. TBARS and TVB-N values were established the highest increase in dry salted samples at the end of storage. Modified atmosphere packaging, in terms investigated of all parameters gave better results than vacuum packaging. According to the results of microbiological analyses, shelf life of rainbow trout fillets was estimated as 10, 15, 20, 25, 15 and 20 days for CV, CM, V1, M1, V2 and M2 respectively Keywords: Rainbow trout, Salting, MAP, Vacuum, Shelf life Buzdolabı Koşullarında Depolanan Taze Gökkuşağı Alabalığı (Oncorhynchus mykiss) Filetoları Üzerine Tuzlama ve Paketleme İşlemlerinin Etkisi Özet Araştırmada %20 lik sodyum klorür ile tuzlanan (salamura ve kuru tuzlama) vakum veya modifiye atmosferde (%50 CO 2 + %50 N 2 ) ambalajlanıp 4±1 C de 25 gün depolanan gökkuşağı alabalığı (Oncorhynchus mykiss) filetolarının kimyasal ve mikrobiyolojik özellikleri üzerine tuzlama ve paketleme işlemlerinin etkisi incelenmiştir. Filetolar depolamanın belirli günlerinde (0, 5, 10, 15 ve 25. gün) mikrobiyolojik (toplam aerobik mezofilik bakteri, psikrotrofik bakteri, Pseudomonas, laktik asit bakterileri, Enterobacteriaceae, maya ve küf) ve kimyasal (ph, TBARS, TVB-N) açıdan analiz edilmiştir. Depolama sonunda TVB-N ve TBARS değerleri açısından en yüksek artış kuru tuzlanmış örneklerde tespit edilmiştir. Tüm parametreler incelendiğinde, modifiye atmosfer paketlemenin vakum paketlemeye göre daha iyi sonuç verdiği saptanmıştır. Mikrobiyolojik analiz sonuçlarına göre gökkuşağı alabalığının raf ömrü CV, CM, V1, M1, V2 ve M2 grubu örneklerde sırasıyla 10, 15, 20, 25, 15 ve 20 gün olarak belirlenmiştir. Anahtar sözcükler: Gökkuşağı alabalığı, Tuzlama, MAP, Vakum, Raf ömrü INTRODUCTION Microorganisms can reproduce in the muscle tissue of aquatic products because these are not only sensitive but also has reach nutrient content. So, the conservation and handling of aquatic products are very important 1. One of the conservation processes of aquatic products are salting 2. Although salting process is itself a preservation technique, for many processing technology (smoking, drying and marinating processes) is used as a preliminary operation. The main purpose of salting the fish meat is a part of the elimination of water. Bacterial activity is largely prevented in high salt concentrations. High salt concentration prevents the development of microflora causing spoilage in fish. In İletişim (Correspondence) pinaroguzhan@ardahan.edu.tr

96 444 Effect of Salting and Packaging... addition, significantly increase the shelf life of fish 3. NaCl is an essential ingredient in processed meat products for its contribution to the water-holding capacity, prevention of microbial growth, reduction of water activity, facilitating the solubilisation of certain proteins and conferring a typical salty taste by enhancing the flavour of such food products 4. Vacuum packaging method is a type of passive modified atmosphere. After placing the food into the packaging material suitable for this operation, the package is emptied in the air by vacuum and hermetic (air tight) is made a closure. This method is usually used for preservation of meat products. Vacuum packaging in vacuum, albeit a very small amount will remain at O 2. However, the low percentage of O 2 in the package as soon as possible is used by aerobic microorganisms and CO 2 is produced. These types of products, the proliferation of bacteria and oxidation products is prevented as air is not in the package 5-7. While abundant data exists on preservation of fish and fishery products using vacuum packaging, including salmon 8-10, ascidia 11, sardine 12,13, trout Modified atmosphere packaging (MAP), is a protecting technique use to extent shelf-life of fish and fish products 17. Modified atmosphere packaging, elimination of oxygen from inside package and filled with different concentrations of CO 2 and N 2, however, refrigerated storage conditions for aerobic microorganisms, proteolytic bacteria, yeast and mold growth is inhibited 6,18,19. There are a lot of research related to MAP that extension of the shelf life of fish, including chub mackarel 20, cod 21,22, swordfish 23, rainbow trout 24, salmon 25, bass 26, herring 27, catfish 28. There is not information in the literature regarding to the effects on chemical and microbiological properties of rainbow trout (Oncorhynchus mykiss) fillets prepared with brine method and dry salting method and packaged vacuum or modified atmosphere. The aim of this research is to determine with combined effects of salting (dry salting and brine salting) and packaging (vacuum and MAP) on the shelflife of refrigerated (4 C) rainbow trout fillets by evaluating certain microbiological and chemical parameters. MATERIAL and METHODS Preparing Samples Fish material, rainbow trout (O. mykiss) (250±25 g) were obtained from Ataturk University Agricultural College Fisheries Department s rainbow trout breeding and research center. Fish were carried to laboratory and washed with tap water. The fish (72 samples) were eviscerated, stored until rigor had resolved and then filleted, 144 fillets in total 29. Fillets were washed again for removing blood and mucous remains. All filleted samples including the control were packaged in obtained from the firm Südpack Verpackungen GmbH+Co (Germany) 15x25 cm PA/PE (Polyethylene/ Polyamide) (3-seal bags GB 70) in thickness having an O 2 permeability of 40 cm 3 /m 2 /day.atm.23 C; N 2 permeability of 24 cm 3 /m 2 /day.atm.23 C; CO 2 permeability of 145 cm 3 / m 2 /day.atm.23 C and a water vapour permeability of <3 g/m 2 /day.atm.23 C). Fillets, divided into 3 groups. Fresh fish in the first group were evaluated as the control group. The second group were applied at 8 C for 1 h 20% dry salting (NaCl) for each fish. The third group were applied at 8 C for 1 h 20% brine (NaCl) for each fish. Then, fillets were packed by applying vacuum and modified atmosphere. Treatments included: CV (control samples vacuum packaged) CM (control samples modified atmosphere packaged-50%co %N 2 ), V1 (vacuum packaged-dry salted), M1 (modified atmosphere packaged-dry salted), V2 (vacuum packaged-brine) and M2 (modified atmosphere packaged-brine). Each group was included 24 fillets. Rainbow trout fillets stored under refrigeration (4±1 C) and samples were subjected to microbiological (total aerobic mesophilic bacteria, psychrotrophic bacteria, Pseudomonas, lactic acid bacteria, Enterobacteriaceae, yeast and mould) and chemical (ph, thiobarbituric acid reactive substances- TBARS, total volatile base nitrogen-tvb-n) analyzes on certain days (0, 5, 10, 15, 20 and 25 th days) of storage. Microbiological Analysis A sample (25 g) was taken from each trout fillet, transferred aseptically into a stomacher bag containing 225 ml of 0.1% peptone water was added, and the mixture was homogenized for 60 s using a Stomacher (Lab Stomacher Blender 400-BA 7021 Sewardmedical, England) at room temperature. For microbial enumeration, 0.1 ml samples of serial dilutions (1:10, diluent, 0.1% peptonewater) of fish homogenates were spread on petri dish of various agar materials. Total aerobic mesophilic bacteria (TMAB) were enumerated on Plate Count Agar (PCA, Merck ), and incubated at 30ºC for 2 days. Psychrotrophic bacteria were enumerated on Plate Count Agar (PCA, Merck ), and incubated at 10ºC for 7 days. Pseudomonas were enumerated on cetrimide fusidin cephaloridine agar (CFC, Pseudomonas Agar Base-Oxoid CM CFC Selective Agar Supplement-Oxoid SR0103) and incubated at 25 C for 2 days. Lactic acid bacteria (LAB) were enumerated on de Man Rogosa Sharpe agar (MRS, de Man, Rogosa Sharpe Agar Oxoid CM0361) incubated at 30 C for 2 days. For Enterobacteriaceae (VRBD, Violet Red Bile Dextrose Agar Merck ) incubated at 30 C for 2 days. Yeast and mould were enumerated on RBC (Rose Bengal Chloramphenicol) Agar (Merck ) incubated at 25 C for 5 days. Chemical Analysis Total volatile basic nitrogen (TVB-N) was determined using the method of Malle and Tao 30. TVB-N contents were expressed as mg 100/g fish muscle. Thiobarbituric acid reactive substans (TBARS) was determined according to the method of Lemon 31 and Kılıç and Richards 32. TBARS content was expressed as µmol Malondialdehyde (MDA)/ kg fish muscle. ph was determined according to the method of Gökalp et al. 33.

97 445 OĞUZHAN, ANGİŞ Statistical Analysis Experiments were replicated twice on two separate occasions with different fish samples. Analyses were run in duplicate for each replicate. All obtained data from this study were subjected to analysis of variance (ANOVA), and followed by Duncan s multiple range test to determine significant differences among means at α = 0.05 level, using by SPSS 34. RESULTS Microbiological Changes Changes in TMAB of refrigerated fresh rainbow trout fillets during storage under vacuum and modified atmosphere packaging are shown in Fig. 1a. The initial (day 0) TMAB (Fig. 1a) of rainbow trout fillets was 3.12 log cfu/g. CV, CM, V1, M1, V2 and M2 rainbow trout fillets exceeded the value of 7 log cfu/g for TMAB, considered as the upper acceptability limit for fresh marine species 35 on days 10, 15, 20, 25, 15 and 20 of storage, respectively. At the end of storage period CV, CM, V1, M1, V2 and M2 respectively, levels of 10.24, 9.94, 8.11, 7.24, 8.53 and 8.51 log cfu/g were reached. The initial (day 0) Psychrotrophic bacteria (Fig. 1b) of rainbow trout fillets was 3.22 log cfu/g. CV, CM, V1, M1, V2 and M2 rainbow trout fillets exceeded the value of 7 log cfu/g for Psychrotrophic bacteria, considered as the upper acceptability limit for fresh marine species 35 on days 10, 15, 20, 25, 15 and 15 of storage, respectively. At the end of storage period CV, CM, V1, M1, V2 and M2 respectively, levels of 10.60, 9.80, 8.24, 7.61, 8.88 and 8.66 log cfu/g were reached. Inhibiting effect of dry salting method was higher than the brine method on the number of total aerobic mesophilic bacteria and psychrotrophic bacteria of fillets during storage. The initial (day 0) Pseudomonas (Fig. 1c) of rainbow trout fillets was 3.50 log cfu/g. At the end of storage period CV, CM, V1, M1, V2 and M2 respectively, levels of 8.33, 8.10, 6.62, 6.16, 7.26 and 7.16 log cfu/g were reached. Initial counts were 2.0 log cfu/g (LAB) (Fig. 1d) and 2.0 log cfu/g (Enterobacteriaceae) (Fig. 1e), at the end of storage period populations of LAB (8.46, 8.02, 8.52, 8.85, 7.49 and 7.48 log cfu/g) and Enterobacteriaceae (9.55, 9.0, 5.02, 5.33, 5.12 and 5.05 log cfu/g) were recorded for treatments CV, CM, V1, M1, V2 and M2, respectively. The initial (day 0) yeast and mould (Fig. 1f) of rainbow trout fillets was 2.08 log cfu/g. At the end of storage period CV, CM, V1, M1, V2 and M2 respectively, levels of 5.65, 5.40, 4.27, 3.97, 3.96 and 3.84 log cfu/g were reached. Chemical Changes - TVB-Nitrogen: The amount of TVB-N is an important criteriation in determining freshness of fish and fish products and TVB-N values are increasing in paralel spoilage 36. The initial (day 0) TVB-N values (Fig. 2a) of rainbow trout fillets were mg/100 g. CV, CM, V2, M1 and M2 rainbow trout fillets exceeded the value of 25 mg/100 g which an upper acceptable limit TVBN value of 25 mg N/100 for rainbow trout was suggested by 37 on days 15 of storage. V1 rainbow trout fillets exceeded the value of 25 mg/100 g on days 10 of storage. - Lipid Oxidation: Oxidative rancidity may become a problem if higher than normal levels of oxygen are used. Rancidity due to oxidation of polyunsaturated fatty acids (PUFA) in some fish may be a problem in modified atmosphere with O Initial TBARS values (Fig. 2b) were 1.95 µmol MDA/kg. At the end of storage period TBARS values 9.19, 8.37, 10.83, 9.99, 9.81 and 9.06 µmol MDA/kg were recorded for treatments CV, CM, V1, M1, V2 and M2, respectively. - ph: ph value of fish meat usually ranges from Fresh fish is close to neutral ph, after the death with be formed the lactic acid firstly falling and then rising again with spoilage 40. ph values of rainbow trout fillets (Fig. 2c) were At the end of storage period ph values 6.70, 6.39, 6.29, 6.25, 6.34 and 6.33 were recorded for treatments CV, CM, V1, M1, V2 and M2, respectively. DISCUSSION Bacterial growth of modified atmosphere packaged samples are lower than vacuum packaged samples because of CO 2 gas is exist in MAP. The carbon dioxide atmosphere can be considered effectively inhibitory on the total aerobic mesophilic and psychrotrophic flora. Similary results were observed by many other researchers 16,24, The application of MAP has been previously reported to extend the shelf life of herring 27, rainbow trout 37, salmon 48, hake 49,50, cod fillets 22,51, Baltic herring fillets 52 and eel 53. Inhibiting effect of dry salting method was higher than the brine method on the number of total aerobic mesophilic bacteria and psychrotrophic bacteria of fillets during storage. Similar initial Pseudomonas (day 0) were reported for rainbow trout by Frangos et al. 16, Pyrogotou et al. 46 and Mexis et al. 54. Pseudomonas spp. and Shewanella putrefaciens were early recognised as putative spoilage inducers in fish muscle and have since then been found in various fish species from fresh- and marine waters as well as in other foods The initial LAB and Enterobacteriaceae numbers 2.0 log cfu/g while this values increased during storage time all groups. Similar findings were found for sardine by Can 47.

98 446 Effect of Salting and Packaging... a b c d e f Fig 1. Total aerobic mesophilic bacteria counts (a), psychrotrophic bacteria (b), Pseudomonas (c), lactic acid bacteria counts (d), Enterobacteriaceae (e) and yeast and mould (f) changes of salted (brine and dry salting) rainbow trout fillets during cold storage in vacuum and MAP conditions at 4 C Şekil 1. Soğuk depolama boyunca tuzlanmış (salamura ve kuru tuzlama) alabalık filetolarının 4 C de vakum ve modifiye atmosfer paketleme şartlarında toplam aerobik mezofilik bakteri (a), psikrotrofik bakteri (b), Pseudomonas (c), laktik asit bakterileri (d), Enterobacteriaceae (e), maya ve küf (f) deki değişiklikler Similar initial yeast and mould (day 0) were reported for rainbow trout by Can 47 and mud eel by Vishwanath et al. 58. TVB-N may be considered as a quality index for fish. Its increase related to the activity of spoilage bacterai and endogenous enzymes The initial (day 0) TVB-N numbers mg/100 g while this values increased in the duration of storage time all groups. Similarly, TVB-N values have been reported for salmon 41, red mullet 43, trout 62, chub mackarel 63, Atlantic bonito 64 and mahi sefid 65. In perfect material TBA value should be less than 3 mg malonaldehyde/kg, in good material TBA value should not be more than 5 mg malonaldehyde/kg and consumption limit for TBA value is between 7 and 8 mg malonaldehyde/kg. TBA values showed the degree of rancidity in the products, and values greater than 3-4 mg malonaldehyde/kg indicated a loss of product quality 24. Initial TBARS values were 1.95 µmol MDA/kg. Increased TBARS values in the duration of storage time all groups. Similarly, TBARS values have been reported for rainbow trout 24, catfish 28, anchovy 36, mahi sefid 65 and whitefish 66. The ph in fresh fish flesh in almost neutral. In the post-mortem period, decomposition of nitrogenous compounds leads to an increase in ph in the fish flesh. The increase in ph indicates the loss of quality 47. ph values of rainbow trout fillets were Similarly, ph values have been reported for red mullet 43, sardine 47, mahi sefid 65, sea bream 67 and tilapia 68. ph values of modified atmosphere packaged control group are lower than vacuum packaged samples. This result is occured due to carbonic acid the conversion of carbon dioxide. However ph values of the brine method was higher than the dry salting method. Similary findings were observed by Bilgin et al. 40. The highest TBARS and TVB-N values were established in the dry salted and vacuum packaged samples while the lowest ph value was determined in the dry salted and modified atmosphere packaged samples at the end of storage.

99 447 OĞUZHAN, ANGİŞ a b Fig 2. TVB-N (a), TBARS (b), ph (c) changes of salted (brine and dry salting) rainbow trout fillets during cold storage in vacuum and MAP conditions at 4 C. Şekil 2. Soğuk depolama boyunca tuzlanmış (salamura ve kuru tuzlama) alabalık filetolarının 4 C de vakum ve modifiye atmosfer paketleme şartlarında TVB-N (a), TBARS (b), ph (c) değerlerindeki değişimler c According to microbiological analyses data, the shelf life of CV, CM, V1, M1, V2 and M2 to 10, 15, 20, 25, 15 and 20 days respectively. The present study concluded that dry salting and modified atmosphere packaging combination can retard total aerobic mesophilic bacteria, psychrotrophic bacteria, Pseudomonas of samples but increase lactic acid bacteria and brine salting and modified atmosphere packaging combination can delay Enterobacteriaceae, yeast and mould of samples during refrigerated storage. REFERENCES 1. Babadoğan G: Su Ürünleri Sektör Araştırması. İGEME, s. 124, Ankara, Bellagha S, Sahli A, Farhat A, Kechaou N, Glenza A: Studies on salting and drying of sardine (Sardinella aurita): Experimental kinetics and modeling. J Food Engine, 78, , Ismail N, Wootton M: Fish salting and drying a review. ASEAN Food J, 7 (4): , Armenteros M, Aristoy MC, Barat JM, Toldrá F: Biochemical changes in dry-cured loins salted with partial replacements of NaCl by KCl. Food Chem, 117, , Keles F: Gıda ambalajlama ilkeleri, Atatürk Üniversitesi Ziraat Fakültesi Yayınları No: 189, Atatürk Üniversitesi Ziraat Fakültesi Ofset Tesisi, Erzurum, Gülyavuz H, Ünlüsayın M: Su Ürünleri Işleme Teknolojisi. Süleyman Demirel Üniversitesi Eğridir Su Ürünleri Fakültesi, Isparta, Kılınç B, Çaklı Ş: Paketleme tekniklerinin balık ve kabuklu su ürünleri mikrobiyal florası üzerine etkileri. J Fisheries & Aquat Sci, 18 (1-2): , Leroi F, Joffraud JJ, Chevalier F: Effect of salt and smoke on the microbiological quality of cold-smoked salmon during storage at 5 C as estimated by the factorial design method. J Food Prot, 63 (4): , González-Rodríguez MN, José-Javier S, Santos JA, Otero A, García- López MA: Numbers and types of microorganisms in vacuum-packed coldsmoked freshwater fish at the retail level. Int J Food Microbiol, 77, , Martinez O, Salerón J, Guillén MD, Casas C: Effect of freezing on the physicochemical, textural and sensorial characteristics of salmon (Salmo salar) smoked with a liquid smoke flavouring. LWT-Food Sci and Technol, 43, , Stamatis N, Arkoudelos J, Vafidis D: Differences in chemical, microbial and sensory quality parameters of the marinated ascidia Microcosmus sabatieri Roule, 1885 during storage at 6 C under vacuum conditions. Int J Food Sci and Technol, 43, , Senesi E, Bertolo G, Torreggiani D, Cesare L, Caserio G: The utilization of mediterranean sardines by means of smoking. Advances in Fish Sci and Technol, , Gómez-Estaca J, Gimènez B, Gómez-Guillén C, Montero P: Influence of frozen storage on aptitude of sardine and dolphinfish for cold-smoking process. LWT-Food Sci and Technol, 43, , Schulze K: Untersuchungen zur Mikrobiologie, Haltbarkeit und Zusammensetzung von Raucherforellen aus einer Aquakultur. Arch Lebensmittelhyg, 36 (4): 82-85, Lyhs U, Björkroth J, Hyytia E, Korkeala H: The spoilage flora of vacuumpackaged, sodium nitrite or potasium nitrate treated, cold- smoked rainbow trout stored at 4 C or 8 C. Int J Food Microbiol, 45 (2): , Frangos L, Pyrgotou N, Giatrakou V, Ntzimani A, Savvaidis IN: Combined effects of salting, oregano oil and vacuum-packaging on the shelf-life of refrigerated trout fillets. Food Microbiol, 27, , Özoğul Y, Özoğul F, Küley E: Modifiye edilmiş atmosfer paketlemenin balık ve balık ürünlerine etkisi. J Fisheries & Aquat Sci, 23 (1-2): , Swiderski F, Russel S, Waszkiewiez-Robak B, Cholewinska E: Evaluation of vacuum-packaged poultry meat and its products. J Sci Food Agric, 48, , Kılınç B, Çaklı Ş: Su ürünlerinin modifiye atmosferde paketlenmesi. J Fisheries & Aquat Sci, 21 (3-4): , Erkan N, Özden Ö, Inuğur M: The effects of modified atmosphere and vacuum packaging on quality of chub mackerel. Int J Food Sci and Technol, 42, , Cann DC, Smith GL, Houston NC: Further studies of the packaging of marine fish products Under Modified Atmospheres, Torry Research Station. Abendeen-UK, Debevere J, Boskou G: Effect of modified atmosphere packaging on the TVB/TMA-producing microflora of cod fillets. Int J Food Microbiol, 31 (1-3): , Muratore G, Licciardella F: Effect of vacuum and modified atmosphere packaging on the shelf life liquid smoked swordfish (Xiphias gladius). Food

100 448 Effect of Salting and Packaging... Chem and Toxic, 70, , Çaklı Ş, Kılınç B, Dinçer T, Tolasa Ş: Comparison of the shelf lifes of Map and vacuum packaged hot smoked rainbow trout (Oncorhynchus mykiss). Eur Food Res Technol, 224, 19-26, Paludan-Müller C, Dalgaard P, Huss HH, Gram L: Evaluation of the role of Carnobacterium piscicola in spoilage of vacuum and modified atmosfere packed cold smoked salmon stored at 5 C. Int J Food Microbiol, 39, , Torrieri E, Cavella S, Villani F, Masi P: Influence of modified atmosphere packaging on the chilled shelf life of gutted farmed bass (Dicentrarchus labrax). J Food Engine, 77, , Lyhs U, Lahtinenb J, Schelvis-Smit R: Microbiological quality of maatjes herring stored in air and under modified atmosphere at 4 and 10 C. Food Microbiol, 24, , Göktepe I, Moody MW: Effect of modified atmosphere packaging on the quality of smoked catfish. J Muscle Foods, 9, , Robb DHF, Kestin SC, Warriss PD, Nute GR: Muscle lipid content determines the eating quality of smoked and cooked Atlantic salmon (Salmo salar). Aquat, 205, , Malle P, Tao SH: Rapid quantitative determination of trimethylamine using steam distillation. J Food Prot, 50 (9): , Lemon DW: An Improved TBA Test for Rancidity, New Series Circular, May 8, No:51, Halifax Laboratory, Halifax Mova, Kılıç B, Richards MP: Lipid oxidation in poultry döner kebabi. Prooxidative and anti-oxidative factors. J Food Sci, 68 (2): , Gökalp HY, Kaya M, Zorba Ö, Tülek Y: Et ve ürünlerinde kalite kontrolü ve laboratuar uygulama kılavuzu, Atatürk Üniversitesi Ziraat Fakültesi Yayın No: 318, Ders Kitabı: 69. Erzurum, SPSS: SPSS for windows release 10.0, SPSS Inc. Chicago-USA, ICMSF: International commission on microbiological specifications for foods. Sampling plans for fish and shellfish. In, ICMSF, Microorganisms in Foods. Sampling for Microbiological Analysis: Principles and Scientific Applications. Toronto, Ontario, Canada: University of Toronto Press, Köse S, Koral S: Tütsülenmiş hamsinin buzdolabı koşullarında (4±1 C) depolanması esnasında kalite değişimlerinin belirlenmesi, XIII. Ulusal Su Ürünleri Sempozyumu,1-4 Eylül, Çanakkale, Aras Hisar Ş, Hisar O, Kaya M, Yanık T: Effects of modified atmosphere and vacuum packaging on microbiological and chemical properties of rainbow trout (Oncorhynchus mykiss) Fillets. Int J Food Microbiol, 97 (2): , Finne G: Modified and controlled atmosphere storage of muscle foods. Food Technol, 36 (2): , Stammen K, Gerdes D, Caporaso F: Modified atmosphere packaging of seafood. Critical Reviews in Food Sci and Technol, 29, , Bilgin Ş, Ertan OÖ, Günlü A: The effects on chemical composition of Salmo trutta macrostigma Dumeril, 1858 of different salting techniques. J Fisheries & Aquat Sci, 24 (3-4): , Leroi F, Joffraud JJ, Chevalier F, Cardinal M: Study of the microbial ecology of cold-smoked salmon during storage of 8 C. Int J Food Microbiol, 39, , Dondero M, Cisternas F, Carvaja L, Simpson R: Changes in qulity of vacuum-packed cold-smoked salmon (Salmo salar) as a function of storage temperature. Food Chem, 83, , Gümüş B, İkiz R, Ünlüsayin M, Gülyavuz H: Quality changes of salted red mullet (Mullus barbatus L., 1758) during vacuum packaged stored at +4 C. J Fisheries & Aquat Sci, 25 (2): , Kilinc B, Cakli S, Dincer T, Tolasa S: Microbiological, chemical, sensory, color, and textural changes of rainbow trout fillets treated with sodium acetate, sodium lactate, sodium citrate, and stored at 4 C. J Aquat Food Product Technol, 18, 3-17, Erkan N: The Effect of thyme and garlic oil on the preservation of vacuum-packaged hot smoked rainbow trout (Oncorhynchus mykiss). Food Bioprocess Technol, 1-9, Pyrgotou N, Giatrakou V, Ntzimani A, Savvaidis IN: Quality assessment of salted, modified atmosphere packaged rainbow trout under treatment with oregano essential oil. J Food Sci, 75 (7): , Can ÖP: Combine effect of potassium sorbate and dry salting on the shelf life sardine (Sardina pilchardus). J Food Tech, 9 (1): 43-49, Pastoriza L, Sampedro G, Herrera JJ, Cabo ML: Effect of carbon dioxid atmosphere on microbial growth and quality of salmon slices. J Sci Food Agric, 72, , Pastoriza L, Sampedro G, Herrera JJ, Cabo ML: Effect of modified atmosphere packaging on shelf-life of iced fresh hake slices. J Sci Food Agric, 71, , Pastoriza L, Sampedro G, Herrera JJ, Cabo ML: Influence of sodium chloride and modified atmosphere packaging on microbiological, chemical and sensorial properties in ice storage of slices of hake (Merluccius merluccius). Food Chem, 61 (1-2), 23-28, Lauzon HL, Magnússon H, Sveinsdóttir K, Gudjónsdóttir M, Martinsdóttir E: Effect of brining, modified atmosphere packaging and superchilling on the shelf life of cod (Gadus morhua) loins. J Food Sci, 74 (6): , Randell K, Hattula T, Ahvenainen R: Effect of packaging method on the quality of rainbow trout and baltic herring fillets. LWT, 36, 56-61, Arkoudelos J, Stamatis N, Samaras F: Quality attributes of farmed eel (Anguilla anguilla) stored under air, vacuum and modified atmosphere packaging at 0 C. Food Microbiol, 24, , Mexis SF, Chouliara E, Komtominas MG: Combined effect of an oxygen absorber and oregano essential oil on shelf life extension of rainbow trout fillets stored at 4 C. Food Microbiol, 26, , Castell CH, Greenough MF: The action of Pseudomonas on fish muscle: I. Organisms responsible for odour produced during incipient spoilage of chilled fish muscle. J Fish Res Board Can, 16, 13-19, Macdonell MT, Colwell RR: Phylogeny of the Vibrionaceae and recommendation for two new genera, Listonella and Shewanella. Syst Appl Microbiol, 6, , Reynisson E, Lauzon HL, Magnússon H, Jónsdóttir R, Ólafsdóttir G, Marteinsson V, Hreggviðsson GÓ: Bacterial composition and succession during storage of North-Atlantic cod (Gadus morhua) at superchilled temperatures. BMC Microbiol, 9, Vishwanath W, Lilabati H, Bijen M: Biochemical, nutritional and microbiolgical quality of fresh and smoked mud eel fish Monopterus albus-a comparative study. Food Chem, 61 (1/2): , Özoğul Y, Polat A, Özoğul F: The effect of modified atmosphere packaging and vacuum packaging on chemical, sensory, and microbiological changes of sardines (Sardina pilchardus). Food Chem, 85, 49-57, Ruiz-Capillas C, Moral A: Sensory and biochemical aspects of quality of whole big eye tuna (Thunnus obesus) during bulk storage in controlled atmospheres. Food Chem, 89, , Öksüztepe G, Emir Çoban Ö, Güran Ş: Sodyum laktat ilavesinin taze gökkuşağı alabalığından (Oncorhynchus mykiss) yapılan köftelere etkisi. Kafkas Univ Vet Fak Derg, 16 (Suppl-A): S65-S72, Zorn VW, Greul E, Kramez J: Beurteilung des hygienestatus geraucherter, vakuumverpackter forellenfillets. Arch Lebensmittelhyg, 44, , Goulas AE, Kontominas MG: Effect of salting and smoking-method on the keeping quality of chub mackarel (Scomber japonicus): Biochemical and sensory attribuetes. Food Chem, 93, , Duyar HA, Erdem ME, Samsun S, Kalaycı F: The effects of the different woods on hot-smoking vacuum packed Atlantic Bonito (Sarda sarda) stored at 4 C. J Anim Vet Adv, 7 (9): , Zolfaghari M, Shabanpour B, Fallahzadeh S: Quality preservation of salted, vacuum packaged and refrigerated mahi sefid (Rutilus frisii kutum) fillets using an onion (Allium cepa) extract. Aquat Res, 41, , Cuppett SL, Gray JI, Booren AM, Price JF, Stachiw MA: Effect of processing variables on lipid stability in smoked great lakes whitefish. J Food Sci, 54 (1): 52-54, Goulas AE, Kontominas MG: Combined effect of light salting, modified atmosphere packaging and oregano essential oil on the shelf-life of sea bream (Sparus aurata): Biochemical and sensory attributes. Food Chem, 100, , Chaijan M: Physicochemical changes of tilapia (Oreochromis niloticus) muscle during salting. Food Chem, 129, , 2011.

101 Kafkas Univ Vet Fak Derg 18 (3): , 2012 DOI: /kvfd RESEARCH ARTICLE Antimicrobial Susceptibility, Presence of Resistance Genes and Biofilm Formation in Coagulase Negative Staphlococci Isolated from Subclinical Sheep Mastitis [1] [1] * ** *** **** Summary In this study, coagulase negative staphylococci (CoNS) (n = 70) isolated from subclinical sheep mastitis were screened for minimum inhibitory concentration (MIC) to antimicrobials used commonly in veterinary field in Turkey. In addition, plasmid profiling and biofilm production of CoNS isolates was investigated. All isolates were found to be susceptible to amoxycillin-clavulanic acid, cephalothin, gentamicin, enrofloxacin and oxacillin. The highest resistance was observed in 42.9% (n = 30) of the isolates against the beta-lactam antibiotics, penicillin and ampicillin. All beta-lactam resistant isolates produced beta-lactamase and carried blaz. Tetracycline resistance was observed in 11.4% (n = 8) of the isolates, either alone or in combination with beta-lactams and macrolides. Of the tetracycline resistant 8 isolates, 5 carried the tetk gene, one carried the tetm and 2 isolates carried both genes together. Erythromycin resistance was observed in 5.7% of the isolates; msra was detected alone (one isolate) or in combination with mphc (one isolate) and ermc (one isolate). erma was observed only in one isolate. Most of the strains showed only a single plasmid band in size of 19.3 kb, but some had 2 to 3 plasmids ranging from >19.3 kb to 0.9 kb. Out of 70 CoNS isolates, 28 (40%) were identified as biofilm producer by Congo red agar (CRA) method, and 30 (42.9%) were positive for both icaa and icad genes, which are known to be responsible for biofilm formation in CoNS. Keywords: Antimicrobial resistance, Biofilm production, Coagulase negative staphylococci, Sheep, Subclinical mastitis Subklinik Koyun Mastitislerinden İzole Edilen Koagulaz Negatif Stafilokok Suşlarının Antibiyotik Duyarlılıkları, Direnç Genlerinin Varlığı ve Biyofilm Sentezi Özet Yaşar ERGÜN * Özkan ASLANTAŞ ** Ekrem KİREÇCİ *** Fatma ÖZTÜRK **** Ahmet CEYLAN **** Yılmaz BOYAR ** This study was funded by Mustafa Kemal University Scientific Research Project Fund (BAP- 08 G 0 205) Mustafa Kemal University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynaecology, TR Hatay - TÜRKİYE Mustafa Kemal University, Faculty of Veterinary Medicine, Department of Microbiology, TR Hatay - TÜRKİYE Kahramanmaras Sutcu Imam University, School of Health, TR Kahramanmaraş - TÜRKİYE Erciyes University, Faculty of Art and Science, Department of Biology, TR Kayseri - TÜRKİYE Makale Kodu (Article Code): KVFD Bu çalışmada, subklinik koyun mastitislerinden izole edilen koagulaz negatif stafilokokların (KNS) (n = 70) veteriner hekimlik alanında yaygın olarak kullanılan antimikrobiyallere minimal inhibitor konsantrasyonları (MİK), plazmid profilleri ve biyofilm üretimi araştırıldı. Tüm izolatlar amoksisilin-klavulanik asid, cefalotin, gentamisin, enrofloksasin ve oksasiline duyarlı bulundu. En yüksek direnç izolatların %42.9 unda (n = 30) beta-laktam antibiyotiklere (penisilin ve ampisilin) karşı gözlendi. Beta-laktam antibiyotiklere dirençli izolatların tamamı beta-laktamaz sentezlediği ve blaz genini taşıdığı belirlendi. Tetrasiklin direnci tek veya beta-laktam antibiyotikler ve makrolidlerle kombine olarak izolatların %11.4 ünde (n = 8) gözlendi. Tetrasiklin dirençli izolatların 5 inde tetk, birinde tetm ve ikisinde de her iki geni birlikte bulundu. Eritromisin direnci izolatların %5.7 sinde (n = 4) bulundu. msra, mphc, erma birer izolatta, ermc ise msra geni ile kombine olarak bir izolatta tespit edildi. İzolatların büyük kısmı 19.3 kb büyüklüğünde tek plasmid gösterirken, bazı izolatlar büyüklüğü >19.3 kb ile 0.9 kb arasında değişen 2-3 plazmid taşıdığı belirlendi. Yetmiş KNS izolatından 28 i (%40) Kongo Red Agar (KRA) metodu ile biyofilm sentezi ve 30 unun da (%42.9) biyofilm sentezinden sorumlu olan icaa ve icad genleri yönünden pozitif olduğu saptandı. Anahtar sözcükler: Antimikrobiyel direnç, Biyofilm sentezi, Koagulaz negatif stafilokok, Koyun, Subklinik mastitis İletişim (Correspondence) GSM: yasarergun@yahoo.com & yasar@mku.edu.tr

102 450 Antimicrobial Susceptibility... INTRODUCTION Mastitis is recognised as one of the most important diseases affecting dairy sheep industry resulting in substantial economic losses worldwide due to reduced milk production, quality, and weak lambs 1,2. Although a variety of microorganisms can be isolated from mastitis cases, staphylococci are the most frequent ones encountered in intramammal infections (IMI) of sheep. While Staphylococcus aureus is the more frequently isolated from clinical mastitis cases 3, coagulase negative staphylococci (CoNS) are the predominant microorganism in subclinical sheep mastitis 4-6. CoNS are often the cause of persistent subclinic mastitis in dairy cattle and sheep 1. Currently, CoNS consist of more than 30 species 7, Staphylococcus epidermidis, Staphylococcus xylosus, Staphylococcus chromogenes and Staphylococcus simulans being the most commonly isolated CoNS species in persistent subclinical IMI of sheep 2,4. The presence of different CoNS species could be attributable to certain practices for controlling mastitis such as protocol and type of disinfectant used for teat dipping and dry-off treatments 1. Antimicrobials play an important role not only in eliminating any existing IMI infection but also in preventing new infections at dry (dry-off) period 8,9. Owing to the important role of antimicrobials in mastitis control programs, the determination of antimicrobial susceptibilities of mastitis pathogens is necessary for therapy and monitoring the spread of resistant strains among populations 10,11. Also, antimicrobial resistant bacteria of animal origin can be transfered to humans via food chain and can pose public health problems 12. Taponen and Pyorälä 7 have recently reported that CoNS tends to be more resistant than S. aureus and easily develop multiresistance. Studies from different parts of the world have showed that antimicrobial resistance in CoNS isolates of mastitis origin is on the rise, causing treatment failures. Also, higher percentage of penicillin resistance for CoNS isolated from bovine mastitis was reported 49.6% 13 and 62.5% 14 in Turkey. The ongoing rise in the antimicrobial resistance in CoNS highlight the importance of prudent antibiotic use in the control of mastitis and continuous surveillance of resistance levels in CoNS isolated from IMIs. Biofilm production has been increasingly accepted to play an important role in the pathogenesis of staphylococcal mastitis Biofilm is an exopolisaccharide matrix formed around bacterial cells 18. Biofilm forming ability of staphylococci helps in adherence and colonization of the organism on mammary gland epitelium, and survival in hostile environments within host. Exopolisaccharide matrix surrounding bacterial colonies protects bacteria from phagocytosis and high concentrations of antimicrobials, and allows the persistence of the infection 17, The objectives of this study were to determine the antibiotic susceptibility profiles of CoNS strains from subclinical sheep mastitis to nine antibiotics used commonly in veterinary field in Turkey, to screen the distribution of genetic determinants of antibiotic resistance, and to investigate the biofilm forming ability and occurence of the icaa and icad genes. MATERIAL and METHODS Bacterial Strains A total of 70 CoNS isolates were used in this study. These strains were previously isolated and identified from milk samples of sheep with subclinical ewe mastitis in Hatay province of Turkey 4. Antibiotic Susceptibility Testing Minimum inhibitory concentrations (MIC) of 9 antimicrobial agents (penicilin G, ampicillin, amoxycillinclavulanic acid, tetracyclin, gentamicin, cephalothin, enrofloxacin, oxacillin, and erythromycin) were determined using microbroth dilution susceptibility method in accordance with instructions in M31-A2 of the Clinical Laboratory Standards Institute 22. The MIC test was performed using cation-adjusted Mueller-Hinton broth (MHB) (Merck, Germany) containing each drug in concentrations ranging from 0.06 to 256 µg/ml. The MHB supplemented with 2% NaCl was used for determining the oxacillin MIC value. Plates containing oxacillin were incubated at 35 o C for 24 h, while other plates were incubated at 37 C for 18 h. The MIC level was defined as the lowest concentration of antimicrobial agents that inhibited visible growth. ß-lactamase Production Beta-lactamase sticks (Oxoid, UK, Code no: BR0066) impregnated with nitrocefin, a chromogenic cephalosporin, were used for the detection of beta-lactamase production by CoNS isolates. Development of a pink/red colour was accepted as positive reaction, while no colour change was regarded as negative reaction. Biofilm Biofilm formation was detected by cultivation on Congo Red agar (CRA) as described by Freeman et al. 23. Strains producing black colonies with a rough, dry and crystalline consistency were considered biofilm producers. Strains producing red colonies with rough, dry and crystalline consistency or smooth colonies were classified as non-biofilm producers. DNA Isolation and PCR Amplification of Resistance Genes Genomic DNA was extracted from CoNS isolates as reported previously by Hesselbarth and Schwarz 24. PCR amplification of resistance genes in CoNS isolates was

103 451 ERGÜN, ASLANTAŞ, KİREÇCİ ÖZTÜRK, CEYLAN, BOYAR performed using primers described by Lüthje and Schwarz 25, Choi et al. 26, Strommenger et al. 27, Martineau et al. 28, Jensen et al. 29, Vesterholm-Nielsen et al. 30, and a primer specific to 16S rdna described by Strommenger et al. 27. Also, primers for the detection of intercelluler adhesion genes, icaa and icad, were used in this study as previously described 18 (Table 1). Plasmid Profiling Plasmid DNA was prepared according to the method described by Anderson and McKay 31. Plasmid DNA was electrophoresed in 0.8% agarose gel in TAE buffer for 3 h at 60 V. At the end of electrophoresis, the gel without ethidium bromide was stained in the same buffer containing ethidium bromide (0.5 μg/ml). The gels were then viewed with a transilluminator and the images were captured by a video-camera as TIFF files. RESULTS Antimicrobial Susceptibility The data on the antimicrobial susceptibility of 70 CoNS strains are summarised in Table 1. A total of 30 (42.9%) CoNS isolates were resistant to penicillin and ampicillin, 2 of which were also resistant to tetracycline. While resistance to tetracycline was found in 8 (11.4%) strains, only 4 (5.6%) strains exhibited resistance to erytromycin. CoNS isolates that were phenotypically resistant to penicillin and ampicillin were also beta-lactamase producers by nitrocefin test. No resistance was detected for amoxycillin-clavulanic acid, gentamicin, cephalothin, enrofloxacin, or oxacillin. Prevalence of Antimicrobial Resistance Genes All penicillin ( 0.25 µg/ml) and ampicillin resistant CoNS Table 1. Oligonucleotide primers used in this study Tablo 1. Çalışmada kullanılan primerler Gene Sequence (5 3 ) Size (bp) References GAA GTA CGC AGA AGA GA aac(6 )/aph(2 ) ACA TGG CAA GCT CTA GGA AAA TAC CGC TGC GTA aph(3 )-IIIa CAT ACT CTT CCG AGC AA AAT CGG TAG AAG CCC AA ant(4 )-Ia GCA CCT GCC ATT GCT A CCT AGT AAA GCT CCG GAA meca CTA GTC CAT TCG GTC CA TAT TTT GGC TTT GTA TTC TTT CAT tetk GCT ATA CCT GTT CCC TCT GAT AA AGT TTT AGC TCA TGT TGA TG tetm TCC GAC TAT TTA GAC GAC GG TCA AAG CCT GTC GGA ATT GG erma AAG CGG TAA ACC CCT CTG AG CAT TTA ACG ACG AAA CTG GC ermb GGA ACA TCT GTG GTA TGG CG ATC TTT GAA ATC GGC TCA GG ermc CAA ACC CGT ATT CCA CGA TT TCC AAT CAT TGC ACA AAA TC msra AAA CGT CAC GCA TGT CTT CA mphc GAGACTACCAAGAAGACCTGACG CATACG CCG ATT CTC CTGAT TAC AAC TGT AAT ATC GGA GGG blaz CAT TAC ACT CTT GGC GGT TTC CAG CTC GTG TCG TGA GAT GT 16S rrna AAT CAT TTG TCC CAC CTT CG CCT AAC TAACGA AAG GTA G icaa AAG ATATAG CGATAA GTG C AAA CGT AAG AGA GGT GG icad GGC AAT ATG ATCAAG ATA C Choi et al Strommenger et al Jensen et al Martineau et al Vesterholm-Nielsen et al Strommenger et al Vasudevan et al

104 452 Antimicrobial Susceptibility... ( 0.5 µg/ml) strains carried the blaz that encode β- lactamase (Fig. 1). Of the 4 erythromycin ( 8 µg/ml) resistant isolates, three carried msra gene. This gene occured alone (n=1) or in combination with mphc (n=1), and ermc (n=1). erma was observed in only one isolate (Fig. 2). Of the 8 tetracycline resistant isolates ( 16 µg/ml), while five carried the tetk gene alone, 2 strains carried both tetk and tetm, and one harbored tetm alone (Fig. 3). None of the CoNS strains contained the genes meca, aac(6 )/ aph(2 ), aph(3 )-IIIa, ant(4 )-Ia, and ermb genes. Plasmid Analysis Plasmids were detected in 69 (98.6%) of CoNS strains Fig 1. Agarose gel electrophoresis of blaz gene. Lane 1 = 100 bp DNA marker (Fermentas) Lane 2 = blaz, Lane 3 = negative control Şekil 1. blaz geninin agaroz jel elektroforez görüntüsü. Kuyucuk 1 = 100 bp DNA marker (Fermentas), Kuyucuk 2 = blaz, Kuyucuk 3 = Negatif kontrol tested in this study. Only one CoNS isolate did not yield any plasmid of detectable size using the methods described in materials and methods. Plasmid profiles of CoNS strains are shown in Fig. 4. Size of plasmids varied from >19.3 kb to 0.9 kb. Seven different plasmid sizes (>19.3, 19.3, 7.7, 4.2, 2.3, 1.8, 1.6, 1.4, 0.9) were identified across the 69 isolates. Most of the strains showed only single plasmid band with size of 19.3 kb, but the rest of the strains had 2 to 3 plasmids ranging from >19.3 kb to 0.9 kb. The most common plasmid of 19.3 kb was detected in all strains. While 52 (74.3%) of CoNS strains contained single plasmid, 17 (24.3%) strains had multiple plasmids. We also attempted to determine whether there was a correlation between antimicrobial resistance and plasmid profiles of the CoNS isolates. As can be seen from Table 2, the 19.3 kb size plasmid was detected in every resistant isolate regardles of the resistance profile, whereas the plasmids were less commonly associated with a particular resistance phenotype. The single CoNS isolate without any detectable plasmid did not show resistance to any antimicrobials tested in this study. The observation that almost all of the CoNS isolates had the 19.3 kb plasmid, in addition to possessing other less commonly found ones, indicates that the presence of these plasmids alone was not sufficient to confer antimicrobial resistance seen in the CoNS strains tested in our study. Therefore, there is a possibility that the resistance confering genes were present on different plasmids which were gone undetected in this study and/or that the resistance traits were associated with the chromosome in the antimicrobial resistant CoNS. Although the suspect resistanceincurring genes were detected in every resistant CoNS isolate tested, the PCR was done with total genomic DNA as template in this study, and thus, it is impossible to know definitively the exact location (chromosome or plasmid) of these genes. Biofilm Of the 70 CoNS isolates included in this study, 28 (40%) Fig 2. Agarose gel electrophoresis of macrolide resistance genes. Lane 1-7 = 100 bp molecular weight marker (100 bp), Lane 2 = mphc, Lane 3 = erma, Lane 4 = ermc, Lane 5 = msra, Lane 6 = Negative control Şekil 2. Makrolid direnç genlerinin agaroz jel elektroforezi. Kuyucuk 1-7 = 100 bp moleküler marker (Fermentas), Kuyucuk 2 = mphc, Kuyucuk 3 = erma, Kuyucuk 4 = ermc, Kuyucuk 5 = msra, Kuyucuk 6 = Negatif kontrol

105 453 ERGÜN, ASLANTAŞ, KİREÇCİ ÖZTÜRK, CEYLAN, BOYAR were biofilm producers by CRA method, and 42 (60%) were found to carry both both icaa and icad genes (Fig. 5). Fourteen (20%) isolates were negative by CRA method despite their biofilm positive genotype. DISCUSSION Fig 3. Agarose gel electrophoresis of tetk and tetm genes. Lane 1-6 = 100 bp molecular marker (Fermentas), Lane 2 = 16S rrna ve tetk, Lane 3 = 16S rrna and tetm, Lane 4 = 16S rrna, tetk and tetm, Lane 5 = Negative control Şekil 3. 16S rrna, tetk ve tetm genlerinin agaroz jel elektroforez görüntüsü. Kuyucuk 1-6: 100 bp moleküler marker (Fermentas). Kuyucuk 2 = 16S rrna ve tetk, Kuyucuk 3 = 16S rrna ve tetm, Kuyucuk 4 = 16S rrna, tetk ve tetm, Kuyucuk 5 = Negatif kontrol ß-lactam antibiotics are among the most widely used antimicrobials for the control and treatment of mastitis. Higher resistance rates to ß-lactam antibiotics have been reported among Staphylococcus spp. from mastitis cases in different countries when compared with resistance rates to other antimicrobial agents 9,32,33. In accordance with previous studies, highest resistance frequency was also observed against ß-lactam antibiotics, penicillin and ampicillin (42.8%) in the present study. However, some authors emphasized species specific differences in susceptibility patterns among CoNS isolated from mastitis cases 8,9. Higher resistance rates against ß-lactam antibiotics were also reported by authors studied on bovine mastitis in different geographical regions of Turkey 13,14,33,34. The high rate of resistance against ß-lactam antibiotics detected in Fig 4. Agarose gel electrophoresis of plasmid patterns of representative CoNS isolates. Lane M= puc mix marker (Fermentas), Lane 1-15 = CoNS isolates of sheep subclinical mastitis Şekil 4. Temsili KNS izolatlarının plasmid agaroz jel elektroforezis görüntüsü. Kuyucuk 1 = puc miks marker (Fermentas), Kuyucuk 1-15 = KNS izolatlar Table 2. Distribution of MIC values for the 70 CoNS strains from subclinical sheep mastitis to antimicrobials commonly used in veterinary medicine in Turkey Tablo 2. Türkiye de subklinik koyun mastitislerinden izole edilen 70 KNS suşuna karşı veteriner hekimliğinde yaygın kullanılan antimikrobiyallerin minimum inhibitor konsantrasyon değerlerinin dağılımları No. of Isolates with MIC (mg/l) Resistant Antimicrobial Agent(s) no % Penicillin Ampicillin Amoxillin - Clavulanic Acid Cephalothin Gentamicin Erythromycin Tetracycline Enrofloxacin Oaxcillin + 2% NaCl