Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu"


1 Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara Şubat 2011, İzmir

2 Sunum Planı Teorik bilgi (20 dk) Örnekler (15 dk) Tartışma (10 dk)

3 Sekans analizi nedir? DNA baz dizilimlerinin belirlenmesi

4 DNA RNA Şeker D-deoksiriboz D-riboz Asit Fosforik asit Fosforik asit Baz A, T, G, C A, U, G, C


6 Bazlar Pürin Pirimidin Adenin Sitozin Guanin Timin

7 Nükleozid = Baz + Şeker Glikozid bağı ile birleşir, aradan su çıkar Nükleotid = Fosfat + Şeker + Baz

8 Nükleotidler DNA ve RNA yapı taşıdır

9 Sekans (DNA dizi) analizi yöntemleri 1. Kimyasal (Maxam-Gilbert) 2. Enzimatik (Sanger) 3. Pirosekanslama

10 Kimyasal yöntem DNA molekülü kinaz enzimi ile 5 fosfat ucundan 32 P ile işaretlenir. Seçici olarak 4 bazı parçalayan kimyasal maddeler kullanılarak farklı uzunluklarda DNA parçaları elde edilir. Elektroforezle ayrılan bantlar otoradyografi ile incelenir. Maxam A & Gilbert W. 1977


12 Enzimatik yöntem DNA parçası asimetrik PCR ile tek zincir halinde çoğaltılır ve kalıp olarak kullanılır. DNA polimerazlar deoksiribozun 3 pozisyonunda OH grubu taşımayan dideoksiribonükleotidleri dizilere ekler. Sentezleri ddntp kullanılarak durdurulmuş farklı uzunlukta yeni zincirler Her modifiye baz için ayrı tüplerde sentez yapılır ve ürünler denatüre akrilamid jel elektroforezinde 4 sıra halinde yürütülür. Sanger ve ark., 1980


14 Kalıp DNA lar Primer dntp karışımı Enzim Dört reaksiyon tüpünün her birine bir ddntp eklenmesinden sonra bağlanma ve uzama işlemleri uygulanmaktadır. Farklı uzunlukta DNA parçaları Jel elektroforezi

15 DNA dizi analizi 5 G C A T G C 3 Kalıp 5 Primer datp dctp dgtp dttp ddctp datp dctp dgtp dttp ddatp datp dctp dgtp dttp ddttp datp dctp dgtp dttp ddctp GddC GCddA GCAddT ddg GCATGddC GCATddG

16 G T C A kısa G C A T G C + + uzun


18 Maxam & Gilbert Yöntemi Sanger Yöntemi

19 DNA parçaları nasıl elde edilir? Maxam-Gilbert: 32 P ATCGATCGAT G için özgül reaksiyon Kimyasal yöntem 32 P ATCGATCG 32 P ATCG Parçala Temizle AT ATCGAT Radyoaktif olmayan (görünmeyen) Parçala Temizle Sanger: 32 P A,T,C,G ATCG TAGCTAGCTA Hedef Enzimatik yöntem 32 P ATCGA TAGCTAGCTA A Analog veya STOP ATCG TAGCTAGCTA A Devam Yeni parçalar üretme Sonlandırma

20 Sanger Yöntemi 5 Normal bağlanma 3 1 OH PO 4 2- Fosfodiester bağı 5 3 dideoxynuceotide H 2 H ddntp A 5 P R P R P R P R P R P R Reaksiyona girmez A 4 3 Sonlanma 5 6

21 DNA dizisi nasıl sonlandırılır? Bir nükleotid farkı olan DNA parçaları jelde ayrılır 32 P 32 P 32 P 32 P 32 P 32 P 32 P 32 P 32 P 32 P ATCGATCGAT ATCGATCGA ATCGATCG ATCGATC ATCGAT ATCGA ATCG ATC AT A PAGE T A G C G C T A Fakat bu bantlar bize son nükleotid bilgisini vermez Aynı nükleotid ile biten dizileri gruplar isek, tüm genomu tanımlayabiliriz.

22 OTOMATİZE DNA DİZİ ANALİZİ Floresans boya Leroy Hood ve ark. 1986



25 Kapiller Elektroforez


27 Kromatogram analizi

28 DNA sekans cihazları Cihaz Kapiller sayıları

29 PCR Saflaştırma Cycle Sequencing (ddntp) Presipitasyon Kapiller jel elektroforezi ve okuma

30 HEDEF ssdna vektörleri M13 puc PCR dsdna (+/- PCR)

31 Primerler Genel primerler ucuz, hızlı, kolay Özel primerler pahalı, yavaş, özgül

32 UZAMA Polimeraz Sekans (Cycle Sequencing) Sonlandırma Boyama=İşaretleme ( Big Dye ) dda,c,g,t

33 AYIRMA Jel Elektroforezi Kapiller Elektroforez Otomatize edilebilir Hızlı (2 saat) Basit ısı kontrolü 96 kuyucuk

34 PİROSEKANSLAMA Sekans primeri tek zincirli DNA kalıbına hibridize olur. 4 deoksinükleotid trifosfattan (dntp) ilki reaksiyona eklenir. Her nükleotid yerleşimine, yerleşen nükleotid miktarı kadar pirofosfat (PPi) salınımı eşlik eder.


36 PİROSEKANSLAMA Elektroforez gerektirmez Hızlıdır Her dntp sıra ile eklenir Komplimenter değilse hızla ortadan kaldırılır

37 454 Teknolojisi Başlangıçta DNA bp parçalara ayrılır Her sona bir adaptör bağlanır Bir adaptör biotin içerir ve streptavidin-kaplı boncuklara bağlanır. Boncuk / DNA oranı kontrol edilir. Her boncuğa bir DNA bağlanması sağlanır. Boncuklara yağ eklenir ve bir sütsü sıvı yaratılır. PCR yapılır. DNA kopyalanır.

38 454 Teknolojisi Yağ uzaklaştırılır. Boncuklar picotiter plaklarına eklenir. Her bir kuyucuğa bir boncuk yerleşir. Her kuyucuğa pirosekans enzimi eklenir. Her plak tekrar tekrar dntp ile yıkanır. Gerekli kimyasallar eklenir. Plak fiber optik çip ile kaplanır. Her kuyucuktan ayrılan ışıma CCD kamera ile okunur.

39 DNA dizi analizi ile mantarların tanımlanması Örnekler

40 rdna bölgesi 5.8S 5S 18S ITS1 ITS2 26S IGS1 IGS2 18S ITS : Internal Transcribed Spacer IGS : Intergenic Spacer 8,188 bp

41 Hangi bölgeyi dizileyelim? 18S 26S ITS IGS Sınıf Aile Cins Tür Köken

42 DNA benzerliği Aynı tür > 70% Farklılık 30-70% Farklı tür < 30%

43 rrna gen bölgesi için kullanılacak primer dizileri Subunit or spacer region Name of primer Sequence ITS region ITS1 (forward) TCCGTAGGTGAACCTGCGG ITS4 (reverse) TCCTCCGCTTATTGATATG D1/D2 LSU NL1 (forward) GCATATCAATAAGCGGAGGAAAAG NL4 reverse) GGTCCGTGTTTCAAGACGG

44 DNA dizi analizi ile mantarların tanımlanması Malassezia rrna geni S ITS1 ITS2 5.8S 26S IGS1 5S IGS2 18S ITS : Internal Transcribed Spacer IGS : Intergenic Spacer 8,188 bp

45 IGS bölgesi IGS1 IGS2 C. albicans Cr. neoformans T. asahii M. globosa (kbp)

46 IGS & ITS 100 ITS benzerliği (%) IGS benzerliği (%)

47 IGS analizi ile epidemiyolojik karşılaştırma yapılabilir.


49 Trichosporon asahii kökenlerinin IGS analizi ile genotiplendirilmesi Türkiye Japonya % ABD 0 Genotip

50 Uygulama örneği Fenotipik yöntemler ile tür tanımı yapılamayan bir mantar 5.8S 5S 18S 26S 18S ITS 1 ITS 4 IGS 1 IGS 2 DNA DİZİ ANALİZİ

51 PCR Saflaştırma Cycle Sequencing (ddntp) Presipitasyon Kapiller jel elektroforezi ve okuma

52 Dizilenecek üründen DNA elde edilir. Bu ürün genellikle mantar kolonisidir. Nadiren hasta örneklerinde bulunan fungal DNA da dizilenebilir. Elde edilen DNA miktarı ve kalitesi MUTLAKA ölçülür. Çok düşük (10-50ng/mikrolitre) DNA olan örneklerde dizi analizi sonucu başarılı olmayabilir. DNA miktarı yüksek ve saf olan örneklerde tür tanımı daha doğru yapılır. Nanodrop (USA) Bir hedef seçilerek çoğaltma yapılır.

53 Amplifikasyon karışımı 10x buffer 3.5 l dntp 2.8 l (36.6nmol) Forward primer 0.14 l (100pmol) Reverse primer 0.14 l (100 pmol) Taq polimeraz l (250 U) SU l HER TÜPE 34 l dağıt 1 l DNA ekle. Termal cycler cihazına yükle.

54 PROGRAM (IGS 1-IGS 2 primerleri için) 94 0 C 1 dk 94 0 C 30 sn 57 0 C 30 sn x 33 Siklüs 72 0 C 30 sn 72 0 C 10 dk ADI IGS 1 IGS 2 DİZİSİ 5 -ATC CTT TGC AGA CGA CTT AGC TTG ACT TCG CAG ATC

55 Amplifikasyon sonrasında PCR ürünü MUTLAK elektroforez yürütülür. Kontrol edilir. Sekans öncesi mutlak gereklidir. Yürütme sırasında 1 birim yükleme tamponu, 3 birim örnek yüklenir. PCR sonrasında mutlak pürifikasyon yapılır. Pürifikasyon için spin kolon protokolü kullanılır. Pürifiye edilen ürünlerde ürün tekrar ölçülür veya tekrar elektroforez yapılır. Kontrol için.

56 Cycle Sequencing (ddntp) BigDye daha önceden 6 l halinde 0.2 lik ependorflara hazırlanarak -20 de bekletilebilir. 20 l karışım için her tüpe tek tek şunlar eklenir; BigDye 6 l (HAZIR) Hedef PCR ürünü (pürifikasyon sonrası ürün) 1 l Primer (reverse primer) 0.65 l SU l Program: 96 0 C 10 sn 50 0 C 5 sn X 25 siklüs 60 0 C 4 dk

57 BigDye Cycle sequencing sonrası pürifikasyon Pürifikasyon için, etil alkol kullanılır. 20 l BigDye ürünü içeren ependorf termal cycler dan çıkarılıp üzerine 3.3 l NaOAc (sodyum asetat) eklenir. Pipetaj yapılır. Karışımın üzerine 2.5 kat (20+3.3=23.3 X 2.5 = l) Etil alkol (%100) eklenir rpm 15 dk santrifüj yapılır. Süpernatan atılır. Çökelek üzerine 100 l %70 lik Etil alkol konur rpm 5 dk santrifüj yapılır. Süpernatan atılır rpm 3 dk santrifüj 10 l lik pipet ile kalan etil alkol çekilir. Ependorflar vakumlu santrifüj ile kurutulur C de saklanır.

58 Etanol pürifikasyonu sonrası YİNE DNA ölçülür. Kalite kontrolü için. Otomatik sekans cihazına yüklenir. Burada yapılan kapiler jel eketroforezidir. Tek yönde uzatılmış (BigDye) DNA burada tek tek okunur. Elde edilen nükleotid dizisi veri kütüphaneleri ile karşılaştırılarak tür tanımlaması yapılır.

59 Hizalama Göz ile kontrol!!!!!

60 İşlem basamakları DNA eldesi DNA ölçümü PCR Elektroforez Pürifikasyon DNA ölçümü Elektroforez Cycle sequencing Pürifikasyon DNA ölçümü Kapiller elektroforez Veri analizi

61 Fungal DNA dizi analizi bize neler sağlar?? Kesin tür tanımı Alt tür Filogenetik analiz Mutasyon analizi Direnç bölgelerinde mutasyon Virülans genlerinde mutasyon


MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara Taksonomik terimler Alem (Kingdom) Bölüm veya şube (divisio, filum)






MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ DNA dizi analizleri ya da sekanslama; DNA birincil (temel) yapılarının belirlenmesinde kullanılan yöntemlerdir, DNA nın nukleotid dizilerinin saptanması anlamına gelir.



KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7


İşlevsel Genomik Nedir?

İşlevsel Genomik Nedir? İşlevsel Genomik Nedir? İşlevsel Genomik, yapısal genomik tarafından sağlanan bileşenlerin ve bilginin kullanımı ile gen işlevinin değerlendirilmesinde, deneysel yaklaşımların (genom veya sistem boyunca)


DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY

DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY DNA Sekanslama ve Filogenetik Analizler Dr. Eda UĞURTAY DNA baz dizilimlerinin belirlenmesidir. İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. Kullanım



BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür


Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı

Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı 4. Ha&a Polimeraz Zincir Reaksiyonu Mikrobiyoloji Anabilim Dalı Sunu içeriği PCR ın tanımı PCR ın kısa tarihçesi Hücre içi DNA replikasyonu PCR bileşenleri PCR temel prensipler PCR ın kullanım alanları


DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi SEKANS TEKNİKLERİ DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un


Moleküler Biyolojide Kullanılan Yöntemler-5

Moleküler Biyolojide Kullanılan Yöntemler-5 Moleküler Biyolojide Kullanılan Yöntemler-5 Polimeraz zincir reaksiyonu (PCR) (DNA nın in vitro çoğaltılması) 2 Hücrede doğal olarak (in vivo)gerçekleşen replikasyon, in vitro koşullarda da (hücre dışında)


DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi


Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION


Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ Nükleik asitler Sıcaklıkla öldürülmüş S suşları Canlı R suşlarını canlı S suşuna dönüştürür a) Farelere virulan S suşu enjekte edildiğinde ölür b) R suşu enjekte edildiğinde yaşar c) Isıyla öldürülmüş


Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören

Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu Dr. Mahmut Çerkez Ergören Genetik materyal; Kendini çoğaltır. Bilgi depolar. Bilgiyi ifade eder. Mutasyonla varyasyonlara izin verir. Genetik Tarihçe


DNA Dizi Analiz Yöntemleri

DNA Dizi Analiz Yöntemleri DNA Dizi Analiz Yöntemleri DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine



BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER Bilgi paylaştıkça çoğalır. BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER NÜKLEİK ASİTLER Nükleik asitler, bütün canlı hücrelerde ve virüslerde bulunan, nükleotid birimlerden


Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03. Laboratuvar Tekniği Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.2014) 1 5. Haftanın Ders İçeriği DNA ekstraksiyonu DNA ekstraksiyonunun amacı


Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.


RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod


SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006 SEKANS TEKNİKLERİ GENOMİK-PROTEOMİK Ders Sorumlusu: Doç.Dr. Hatice MERGEN Hazırlayan: Levent ZORBEK Ankara,2006 DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem;



DİZİ ANALİZİ (SEKANS) TEKNİKLERİ DİZİ AALİZİ (SEKAS) TEKİKLERİ DA dizi analizi, gen yapısı ve genetik kontrol mekanizmaları hakkında bir çok bilgi edinmemizi sağlamıştır. erhangi bir organizmadan çok miktarda saf DA elde edilmesini sağlayan


Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler


İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır.

İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine hibridizasyonuna dayanır.


Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans


Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını


Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A


Epigenetik modifikasyonlarla çalışma yöntemleri.

Epigenetik modifikasyonlarla çalışma yöntemleri. Epigenetik modifikasyonlarla çalışma yöntemleri Epigenetik modifikasyonlarla çalışma yöntemleri DNA metilasyonu bisülfit dizileme TTCGCCGACTAA TTCGCCGAuTAA



12. SINIF KONU ANLATIMI 2 DNA VE RNA 12. SINIF KONU ANLATIMI 2 DNA VE RNA DNA (DEOKSİRİBONÜKLEİK ASİT) Temel nükleik asittir. Prokaryot hücrelerin sitoplazmasında, ökaryot hücrelerde çekirdek, mitokondri ve kloroplast organelinde bulunur.


Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml


Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim

Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim PCR nedir? DNA Polimeraz enzimi kullanılarak DNA nın spesifik bir parçasının in vitro (bir tüp içerisinde)



GIDA BİYOTEKNOLOJİSİ-2 DNA nın replikasyonu GIDA BİYOTEKNOLOJİSİ-2 1 2 DNA Replikasyonu (DNA çoğalması, DNA ikileşmesi, DNA sentezi) Bir hücrenin bölünebilmesi için DNA nın da çoğalması gerekir. DNA replikasyon mekanizmasının



HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla


Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT


PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade


16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 16S rrna Analizi Doç. Dr. Zeynep Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum içeriği Genel bilgi Uygulanışı Kullanım alanları Avantajları Dezavantajları Neden


DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon


Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya


Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen


Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji nabilimdalı 5. Yeni Nesil Dizileme Kongresi Yeni Nesil Dizileme Pazarı 2018 de tahmin edilen pazar payı4 milyar


III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler


Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON

Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON Biyoteknoloji ve Genetik II Hafta 8 TRANSLASYON Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: TRANSLASYON Translasyon a. mrna ribozoma


Protokolü PD S Reaksiyon

Protokolü PD S Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S00 0 50 Reaksiyon REŞİT GALİP CADDESİ 74-7 06700 ÇANKAYA, ANKARA, TÜRKİYE T +90 32 447 22 79 / 80 F +90 32 447 22 07 İnternal Pozitif



TRANSLASYON VE TRANKRİPSİYON TRANSLASYON VE TRANKRİPSİYON GEN İFADESİ (GEN EKSPRESYONU) Gen ifadesinin düzenlenmesi çeşitli aşamalarda olur: 1) Primer transkriptlerin oluşumu 2) Primer mrna dan matür (olgun) mrna oluşumu 3) mrna nın



REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda


Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil


RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050



11. Hafta: Prof. Dr. Şule PEKYARDIMCI NÜKLEOTİDLER 11. Hafta: Nükleik Asitler: Nükleik asitlerin yapısal üniteleri, nükleozitler, nükleotidler, inorganik fosfat, nükleotidlerin fonksiyonları, nükleik asitler, polinükleotidler, DNA nın primer ve sekonder


Dilara YILDIRAN. Candida İzolatlarının Tür Düzeyinde. ve MALDI-TOF MS Sistemlerinin Karşılaştırılması. Mikr. Uzm.

Dilara YILDIRAN. Candida İzolatlarının Tür Düzeyinde. ve MALDI-TOF MS Sistemlerinin Karşılaştırılması. Mikr. Uzm. Candida İzolatlarının Tür Düzeyinde Tanımlanmasında Altın Standart Yöntem Olan rdna ITS1/2 Dizi Analizi ile VITEK 2 YEAST ID, API ID 32C ve MALDI-TOF MS Sistemlerinin Karşılaştırılması D i l a r a Y ı


HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine



MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite


1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8)

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8) KONU-7. MOLEKÜLER BĠYOLOJĠDE TEMEL TEKNĠKLER BĠTKĠDEN GENOMĠK DNA ĠZOLASYONU Kullanılan Tamponlar: 1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol,





Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak BİYOFİZİK 2015 1 Amaç Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak 2 Hedefler Bu pratiğin sonunda öğrenciler, polimeraz zincir



TRANSLASYON VE DÜZENLENMESİ TRANSLASYON VE DÜZENLENMESİ TRANSLASYON Translasyonda nükleik asit kullanılır fakat son ürün bir nükleik asit değil proteindir. Translasyon mekanizması 4 ana bileşenden oluşmaktadır: 1. mrnalar 2. trnalar


Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: Tel: 2225826/202 Ders Notları Đçin: adresinden Genombilimde


LYS ANAHTAR SORULAR #4. Nükleik Asitler ve Protein Sentezi

LYS ANAHTAR SORULAR #4. Nükleik Asitler ve Protein Sentezi LYS ANAHTAR SORULAR #4 Nükleik Asitler ve Protein Sentezi 1) İncelenen bir nükleotidin DNA ya mı yoksa RNA ya mı ait olduğu; I. Bağ çeşidi II. Pürin bazı çeşidi III. Pirimidin bazı çeşidi IV. Şeker çeşidi



MİKROBİYOLOJİDE BİYOTEKNOLOJİ MİKROBİYOLOJİDE BİYOTEKNOLOJİ Biyoteknoloji; Genetik materyallerde moleküler düzeyde yapılan manipulasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde etmektir 1920 li yıllar...



MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL MİKROBİYOLOJİDE BİYOTEKNOLOJİ Doç. Dr. Funda BAĞCIGİL Biyoteknoloji; Genetik materyallerde moleküler düzeyde yapılan manipulasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde etmektir


SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.


ÜNİTE 6 Nükleoproteinler ve Nükleik Asitler

ÜNİTE 6 Nükleoproteinler ve Nükleik Asitler ÜNİTE 6 Nükleoproteinler ve Nükleik Asitler Amaçlar Bu üniteyi çalıştıktan sonra; Nükleoprotein ve nükleik asitlerin yapısını, Nükleozid, nükleotid tanımlarını, Azotlu bazları, Nükleik asitlerin metabolizmasını



SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) Geleneksel olarak bireylerin kendisini, atalarını ve varsa döllerinin bilgilerini içeren kriterlere göre seleksiyon yapılmaktadır. Elde edilen


NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller)

NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller) NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller) NÜKLEİK ASİTLERİN KEŞFİ *FRIEDRICH MIESCHER * Balık spermlerinin çekirdeklerini ve akyuvar çekirdeklerini ayrıştırarak yaptığı çalışmalarda, bu hücrelerin


MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER GİRİŞ Ara Sınav 50 Ödev 30 Performans Görevi (Seminer) 20

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER GİRİŞ Ara Sınav 50 Ödev 30 Performans Görevi (Seminer) 20 MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER Dersin içeriği Nükleik asitler Hücre parçalama yöntemleri Ayırma ve saflaştırma yöntemleri (filtrasyon, diyaliz, çöktürme santrifüjleme vb) DNA izolasyonu ve analizi



A. DNA NIN KEŞFİ VE ÖNEMİ DNA nın Yapısı ve Replikasyonu Biyoloji Ders Notları A. DNA NIN KEŞFİ VE ÖNEMİ İlk olarak Friedrich Miescher (1869) akyuvar hücreleri ve balık sperminde yönetici molekülleri tespit etmiştir. Çekirdekte



YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE YAZILIYA HAZIRLIK SORULARI 12. Sınıf 1 GENDEN PROTEİNE Protein sentezini tüm canlılar gerçekleştirir. Bir mrna molekülünde en fazla 64 çeşit kodon bulunur. DOĞRU YANLIŞ SORULARI Canlıların heterotrof beslenenleri






DNA REPLİKASYONU. Doç.Dr. TUĞBA YILMAZ ÖZDEN DNA REPLİKASYONU Doç.Dr. TUĞBA YILMAZ ÖZDEN DNA sentezi (replikasyon) DNA çift heliksini oluşturan iki zincir birbirinden ayrıldığında, bu zincirlerden her biri sentezlenecek yeni zincir için kalıp olarak



Uzm. Bio. NUR YILDIRIM Uzm. Bio. NUR YILDIRIM Genlerin çok büyük ve çok sayıda ekzondan oluştuğu göz önüne alındığında, bu genleri Sanger sekanslama ve genom boyu SNP genotiplemesi gibi klasik genetik metodlarla taramak hem


RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500


Genetik materyal: DNA replikasyonu

Genetik materyal: DNA replikasyonu Genetik materyal: DNA replikasyonu Umut Fahrioglu, PhD MSc DNA Replikasyonu DNA replikasyonu genomların ve içerdikleri genlerin nesilden nesile aktarılmasında çok önemli bir rol oynar. Hücreden hücreye


Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR İçerik (2


C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi


Hücre zarının yapısındaki yağlardan eriyerek hücre zarından geçerler.fazlalıkları karaciğerde depo edilir.

Hücre zarının yapısındaki yağlardan eriyerek hücre zarından geçerler.fazlalıkları karaciğerde depo edilir. DERS: BİYOLOJİ KONU: C.T.B(Vitaminler e Nükleik Asitler) VİTAMİNLER Bitkiler ihtiyaç duydukları bütün vitaminleri üretip, insanlar ise bir kısmını hazır alır. Özellikleri: Yapıcı, onarıcı, düzenleyicidirler.


RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA (Ribonükleik Asit) Nükleik asitler, Friedrich Miescher tara2ndan 1869'da keşfedildi. İl=haplı bandajlardan izole edilen bu maddeye nüklein adını

Detaylı YÖNETİCİ MOLEKÜLLER C, H, O, N, P atomlarından meydana gelir. Hücrenin en büyük yapılı molekülüdür. Yönetici moleküller hücreye ait genetik bilgiyi taşır, hayatsal faaliyetleri yönetir, genetik bilginin


RNA DNA. Nükleosit Baz + Şeker Riboz (RNA) Deoksiriboz (DNA) Ribonükleozitler : Adenozin, Pürinler: Pirimidinler: AveGdışında

RNA DNA. Nükleosit Baz + Şeker Riboz (RNA) Deoksiriboz (DNA) Ribonükleozitler : Adenozin, Pürinler: Pirimidinler: AveGdışında Bazlar : Nükleik Asitlerin karakteristik Özellikleri DNA RNA Yasin EREN Recep LiMAN Muhsin KONUK Nükleik Asitlerin Yapısı Pürinler: Pirimidinler: AveGdışında TU T,U ve Sdışında d bazı theobromin, kafein,



DNA ve RNA NIN YAPISI. Yrd.Doç.Dr. Özlem KURT ŞİRİN DNA ve RNA NIN YAPISI Yrd.Doç.Dr. Özlem KURT ŞİRİN Bu derste neler öğreneceğiz? Nükleotid tanımı ve yapısı DNA nın primer, sekonder ve tersiyer yapısı RNA çeşitleri ve yapıları Canlılarda, genetik bilginin


07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon


HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden



MİKROBİYOLOJİ ANABİLİM DALI BİYOTEKNOLOJİ DERS NOTLARI MİKROBİYOLOJİ ANABİLİM DALI BİYOTEKNOLOJİ DERS NOTLARI Biyoteknoloji, genetik materyallerde moleküler düzeyde yapılan manipülasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde


Farmakogenetikte Kullanılan Temel Yöntemler

Farmakogenetikte Kullanılan Temel Yöntemler Farmakogenetikte Kullanılan Temel Yöntemler Dr. Melih Ö. Babaoğlu Hacettepe Üniversitesi Tıp Fakültesi Farmakoloji A.D. XIII. TFD Eğitim Sempozyumu Van 1 Hastalık derecesi Fizyolojik durum İlaç etkileşmeleri


MOLEKÜLER BİYOLOJİ. Dr. ismail Bezirganoglu

MOLEKÜLER BİYOLOJİ. Dr. ismail Bezirganoglu MOLEKÜLER BİYOLOJİ Dr. ismail Bezirganoglu DNA YAPISI Kimyasal anlamda DNA, nükleotid denilen yapıtaşlarından oluşan bir zincirdir. Her nükleotid bir şeker, bir baz ve bir fosfat dan oluşur. Bu bölümün





Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık


SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi


Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Türkiye'de 2015-2016 İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Dilek Güldemir 1,Ayşe Başak Altaş 1,Fatma Filiz Arı 1,Zekiye Bakkaloğlu 1,Özlem Ünaldı 1,Fatma


DNA REPLİKASYONU. Dr. Mahmut Cerkez Ergoren

DNA REPLİKASYONU. Dr. Mahmut Cerkez Ergoren DNA REPLİKASYONU Dr. Mahmut Cerkez Ergoren Arthur Kornberg 1959 Nobel Ödülü "the mechanisms in the biological synthesis of DNA DNA Replikasyonu Replikasyon genetik materyalin tamamen kendi benzeri yeni


DNA izolasyonu hangi amaçlarla yapılır?

DNA izolasyonu hangi amaçlarla yapılır? 3. Ha&a DNA izolasyonu hangi amaçlarla yapılır? Klonlama Teşhis PCR Hibridizasyon yöntemleri (Southern blotting) Tiplendirme (RFLP) Korunma Örn. DNA aşıları " DNA fingerprinting ile adli tıp " analık babalık


MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı

MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı MERKEZ LABORATUVAR Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı Yüksek Performans Sıvı Kromatografisi (HPLC) Karbonhidratların, organik asitlerin, vitaminlerin, amino asitlerin


Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri mrna trna - rrna Taşıyıcı (transfer) RNA (trna) Nispeten küçük moleküllerdir. Bir öncu molekülün nükleusta işlenmesiyle oluşurlar. trna molekülleri, mrna


Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:


attomol apo B-100 quicktype

attomol apo B-100 quicktype attomol apo B-100 quicktype İnsan apolipoprotein B-100 (apo B-3500 mutasyonu) gen inde 10708G>A geçiş tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1015


Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir.

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. METABOLİZMA ve ENZİMLER METABOLİZMA Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. A. ÖZÜMLEME (ANABOLİZMA) Metabolizmanın yapım reaksiyonlarıdır. Bu tür olaylara


Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi


Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor!

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor! Uygulamalı Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları Yaz Dönemi Başlıyor! : DNA izolasyonu, Primer tasarımı, PCR Teknikleri, Agaroz Jel Elektroforezi,


REKOMBİNAT DNA TEKNOLOJİSİ TEMEL İLKELERİ VE UYGULAMA ALANLARI. Yard.Doç.Dr. Gülay Büyükköroğlu Eczacılık Fakültesi Farmasötik Biyoteknoloji ABD.

REKOMBİNAT DNA TEKNOLOJİSİ TEMEL İLKELERİ VE UYGULAMA ALANLARI. Yard.Doç.Dr. Gülay Büyükköroğlu Eczacılık Fakültesi Farmasötik Biyoteknoloji ABD. REKOMBİNAT DNA TEKNOLOJİSİ TEMEL İLKELERİ VE UYGULAMA ALANLARI Yard.Doç.Dr. Gülay Büyükköroğlu Eczacılık Fakültesi Farmasötik Biyoteknoloji ABD. Tarihçe Rekombinant DNA teknolojisine ilişkin deneysel çalışmalar


Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler

Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler ADANA BİLİM ve TEKNOLOJİ ÜNİVERSİTESİ Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler Ar. Gör. Sevgin DIBLAN Yrd. Doç. Dr. Pınar KADİROĞLU 1 İçerik Tağşiş nedir ve etkileri Gıda tağşişinin



REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda



