Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu"


1 Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara Şubat 2011, İzmir

2 Sunum Planı Teorik bilgi (20 dk) Örnekler (15 dk) Tartışma (10 dk)

3 Sekans analizi nedir? DNA baz dizilimlerinin belirlenmesi

4 DNA RNA Şeker D-deoksiriboz D-riboz Asit Fosforik asit Fosforik asit Baz A, T, G, C A, U, G, C


6 Bazlar Pürin Pirimidin Adenin Sitozin Guanin Timin

7 Nükleozid = Baz + Şeker Glikozid bağı ile birleşir, aradan su çıkar Nükleotid = Fosfat + Şeker + Baz

8 Nükleotidler DNA ve RNA yapı taşıdır

9 Sekans (DNA dizi) analizi yöntemleri 1. Kimyasal (Maxam-Gilbert) 2. Enzimatik (Sanger) 3. Pirosekanslama

10 Kimyasal yöntem DNA molekülü kinaz enzimi ile 5 fosfat ucundan 32 P ile işaretlenir. Seçici olarak 4 bazı parçalayan kimyasal maddeler kullanılarak farklı uzunluklarda DNA parçaları elde edilir. Elektroforezle ayrılan bantlar otoradyografi ile incelenir. Maxam A & Gilbert W. 1977


12 Enzimatik yöntem DNA parçası asimetrik PCR ile tek zincir halinde çoğaltılır ve kalıp olarak kullanılır. DNA polimerazlar deoksiribozun 3 pozisyonunda OH grubu taşımayan dideoksiribonükleotidleri dizilere ekler. Sentezleri ddntp kullanılarak durdurulmuş farklı uzunlukta yeni zincirler Her modifiye baz için ayrı tüplerde sentez yapılır ve ürünler denatüre akrilamid jel elektroforezinde 4 sıra halinde yürütülür. Sanger ve ark., 1980


14 Kalıp DNA lar Primer dntp karışımı Enzim Dört reaksiyon tüpünün her birine bir ddntp eklenmesinden sonra bağlanma ve uzama işlemleri uygulanmaktadır. Farklı uzunlukta DNA parçaları Jel elektroforezi

15 DNA dizi analizi 5 G C A T G C 3 Kalıp 5 Primer datp dctp dgtp dttp ddctp datp dctp dgtp dttp ddatp datp dctp dgtp dttp ddttp datp dctp dgtp dttp ddctp GddC GCddA GCAddT ddg GCATGddC GCATddG

16 G T C A kısa G C A T G C + + uzun


18 Maxam & Gilbert Yöntemi Sanger Yöntemi

19 DNA parçaları nasıl elde edilir? Maxam-Gilbert: 32 P ATCGATCGAT G için özgül reaksiyon Kimyasal yöntem 32 P ATCGATCG 32 P ATCG Parçala Temizle AT ATCGAT Radyoaktif olmayan (görünmeyen) Parçala Temizle Sanger: 32 P A,T,C,G ATCG TAGCTAGCTA Hedef Enzimatik yöntem 32 P ATCGA TAGCTAGCTA A Analog veya STOP ATCG TAGCTAGCTA A Devam Yeni parçalar üretme Sonlandırma

20 Sanger Yöntemi 5 Normal bağlanma 3 1 OH PO 4 2- Fosfodiester bağı 5 3 dideoxynuceotide H 2 H ddntp A 5 P R P R P R P R P R P R Reaksiyona girmez A 4 3 Sonlanma 5 6

21 DNA dizisi nasıl sonlandırılır? Bir nükleotid farkı olan DNA parçaları jelde ayrılır 32 P 32 P 32 P 32 P 32 P 32 P 32 P 32 P 32 P 32 P ATCGATCGAT ATCGATCGA ATCGATCG ATCGATC ATCGAT ATCGA ATCG ATC AT A PAGE T A G C G C T A Fakat bu bantlar bize son nükleotid bilgisini vermez Aynı nükleotid ile biten dizileri gruplar isek, tüm genomu tanımlayabiliriz.

22 OTOMATİZE DNA DİZİ ANALİZİ Floresans boya Leroy Hood ve ark. 1986



25 Kapiller Elektroforez


27 Kromatogram analizi

28 DNA sekans cihazları Cihaz Kapiller sayıları

29 PCR Saflaştırma Cycle Sequencing (ddntp) Presipitasyon Kapiller jel elektroforezi ve okuma

30 HEDEF ssdna vektörleri M13 puc PCR dsdna (+/- PCR)

31 Primerler Genel primerler ucuz, hızlı, kolay Özel primerler pahalı, yavaş, özgül

32 UZAMA Polimeraz Sekans (Cycle Sequencing) Sonlandırma Boyama=İşaretleme ( Big Dye ) dda,c,g,t

33 AYIRMA Jel Elektroforezi Kapiller Elektroforez Otomatize edilebilir Hızlı (2 saat) Basit ısı kontrolü 96 kuyucuk

34 PİROSEKANSLAMA Sekans primeri tek zincirli DNA kalıbına hibridize olur. 4 deoksinükleotid trifosfattan (dntp) ilki reaksiyona eklenir. Her nükleotid yerleşimine, yerleşen nükleotid miktarı kadar pirofosfat (PPi) salınımı eşlik eder.


36 PİROSEKANSLAMA Elektroforez gerektirmez Hızlıdır Her dntp sıra ile eklenir Komplimenter değilse hızla ortadan kaldırılır

37 454 Teknolojisi Başlangıçta DNA bp parçalara ayrılır Her sona bir adaptör bağlanır Bir adaptör biotin içerir ve streptavidin-kaplı boncuklara bağlanır. Boncuk / DNA oranı kontrol edilir. Her boncuğa bir DNA bağlanması sağlanır. Boncuklara yağ eklenir ve bir sütsü sıvı yaratılır. PCR yapılır. DNA kopyalanır.

38 454 Teknolojisi Yağ uzaklaştırılır. Boncuklar picotiter plaklarına eklenir. Her bir kuyucuğa bir boncuk yerleşir. Her kuyucuğa pirosekans enzimi eklenir. Her plak tekrar tekrar dntp ile yıkanır. Gerekli kimyasallar eklenir. Plak fiber optik çip ile kaplanır. Her kuyucuktan ayrılan ışıma CCD kamera ile okunur.

39 DNA dizi analizi ile mantarların tanımlanması Örnekler

40 rdna bölgesi 5.8S 5S 18S ITS1 ITS2 26S IGS1 IGS2 18S ITS : Internal Transcribed Spacer IGS : Intergenic Spacer 8,188 bp

41 Hangi bölgeyi dizileyelim? 18S 26S ITS IGS Sınıf Aile Cins Tür Köken

42 DNA benzerliği Aynı tür > 70% Farklılık 30-70% Farklı tür < 30%

43 rrna gen bölgesi için kullanılacak primer dizileri Subunit or spacer region Name of primer Sequence ITS region ITS1 (forward) TCCGTAGGTGAACCTGCGG ITS4 (reverse) TCCTCCGCTTATTGATATG D1/D2 LSU NL1 (forward) GCATATCAATAAGCGGAGGAAAAG NL4 reverse) GGTCCGTGTTTCAAGACGG

44 DNA dizi analizi ile mantarların tanımlanması Malassezia rrna geni S ITS1 ITS2 5.8S 26S IGS1 5S IGS2 18S ITS : Internal Transcribed Spacer IGS : Intergenic Spacer 8,188 bp

45 IGS bölgesi IGS1 IGS2 C. albicans Cr. neoformans T. asahii M. globosa (kbp)

46 IGS & ITS 100 ITS benzerliği (%) IGS benzerliği (%)

47 IGS analizi ile epidemiyolojik karşılaştırma yapılabilir.


49 Trichosporon asahii kökenlerinin IGS analizi ile genotiplendirilmesi Türkiye Japonya % ABD 0 Genotip

50 Uygulama örneği Fenotipik yöntemler ile tür tanımı yapılamayan bir mantar 5.8S 5S 18S 26S 18S ITS 1 ITS 4 IGS 1 IGS 2 DNA DİZİ ANALİZİ

51 PCR Saflaştırma Cycle Sequencing (ddntp) Presipitasyon Kapiller jel elektroforezi ve okuma

52 Dizilenecek üründen DNA elde edilir. Bu ürün genellikle mantar kolonisidir. Nadiren hasta örneklerinde bulunan fungal DNA da dizilenebilir. Elde edilen DNA miktarı ve kalitesi MUTLAKA ölçülür. Çok düşük (10-50ng/mikrolitre) DNA olan örneklerde dizi analizi sonucu başarılı olmayabilir. DNA miktarı yüksek ve saf olan örneklerde tür tanımı daha doğru yapılır. Nanodrop (USA) Bir hedef seçilerek çoğaltma yapılır.

53 Amplifikasyon karışımı 10x buffer 3.5 l dntp 2.8 l (36.6nmol) Forward primer 0.14 l (100pmol) Reverse primer 0.14 l (100 pmol) Taq polimeraz l (250 U) SU l HER TÜPE 34 l dağıt 1 l DNA ekle. Termal cycler cihazına yükle.

54 PROGRAM (IGS 1-IGS 2 primerleri için) 94 0 C 1 dk 94 0 C 30 sn 57 0 C 30 sn x 33 Siklüs 72 0 C 30 sn 72 0 C 10 dk ADI IGS 1 IGS 2 DİZİSİ 5 -ATC CTT TGC AGA CGA CTT AGC TTG ACT TCG CAG ATC

55 Amplifikasyon sonrasında PCR ürünü MUTLAK elektroforez yürütülür. Kontrol edilir. Sekans öncesi mutlak gereklidir. Yürütme sırasında 1 birim yükleme tamponu, 3 birim örnek yüklenir. PCR sonrasında mutlak pürifikasyon yapılır. Pürifikasyon için spin kolon protokolü kullanılır. Pürifiye edilen ürünlerde ürün tekrar ölçülür veya tekrar elektroforez yapılır. Kontrol için.

56 Cycle Sequencing (ddntp) BigDye daha önceden 6 l halinde 0.2 lik ependorflara hazırlanarak -20 de bekletilebilir. 20 l karışım için her tüpe tek tek şunlar eklenir; BigDye 6 l (HAZIR) Hedef PCR ürünü (pürifikasyon sonrası ürün) 1 l Primer (reverse primer) 0.65 l SU l Program: 96 0 C 10 sn 50 0 C 5 sn X 25 siklüs 60 0 C 4 dk

57 BigDye Cycle sequencing sonrası pürifikasyon Pürifikasyon için, etil alkol kullanılır. 20 l BigDye ürünü içeren ependorf termal cycler dan çıkarılıp üzerine 3.3 l NaOAc (sodyum asetat) eklenir. Pipetaj yapılır. Karışımın üzerine 2.5 kat (20+3.3=23.3 X 2.5 = l) Etil alkol (%100) eklenir rpm 15 dk santrifüj yapılır. Süpernatan atılır. Çökelek üzerine 100 l %70 lik Etil alkol konur rpm 5 dk santrifüj yapılır. Süpernatan atılır rpm 3 dk santrifüj 10 l lik pipet ile kalan etil alkol çekilir. Ependorflar vakumlu santrifüj ile kurutulur C de saklanır.

58 Etanol pürifikasyonu sonrası YİNE DNA ölçülür. Kalite kontrolü için. Otomatik sekans cihazına yüklenir. Burada yapılan kapiler jel eketroforezidir. Tek yönde uzatılmış (BigDye) DNA burada tek tek okunur. Elde edilen nükleotid dizisi veri kütüphaneleri ile karşılaştırılarak tür tanımlaması yapılır.

59 Hizalama Göz ile kontrol!!!!!

60 İşlem basamakları DNA eldesi DNA ölçümü PCR Elektroforez Pürifikasyon DNA ölçümü Elektroforez Cycle sequencing Pürifikasyon DNA ölçümü Kapiller elektroforez Veri analizi

61 Fungal DNA dizi analizi bize neler sağlar?? Kesin tür tanımı Alt tür Filogenetik analiz Mutasyon analizi Direnç bölgelerinde mutasyon Virülans genlerinde mutasyon


MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara Taksonomik terimler Alem (Kingdom) Bölüm veya şube (divisio, filum)






MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ DNA dizi analizleri ya da sekanslama; DNA birincil (temel) yapılarının belirlenmesinde kullanılan yöntemlerdir, DNA nın nukleotid dizilerinin saptanması anlamına gelir.



KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7


DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY

DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY DNA Sekanslama ve Filogenetik Analizler Dr. Eda UĞURTAY DNA baz dizilimlerinin belirlenmesidir. İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. Kullanım


DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi SEKANS TEKNİKLERİ DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un


Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ Nükleik asitler Sıcaklıkla öldürülmüş S suşları Canlı R suşlarını canlı S suşuna dönüştürür a) Farelere virulan S suşu enjekte edildiğinde ölür b) R suşu enjekte edildiğinde yaşar c) Isıyla öldürülmüş


DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi


Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION


DNA Dizi Analiz Yöntemleri

DNA Dizi Analiz Yöntemleri DNA Dizi Analiz Yöntemleri DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine


Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03. Laboratuvar Tekniği Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.2014) 1 5. Haftanın Ders İçeriği DNA ekstraksiyonu DNA ekstraksiyonunun amacı


RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod


Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.


İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır.

İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine hibridizasyonuna dayanır.


SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006 SEKANS TEKNİKLERİ GENOMİK-PROTEOMİK Ders Sorumlusu: Doç.Dr. Hatice MERGEN Hazırlayan: Levent ZORBEK Ankara,2006 DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem;


Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler


Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A


Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans



DİZİ ANALİZİ (SEKANS) TEKNİKLERİ DİZİ AALİZİ (SEKAS) TEKİKLERİ DA dizi analizi, gen yapısı ve genetik kontrol mekanizmaları hakkında bir çok bilgi edinmemizi sağlamıştır. erhangi bir organizmadan çok miktarda saf DA elde edilmesini sağlayan


PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade


16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 16S rrna Analizi Doç. Dr. Zeynep Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum içeriği Genel bilgi Uygulanışı Kullanım alanları Avantajları Dezavantajları Neden


Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT



HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla


Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya


Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen


RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050


III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler



MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite



TRANSLASYON VE TRANKRİPSİYON TRANSLASYON VE TRANKRİPSİYON GEN İFADESİ (GEN EKSPRESYONU) Gen ifadesinin düzenlenmesi çeşitli aşamalarda olur: 1) Primer transkriptlerin oluşumu 2) Primer mrna dan matür (olgun) mrna oluşumu 3) mrna nın


Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil



REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda


HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine


Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: Tel: 2225826/202 Ders Notları Đçin: adresinden Genombilimde


1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8)

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8) KONU-7. MOLEKÜLER BĠYOLOJĠDE TEMEL TEKNĠKLER BĠTKĠDEN GENOMĠK DNA ĠZOLASYONU Kullanılan Tamponlar: 1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol,


SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.


Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR İçerik (2



SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) Geleneksel olarak bireylerin kendisini, atalarını ve varsa döllerinin bilgilerini içeren kriterlere göre seleksiyon yapılmaktadır. Elde edilen



MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL MİKROBİYOLOJİDE BİYOTEKNOLOJİ Doç. Dr. Funda BAĞCIGİL Biyoteknoloji; Genetik materyallerde moleküler düzeyde yapılan manipulasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde etmektir


C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi


Genetik materyal: DNA replikasyonu

Genetik materyal: DNA replikasyonu Genetik materyal: DNA replikasyonu Umut Fahrioglu, PhD MSc DNA Replikasyonu DNA replikasyonu genomların ve içerdikleri genlerin nesilden nesile aktarılmasında çok önemli bir rol oynar. Hücreden hücreye

Detaylı YÖNETİCİ MOLEKÜLLER C, H, O, N, P atomlarından meydana gelir. Hücrenin en büyük yapılı molekülüdür. Yönetici moleküller hücreye ait genetik bilgiyi taşır, hayatsal faaliyetleri yönetir, genetik bilginin


RNA DNA. Nükleosit Baz + Şeker Riboz (RNA) Deoksiriboz (DNA) Ribonükleozitler : Adenozin, Pürinler: Pirimidinler: AveGdışında

RNA DNA. Nükleosit Baz + Şeker Riboz (RNA) Deoksiriboz (DNA) Ribonükleozitler : Adenozin, Pürinler: Pirimidinler: AveGdışında Bazlar : Nükleik Asitlerin karakteristik Özellikleri DNA RNA Yasin EREN Recep LiMAN Muhsin KONUK Nükleik Asitlerin Yapısı Pürinler: Pirimidinler: AveGdışında TU T,U ve Sdışında d bazı theobromin, kafein,


Farmakogenetikte Kullanılan Temel Yöntemler

Farmakogenetikte Kullanılan Temel Yöntemler Farmakogenetikte Kullanılan Temel Yöntemler Dr. Melih Ö. Babaoğlu Hacettepe Üniversitesi Tıp Fakültesi Farmakoloji A.D. XIII. TFD Eğitim Sempozyumu Van 1 Hastalık derecesi Fizyolojik durum İlaç etkileşmeleri


07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon


HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden






REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda


MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı

MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı MERKEZ LABORATUVAR Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı Yüksek Performans Sıvı Kromatografisi (HPLC) Karbonhidratların, organik asitlerin, vitaminlerin, amino asitlerin


Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:


Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi





Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor!

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor! Uygulamalı Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları Yaz Dönemi Başlıyor! : DNA izolasyonu, Primer tasarımı, PCR Teknikleri, Agaroz Jel Elektroforezi,



DNA ARAÇLARI ve BİYOTEKNOLOJİ DNA ARAÇLARI ve BİYOTEKNOLOJİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER DNA Düzenlenmesi İnsan DNA sı ile yapılan ilk çalışmalar için yani çalışma yöntemi geliştirilmesi için yaklaşık 1 milyon dolar


RTA Bakteriden Genomik DNA İzolasyon Kiti

RTA Bakteriden Genomik DNA İzolasyon Kiti RTA Bakteriden Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 IVD Bakteri örneklerinden genomik nükleik asit izolasyonu ve saflaştırılması için In vitro tanı amaçlı kullanım için Yalnızca





RTA Plazmid DNA İzolasyon Kiti

RTA Plazmid DNA İzolasyon Kiti RTA Plazmid DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 Bakteri örneklerinden plazmid DNA izolasyonu ve saflaştırılması için Yalnızca profesyonel kullanım için REF 09007050 50 test 09007100



1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1 DNA (Deosiribo Nükleik Asit) Kalıtım maddesi hücre çekirdeğinde bulunur. Kalıtım maddesi iğ ipliği (Yumak) şeklinde bir görünümdedir. İğ ipliğindeki kalıtım maddesi


DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar.

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar. DNA Đzolasyonu Saflaştırılmak istenen DNA ya genomik DNA dır ya da genomik olmayan mtdna, chldna, plasmit DNAsıdır.DNA izolasyon kitleri, genomik ve genomik olmayan DNA izole etmemizi sağlayan standartlaştırılmış





Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir.

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. METABOLİZMA ve ENZİMLER METABOLİZMA Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. A. ÖZÜMLEME (ANABOLİZMA) Metabolizmanın yapım reaksiyonlarıdır. Bu tür olaylara



MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ Doç.Dr. Aynur KARADENİZLİ Kocaeli Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Francisella tularensis Küçük, aerobik, pleomorfik,


MAIA Pesticide MultiTest

MAIA Pesticide MultiTest MAIA Pesticide MultiTest GIDALARDA PESTİSiT KALINTILARI İÇİN AB MAKSİMUM KALINTI LİMİTLERİ İLE UYUMLU ÇOKLU KALINTI TARAMA TESTİ Microplate Acetylcholinesterase Inhibition Assay (MAIA) katı veya sıvı gıda


XYLELLA FASTIDIOSA Gerekli Kimyasallar: - DNA izolasyon kiti (Qiagen Plant Minikit veya Invitrogen DNA purification kit ) - TaqMan Universal PCR

XYLELLA FASTIDIOSA Gerekli Kimyasallar: - DNA izolasyon kiti (Qiagen Plant Minikit veya Invitrogen DNA purification kit ) - TaqMan Universal PCR XYLELLA FASTIDIOSA Gerekli Kimyasallar: - DNA izolasyon kiti (Qiagen Plant Minikit veya Invitrogen DNA purification kit ) - TaqMan Universal PCR Master Mix (Applied Biosystems) Gerekli Sarf Malzemeleri



KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA ET ÜRÜNLERİNDE TAĞŞİŞ Tağşiş; gıda maddesinin mevzuata veya izin verilen özelliklerine aykırı olarak üretilmesi hali olarak tanımlanmaktadır. Gıda ürünlerinde; tağşiş bir çok şekilde yapılabilmektedir.


DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Replikasyon genetik materyelin tamamen kendi benzeri yeni bir molekül oluşturma işlemidir. DNA kendini eşleyebilen yegane biyomoleküldür


Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli


ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D 1. DNA replikasyonu.. için gereklidir A) sadece mitoz B) sadece mayoz C) mitoz ve mayoz D) sadece gamet oluşumu E) sadece protein sentezi 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki


Elektroforez, Western Blot, Southern Blot, Northern Blot

Elektroforez, Western Blot, Southern Blot, Northern Blot Elektroforez, Western Blot, Southern Blot, Northern Blot Dr. Gaye Güler Tezel Hacettepe Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Elektroforez DNA, RNA ve protein moleküllerini büyüklük, şekil



MOLEKÜLER MİKROBİYOLOJİ LABORATUVARI ÇALIŞMA PROSEDÜRÜ KOD.MİK.PR.02 YAYIN TRH. KASIM 2011 REV. TRH. EYLÜL 2012 REV. NO.1 SAYFA NO.1/14 1. AMAÇ: Moleküler mikrobiyoloji laboratuvarında yürütülen faaliyetleri tanımlamak. 2. KAPSAM: Bu talimat, Moleküler mikrobiyoloji



NÜKLEİK ASİTLER ÜN TE 3 NÜKLEİK SİTLER ÜN TE 3 NÜKLEİK SİTLER NÜKLE K S TLER DN (Deoksiribonükleik asit) RN (Ribonükleik asit) Bulundu u Yerler Çekirdek Bulundu u Yerler Çekirdek Mitokondri Ökaryotlarda Mitokondri Kloroplast



HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik



SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler



ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ Genetik mühendisliği gelişmeden önce insanlar yapay seçilim yoluyla istenen özelliklerin yavru canlılarda görülmesini sağlamışlardır. Örneğin seçici üretim


DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel



BIONEER MARKA ACCUPOWER EBV QUANTATIVE PCR KİTİ PROTOKOLÜ BIONEER MARKA ACCUPOWER EBV QUANTATIVE PCR KİTİ PROTOKOLÜ Kullanılan Ekipmanlar : - Bioneer Marka ExiPrep16 Plus Model Tam Otomatik Nükleik Asit Ekstraksiyon Sistemi - Bioneer Marka ExiPrep Viral DNA/RNA


Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β


RTA Mayadan Genomik DNA İzolasyon Kiti

RTA Mayadan Genomik DNA İzolasyon Kiti RTA Mayadan Genomik DNA İzolasyon Kiti Kullanma Klavuzu Yayın Tarihi - 2011-12 Maya örneklerinden genomik nükleik asit izolasyonu ve saflaştırılması için Yalnızca profesyonel kullanım için REF 09002050



PROTEİNLERİN SAFLAŞTIRILMASI PROTEİNLERİN SAFLAŞTIRILMASI Bir hücre ve dokudan istenilen bir proteinin saf halde izole edilmesi oldukça güç bir olaydır. Bu proteinin konsantrasyonu düşük ise binlerce farklı protein arasından ayırmak


BIONEER ExiCycler 96 REAL TIME PCR CİHAZI. Gradient Real Time PCR Cihazı. Kullanım Amacı. Uygulama Alanları. Temel Teknik Özellikler

BIONEER ExiCycler 96 REAL TIME PCR CİHAZI. Gradient Real Time PCR Cihazı. Kullanım Amacı. Uygulama Alanları. Temel Teknik Özellikler REAL TIME PCR CİHAZI BIONEER ExiCycler 96 Gradient Real Time PCR Cihazı Cihaz, gerçek zamanlı PCR (Polimeraz Zincir Reaksiyonu) yöntemi ile DNA ve RNA nın Amplifikasyonu (çoğaltılması) ve analiz edilmesi



VİRAL TANI KİTLERİ (GFJ-480) VİRAL TANI KİTLERİ (GFJ-480) CMV PCR Tanı Kiti Cytomegalovirus un Konvensiyonel PCR yöntemiyle tanınması. HHV-5 olarak da bilinen Sitomegalovirüs, herpes virus ailesinin bir üyesidir. Oldukça sık görülen



MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA RİBOZOMLAR Ribozom RİBONÜKLEOPROTEİN (RNP) yapısındadır. Ribozomlar hem protein hem de RNA moleküllerinden oluşur. Ribozomlar protein ve RNA moleküllerinden oluşan


SDS-PAGE Jel Elektroforezi İÇERİK

SDS-PAGE Jel Elektroforezi İÇERİK İÇERİK Tanım...2 SDS-PAGE jel elektroforez metodu...3 SDS-PAGE jel elektroforezi yürütme ortamının hazırlanması...4 Protein örneklerinin yüklenmesi...8 Jelin yürütülmesi...9 Jelin boyanması ve boyanın



SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm


RTA Kandan Genomik DNA İzolasyon Kiti

RTA Kandan Genomik DNA İzolasyon Kiti RTA Kandan Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-05 IVD İnsan kan örneklerinden in vitro tanı amaçlı genomik nükleik asit izolasyon ve saflaştırması için In vitro tanı amaçlı


Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar

Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar İçerik Giriş...2 Western Blot Yöntemi...2 Protein Örneklerinin Hazırlanması...2 Dikey Jel Sistemi Kullanımı...3 Kuru Transfer Sistem Kullanımı...4 Bloklama...6 Protein Tespiti...6 Kemilüminesans Tanımlama





Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1

Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Brusellozda laboratuvar tanı yöntemleri 14.02.2006 1 Spesifik tanı yöntemleri: 1. Direk (kült ltür r ve bakterinin gösterilmesi) g 2. Antikorların n gösterilmesig 1.Standart tüp aglütinasyonu 2.Rose Bengal


DÖNEM I 3. DERS KURULU 9 Şubat 3 Nisan 2015. Prof.Dr. Mustafa SARSILMAZ

DÖNEM I 3. DERS KURULU 9 Şubat 3 Nisan 2015. Prof.Dr. Mustafa SARSILMAZ DÖNEM I. DERS KURULU 9 Şubat Nisan 0 Dekan : Prof.Dr. Mustafa SARSILMAZ Dönem I Koordinatörü : Ders Kurulu Başkanı : Doç.Dr. Doç.Dr. KURUL DERSLERİ TEORİK PRATİK TOPLAM AKTS DERS VEREN ÖĞRETİM ÜYELERİ



LABORATUVAR MATEMATİĞİ LABORATUVAR MATEMATİĞİ Dr. Zafer KÜÇÜKODACI GATA HEH Patoloji Servisi 22. ULUSAL PATOLOJİ KONGRESİ 7 Kasım 2012 Manavgat AMAÇ 2.3. DNA extraction by boiling : Total DNA was extracted by a boiling method


NRAS Mutasyon Kiti Teknik Şartnamesi

NRAS Mutasyon Kiti Teknik Şartnamesi NRAS Mutasyon Kiti Teknik Şartnamesi 1- Sistem ile PCR ürünlerinden direkt olarak dizi analizi yapılabilmeli, ayrıca cycle sequencing işlemine gerek kalmamalıdır. 2- Sistemde dizinin sentezi ile deteksiyonu



MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son


ı. BCR-ABL Mbcr Kiti(p210) 144 test

ı. BCR-ABL Mbcr Kiti(p210) 144 test C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Hematolojik Malignensi Translokasyon Testleri ve Cihaz Teknik Şartnamesi ı. BCR-ABL Mbcr Kiti(p210) 144 test 2. BCR-ABL mbcr Kiti(p190)





Hücre Üzerine Mikrocerrahi Uygulamaları Hücrenin altbirimlerine ayrılması Moleküllerin analizi. Prof. Dr. Müjgan Cengiz

Hücre Üzerine Mikrocerrahi Uygulamaları Hücrenin altbirimlerine ayrılması Moleküllerin analizi. Prof. Dr. Müjgan Cengiz Hücre Üzerine Mikrocerrahi Uygulamaları Hücrenin altbirimlerine ayrılması Moleküllerin analizi Prof. Dr. Müjgan Cengiz Canlı Hücrelerdeki Moleküllerin İzlenmesi Mikroskopla inceleme hücrede belli düzeyde






MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son


Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde



DNA REPLİKASYONU VE REKOMBİNASYONU DNA REPLİKASYONU VE REKOMBİNASYONU Replikasyon Watson ve Crick in DNA nın yapısını önermelerinin ardından bilim adamları DNA nın nasıl kopyalandığı üzerinde yoğunlaşmıştır. DNA nın kendini kopyalamasına



ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı Dönem I. 2. Ders Kurulu II. HÜCRE BİLİMLERİ-I Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Prof. Dr. Alirıza ERDOĞAN Yrd. Doç. Ders Kurulu
