Metisiline Dirençli Staphylococcus aureus un Kantitatif Antibiyogram ve Arbitrarily Primed PCR (AP-PCR) Yöntemleriyle Epidemiyolojik Sürveyans

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Metisiline Dirençli Staphylococcus aureus un Kantitatif Antibiyogram ve Arbitrarily Primed PCR (AP-PCR) Yöntemleriyle Epidemiyolojik Sürveyans"

Transkript

1 Hastane nfeksiyonlar Dergisi 1997; 1: Hastane İnfeksiyonları Metisiline Dirençli Staphylococcus aureus un Kantitatif Antibiyogram ve Arbitrarily Primed PCR (AP-PCR) Yöntemleriyle Epidemiyolojik Sürveyans Dr. Metin OTKUN*, Dr. Filiz AKATA*, Dr. Sesin KOCAGÖZ**, Dr. Müflerref TATMAN-OTKUN*, Dr. Yeflim ÇET NKAYA**, Dr. Bahri TEKER* Dr. Volkan DÜNDAR*, Dr. Serhat ÜNAL** * Trakya Üniversitesi T p Fakültesi, Klinik Bakteriyoloji ve nfeksiyon Hastal klar Anabilim Dal, Edirne. ** Hacettepe Üniversitesi T p Fakültesi, ç Hastal klar Anabilim Dal nfeksiyon Hastal klar Ünitesi, Ankara. ÖZET Metisiline dirençli Staphylococcus aureus (MRSA) infeksiyonlar ciddi ve tedavisi güç infeksiyonlard r. MRSA salg nlar n n epidemiyolojisini incelemek ve nozokomiyal yay l m yollar n tan mlamak için bireysel MRSA kökenlerinin ay rt edilebilmesi gerekir. Bu çal flman n amac kantitatif antibiyogram yöntemini kullanarak MRSA sürveyans n sa lamak ve sonuçlar n AP-PCR ile karfl - laflt rarak yinelenebilirlik, ay rt edici güç ve epidemiyolojik aç dan de erini incelemektir. Ekim May s 1996 döneminde 26 hastadan 33 MRSA izole edilmifltir. Kantitatif antibiyogram tipleme 33 izolat alt gruba ay rm flt r. Bunlardan birincisinde 27 izolat yer al rken, birinde iki ve dördünde birer izolat bulunmaktad r. AP-PCR ise MRSA izolatlar n dört gruba ay rm flt r. Bu gruplardan birincisinde 31 izolat yer al rken, üç izolat farkl amplifikasyon bantlar vermifltir. Epidemiyolojik veriler ile birlikte de erlendirildi inde her iki yöntemin de ay rt edici gücü s n rl bulunmufl, sonuçlar n birlikte de erlendirilmesi halinde daha yüksek ay rt edici güç sa lanm flt r. Sonuç olarak de iflik kökenlerin araya girmesine karfl n bir özel klonun Trakya Üniversitesi T p Fakültesi hastanemizde zaman içinde endemik hale geldi i saptanm flt r. Anahtar Kelimeler: MRSA, Sürveyans, Tipleme, Kantitatif Antibiyogram, AP-PCR SUMMARY Epidemiological Surveillance of Methicillin - Resistant Staphylococcus aureus by Quantitative Antibiogram and Arbitrarily Primed PCR (AP-PCR) Typing Methods The methicillin-resistant Staphylococcus aureus (MRSA) infections are serious and difficult to treat. Epidemiologic investigation of MRSA infections and identification of modes of nosocomial MRSA transmission require the ability to distinguish individual strains. The purpose of this study was to follow the MRSA surveillance by using quantitative antibiogram and to analyze its reproducibility, discriminatory power and epidemiological value by comparing the results with AP-PCR. Thirty three MRSA isolates were obtained from 26 patients between October 1994 and May Quantitative antibiogram typing classified these isolates into six distinct groups. One of these groups included 27 MRSA isolates and one of the others included two MRSA isolates. The remaining four MRSA isolates were found to be different from each other and classified into four seperate groups. By AP-PCR four groups were discriminated among these isolates. Thirty-one of the isolates were in one group and the remaining two MRSA isolates were classified into distinct groups. Discriminatory power of both methods were found to be limited when the results were evaluated in accordance with epidemiological data. On the other hand, discriminatory power was more enhanced if the results of AP-PCR and quantitative antibiogram typing were evaluated together. It was concluded that although several different MRSA strains were involved, a special clone has become endemic in Trakya University Hospital. Key Words: MRSA, Surveillance, Typing, Quantitative Antibiogram, AP-PCR 106 Hastane nfeksiyonlar Dergisi 1997; 1: 2

2 Metisiline Dirençli Staphylococcus aureus un Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, G R fi Metisiline dirençli Staphylococcus aureus (MRSA) ilk olarak 35 y l önce tan mlanm flt r (1) ve halen tüm dünyada hastaneden kazan lm fl infeksiyonlar n önemli ve gittikçe artan bir etkenidir (2). Türkiye de S. aureus izolatlar nda metisilin direnci %25-40 aras nda de iflmektedir (3-7). MRSA salg nlar n n epidemiyolojisini incelemek ve nozokomiyal MRSA yay l m n n yollar n tan mlamak için bireysel MRSA kökenlerinin ay rt edilebilmesi gerekir (8). Hastane içinde S. aureus un klonal yay lma e ilimi klinik izolatlarda özgül tipleme yöntemlerinin gelifltirilmesine yol açm flt r. Ancak MRSA kökenleri aras nda yüksek derecedeki genetik yak nl k (9) nedeniyle özellikle rutin bakteriyolojik yöntemleri kullanan pek çok hastane laboratuvar için bu ayr m güç olabilir. K sa bir süre önce Tenover ve arkadafllar 12 de iflik tipleme yöntemini karfl laflt rm fllar ve epidemiyolojik çal flmalar için DNA kaynakl tiplemelerin daha uygun oldu unu, ama karfl laflt rd klar hiç bir yöntemin tek bafl na, ba lant s z kökenleri epidemiyolojik olarak ba lant l kökenlerden aç k bir flekilde ay rt etmeye yetmedi ini belirtmifllerdir (10). Antimikrobiyal duyarl l k testleri bu amaçla s k kullan lan yöntemlerden biridir. Ancak MRSA lar n büyük bir k sm benzer flekilde ço ul antibiyotik dirençli olduklar ndan bu yöntemin araflt rmalardaki yarar s n rl d r (11). Antimikrobiyal duyarl l k testleri ile tiplemenin do al bir zay fl bu duyarl l n s kl kla çevresel faktörler veya plazmidlerle de iflebilmesidir (12). Sürveyans çal flmalar nda yöntemin de erini artt rabilmek için Giacca ve arkadafllar disk diffüzyon testlerinde ölçülen inhibisyon zon çaplar n kullanarak yap lan bir benzerlik analizi önermifllerdir (13). Blanc ve arkadafllar kantitatif antibiyogram diye isimlendirilebilecek bu yöntemi MRSA sürveyans nda kullanm fllar, karmafl k ve pahal moleküler tipleme yöntemlerine ulafl lamayan durumlarda basit ve güvenilir bir yöntem oldu- unu ileri sürmüfllerdir (14). Bu çal flman n amac bir üniversite hastanesinde 20 ayl k bir dönem içinde kantitatif antibiyogram yöntemini kullanarak MRSA sürveyans n sa lamak ve sonuçlar n iyi tan mlanm fl moleküler bir tipleme yöntemi olan Arbitrarily primed PCR (AP-PCR) ile karfl laflt rarak yinelenebilirlik, ay rt edici güç ve epidemiyolojik aç dan de erini incelemektir. MATERYAL ve METOD Hastanenin özellikleri ve çal flma dönemi: Trakya Üniversitesi Hastanesi (TÜH) 400 yatakl, üçüncü basamak bir e itim hastanesidir. Hizmet etti i nüfus yaklafl k dir ve y lda yaklafl k hasta hastaneye yat r lmaktad r. TÜH de dört yatakl bir merkezi yo un bak m birimi bulunmakta olup S. aureus izolatlar nda metisilin direnci s kl 1995 y l içinde %48 olarak bulunmufltur (15). Bu çal flmaya Ekim May s 1996 aras klinik kültürlerinde MRSA üretilen tüm hastalar al nm flt r. Epidemiyoloji Çal flmaya al nan her hastadan TÜH nfeksiyon Kontrol Ekibi taraf ndan flu veriler toplanm flt r: demografik veriler, ikamet yeri, baflvuru ve ç k fl tarihleri, yat r ld servis ve hastane içinde varsa di er servislere nakli, daha önceki yat fllar, tan, bakteriyoloji sonuçlar ve infeksiyon kontrol önlemleri. Olgular yatt klar serviste ayn antibiyotip ile infekte baflka bir hasta ile ayn dönemde yatm fllar ise epidemiyolojik olarak ba lant l kabul edilmifl, epidemiyolojik ba lant kurulamayan olgular sporadik olarak nitelendirilmifllerdir. Ayn serviste MRSA l baflka bir hasta yok iken yat - fl n ilk 48 saati içinde izole edilen MRSA hastane d fl kökenli olarak düflünülmüfltür. Çal flman n ikincil bir amac da tipleme yöntemlerinin özgüllük ve duyarl l klar n de erlendirmek oldu undan ayn hastadan izole edilen birden fazla MRSA çal flmaya al nm flt r. Mikrobiyoloji S. aureus izolatlar Gram boyama, katalaz, koagülaz ve DNaz testleri ile tan mlanm flt r (16). Metisilin direnci 1 µg oksasilin diski, agar tarama (screen) (17) ve modifiye agar yayma (spread) (18) testleri ile araflt r lm flt r. Oksasilinin minimal inhibitör konsantrasyon (M K) de erleri mikrodilüsyon yöntemiyle NCCLS önerileri do rultusunda saptanm flt r (17). Metisiline dirençli oldu u yukar da belirtilen metodlarla do rulanan izolatlarda Ünal ve arkadafllar taraf ndan tan mlanan yöntem kullan larak PCR ile meca geni araflt r lm flt r (19). Hastane nfeksiyonlar Dergisi 1997; 1: 2 107

3 Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, Metisiline Dirençli Staphylococcus aureus un Kantitatif antibiyogram tipleme Antimikrobiyal duyarl l k testleri Müller-Hinton agar ve standart antimikrobik diskler (Difco Laboratories, ABD) kullanarak NCCLS önerilerine göre disk diffüzyon testi ile yap lm flt r (20). Çal fl lan antimikrobikler: eritromisin, klindamisin, kotrimoksazol, gentamisin ve rifampisindir. Bu antimikrobiklerin seçilmelerinin nedenleri: (i) MRSA izolatlar nda de iflik ve ba ms z direnç mekanizmalar n n olmas ve/veya, (ii) Direncin kromozomal olmas ve/veya, (iii) Hastanemizde nispeten az kullan lmalar d r. Kantitatif antibiyogram tipleme disk diffüzyon testlerinde elde edilen inhibisyon zon çaplar n n benzerlik analizi yöntemiyle yap lm flt r (14). Benzerlik katsay s olarak Euclid aral kullan lm flt r; iki MRSA aras ndaki fark her bir antimikrobik için karfl laflt r lan iki izolat n inhibisyon zon çaplar aras ndaki farklar n kareleri toplam n n kareköküdür. ki organizma aras ndaki fark büyüdükçe benzerlik azalmaktad r. Bu formül her bir izolat n di er bütün izolatlar ile yak nl k derecesini saptamak için hesaplanm flt r. Ayn kökenin farkl zamanlarda antibiyogram tekrar yap ld nda belli bir de iflkenlik görülebilece inden tüm izolatlarda farkl zamanlarda iki kez disk difüzyon duyarl l k testi yap lm flt r. Her bir mikroorganizma için iki test aras ndaki Euclid aral klar na göre bir s n r de er seçilmifltir. Seçilen s n r de er ilk ve ikinci test sonuçlar aras ndaki Euclid aral klar n n en az %95 inden büyük olan de erdir. Bu yüzden yöntemin yinelenebilirli i en az %95 tir. ki ayr izolat aras ndaki Euclid aral s n r de erden düflükse kantitatif antibiyogram tipleme yönteminde izolatlar ba lant l olarak nitelendirilmifltir. Daha sonra a rl ks z olarak çiftleri gruplama yoluyla küme analizi yap lm fl ve buna göre bir dendrogram çizilmifltir. Hesaplamalarda ve dendrogram çiziminde SPSS for Windows (Release 6.1, SPSS Inc., 1994) bilgisayar program kullan lm flt r. Disk diffüzyon testlerinde kalite kontrol amac yla standart sufl olarak Escherichia coli ATCC ve S. aureus ATCC kullan lm flt r. Arbitrarily Primed PCR (AP-PCR) Bakteri DNA s n n haz rlanmas nda Ünal ve arkadafllar taraf ndan stafilokoklar için tan mlanm fl olan h zl lizis protokolü modifiye edilerek kullan lm flt r (19). fllem öncesinde tüm MRSA izolatlar n n Mueller-Hinton s v besiyerine ekimi yap lm flt r. 35 C da bir gecelik inkübasyonu takiben 5000 rpm de 20 dakikal k santrifüjle bakterilerin çökmesi sa lanm fl ve üst s v uzaklaflt - r lm flt r. Bakteri çökelekleri steril koflullarda ependorf tüplere aktar lm fl ve rpm de 5 dakika daha santrifüj edilmifltir. Üst s v uzaklaflt r ld ktan sonra kalan bakteri çökele inin üzerine 50 µl lizostafin (100 µg/ml, Sigma Chemical Co., St.Louis, Mo.) eklenip 5 dakika 37 C da su banyosunda tutulmufltur. Daha sonra bu süspansiyonun üzerine 50 µl proteinaz K (100 µg/ml, Sigma Chemical Co., St.Louis, Mo.) eklenmifl ve 5 dakika daha 37 C de bekletilmifltir. Tüpler kaynar su içinde 15 dakika kaynat ld ktan sonra 1 dakika rpm de santrifüj edilmifl ve üst s v yeni bir ependorf tüpe aktar larak -20 C de saklanm flt r. Elde edilmifl olan bu bakteri DNA süspansiyonunun 1 µl si 50 µl PCR kar fl m içinde amplifikasyona al nm flt r. Amplifikasyonlarda Mycobacterium tuberculosis e özgül primerler (5 CCTGTGGGGTCCGG- GCTTTC 3, 5 GATCTGCGGGTCGTCCCAGGT 3 ) kullan lm flt r. Her tüpte 50 mm KCl, 10 mm Tris- HCl (ph 8.3), %0.1 TritonX-100, 2.5 mm MgCl 2, her dntp den 0.2 mm, 1 ünite taq polimeraz enzimi Epicentre) ve 50 pmol primer olacak flekilde reaksiyon kar fl mlar haz rlanm flt r. DNA amplifikasyonlar (Stuart, EC) üretici firman n önerileri do rultusunda flu parametreler kullan - larak gerçeklefltirilmifltir: Low-stringency sikluslar (3 siklus): Denatürasyon 94 C 1 dakika Birleflme 30 C 1 dakika Uzama 72 C 1 dakika High-stringency sikluslar (45 siklus) Denatürasyon 94 C 1 dakika Birleflme 55 C 1 dakika Uzama 72 C 1 dakika Elde edilen amplifikasyon ürünlerinin 10 µl si, %2 lik agaroz jelde yürütülerek ultraviolet transillüminatör üzerinde incelenerek foto raflar çekilmifltir (21,22). AP-PCR çal fl l rken bir adet metisiline duyarl S. aureus (MSSA) ve bir adet metisiline dirençli S. epidermidis (MRSE) kökeni kontrol amac yla di er izolatlarla birlikte çal fl lm flt r. 108 Hastane nfeksiyonlar Dergisi 1997; 1: 2

4 Metisiline Dirençli Staphylococcus aureus un Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, SONUÇLAR TÜH de Ekim May s 1996 döneminde 26 hastadan 33 MRSA izole edilmifltir. Bu hastalar n 8 i kad n, 18 i erkek olup yafl ortalamalar 44.4 ± 16.6 ( ) (ortalama ± standart sapma (minimum - median - maksimum) d r. Hastalar n 7 si merkez yo un bak m ünitesi 6 s ortopedi, 4 ü iç hastal klar, 2 si beyin cerrahisi ve birer tanesi gö üs hastal klar, nöroloji, üroloji, gö üskalp-damar cerrahisi, koroner yo un bak m ve genel cerrahi servislerinde yatm flt r. Multipl miyelom tan l bir hasta ise acil servise baflvurdu- unda istenen idrar kültüründe MRSA üremifltir. Ancak bu hastan n di er bilgilerine ulafl lamam flt r. Servis hastalar n n yat r lma nedenleri 8 inde travmaya ba l kemik k r klar, 3 ünde serebrovasküler hastal k, 3 ünde kronik böbrek yetmezli i, üçünde malignite, birer hastada ise ateflli silah yaralanmas, Guillain-Barré sendromu, gazl gangren, korozif madde içilmesi, tüberküloz ampiyem, kalp yetmezli i, akut arteriyel tromboz ve postoperatif pnömotorakst r. Hastalar n 12 sinde operasyon öyküsü al nm fl ve 23 ü MRSA n n saptanmas ndan önce antibiyotik kullanm flt r. En s k kullan lan antibiyotikler 14 hastada 2. veya 3. kuflak sefalosporin, 10 hastada imipenem ve 8 hastada aminoglikozitlerdir. MRSA kolonizasyonu ve infeksiyonunu kolaylaflt racak risk faktörü olarak 10 hastada nazogastrik sonda, 16 hastada idrar sondas, 6 hastada kemik-eklem protezi veya ortopedik çivi, 5 hastada damar içi kateter bulunmufltur. Bu hastalar n yat fl, ç k fl ve MRSA üremesinin saptand tarihler fiekil 1 de gösterilmifltir. MRSA izolatlar n n 20 si (%61) eritromisine, 30 u (%91) klindamisine, 2 si (%6) kotrimoksazole, 30 u (%91) gentamisine ve 29 u (%88) rifampisine dirençlidir. Bu izolatlar n izole edildikleri infeksiyon yerleri, tarihleri ve servisleri, çal fl lan antimikrobik diskleri çevresindeki inhibisyon zon çaplar, oksasilin minimal inhibisyon konsantrasyon (M K) de erleri ve meca geni sonuçlar Tablo 1 de gösterilmifltir. zolat 5, 7 ve 9, izolat 20 ve 21, izolat 17, 19, 22 ve 26, izolat 29 ve 30 ayn hastalardan izole edilmifl gruplard r. Tüm izolatlar n iki kez tekrarlanan antimikrobiyal duyarl l klar sonuçlar na göre elde edilen en büyük Euclid aral 11.5 tir ve 33 izolat n 32 sinde bu de er 8.0 den küçük bulunmufltur. Bu nedenle s n r de er 8.0 olarak seçilmifltir. Yöntemimizin yinelenebilirli i %97.0 (32/33) dir. Sonuçta izolatlar aras ndaki fark 8.0 den küçükse ba lant l kabul edilmifltir. Kantitatif antibiyogram tiplemeye dayanan dendrogram 33 izolat alt gruba ay rm flt r. Bunlardan birincisinde 27 izolat yer al rken, birinde iki ve dördünde birer izolat bulunmaktad r (fiekil 2). AP-PCR yöntemi ise MRSA izolatlar n dört gruba ay rm flt r. Bu gruplardan birincisinde 31 izolat yer al rken izolat 10, 14 ve 16 farkl bant paterni vermifltir (fiekil 3). Bunlardan izolat 10 ve 16 kantitatif antibiyogram ile de farkl bulunurken izolat 14 kantitatif antibiyogram ile ay rt edilememifltir. Buna karfl n kantitatif antibiyogram, AP-PCR taraf ndan büyük grupta olarak nitelendirilen izolat 1, 4, 2 ve 15 i ayr tipler halinde ay rt etmifl ve izolat 2 ile 15 i bir gruba sokmufltur. Ayn hastadan izole edilen izolatlar her iki yöntemle de ba lant l bulunmufltur. Kontrol amac yla çal fl lan MSSA ve MRSE kökenleri AP- PCR taraf ndan di er izolatlardan ay rt edilebilmifltir. Her iki yöntemin s n fland rma sonuçlar yine Tablo 1 de sunulmufltur. Hem kantitatif antibiyogram, hem de AP-PCR ile di erlerinden ayr lan 16 no lu izolat 256 µg/ml nin üstünde bulunan oksasilin M K de erine karfl n meca geni negatif olarak saptanm flt r. TARTIfiMA MRSA infeksiyonlar ciddi ve tedavisi güç infeksiyonlard r. Bu infeksiyonlar n tedavisi için çok az antimikrobik seçene i vard r ve bunlar n hiçbiri de ideal özellikleri tafl maz. Bu infeksiyonlar n korunmas nda bakterinin kaynaklar n saptamak ve yok etmek veya hastaya bulafl yollar n kesmek, böylece MRSA infeksiyonlar n n say s n azaltmak önemli bir amaçt r. Hangi kökenin, hangi kaynaktan ve hangi yollarla di er hastalara yay ld n saptayabilmek için kökenleri tiplendirerek tek tek ay rt edebilmek gerekir (22). MRSA tiplendirilmesinde fenotipik ya da genotipik özellikleri temel alan pek çok çal flma yap lm flt r, ama amaca tam anlam ile uyan ideal bir tipleme yöntemi bu güne kadar tan mlanamam flt r (23). MRSA tiplendirilmesinde kullan - lan çeflitli yöntemleri karfl laflt ran en genifl çal flmada hiç bir yöntemin di erlerine tam anlam yla üstünlük sa layamad, yöntemleri kombine etmenin daha iyi sonuç verece i ve bu nedenle her laboratuvar n iki tipleme yöntemini rutin olarak kullanmas gerekti i sonucuna ulafl lm flt r Hastane nfeksiyonlar Dergisi 1997; 1: 2 109

5 Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, Metisiline Dirençli Staphylococcus aureus un Antibiyotip 6 Antibiyotip 5 Antibiyotip 4 Antibiyotip 3 Antibiyotip 2 Antibiyotip 1 Üroloji (10)* Beyin cerrahisi (4) ç hastal klar (16)* ç hastal klar (1) Koroner (2) Gö üs hastal klar (15) Ortopedi (6) Ortopedi (3) Ortopedi (5,7,9) ç hastal klar (8) Ortopedi (11) MYBÜ (12) MYBÜ (13) Acil (14)* Beyin cerrahi (17,19,22,26) MYBÜ (18) ç hastal klar (20,21) Ortopedi (23) MYBÜ (24) Nöroloji (25) MYBÜ (27) Ortopedi (28) MYBÜ (29,30) GKDC (31) MYBÜ (32) Cerrahi (33) Ekim 1994 May s 1996 fiekil 1. MRSA izole edilen hastalar n yat fl tarihleri ve servisleri. (Gri renkli çubuklar yat fl dönemlerini, dikine siyah çizgiler MRSA izolasyon tarihlerini göstermektedir. Parantez içindeki numaralar izolat no sudur. MYBÜ: merkez yo un bak m ünitesi; GDKC: gö üs-kalp-damar cerrahisi; *: AP-PCR taraf ndan ay rt edilen izolatlar). 110 Hastane nfeksiyonlar Dergisi 1997; 1: 2

6 Metisiline Dirençli Staphylococcus aureus un Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, Tablo 1. MRSA zolatlar n n Mikrobiyolojik ve Epidemiyolojik Özellikleri. zolat Tarih nfeksiyon yeri Servis CC SXT E GM RA OXA MecA Antibiyotip AP-PCR No tip Yumuflak doku ç hastal klar A Kan Koroner > A Cerrahi yara Ortopedi > A Cerrahi yara Beyin cerrahisi > A Cerrahi yara Ortopedi > A Cerrahi yara Ortopedi > A Cerrahi yara Ortopedi > A Kateter yeri ç hastal klar A Cerrahi yara Ortopedi Ç Ç drar Üroloji > C Cerrahi yara Ortopedi > A Trakeal aspirat MYBÜ A Kan MYBÜ > A drar Acil servis > B Balgam Gö üs hast > A Kateter yeri ç hastal klar >256-4 D Trakeal aspirat Beyin cerrahisi Ç Ç Trakeal aspirat MYBÜ Ç Ç BOS Beyin cerrahisi Ç Ç Kan ç hastal klar Ç Ç Kateter yeri ç hastal klar Ç Ç Nöral doku Beyin cerrahisi Ç Ç Cerrahi yara Ortopedi > A Kan MYBÜ > A Trakeal aspirat Nöroloji > A Cerrahi yara Beyin cerrahisi A Trakeal aspirat MYBÜ > A Cerrahi yara Ortopedi A Kateter yeri MYBÜ > A Trakeal aspirat MYBÜ > A Cerrahi yara GKDC > A Trakeal aspirat MYBÜ A Cerrahi yara Genel cerrahi > A CC: klindamisin, SXT: kotrimoksazol, E: eritromisin, GM: gentamisin, RA: rifampin, OXA: oksasilin, Ç: çal fl lmad, MYBÜ: merkez yo un bak m ünitesi, GKDC: gö üs-kalp-damar cerrahisi. Hastane nfeksiyonlar Dergisi 1997; 1: 2 111

7 Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, Metisiline Dirençli Staphylococcus aureus un 8 : Servis No + : MYBÜ 29 : MYBÜ 32 : Ortopedi 23 : MYBÜ 13 : MYBÜ 24 : Beyin Cer. 19 : Nöroloji 25 : Genel Cer. 33 : Ortopedi 6 : Ortopedi 11 : Beyin Cer. 22 : Beyin Cer. 26 : ç Hast. 8 : MYBÜ 30 : Ortopedi 5 : MYBÜ 12 : Beyin Cer. 17 : Ortopedi 28 : Ortopedi 7 : ç Hast. 20 : Ortopedi 3 : Acil Servis 14 : MYBÜ 18 : ç Hast. 21 : MYBÜ 27 : Ortopedi 9 : GTDC 31 : Koroner 2 : Gö üs Hast. 15 : ç Hast. 1 : ç Hast. 16 : Beyin Cer. 4 : Üroloji 10 : : S n r de er fiekil 2. Befl adet antibiyotik diskinin çevresindeki inhibisyon zonlar n n Euclid aral klar na göre çizilen dendrogram. (10). Seçilecek yöntemlerden biri epidemiyolojik bir çal flmada ileri incelemeye al nacak tüm olas kökenleri saptayacak duyarl l kta ve di eri de daha sonra ayr nt l köken farkl l n saptayacak özgüllükte olmal d r. Yöntemlerin seçilmesi laboratuvar n kaynaklar na ve personelinin teknik ustal na ba l d r. Maslow ve arkadafllar tipleme sistemlerinin befl özelli ini tan mlam fllard r (24). Bunlar tipleyebilme, yinelenebilme, ay rt edici güç, yorum kolayl ve kullan m kolayl d r. Kökenleraras farkl l saptayabilmek için teknik ustal k gereksinimi artt kça genellikle bu ustal olmayan klinik mikrobiyologlarca yöntemi uygulama iste i düflmektedir (14). Antimikrobiyal duyarl l k testleri haz rlamas ve yorumlamas en kolay, en ucuz ve en h zl tipleme yöntemidir ve özellikle küçük laboratuvarlarda köken yak nl n incelemenin ilk yolu olarak nitelendirilir. Bu yöntem hastane ortam na yeni ve farkl bir MRSA kökeninin giriflini saptamada baflar l bir flekilde kullan lm flt r (25). Ancak pek çok MRSA klonu benzer flekilde ço ul antibiyotik dirençli olduklar, direncin plazmid kaynakl olabilmesi ve hastane içinde kullan lan antibiyotiklerin seçici bask s yüzünden ayn anda farkl kökenlerde direncin geliflmesi nedeni ile zay f ay rt edici güçte bulunur. Duyarl, ara duyarl ve dirençli fleklinde s n flama yorumlar 112 Hastane nfeksiyonlar Dergisi 1997; 1: 2

8 Metisiline Dirençli Staphylococcus aureus un Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, fiekil 3. AP-PCR yöntemi ile farkl izolatlardan elde edilen ço altma ürünleri. Bu ürünlerin elektroforezi sonucu elde edilen bant paternleri. (Kolon1: Molekül a rl k standard Kolon 2-7,10 ve 11: Ayn bant paterni gösteren izolatlar; Kolon 8 ve 9: Farkl bant paterni gösteren izolatlar). bu amaç için yetersiz olup inhibisyon zon çaplar n n de erlendirilmesi gerekir (14). Bu çal flmada kullan lan kantitatif antibiyogram tipleme inhibisyon zon çaplar n de erlendirerek yap lmakta ve antibiyogram tiplemenin tüm avantajlar n içermektedir. MRSA kökenlerinin moleküler tiplemesi temel ve epidemiyolojik MRSA çal flmalar nda büyük ümitler vaad etmektedir. Halen alt n standart olarak kabul edilen faj tipleme yerine PFGE (Pulsed Field Gel Electrophoresis) tekni i önerilmektedir (26). Buna karfl n zahmetli ve zaman al c, bu nedenle de rutin kullan ma uygulanamayacak bu yöntemin yerine kromozomal DNA daki de ifliklikleri saptamaya yarayan di er tipleme yöntemlerine e ilim çok daha güçlüdür. Bu yöntemlerden biri olan AP-PCR n en önemli avantajlar çok yönlülü ü ve teknik aç dan basitli idir. Deney koflullar standardize edildikten sonra 48 saat gibi çok k sa bir sürede bir çok köken birden çal fl labilerek bir bölgedeki veya hastanedeki epideminin kayna saptanabilir (27). Epidemiyolojik verileri önemsemeden yaln zca tipleme yöntemine güvenilmemelidir. Yöntemlerin karfl laflt rmal çal flmalar nda alt n standart toplanan epidemiyolojik veriler olmal, laboratuvar verileri bu verilerle birlikte yorumlanmal d r (12). Bu çal flmada da ayn (ayn hastadan, ayn günde ve ayn yerden) veya yak n ba lant l (ayn hastadan farkl gün veya yerden) olmas gereken izolatlar birlikte çal fl larak yöntemlerin duyarl l k ve özgüllükleri incelenmifltir. Kulland m z her iki yöntem de bu kökenleri ayn tip olarak göstermesine karfl n çal fl lan 33 izolat kantitatif antibiyogram tipleme alt, AP-PCR dört gruba ay rm flt r. Kantitatif antibiyogramda büyük gruba dahil edilen, ancak AP-PCR taraf ndan farkl bulunan izolat 14, acil servise baflvuran bir hastaya aittir ve hastane içi kökenlerle epidemiyolojik ba lant s oldu una dair bir bulgu saptanamam flt r. Bu durum kantitatif antibiyogram n az da olsa rastlanan bir zay fl olarak düflünülmüfltür. Koroner yo un bak mdan izole edilen izolat 2 ve gö üs hastal klar servisinde saptanan izolat 15 kantitatif antibiyogramda büyük gruptan ayr olacak flekilde bir gruba sokulmufl, ancak AP- PCR taraf ndan büyük gruptan ay rt edilememifltir. Bu iki izolat için de hastanedeki di er kökenlerle epidemiyolojik ba lant kurulamam fl ve sporadik olarak nitelendirilmifllerdir. Bu durumda AP-PCR yönteminin ay rt edici gücü zay f kalm fl, kantitatif antibiyogram ise bu iki izolat büyük gruptan ay rd halde birbirinden ay ramam flt r. zolat 1 ve 4 de kantitatif antibiyogram ile ay rt edilmifl, ancak AP-PCR ile büyük gruptan ayr lamam flt r. zolat 1 iç hastal klar servisinde saptanan en eski MRSA d r ve sonradan kronik böbrek yetmezli i nedeniyle diyalize al nan iç hastal klar servisinin di er üç hastas ndan izole edilen MRSA larla zaman fark oldukça fazlad r. zolat 4 ise beyin cerrahisi servisindeki en eski izolatt r. Dolay s yla bu iki izolat bu servislerde daha sonra görülen bask n klonla epidemiyolojik olarak ba lant s z görülmektedir. Olas l kla bu iki servis hastane içindeki bask n kökeni daha sonradan ortopedi veya merkez yo un bak m ünitesi (MYBÜ) nden alm fllard r. O halde, AP- PCR bu bahsedilen izolatlar için zay f ay rt edici güçte kalm fl olabilir. MRSA için kullan lan tipleme yöntemlerinin uyuflmayan sonuçlar n yorumlamak için herhangi bir ilke saptanmam flt r. Bu durumda bir yöntemin fazla ay rt edici oldu- u ileri sürülebilir (28). Ancak çok say daki MRSA klonu endemik bir MRSA zeminine toplumdan veya di er hastanelerden yeni kökenlerin araya giriflini de yans tabilir. Bu durumda toplum ve Hastane nfeksiyonlar Dergisi 1997; 1: 2 113

9 Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, Metisiline Dirençli Staphylococcus aureus un di er hastaneler farkl MRSA kökenleri için sürekli bir kaynak oluflturmaktad rlar (29). meca geni bulunamayan, ancak oksasilin M K de eri 256 µg/ml den yüksek bulunan izolat 16 her iki yöntemle de ay rt edilebilmifltir. Bu çal flmada hem kantitatif antibiyogram, hem de AP-PCR tipleme yöntemleri de iflik kökenlerin araya girmesine karfl n bir özel kökenin zaman içinde TÜH de endemik hale geldi ini göstermektedir. Bu kökenin ilk örne i izolat 3 olup Ekim 1994 te ortopedi klini inde saptanm flt r. Bu klonun TÜH e girifli çal flma dönemimiz öncesinde de olabilir. MYBÜ ise 1995 y l içinde aç lm flt r ve bu birimde ilk izolasyon te trafik kazas nedeniyle yat r lan bir hastaya aittir. Bu nedenle MYBÜ de sonradan endemik hale geçen klonun ilk kayna n n ortopedi oldu u düflünülmüfltür. Yerleflmeyi kolaylaflt racak di er faktörler ise olas l kla yüksek hasta say s, yetersiz personel, bu iki faktörün etkiledi i infeksiyon kontrol önlemlerinde, baflta el y kama olmak üzere aksamalar ve son olarak MRSA yerleflimini kolaylaflt racak afl r antibiyotik kullan m d r. Üçüncü kuflak sefalosporinler, imipenem ve aminoglikozitlerin yo un kullan m MRSA kökenlerinde di er S. aureus kökenleri içinde seçici bask sa layarak yay lmay kolaylaflt rmaktad r (30). Bu say lan faktörler özellikle hastanemiz yo un bak m biriminde belirgindir. Daha sonra MYBÜ tüm hastaneye klonun yay lmas için merkez görevini görmüfltür. Hastane içinde de iflik servislere yay l m n yolu servisler aras nakledilen hastalar yan s ra konsültan hekimler hatta t p ö rencileri olabilir. Sonuç olarak S. aureus izolatlar içinde 1995 y - l nda %48 e ulaflan metisilin direnci nedeniyle TÜH flu anda MRSA n n endemik oldu u bir hastanedir. Direnç özellikle bir klonun yay lmas na ba l d r. Hastanemiz infeksiyon kontrol ekibi taraf ndan mücadele sürdürülmekte ise de halen bu klonun eradike edilmesi güç görünmektedir. KAYNAKLAR 1. Barber M. Methicillin resistant stapylococci. J Clin Pathol 1961;14: Brumfitt W, Hamilton-Miller J. Methicillin-resistant Staphylococcus aureus. N Eng J Med 1989; 320: Ar kan S, Taflova Y, Gür D, Özkuyumcu C, Ünal S, Akal n HE. Klinik örneklerden izole edilen stafilokoklar n antibiyotiklere duyarl l klar n n araflt r lmas. 5. Ulusal nfeksiyon Hastal klar Kongresi, 4-6 Eylül 1995, stanbul, Kongre Kitab 1995; Gürler N, Öngen B, Atilla A, Öksüz L, Töreci K. Gram pozitif koklarda seçimsiz duyarl l k deneylerinde saptanan direnç oranlar. ANKEM Derg 1995;9: Öztürk R, Midilli K, Ergin S, Aygün G. Cerrahpafla T p Fakültesi kliniklerinde yatan hastalar n klinik materyallerinden izole edilen stafilokoklar n antimikrobik maddelere duyarl l. ANKEM Derg 1995;9: Çetinkaya Y, Ünal S: Metisilin Derinçli Staphylococcus aureus infeksiyonlar : Epidemiyoloji ve kontrol. Flora 1996;1(3 ek): Akgül A, Dündar V, Metin T, Selçuk S: Haydarpafla Numune Hastanesi nde burun tafl y c lar ndan izole edilen Staphylococcus aureus sufllar nda oksasilin direnci. ANKEM Derg 1992;6: Fang FC, McClelland M, Guiney D, et al. Value of molecular analysis in a nozocomial methicillin-resistant Staphylococcus aureus outbreak. JAMA 1993;270: Kreiswirth B, Kornblum J, Arbeit RD, et al. Evidence for a clonal origin of methicillin resistance in Staphylococcus aureus. Science 1993;259: Tenover FC, Arbeit R, Archer G, et al. Comparison and molecular methods of typing isolates of Staphylococcus aureus. J Clin Microbiol 1994;32: Mulligan ME. Epidemiologic and clinical utility of typing systems for differentiating among strains of methicillin-resistant Staphylococcus aureus. Infect Cont Hosp Epidemiol 1991;12: Blanc DS, Christiane P, Moreillon P, Wenger A, Bille J, Francioli P. Quantitative antibiogram as a typing method for the prospective epidemiological surveillance and control of MRSA: Comparison with molecular typing. Infect Cont Hosp Epidemiol 1996;17: Giacca M, Menzo S, Trojan S, Monti-Bragadin C. Cluster analysis of antibiotic susceptibility patterns of clinical isolates as a tool in nozocomial infection surveillance. Eur J Epidemiol 1987;3: Blanc DS, Lugeon C, Wenger A, Siegrist HH, Francioli P. Quantitative antibiogram typing using inhibition zone diameters compared with ribotyping for epidemiological typing of methicillin-resistant Staphylococcus aureus. J Clin Microbiol 1994;32: Otkun M, Akata F, Teker B ve arkadafllar Nozocomial infections in a third level education hospital in Türkiye: Trakya University Hospital First European Congress of Chemotherapy May 1996 Glaskow, Scotland. Abstract Book, Abstract No: Kloos WE, Lambe WD Jr. Staphylococcus. In: Balows A, Hausler WJ Jr, Herrman KL, Isenberg HD, Shadomy HJ (ed). Manual of Clinical Microbiology. Fifth edition. Washington DC. American Society for Microbiology 1991: National Committee for Clinical Laboratory Stardards. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, Third edition; Approved standard. NCCLS Document M7-A3, Villanova, PA: NCCLS, Hastane nfeksiyonlar Dergisi 1997; 1: 2

10 Metisiline Dirençli Staphylococcus aureus un Otkun M, Akata F, Kocagöz S, Tatman-Otkun M, 18. Richard P, Meyran M, Carpentier E, Thabaut A, Drugeon HB. Comparison of phenotypic methods and DNA hybridization for detection of methicillin-resistant Staphylococcus aureus. J Clin Microbiol 1994;32: Unal S, Hoskins J, Flokowitsch JE, Ernie Wu CY, Preston DA, Skatrud PL. Detection of methicillinresistant staphylococci by using the polymerase chain reaction. J Clin Microbiol 1992;30: National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial disk susceptibility tests, Fourth edition. Approved standard, NCCLS Document M2-A4, vol.10. Villanova, PA: NCCLS, Bellum A, Kluytumans J, Leeuwen et al. Multicenter evaluation of Arbitrarily primed PCR for typing of Staphylococcus aureus strains. J. Clin Microbiol; 1995;33: Liu PY, Shi Z, Lau Y et al. Use of restriction endonuclease analysis of plasmids and pulsed fiels gel electrophoresis to investigate outbreaks of methicillin-resistant Staphylococcus aureus infection. Clin Infect Dis 1996;22: Mulligan ME, Arbeit RD: Epidemiologic and clinical utility of typing systems for differentiating among strains of methicillin-resistant Staphylococcus aureus. Infect Cont Hosp Epidemiol 1991;12: Maslow JN, Mulligan ME, Arbeit RD: Molecular epidemiology: The application of contemporary techniques to typing bacteria. Clin Infect Dis 1993;17: Archer GL, Mayhall CG. Comparison of epidemiological markers used in the investigation of an outbreak of methicillin-resistant Staphylococcus aureus infection. J Clin Microbiol 1983:18; Saulnier P, Bourneix C, Prévost G, Andremont A. Random amplified polymorphic DNA assay is less discriminant than pulsed-field gel electrophoresis for typing strains of methicillin-resistant Staphylococcus aureus. J Clin Microbiol 1993;31: Struelens MJ, Bax R, Deplano A, Quint WGV, Van Belkum A. Concordant clonal delineation of methicillin-resistant Staphylococcus aureus by macrorestriction analysis and polimerase chain reaction genome fingerprinting. J Clin Microbiol 1993;31: Jorgensen M, Givney R, Pegler M, Vickery A, Funnell G. Typing multidrug resistant Staphylococcus aureus: Conflicting epidemiological data produced by genotypic and phenotypic methods clarified by phylogenetic analysis. J Clin Microbiol 1996;34: Couto I, Melo-Christino J, Fernandes ML, et al. Unusually large number of methicillin-resistant Staphylococcus aureus clones in a Portuguese hospital. J Clin Microbiol 1995;33: Jacob J, Meers PD. Partial characterization of an endemic strain of a methicillin- and aminoglycoside-resistant Staphylococcus aureus (MARSA) homogeneously resistant to beta-lactam antibiotics. J Hosp Infect 1992;21: YAZIfiMA ADRES : Prof. Dr. Serhat ÜNAL Hacettepe Üniversitesi T p Fakültesi ç Hastal klar Anabilim Dal nfeksiyon Hastal klar Ünitesi Hacettepe-ANKARA Hastane nfeksiyonlar Dergisi 1997; 1: 2 115

SB Sakarya E itim ve Araflt rma Hastanesi Asinetobakterli Hastalarda DAS Uygulamalar ve yilefltirme Çabalar

SB Sakarya E itim ve Araflt rma Hastanesi Asinetobakterli Hastalarda DAS Uygulamalar ve yilefltirme Çabalar SB Sakarya E itim ve Araflt rma Hastanesi Asinetobakterli Hastalarda DAS Uygulamalar ve yilefltirme Çabalar Hmfl. Özlem SANDIKCI SB Sakarya E itim ve Araflt rma Hastanesi, nfeksiyon Kontrol Hemfliresi,

Detaylı

KOLONİZASYON. DR. EMİNE ALP Erciyes Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D.

KOLONİZASYON. DR. EMİNE ALP Erciyes Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D. KOLONİZASYON DR. EMİNE ALP Erciyes Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D. KOLONİZASYON Mikroorganizmanın bir vücut bölgesinde, herhangi bir klinik oluşturmadan

Detaylı

Yo un Bak m Ünitelerinden zole Edilen P. aeruginosa ve Acinetobacter Türlerinin Antibiyotik Duyarl l ndaki Dört Y ll k De iflim (1995 ve 1999) #

Yo un Bak m Ünitelerinden zole Edilen P. aeruginosa ve Acinetobacter Türlerinin Antibiyotik Duyarl l ndaki Dört Y ll k De iflim (1995 ve 1999) # Hastane nfeksiyonlar Dergisi 2001; 5: 49-53 Hastane İnfeksiyonları Yo un Bak m Ünitelerinden zole Edilen P. aeruginosa ve Acinetobacter Türlerinin Antibiyotik Duyarl l ndaki Dört Y ll k De iflim (1995

Detaylı

Kırıkkale Üniversitesi Hastane Personeli İle Hasta Ziyaretçilerinde Nazal Staphylococcus Aureus Taşıyıcılığı

Kırıkkale Üniversitesi Hastane Personeli İle Hasta Ziyaretçilerinde Nazal Staphylococcus Aureus Taşıyıcılığı Van Tıp Dergisi: 12 (2):140-144, 2005 Kırıkkale Üniversitesi Hastane Personeli İle Hasta Ziyaretçilerinde Nazal Staphylococcus Aureus Taşıyıcılığı Selda Hızel*, Cihat Şanlı**, Sedat Kaygusuz***, Alp Tunç****

Detaylı

Atatürk Üniversitesi Hastaneleri nde Hastane nfeksiyonlar :

Atatürk Üniversitesi Hastaneleri nde Hastane nfeksiyonlar : Hastane nfeksiyonlar Dergisi 2001; 5: 38-42 Hastane İnfeksiyonları Atatürk Üniversitesi Hastaneleri nde Hastane nfeksiyonlar : 1999 Y l Sonuçlar Dr. Mehmet A. TAfiYARAN*, Dr. Mustafa ERTEK*, Dr. Selahattin

Detaylı

Gülhane Askeri T p Akademisi Haydarpafla E itim Hastanesi nde Yatan Hastalardan zole Edilen Mikroorganizmalar n 1999 Y l Analizi

Gülhane Askeri T p Akademisi Haydarpafla E itim Hastanesi nde Yatan Hastalardan zole Edilen Mikroorganizmalar n 1999 Y l Analizi Hastane nfeksiyonlar Dergisi 2002; 6: 195-201 Hastane İnfeksiyonları Gülhane Askeri T p Akademisi Haydarpafla E itim Hastanesi nde Yatan Hastalardan zole Edilen Mikroorganizmalar n 1999 Y l Analizi Dr.

Detaylı

Daptomisin: Laboratuvar Yaklaşım. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul

Daptomisin: Laboratuvar Yaklaşım. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul Daptomisin: Laboratuvar Yaklaşım Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul Daptomisin: Mikrobiyolojik Yaklaşım İn vitro çalışma sonuçları İn vitro testler Direnç gelişimi DAPTOMİSİN

Detaylı

Metisilin dirençli Staphylococcus aureus suşlarının antibiyotiklere in-vitro duyarlılıkları

Metisilin dirençli Staphylococcus aureus suşlarının antibiyotiklere in-vitro duyarlılıkları 466 Dicle Tıp Dergisi / İ. Güler ve ark. Metisilin dirençli S.aureus 2011; 38 (4): 466-470 Dicle Medical Journal doi: 10.5798/diclemedj.0921.2011.04.0067 ÖZGÜN ARAŞTIRMA / ORIGINAL ARTICLE Metisilin dirençli

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

Kırıkkale Üniversitesi Tıp Fakültesi Cerrahi Yoğun Bakım Ünitesinde 2008-2009 Yıllarında İzole Edilen Mikroorganizmalar ve Antibiyotik Duyarlılıkları

Kırıkkale Üniversitesi Tıp Fakültesi Cerrahi Yoğun Bakım Ünitesinde 2008-2009 Yıllarında İzole Edilen Mikroorganizmalar ve Antibiyotik Duyarlılıkları 13 ƘŰƬƑƊ Özgün Araştırma / Original Article Kırıkkale Üniversitesi Tıp Fakültesi Cerrahi Yoğun Bakım Ünitesinde 2008-2009 Yıllarında İzole Edilen Mikroorganizmalar ve Antibiyotik Duyarlılıkları Microorganisms

Detaylı

AURAM NE RHODAM NE FLORESAN BOYAMA

AURAM NE RHODAM NE FLORESAN BOYAMA AURAM NE RHODAM NE FLORESAN BOYAMA Dr. Vildan AVKAN O UZ DEÜ T p Fakültesi nfeksiyon Hastal klar ve Klinik Mikrobiyoloji AD. Direkt mikroskopi teknikleri konusunun giriflinde verilen genel bilgiler ve

Detaylı

Hastane nfeksiyonlar n n Sürveyans ve Amerika Ulusal Nozokomiyal nfeksiyon Sürveyans Sistemi: II

Hastane nfeksiyonlar n n Sürveyans ve Amerika Ulusal Nozokomiyal nfeksiyon Sürveyans Sistemi: II Hastane nfeksiyonlar Dergisi 2002; 6: 107-124 Hastane İnfeksiyonları Amerika Ulusal Nozokomiyal nfeksiyon Sürveyans Sistemi: II [National Nosocomial Infection Surveillance System (NNIS)] Dr. Gül Ruhsar

Detaylı

Yoğun Bakımlarda İnfeksiyon Kontrolü: Haricen Klorheksidin Uygulanmalı mı?

Yoğun Bakımlarda İnfeksiyon Kontrolü: Haricen Klorheksidin Uygulanmalı mı? Yoğun Bakımlarda İnfeksiyon Kontrolü: Haricen Klorheksidin Uygulanmalı mı? Dr. Funda YETKİN İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Sunum Planı Klorheksidin

Detaylı

STANDARDİZASYON KURUMLARI VE TÜRKİYE

STANDARDİZASYON KURUMLARI VE TÜRKİYE STANDARDİZASYON KURUMLARI VE TÜRKİYE (yalnızca CLSI mı?) Dr.ELViN DiNÇ OKMEYDANI E.A.H ENFEKSİYON HASTALIKLARI VE KLİNİK MİKROBİYOLOJİ KLİNİĞİ Antibiyotik tedavisi gerektiren bir enfeksiyonda rolü olan

Detaylı

ÜLKEM ZDE ÇOK LACA D RENÇL TÜBERKÜLOZ EP DEM YOLOJ S

ÜLKEM ZDE ÇOK LACA D RENÇL TÜBERKÜLOZ EP DEM YOLOJ S ÜLKEM ZDE ÇOK LACA D RENÇL TÜBERKÜLOZ EP DEM YOLOJ S Doç.Dr. Kemal TAHAO LU Süreyyapafla Gö üs Hastal klar ve Gö üs Cerrahisi Merkezi, STANBUL Çok laca Dirençli Tüberküloz (Ç D TB) ile ilgili gerek ülkemizde

Detaylı

Klinik Örneklerden İzole Edilen Hastane Kaynaklı Metisiline Dirençli Staphylococcus aureus Suşlarının rep-pcr ile Genotiplendirilmesi

Klinik Örneklerden İzole Edilen Hastane Kaynaklı Metisiline Dirençli Staphylococcus aureus Suşlarının rep-pcr ile Genotiplendirilmesi Özgün Çalışma/Original Article Mikrobiyol Bul 2011; 45(4): 581-591 Klinik Örneklerden İzole Edilen Hastane Kaynaklı Metisiline Dirençli Staphylococcus aureus Suşlarının rep-pcr ile Genotiplendirilmesi

Detaylı

YARA YERİ ÖRNEKLERİNDEN İZOLE EDİLEN MİKROORGANİZMALAR VE ANTİBİYOTİK DUYARLILIKLARININ DEĞERLENDİRİLMESİ*

YARA YERİ ÖRNEKLERİNDEN İZOLE EDİLEN MİKROORGANİZMALAR VE ANTİBİYOTİK DUYARLILIKLARININ DEĞERLENDİRİLMESİ* ANKEM Derg ;(): YARA YERİ ÖRNEKLERİNDEN İZOLE EDİLEN MİKROORGANİZMALAR VE ANTİBİYOTİK DUYARLILIKLARININ DEĞERLENDİRİLMESİ* Süreyya GÜL YURTSEVER, Nükhet KURULTAY, Nihan ÇEKEN, Şenel YURTSEVER, İlhan AFŞAR,

Detaylı

İKİNCİ BÖLÜM EKONOMİYE GÜVEN VE BEKLENTİLER ANKETİ

İKİNCİ BÖLÜM EKONOMİYE GÜVEN VE BEKLENTİLER ANKETİ İKİNCİ BÖLÜM EKONOMİYE GÜVEN VE BEKLENTİLER ANKETİ 120 kinci Bölüm - Ekonomiye Güven ve Beklentiler Anketi 1. ARAfiTIRMANIN AMACI ve YÖNTEM Ekonomiye Güven ve Beklentiler Anketi, tüketici enflasyonu, iflsizlik

Detaylı

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara Taksonomik terimler Alem (Kingdom) Bölüm veya şube (divisio, filum)

Detaylı

İdrar Örneklerinden İzole Edilen Bakteriler ve Antibiyotiklere Duyarlılıkları

İdrar Örneklerinden İzole Edilen Bakteriler ve Antibiyotiklere Duyarlılıkları 95 Kocatepe Tıp Dergisi The Medical Journal of Kocatepe 12: 95-100 / Mayıs 2011 Afyon Kocatepe Üniversitesi İdrar Örneklerinden İzole Edilen Bakteriler ve Antibiyotiklere Duyarlılıkları Bacteria Isolated

Detaylı

GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60

GİRİŞ. Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi. ABD de yılda 200.000 KDE, mortalite % 35-60 Dr. Tolga BAŞKESEN GİRİŞ Kan dolaşımı enfeksiyonları (KDE) önemli morbidite ve mortalite sebebi ABD de yılda 200.000 KDE, mortalite % 35-60 Erken ve doğru tedavi ile mortaliteyi azaltmak mümkün GİRİŞ Kan

Detaylı

Bir Devlet Hastanesi Örne i: Eskiflehir Yunus Emre Devlet Hastanesinde 2005 Y l nda Saptanan Hastane nfeksiyonlar #

Bir Devlet Hastanesi Örne i: Eskiflehir Yunus Emre Devlet Hastanesinde 2005 Y l nda Saptanan Hastane nfeksiyonlar # Hastane nfeksiyonlar Dergisi 2006; 10: 244-248 Hastane İnfeksiyonları Bir Devlet Hastanesi Örne i: Eskiflehir Yunus Emre Devlet Hastanesinde 2005 Y l nda Saptanan Hastane nfeksiyonlar # Dr. Figen Ça lan

Detaylı

Geliş Tarihi (Received): 31.07.2012 Kabul Ediliş Tarihi (Accepted): 29.09.2012

Geliş Tarihi (Received): 31.07.2012 Kabul Ediliş Tarihi (Accepted): 29.09.2012 Özgün Çalışma/Original Article Mikrobiyol Bul 2013; 47(1): 11-18 Staphylococcus aureus Suşlarındaki Metisilin Direncinin Belirlenmesinde Sefoksitin Disk Difüzyon Testi, Otomatize Sistem ve Kromojenik Besiyerinin

Detaylı

MALAT SANAY N N TEMEL GÖSTERGELER AÇISINDAN YAPISAL ANAL Z

MALAT SANAY N N TEMEL GÖSTERGELER AÇISINDAN YAPISAL ANAL Z MALAT SANAY N N TEMEL GÖSTERGELER AÇISINDAN YAPISAL ANAL Z Nisan 2010 ISBN 978-9944-60-631-8 1. Bask, 1000 Adet Nisan 2010 stanbul stanbul Sanayi Odas Yay nlar No: 2010/5 Araflt rma fiubesi Meflrutiyet

Detaylı

Yo un Bak m Ünitesinde nvaziv Alet Kullan m ile liflkili Nozokomiyal nfeksiyon H zlar

Yo un Bak m Ünitesinde nvaziv Alet Kullan m ile liflkili Nozokomiyal nfeksiyon H zlar Hastane nfeksiyonlar Dergisi 2005; 9: 107-112 Hastane İnfeksiyonları Kullan m ile liflkili Nozokomiyal nfeksiyon H zlar Dr. Haluk ERDO AN*, Hmfl. Deniz AKAN**, Dr. Funda ERG N***, Dr. Aflk n ERDO AN****,

Detaylı

KLİNİK ÖRNEKLERDEN İZOLE EDİLEN STAPHYLOCOCCUS AUREUS SUŞLARINDA PANTON-VALENTİN LÖKOSİDİN (PVL) VARLIĞININ ARAŞTIRILMASI

KLİNİK ÖRNEKLERDEN İZOLE EDİLEN STAPHYLOCOCCUS AUREUS SUŞLARINDA PANTON-VALENTİN LÖKOSİDİN (PVL) VARLIĞININ ARAŞTIRILMASI MİKROBİYOL MİKROBİYOLOJİ BÜLT 2007; 41: BÜLTENİ 357-362 357 KLİNİK ÖRNEKLERDEN İZOLE EDİLEN STAPHYLOCOCCUS AUREUS SUŞLARINDA PANTON-VALENTİN LÖKOSİDİN (PVL) VARLIĞININ ARAŞTIRILMASI INVESTIGATION OF THE

Detaylı

TÜRK DÜNYASI TRANSPLANTASYON DERNE

TÜRK DÜNYASI TRANSPLANTASYON DERNE Prof. Haberal dan Yeni Bir Uluslararas At l m: TÜRK DÜNYASI TRANSPLANTASYON DERNE Dünyan n dört bir yan ndan yüzlerce biliminsan Prof. Dr. Mehmet Haberal taraf ndan kurulan Türk Dünyas Transplantasyon

Detaylı

Yo un Bak m Ünitesinde Ço ul Dirençli Pseudomonas aeruginosa ya Ba l Bir Hastane nfeksiyonu Salg n n n ncelenmesi #

Yo un Bak m Ünitesinde Ço ul Dirençli Pseudomonas aeruginosa ya Ba l Bir Hastane nfeksiyonu Salg n n n ncelenmesi # Hastane nfeksiyonlar Dergisi 2002; 6: 87-91 Hastane İnfeksiyonları Yo un Bak m Ünitesinde Ço ul Dirençli Pseudomonas aeruginosa ya Ba l Bir Hastane nfeksiyonu Salg n n n ncelenmesi # Dr. Zeynep GÜLAY*,

Detaylı

Febril Nötropenik Hastada Antimikrobiyal Direnç Sorunu : Kliniğe Yansımalar

Febril Nötropenik Hastada Antimikrobiyal Direnç Sorunu : Kliniğe Yansımalar Febril Nötropenik Hastada Antimikrobiyal Direnç Sorunu : Kliniğe Yansımalar Prof.Dr.Halit Özsüt İstanbul Üniversitesi İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı

Detaylı

Y.Y.Ü. Tıp Fakültesi Araştırma Hastanesi Personelinde Nazal Staphylococcus Aureus Taşıyıcılığı İle Metisiline Direnç Oranlarının Araştırılması

Y.Y.Ü. Tıp Fakültesi Araştırma Hastanesi Personelinde Nazal Staphylococcus Aureus Taşıyıcılığı İle Metisiline Direnç Oranlarının Araştırılması Van Bozkurt Tıp Dergisi: ve ark. 14 (2):52-56, 2007 Y.Y.Ü. Tıp Fakültesi Araştırma Hastanesi Personelinde Nazal Staphylococcus Aureus Taşıyıcılığı İle Metisiline Direnç Oranlarının Araştırılması Hamza

Detaylı

T bbi At k Kontrolü P80-P82. 7. Ulusal Sterilizasyon Dezenfeksiyon Kongresi - 2011 673

T bbi At k Kontrolü P80-P82. 7. Ulusal Sterilizasyon Dezenfeksiyon Kongresi - 2011 673 T bbi At k Kontrolü P80-P82 7. Ulusal Sterilizasyon Dezenfeksiyon Kongresi - 2011 673 P80 Son Dört Y ll k Kontamine Kesici Delici Alet Yaralanmalar Sürveyans Melek Meltem Göksel, Özgül Taflp nar, Fatma

Detaylı

Hastane infeksiyonlar nda moleküler biyolojik. Hastane nfeksiyonu Salg n nda Moleküler Biyolojik Yöntemler

Hastane infeksiyonlar nda moleküler biyolojik. Hastane nfeksiyonu Salg n nda Moleküler Biyolojik Yöntemler Hastane nfeksiyonlar Dergisi 2005; 9: 196-202 Hastane İnfeksiyonları Hastane nfeksiyonu Salg n nda Moleküler Biyolojik Yöntemler Dr. R za DURMAZ* * nönü Üniversitesi T p Fakültesi, Mikrobiyoloji ve Klinik

Detaylı

YÖNTEM 1.1. ÖRNEKLEM. 1.1.1. Örneklem plan. 1.1.2. l seçim ölçütleri

YÖNTEM 1.1. ÖRNEKLEM. 1.1.1. Örneklem plan. 1.1.2. l seçim ölçütleri BÖLÜM 1 YÖNTEM Bu çal flma 11, 13 ve 15 yafllar ndaki gençlerin sa l k durumlar ve sa l k davran fllar n saptamay hedefleyen, kesitsel tan mlay c ve çok uluslu Health Behavior in School Aged Children,

Detaylı

Son kullanma tarihi geçmiş ancak hiç kullanılmamış invazif aletleri yeniden sterilize edip kullanabilir miyiz?

Son kullanma tarihi geçmiş ancak hiç kullanılmamış invazif aletleri yeniden sterilize edip kullanabilir miyiz? ÖRNEK E-POSTER 1: Son Kullanma Tarihi Geçmiş İnvazif Aletlerin Yeniden Sterilizasyonu Son kullanma tarihi geçmiş ancak hiç kullanılmamış invazif aletleri yeniden sterilize edip kullanabilir miyiz? Kardiyoloji

Detaylı

SSK Ankara E itim Hastanesi nde Hastane nfeksiyonlar n n Sürveyans

SSK Ankara E itim Hastanesi nde Hastane nfeksiyonlar n n Sürveyans Hastane nfeksiyonlar Dergisi 1998; 2: 94-98 Hastane İnfeksiyonları SSK Ankara E itim Hastanesi nde Dr. Murat ERHAN*, Dr. Necla TÜLEK*, Dr. Ali MERT* * SSK Ankara E itim Hastanesi, Klinik Mikrobiyoloji

Detaylı

İnönü Üniversitesi Tıp Fakültesi Hastanesinde Hastane İnfeksiyonları +

İnönü Üniversitesi Tıp Fakültesi Hastanesinde Hastane İnfeksiyonları + İnönü Üniversitesi Tıp Fakültesi Dergisi 10(3) 133-137 (2003) İnönü Üniversitesi Tıp Fakültesi Hastanesinde Hastane İnfeksiyonları + Yasemin Ersoy*, Mehmet Fırat*, Çiğdem Kuzucu**, Yaşar Bayındır*, Şenay

Detaylı

Tablo 3.3. TAKV YES Z KANAL SAC KALINLIKLARI (mm)

Tablo 3.3. TAKV YES Z KANAL SAC KALINLIKLARI (mm) 3. KANAL KONSTRÜKS YONU Türk Standart ve fiartnamelerinde kanal konstrüksiyonu üzerinde fazla durulmam flt r. Bay nd rl k Bakanl fiartnamesine göre, bas nç s - n fland rmas na ve takviye durumuna bak lmaks

Detaylı

UÜ-SK ORGAN VE DOKU NAKLİ PROSEDÜRÜ

UÜ-SK ORGAN VE DOKU NAKLİ PROSEDÜRÜ Rev. No : 01 Rev.Tarihi : 13 Haziran 2012 1/ 1. Amaç: UÜ-SK da organ ve doku nakli hizmetlerinden yararlanacak hastaların ve/veya canlı vericilerinin başvuru kriterlerinin ve organ bekleme listelerine

Detaylı

Yo un Bak m Ünitelerinde Yatan Hastalarda Efl Zamanl drar ve drar Sonda Ucu Kültürlerinin De erlendirilmesi

Yo un Bak m Ünitelerinde Yatan Hastalarda Efl Zamanl drar ve drar Sonda Ucu Kültürlerinin De erlendirilmesi Hastane nfeksiyonlar Dergisi 1999; 3: 96-101 Hastane İnfeksiyonları Yo un Bak m Ünitelerinde Yatan Hastalarda Efl Zamanl drar ve drar Sonda Ucu Kültürlerinin De erlendirilmesi Dr. Kemalettin AYDIN*, Dr.

Detaylı

Alt Solunum Yolu nfeksiyonlar ndan zole Edilen Streptococcus Pneumoniae Sufllar n n Penisiline Karfl Direnç Oranlar

Alt Solunum Yolu nfeksiyonlar ndan zole Edilen Streptococcus Pneumoniae Sufllar n n Penisiline Karfl Direnç Oranlar ARAfiTIRMA Alt Solunum Yolu nfeksiyonlar ndan zole Edilen Streptococcus Pneumoniae Sufllar n n Penisiline Karfl Direnç Oranlar Günefl fienol, Onur Fevzi Erer, Can Biçmen, Serir Akto u zmir Gö üs Hastal

Detaylı

Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri

Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Emel AZAK, Esra Ulukaya, Ayşe WILLKE Kocaeli Üniversitesi Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik

Detaylı

Hastane infeksiyonlar, bir anlamda yatakl tedavi. Türkiye de Hastane nfeksiyonu Kontrolüne Yönelik Çal flmalar

Hastane infeksiyonlar, bir anlamda yatakl tedavi. Türkiye de Hastane nfeksiyonu Kontrolüne Yönelik Çal flmalar Hastane nfeksiyonlar Dergisi 1997; 1: 144-152 Hastane İnfeksiyonları Dr. Dilek ARMAN* * Gazi Üniversitesi T p Fakültesi, Klinik Bakteriyoloji ve nfeksiyon Hastal klar Anabilim Dal, Ankara. Hastane infeksiyonlar,

Detaylı

Hastane infeksiyonlar (sa l k hizmetine ba l. Kalite Göstergesi Olarak Hastane nfeksiyonlar. Hastane nfeksiyonlar Dergisi 2001; 5: 169-171

Hastane infeksiyonlar (sa l k hizmetine ba l. Kalite Göstergesi Olarak Hastane nfeksiyonlar. Hastane nfeksiyonlar Dergisi 2001; 5: 169-171 Hastane nfeksiyonlar Dergisi 2001; 5: 169-171 Hastane İnfeksiyonları Kalite Göstergesi Olarak Hastane nfeksiyonlar Dr. H. Erdal AKALIN* * Pfizer laçlar Afi, stanbul. Hastane infeksiyonlar (sa l k hizmetine

Detaylı

TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM

TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM Doç. Dr. Alpaslan Alp Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Dünya Sağlık Örgütü 2009 Yılı Raporu Aktif tüberkülozlu hasta

Detaylı

Veri Toplama Yöntemleri. Prof.Dr.Besti Üstün

Veri Toplama Yöntemleri. Prof.Dr.Besti Üstün Veri Toplama Yöntemleri Prof.Dr.Besti Üstün 1 VERİ (DATA) Belirli amaçlar için toplanan bilgilere veri denir. Araştırmacının belirlediği probleme en uygun çözümü bulabilmesi uygun veri toplama yöntemi

Detaylı

Toplum başlangıçlı Escherichia coli

Toplum başlangıçlı Escherichia coli Toplum başlangıçlı Escherichia coli nin neden olduğu üriner sistem infeksiyonlarında siprofloksasin direnci ve risk faktörleri: Prospektif kohort çalışma Türkan TÜZÜN 1, Selda SAYIN KUTLU 2, Murat KUTLU

Detaylı

B anka ve sigorta flirketlerinin yapm fl olduklar ifllemlerin özelli i itibariyle

B anka ve sigorta flirketlerinin yapm fl olduklar ifllemlerin özelli i itibariyle B anka ve sigorta flirketlerinin yapm fl olduklar ifllemlerin özelli i itibariyle bu ifllemlerin üzerinden al nan dolayl vergiler farkl l k arz etmektedir. 13.07.1956 tarih 6802 say l Gider Vergileri Kanunu

Detaylı

Antimikrobiyal Duyarlılık Testleri (AMD) Hangi Durumlarda Yapılmalı? Genel kavramlar

Antimikrobiyal Duyarlılık Testleri (AMD) Hangi Durumlarda Yapılmalı? Genel kavramlar ULUSAL MİKROBİYOLOJİ STANDARTLARI (UMS) Antimikrobiyal Duyarlılık Testleri Hangi Durumlarda Yapılmalı? Genel kavramlar Hazırlayan Birim Klinik Bakteriyoloji Tanı Standartları Çalışma Grubu- 11 Onaylayan

Detaylı

N-3 Diz Sabitleyici (Posterior Sheel)

N-3 Diz Sabitleyici (Posterior Sheel) N-3 Diz Sabitleyici (Posterior Sheel) Laminasyon tekni i ile kaplanm fl 1 cm lik özel süngerli kumafltan yap lan dizli in sa ve sol yanlar nda 1'er adet arkada ise 3 adet cep içine yerlefltirilmifl sert

Detaylı

Venöz Tromboembolizmin Önlenmesinde Antitrombotik Tedavi (Birincil Koruma)

Venöz Tromboembolizmin Önlenmesinde Antitrombotik Tedavi (Birincil Koruma) .Ü. Cerrahpafla T p Fakültesi Sürekli T p E itimi Etkinlikleri Kanama ve Tromboza E ilim Sempozyum Dizisi No: 36 Kas m 2003; s. 185-189 Venöz Tromboembolizmin Önlenmesinde Antitrombotik Tedavi (Birincil

Detaylı

Tüberküloz Sorun mudur? Tüberkülozun güncel tanısı ve sorunlar

Tüberküloz Sorun mudur? Tüberkülozun güncel tanısı ve sorunlar Tüberküloz Sorun mudur? Tüberkülozun güncel tanısı ve sorunlar Dr. Nurhan Albayrak Türkiye Halk Sağlığı Kurumu, Ulusal TB Referans Laboratuvarı Tüberküloz Sorun mu? Dünyanın en ölümcül bulaşıcı hastalığı

Detaylı

Minimum Bakterisidal. Prof.Dr.Ayşe Willke Topcu Mart 2010, Aydın

Minimum Bakterisidal. Prof.Dr.Ayşe Willke Topcu Mart 2010, Aydın Minimum Bakterisidal Konsantrasyon (MBC) Prof.Dr.Ayşe Willke Topcu Mart 2010, Aydın Antimikrobik Tedavinin Başarısı Esas olarak konak defans mekanizmasına bağlıdır Konak antibiyotikle etkisi azalmış mikroorganizmayı

Detaylı

TMS 19 ÇALIfiANLARA SA LANAN FAYDALAR. Yrd. Doç. Dr. Volkan DEM R Galatasaray Üniversitesi Muhasebe-Finansman Anabilim Dal Ö retim Üyesi

TMS 19 ÇALIfiANLARA SA LANAN FAYDALAR. Yrd. Doç. Dr. Volkan DEM R Galatasaray Üniversitesi Muhasebe-Finansman Anabilim Dal Ö retim Üyesi 1 2. B Ö L Ü M TMS 19 ÇALIfiANLARA SA LANAN FAYDALAR Yrd. Doç. Dr. Volkan DEM R Galatasaray Üniversitesi Muhasebe-Finansman Anabilim Dal Ö retim Üyesi 199 12. Bölüm, TMS-19 Çal flanlara Sa lanan Faydalar

Detaylı

HACETTEPE ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ PUREZONE CİHAZI TEST RAPORU

HACETTEPE ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ PUREZONE CİHAZI TEST RAPORU HACETTEPE ÜNİVERSİTESİ MÜHENDİSLİK FAKÜLTESİ PUREZONE CİHAZI TEST RAPORU Prof.Dr. Gülen GÜLLÜ Hacettepe Üniversitesi Çevre Mühendisliği Bölümü 06800 Beytepe Ankara OCAK 2010 Amaç: Bu çalışmada, Shenzhen

Detaylı

ANALOG LABORATUARI İÇİN BAZI GEREKLİ BİLGİLER

ANALOG LABORATUARI İÇİN BAZI GEREKLİ BİLGİLER ANALOG LABORATUARI İÇİN BAZI GEREKLİ BİLGİLER Şekil-1: BREADBOARD Yukarıda, deneylerde kullandığımız breadboard un şekli görünmektedir. Bu board üzerinde harflerle isimlendirilen satırlar ve numaralarla

Detaylı

Hastane infeksiyonlarında klinisyenin klinik mikrobiyoloji laboratuvarından beklentileri

Hastane infeksiyonlarında klinisyenin klinik mikrobiyoloji laboratuvarından beklentileri Hastane infeksiyonlarında klinisyenin klinik mikrobiyoloji laboratuvarından beklentileri Dr. Bilgin ARDA Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Mini Anket 13

Detaylı

Cerrahi Yoğun Bakım Ünitesinden İzole Edilen Bakteriler ve Antibiyotik Duyarlılıkları

Cerrahi Yoğun Bakım Ünitesinden İzole Edilen Bakteriler ve Antibiyotik Duyarlılıkları Cerrahi Yoğun Bakım Ünitesinden İzole Edilen Bakteriler ve Antibiyotik Duyarlılıkları Serap GENÇER*, Nur BENZONANA*, Serdar ÖZER*, İsmihan KUZU*, Yaman ÖZYURT** * Dr. Lütfü Kırdar Eğitim ve Araştırma Hastanesi,

Detaylı

Bağışıklama ve Mikrobiyolojik Sürveyans İnvaziv Bakteriyel Etkenler

Bağışıklama ve Mikrobiyolojik Sürveyans İnvaziv Bakteriyel Etkenler Bağışıklama ve Mikrobiyolojik Sürveyans İnvaziv Bakteriyel Etkenler Dr. Selin NAR ÖTGÜN Türkiye Halk Sağlığı Kurumu Mikrobiyoloji Referans Laboratuvarları Daire Başkanlığı 3.Ulusal Klinik Mikrobiyoloji

Detaylı

İnsan ve sığır kökenli Staphylococcus aureus izolatlarının fenotipik ve genotipik özelliklerinin araştırılması *

İnsan ve sığır kökenli Staphylococcus aureus izolatlarının fenotipik ve genotipik özelliklerinin araştırılması * Ankara Üniv Vet Fak Derg, 56, 119-126, 2009 İnsan ve sığır kökenli Staphylococcus aureus izolatlarının fenotipik ve genotipik özelliklerinin araştırılması * Nilgün ÜNAL, Ersin İSTANBULLUOĞLU Kırıkkale

Detaylı

Merkezi Sterilizasyon Ünitesinde Hizmet çi E itim Uygulamalar

Merkezi Sterilizasyon Ünitesinde Hizmet çi E itim Uygulamalar Merkezi Sterilizasyon Ünitesinde Hizmet çi E itim Uygulamalar Hmfl. Sevgili GÜREL Emekli, Ac badem Sa l k Grubu Ac badem Hastanesi, Merkezi Sterilizasyon Ünitesi, STANBUL e-posta: sgurkan@asg.com.tr H

Detaylı

Animasyon Tabanl Uygulamalar n Yeri ve Önemi

Animasyon Tabanl Uygulamalar n Yeri ve Önemi Otomasyon Sistemleri E itiminde Animasyon Tabanl Uygulamalar n Yeri ve Önemi Murat Ayaz Kocaeli Üniversitesi Teknik E itim Fakültesi, Elektrik E itimi Koray Erhan Kocaeli Üniversitesi, Teknoloji Fakültesi,

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

drar Kültürlerinden zole Edilen Escherichia Coli Sufllar n n S k Kullan lan Antibakteriyellere Karfl Duyarl l klar

drar Kültürlerinden zole Edilen Escherichia Coli Sufllar n n S k Kullan lan Antibakteriyellere Karfl Duyarl l klar Trakya Univ Tip Fak Derg 2007;24(1):6-11 Klinik Çal flma - Araflt rma / Original Article drar Kültürlerinden zole Edilen Escherichia Coli Sufllar n n S k Kullan lan Antibakteriyellere Karfl Duyarl l klar

Detaylı

Zihin ve Hareket Engelli Çocuklar çin E itim Araflt rma ve Uygulama Merkezi nde zlenen Olgular n Demografik Özellikleri

Zihin ve Hareket Engelli Çocuklar çin E itim Araflt rma ve Uygulama Merkezi nde zlenen Olgular n Demografik Özellikleri TRAKYA ÜN V TIP FAK DERG 2005;22(2):88-92 KL N K ARAfiTIRMA Zihin ve Hareket Engelli Çocuklar çin E itim Araflt rma ve Uygulama Merkezi nde zlenen Olgular n Demografik Özellikleri Demographic Characteristics

Detaylı

YÖNETMELİK ANKARA ÜNİVERSİTESİ YABANCI DİL EĞİTİM VE ÖĞRETİM YÖNETMELİĞİ BİRİNCİ BÖLÜM. Amaç, Kapsam, Dayanak ve Tanımlar

YÖNETMELİK ANKARA ÜNİVERSİTESİ YABANCI DİL EĞİTİM VE ÖĞRETİM YÖNETMELİĞİ BİRİNCİ BÖLÜM. Amaç, Kapsam, Dayanak ve Tanımlar 24 Mart 2016 PERŞEMBE Resmî Gazete Sayı : 29663 YÖNETMELİK ANKARA ÜNİVERSİTESİ YABANCI DİL EĞİTİM VE ÖĞRETİM YÖNETMELİĞİ BİRİNCİ BÖLÜM Amaç, Kapsam, Dayanak ve Tanımlar Amaç MADDE 1 (1) Bu Yönetmeliğin

Detaylı

Kateter İnfeksiyonlarında Mikrobiyoloji Doç. Dr. Deniz Akduman Karaelmas Üniversitesi it i Tıp Fakültesi İnfeksiyon hastalıkları ve Klinik Mikrobiyoloji A.D Kateter infeksiyonlarında etkenler; kateter

Detaylı

1. AMAÇ : Hastanenin tüm bölümlerini kapsayan enfeksiyonların önlenmesini sağlamak ve enfeksiyon kontrol programını sağlamak.

1. AMAÇ : Hastanenin tüm bölümlerini kapsayan enfeksiyonların önlenmesini sağlamak ve enfeksiyon kontrol programını sağlamak. Ü VE 1. AMAÇ : Hastanenin tüm bölümlerini kapsayan enfeksiyonların önlenmesini sağlamak ve enfeksiyon kontrol programını sağlamak. 2. KAPSAM : Özel Yalova Hastanesi tüm bölümlerini ve tüm çalışanlarını

Detaylı

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar.

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar. DNA Đzolasyonu Saflaştırılmak istenen DNA ya genomik DNA dır ya da genomik olmayan mtdna, chldna, plasmit DNAsıdır.DNA izolasyon kitleri, genomik ve genomik olmayan DNA izole etmemizi sağlayan standartlaştırılmış

Detaylı

Gram Pozitif Bakteriler ve Duyarlılık Testleri. Güner Söyletir

Gram Pozitif Bakteriler ve Duyarlılık Testleri. Güner Söyletir Gram Pozitif Bakteriler ve Duyarlılık Testleri Güner öyletir Olgu 1 35 y, erkek hasta Karın bölgesinden kurşun yaralanması sonucu cerrahi. Cerrahiden 2 gün sonra yara enfeksiyonu af kültür. aureus Olgu

Detaylı

Staphylococcus aureus gram-pozitif, kümeleflme. Staphylococcus aureus (MRSA) Hastanelerde Metisilin Dirençli

Staphylococcus aureus gram-pozitif, kümeleflme. Staphylococcus aureus (MRSA) Hastanelerde Metisilin Dirençli Hastane nfeksiyonlar Dergisi 2002; 6: 12-18 Hastane İnfeksiyonları Hastanelerde Metisilin Dirençli Staphylococcus aureus (MRSA) Kontrol Politikalar ve MRSA Kolonizasyonunun Eradikasyonu Dr. Aynur KARADEN

Detaylı

KISITLI ANTİBİYOTİK BİLDİRİMİ

KISITLI ANTİBİYOTİK BİLDİRİMİ KISITLI ANTİBİYOTİK BİLDİRİMİ YAYIN TARİHİ 01/07/2011 REVİZYON TAR.-NO 00 BÖLÜM NO 04 STANDART NO 11 DEĞERLENDİRME ÖLÇÜTÜ 00 Kısıtlı Bildirim : Duyarlılık test sonuçları klinikteki geniş spektrumlu antimikrobik

Detaylı

ÇALIŞAN SAĞLIĞI BİRİMİ İŞLEYİŞİ Hastanesi

ÇALIŞAN SAĞLIĞI BİRİMİ İŞLEYİŞİ Hastanesi KİHG/İŞL-005 19.08.2009 07.08.2012 2 1/8 GÜNCELLEME BİLGİLERİ Güncelleme Tarihi Güncelleme No Açıklama 11.11.2009 1 Belge içeriğinde ve belge numarasında değişiklik yapılması 07.08.2012 2 Komite, başlık,

Detaylı

Düzce Üniversitesi Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı, Düzce. (mustafayildirim81@yahoo.com.

Düzce Üniversitesi Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı, Düzce. (mustafayildirim81@yahoo.com. MİKROBİYOL MİKROBİYOLOJİ BÜLT 2007; 41: BÜLTENİ 271-277 271 KISA BİLDİRİ: YATAN HASTALARDA VANKOMİSİN VE YÜKSEK DÜZEY AMİNOGLİKOZİD DİRENÇLİ ENTEROKOK TAŞIYICILIĞININ VE DİRENÇ İLE İLİŞKİLİ RİSK FAKTÖRLERİNİN

Detaylı

LENFOMA NEDİR? Lenfoma lenf dokusunun kötü huylu tümörüne verilen genel bir isimdir.

LENFOMA NEDİR? Lenfoma lenf dokusunun kötü huylu tümörüne verilen genel bir isimdir. LENFOMA LENFOMA NEDİR? Lenfoma lenf dokusunun kötü huylu tümörüne verilen genel bir isimdir. LENF SİSTEMİ NEDİR? Lenf sistemi vücuttaki akkan dolaşım sistemidir. Lenf yolu damarlarındaki bağışıklık hücreleri,

Detaylı

www.mercedes-benz.com.tr Mercedes-Benz Orijinal Ya lar

www.mercedes-benz.com.tr Mercedes-Benz Orijinal Ya lar www.mercedes-benz.com.tr Mercedes-Benz Orijinal Ya lar Kazand ran Güç Mercedes-Benz orijinal ya lar arac n z üreten uzmanlar taraf ndan, gelifltirilmifltir. Mercedes-Benz in dilinden en iyi Mercedes-Benz

Detaylı

Eskiflehir Yunus Emre Devlet Hastanesi nde 2005 Y l nda Saptanan Hastane Enfeksiyonlar

Eskiflehir Yunus Emre Devlet Hastanesi nde 2005 Y l nda Saptanan Hastane Enfeksiyonlar P001 Eskiflehir Yunus Emre Devlet Hastanesi nde 2005 Y l nda Saptanan Hastane Enfeksiyonlar Figen Ça lan Çevik 1, Nevil Ayk n 1, Hasan Naz 1, Melahat U ur 2, Zühre Do ru Yaflar 2 Eskiflehir Yunus Emre

Detaylı

(Hastane Kökenli) SAĞLIK HİZMETİ İLİŞKİLİ İNFEKSİYONLARIN EPİDEMİYOLOJİSİ VE RİSK FAKTÖRLERİ

(Hastane Kökenli) SAĞLIK HİZMETİ İLİŞKİLİ İNFEKSİYONLARIN EPİDEMİYOLOJİSİ VE RİSK FAKTÖRLERİ (Hastane Kökenli) SAĞLIK HİZMETİ İLİŞKİLİ İNFEKSİYONLARIN EPİDEMİYOLOJİSİ VE RİSK FAKTÖRLERİ Dr Vildan AVKAN-OĞUZ Dokuz Eylül Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji

Detaylı

Kocaeli Üniversitesi ktisadi ve dari Bilimler Fakültesi Ö retim Üyesi. 4. Bas

Kocaeli Üniversitesi ktisadi ve dari Bilimler Fakültesi Ö retim Üyesi. 4. Bas 1 Prof. Dr. Yunus Kishal Kocaeli Üniversitesi ktisadi ve dari Bilimler Fakültesi Ö retim Üyesi Tekdüzen Hesap Sistemi ve Çözümlü Muhasebe Problemleri 4. Bas Tekdüzen Muhasebe Sistemi Uygulama Tebli leri

Detaylı

Streptococcus pyogenes'in Etken Olduğu Cerrahi Alan İnfeksiyonu Salgını

Streptococcus pyogenes'in Etken Olduğu Cerrahi Alan İnfeksiyonu Salgını Streptococcus pyogenes'in Etken Olduğu Cerrahi Alan İnfeksiyonu Salgını Yasemin Tezer Tekçe 1, Ayşe Erbay 2, Özlem Ünaldı 3, Hatice Çabadak 1, Süha Şen 1, Rıza Durmaz 3 1 Türkiye Yüksek İhtisas Eğitim

Detaylı

Araştırma Notu 15/177

Araştırma Notu 15/177 Araştırma Notu 15/177 02 Mart 2015 YOKSUL İLE ZENGİN ARASINDAKİ ENFLASYON FARKI REKOR SEVİYEDE Seyfettin Gürsel *, Ayşenur Acar ** Yönetici özeti Türkiye İstatistik Kurumu (TÜİK) tarafından yapılan enflasyon

Detaylı

ORHAN YILMAZ (*) B- 3095 SAYILI YASADA YAPILAN DE fi KL KLER:

ORHAN YILMAZ (*) B- 3095 SAYILI YASADA YAPILAN DE fi KL KLER: YASAL TEMERRÜT FA Z ORHAN YILMAZ (*) A- G R fi: Bilindi i üzere, gerek yasal kapital faizi ve gerekse yasal temerrüt faizi yönünden uygulanmas gereken hükümler, 19.12.1984 gün ve 18610 say l Resmi Gazete

Detaylı

Tuğba Kula Atık, Bayhan Bektöre, Mehmet Burak Selek, Ümit Karakaş, Orhan Baylan, Mustafa Özyurt 1

Tuğba Kula Atık, Bayhan Bektöre, Mehmet Burak Selek, Ümit Karakaş, Orhan Baylan, Mustafa Özyurt 1 BİR EĞİTİM HASTANESİ YOĞUN BAKIM ÜNİTESİNDE GÖRÜLEN SPHİNGOMONAS PAUCİMOBİLİS SALGINI VE ELDE EDİLEN İZOLATLARIN ARBITRARILY PRIMED POLİMERAZ ZİNCİR REAKSİYONU İLE KLONAL İLİŞKİSİNİN ARAŞTIRILMASI Tuğba

Detaylı

Kan kültürü örneklerinde üreyen Candida türlerinin tanımlanmasında MALDI TOFTOF-MS yönteminin değerlendirilmesi Görkem Yaman1, Işın Akyar1, Simge Can2 1Acıbadem Üniversitesi, Tıbbi Mikrobiyoloji AD, İstanbul

Detaylı

2. Kapsam: Bu prosedür erişkin ve çocuk hastanın yoğun bakım ünitesine kabul edilmesinden taburcu edilmesine kadar yürütülen işlemleri kapsar.

2. Kapsam: Bu prosedür erişkin ve çocuk hastanın yoğun bakım ünitesine kabul edilmesinden taburcu edilmesine kadar yürütülen işlemleri kapsar. 1 / 5 1. Amaç: Bu prosedür, UÜ-SK da yaşam desteğine gerek duyan ve komadaki erişkin ve çocuk hastalara sunulacak yoğun bakım hizmetlerinin eşit, standart ve etkin bir şekilde yürütülmesini sağlamayı amaçlamaktadır.

Detaylı

Proteus mirabilis in moleküler tiplemesi için pulsed-field jel elektroforezinin optimizasyonu

Proteus mirabilis in moleküler tiplemesi için pulsed-field jel elektroforezinin optimizasyonu 306 JCEI / Karagöz ve ark. Proteus mirabilis moleküler tiplemesi 2013; 4 (3): 306-312 Journal of Clinical and Experimental Investigations doi: 10.5799/ahinjs.01.2013.03.0290 ÖZGÜN ARAŞTIRMA / RESEARCH

Detaylı

Vankomisin dirençli enterokok suşlarının rep-pcr yöntemi ile klonal analizlerinin değerlendirilmesi

Vankomisin dirençli enterokok suşlarının rep-pcr yöntemi ile klonal analizlerinin değerlendirilmesi Araştırma Makalesi/Original Article Makale Dili Türkçe /Article Language Turkish Türk Hijyen ve Cilt Deneysel 73 Biyoloji Sayı 1 Dergisi 2016 Vankomisin dirençli enterokok suşlarının rep-pcr yöntemi ile

Detaylı

BEBEK VE ÇOCUK ÖLÜMLÜLÜĞÜ 9

BEBEK VE ÇOCUK ÖLÜMLÜLÜĞÜ 9 BEBEK VE ÇOCUK ÖLÜMLÜLÜĞÜ 9 Attila Hancıoğlu ve İlknur Yüksel Alyanak Sağlık programlarının izlenmesi, değerlendirilmesi ve ileriye yönelik politikaların belirlenmesi açısından neonatal, post-neonatal

Detaylı

Bir Üniversite Hastanesinde Hastane nfeksiyonlu Hasta Prevalans :

Bir Üniversite Hastanesinde Hastane nfeksiyonlu Hasta Prevalans : Hastane nfeksiyonlar Dergisi 2002; 6: 32-40 Hastane İnfeksiyonları Bir Üniversite Hastanesinde Hastane nfeksiyonlu Hasta Prevalans : Dr. Selma MET NTAfi*, Dr. Yurdanur AKGÜN**, Dr. Didem ARSLANTAfi*, Dr.

Detaylı

Dr.Şua Sümer Selçuk Üniversitesi Selçuklu Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD KONYA

Dr.Şua Sümer Selçuk Üniversitesi Selçuklu Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD KONYA Dr.Şua Sümer Selçuk Üniversitesi Selçuklu Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD KONYA 49 yaşında, erkek hasta Sol ayakta şişlik, kızarıklık Sol ayak altında siyah renkte yara

Detaylı

Menenjit Ön Tanılı Hastaların BOS Örneklerinin Bir Yıllık Bakteriyolojik İnceleme Sonuçlarının

Menenjit Ön Tanılı Hastaların BOS Örneklerinin Bir Yıllık Bakteriyolojik İnceleme Sonuçlarının Cumhuriyet Üniversitesi Tıp Fakültesi Menenjit Ön Tanılı Hastaların BOS Örneklerinin Bir Yıllık Bakteriyolojik İnceleme Sonuçlarının Değerlendirilmesi Evaluation of the Results of CCF Samples Investigated

Detaylı

TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM)

TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM) TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM) Ne zaman etkendir? Duyarlılık testleri ne zaman ve nasıl yapılmalıdır? Nasıl tedavi edilmelidir? TDM NE ZAMAN ETKENDİR? Şebeke suyundan, topraktan, doğal sulardan,

Detaylı

BİR EĞİTİM HASTANESİNİN ÇOCUK KLİNİĞİNDE

BİR EĞİTİM HASTANESİNİN ÇOCUK KLİNİĞİNDE Özgün Çalışma/Original Article Mikrobiyol Bul 2009; 43: 365-372 BİR EĞİTİM HASTANESİNİN ÇOCUK KLİNİĞİNDE vana GENOTİP ENTEROCOCCUS FAECIUM SALGINI AN OUTBREAK OF vana GENOTYPE ENTEROCOCCUS FAECIUM IN PEDIATRIC

Detaylı

Ayşe YÜCE Dokuz Eylül Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD.

Ayşe YÜCE Dokuz Eylül Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. TÜRKİYE DE TÜBERKÜLOZUN DURUMU Ayşe YÜCE Dokuz Eylül Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. DSÖ Küresel Tüberküloz Kontrolü 2010 Raporu Dünya için 3 büyük tehlikeden

Detaylı

Yay n No : 1700 flletme-ekonomi Dizisi : 196. 1. Bask Ocak 2007 - STANBUL

Yay n No : 1700 flletme-ekonomi Dizisi : 196. 1. Bask Ocak 2007 - STANBUL I Doç.Dr. Faz l GÜLER T E M E L STAT ST K II Yay n No : 1700 flletme-ekonomi Dizisi : 196 1. Bask Ocak 2007 - STANBUL ISBN 978-975 - 295-594 - 3 Copyright Bu kitab n bu bas s n n Türkiye deki yay n haklar

Detaylı

Yoğun Bakım Ünitesinde Yatan Hastalarda Metisiline Dirençli Staphylococcus Aureus Nazal Kolonizasyonu ve Hastane Enfeksiyonu İlişkisi

Yoğun Bakım Ünitesinde Yatan Hastalarda Metisiline Dirençli Staphylococcus Aureus Nazal Kolonizasyonu ve Hastane Enfeksiyonu İlişkisi İstanbul Tıp Derg - Istanbul Med J 2010;11(4):159-163 KLİNİK ÇALIŞMA - ORIGINAL ARTICLE Yoğun Bakım Ünitesinde Yatan Hastalarda Metisiline Dirençli Staphylococcus Aureus Nazal Kolonizasyonu ve Hastane

Detaylı

Marmara Üniversitesi T p Fakültesi Pediatri Servisinde

Marmara Üniversitesi T p Fakültesi Pediatri Servisinde Hastane nfeksiyonlar Dergisi 2006; 10: 143-148 Hastane İnfeksiyonları Marmara Üniversitesi T p Fakültesi Pediatri Servisinde 2004 Y l Nozokomiyal nfeksiyonlar Dr. Ahmet SOYSAL*, Dr. Demet TOPRAK*, Dr.

Detaylı

T ürk Gelir Vergisi Sisteminde, menkul sermaye iratlar n n ve özellikle de

T ürk Gelir Vergisi Sisteminde, menkul sermaye iratlar n n ve özellikle de KURUMLARDAN ELDE ED LEN KAR PAYLARININ VERG LEND R LMES VE BEYANI Necati PERÇ N Gelirler Baflkontrolörü I.- G R fi T ürk Gelir Vergisi Sisteminde, menkul sermaye iratlar n n ve özellikle de flirketlerce

Detaylı

YARGITAY 14. HUKUK DA RES KARARLARI

YARGITAY 14. HUKUK DA RES KARARLARI YARGITAY 14. HUKUK DA RES E: 2004/5475 K: 2004/9296 T: 30.12.2004 SATIfi VAAD SÖZLEfiMES N N GERÇEKLEfiME OLANA I MAR PLANLARI (3194 SK. m. 18/son) YARGITAY 14. HUKUK DA RES KARARLARI Özet: Bir tafl nmazda

Detaylı