Veritabanı Tasarımı. Düzenli İfadeler

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Veritabanı Tasarımı. Düzenli İfadeler"

Transkript

1 Veritabanı Tasarımı Düzenli İfadeler

2 Konular Düzenli ifadeleri tanımlama SQL ifadelerinde düzenli ifadeleri arama, eşleme ve yer değiştirme katarlarında kullanma Düzenli ifadeleri ve kontrol kısıtlamalarını oluşturma ve çalıştırma 2

3 Amaç Bazen bir sütundaki, metin katarı veya belgedeki belirli bir metni aramak ya da değiştirmek zorunda olabilirsiniz. Zaten LIKE ve joker karakter kullanarak basit desen eşleştirme gerçekleştirmeyi biliyorsunuz. Bazen belirtilen metinde Winchester kelimesini bulmak ya da bir metin parçasından tüm URL'leri ayıklamak gibi çok karmaşık metin dizelerine bakmanız gerekebilir. Diğer zamanlarda her ikinci karakteri sesli olan tüm kelimeleri bulmanız gibi daha karmaşık aramalar yapmanız istenebilir. 3

4 Amaç Düzenli ifadeler arama ve değiştirme için hem basit hem de karmaşık modellerdir. Bilgi işleme endüstrisinde sıklıkla kullanılır ve Oracle ile sınırılı değildir. Oracle düzenli ifadeler uygulaması POSIX in uzantısıdır ve IEEE tarafından kontrol edilen bu standart ile tamamen uyumludur. 4

5 Düzenli İfadeler Düzenli ifadelerin kullanılması meta karakterlerin kullanımına dayanmaktadır. Meta karakterler, joker bir karakter, yinelenen bir karakter, eşleşmeyen bir karakter ya da bir karakter aralığı olarak özel bir anlama sahip özel karakterlerdir. Desen eşleştirmede önceden tanımlanmış bir meta karakter sembolü kullanabilirsiniz. Bir sonraki sayfalarda meta karakterler listelenmekte ve her biri için kısa açıklama verilmektedir. 5

6 META Karakterler Sembol Açıklama * Sıfır veya daha fazla örnekle eşleşir Alternatif eşleşmeleri belirtmek için kullanılan eşleşme operatörü ^/$ Satır-başlangıcı / Satır-sonu eşleşmesi [ ] Listede verilen ifadelerin herhangi biri ile eşleşen, eşleşme listesi köşeli parantez arasında belirtilir {m} {m,n} m kere tam eşleşme En m kere fakat en fazla n kere eşleşme [: : ] Bir karakter sınıfını belirtir ve bu sınıfta herhangi bir karakterle eşleşme 6

7 META Karakterler Sembol Açıklama \ 4 farklı anlama sahip olabilir: 1. Kendisi için duran 2. Bir sonraki karakteri tırnaklar 3. Bir operatörü tanıtır 4. Hiçbir şey yapmaz + Bir ya da daha çok tekrarı eşler? Sıfır yada bir tekrarı eşler. Desteklenen karakter setinde NULL hariç herhangi bir karakteri eşler ( ) Tek bir alt-ifade olarak kullanılan gruplama ifadesi [==] Eşitlik sınıflarını belirtir \n Geri-referans ifadesi [..] Çok karakterli bir eleman olarak bir harmanlama elemanı belirtir 7

8 Düzenli İfade Örnekleri Basit bir düzenli ifade aşina olduğunuz joker aramalarına çok benzerdir. Bir örneğe bir göz atalım: Nokta operatörü kullanarak a ile c arasında bulunan herhangi bir karakteri arayalım. Düzenli bir ifade olarak bu a.c şeklinde olmalıdır. Aynı ifade SQL standart joker araması olarak şu şekildedir: WHERE sütun LIKE a_c. 8

9 Düzenli İfade Örnekleri Aşağıdaki ifadelerden hangileri a.c ile eşleşmektedir? ABC, abc, aqx, axc, abc, abc, Amc, amrc 9

10 Düzenli İfade Örnekleri Kırmızı işaretli olan katarlar a.c arama katarı ile eşleşmektedir. ABC, abc, aqx, axc, abc, abc, Amc, amrc Diğer örnekler ya harfin yanlış yerde olması ya da büyük/küçük harf ifadesinin yanlış olmasından kaynaklanmaktadır. 10

11 Düzenli İfade Örnekleri Adı Stephen veya Steven olan tüm çalışanların listelenmesinin istendiğini varsayalım. Şayet standart Oracle joker aramasını kullanırsanız bu başarmak için zor olacaktır fakat düzenli ifadelerle bunu şu şekilde ifade edebiliriz: ^Ste(v ph)en$ ^ aranan katarın başlangıcını ifade eder S büyük harf t küçük harf e küçük harf 11

12 Düzenli İfade Örnekleri ^Ste(v ph)en$ ( bir grup başlatır v küçük harf VEYA ifadesi p küçük harf h küçük harf ) seçilen grubu bitirir e küçük harf n küçük harf $ aranan katarın sonunu belirtir 12

13 Düzenli İfade Fonksiyonları Oracle, düzenli ifadeler kullanarak katarlarda arama ve değişiklik için bir SQL fonksiyonları kümesi sağlar. Bu fonksiyonları CHAR, CLOB ve VARCHAR2 gibi karakter verileri tutan herhangi bir veri türünde kullanabilirsiniz. Bir düzenli ifade tek tırnak işareti içinde verilmelidir. 13

14 Düzenli İfade Fonksiyonları Ad REGEXP_LIKE REGEXP_REPLACE REGEXP_INSTR REGEXP_SUBSTR REGEXP_COUNT Açıklama LIKE operatörüne benzer fakat basit model eşleme yerine düzenli ifade eşlemesi gerçekleştirir. Düzenli bir ifade modeli için arama yapar ve onu değiştirme katarı ile değiştirir. Verilen bir katar için verilen bir düzenli ifade modeli arar ve eşleşmenin bulunduğu pozisyonu geri döndürür. Verilen katar için düzenli bir ifade modeli arar ve eşleşen alt katarı geri döndürür. Bir katarda bir modelin tekrar edilme sayısını geri döndürür. Katarı ve modeli belirtmelisiniz. Ayrıca başlangıç pozisyonunu ve eşleme seçeneklerini belirtebilirsiniz. 14

15 Düzenli İfade Fonksiyonu Örnekleri REGEXP_LIKE düzenli ifadesinin kullanımı Steven veya Stephen listeleme probleminin çözümü için kullanılabilir: 15

16 Düzenli İfade Fonksiyonu Örnekleri Sayı ile başlamayan adreslerin aranması ve bu adresteki ilk alfa olmayan karakterin pozisyonunun listelenmesi şu şekilde yapılabilir: Açıklama ve sonuçlar bir sonraki sayfada bulunabilir. 16

17 Düzenli İfade Fonksiyonu Örnekleri [ ifadenin başlangıcını belirtir ^ parantez içinde belirtildiği zaman NOT anlamına gelir [:alpha:] numaralar gibi alfa karakter sınıfını belirtir ] ifade sonunu belirtir 17

18 Düzenli İfade Fonksiyonu Örnekleri Sokak adresinde, ilk alfabetik olmayan karakter 9. karakter pozisyonundaki boşluk karakteridir. Bu sokak adresleri 123 F gibi numara ile başlar. Sokak, alfabetik olmayan ilk karakterine 1. karakter pozisyonunda sahiptir ve WHERE deyimi kullanarak arama dışına alınır. 18

19 Düzenli İfade Fonksiyonu Örnekleri Bir cümle içeren bir sütundaki sadece ikinci kelimeyi geri döndürmek için aşağıdaki ifadeyi çalıştırabilirsiniz: Herhangi bir boşluk olmayan [^ ]+ karakterin bir ya da daha fazla tekrarını bulur. Bu da ayrıca tek bir boşlukla ve devamında yine tek bir boşlukla [^ ]+ takip eder. 19

20 Düzenli İfade Fonksiyonu Örnekleri [ ifade başlangıcını belirtir ^ NOT ifadesini belirtir bir boşluk belirtir ] ifadenin bitimini belirtir + bir ya da daha fazla olayı belirtir bir boşluğu belirtir 20

21 Düzenli İfade Fonksiyonu Örnekleri Düzenli ifadeler, veritabanında sadece tutarlı verilerin saklanmasını sağlamak için uygulama kodlarının bir parçası olarak da kullanılabilir. Örneğin bir CHECK kısıtlaması gibi bir düzenli ifade fonksiyonu çağırmak için içermesi mümkündür. 21

22 Düzenli İfade Fonksiyonu Örnekleri Veritabanınızdaki bir sembolü olmayan bir mail adresi olmamasını istediğinizde aşağıdaki basit kontrol kısıtlamasını ekleyebilirsiniz: Bu tüm mail işareti içermesini sağlayacaktır. 22

23 Kontrol Kısıtlamalarında Düzenli İfadeler Diğer örnek telefon numaralarını formatlarının kontrolü olabilir: Bu kısıtlama tüm telefon numaralarının (XXX) XXX-XXXX formatında olmasını sağlar. 23

24 Kontrol Kısıtlamalarında Düzenli İfadeler ^ katar başlangıcı \( ters bölüde (\) bir sol parantez, sol parantezi izleyen gruplama ifadesi yerine bir dizgiyi belirten bir çıkış karakteri olarak kullanılır. \d{3} Tam üç basamaklı \) Sağ parantez. Ters bölü (\) işareti önce gelen bir çıkış karakteridir. (space character) Boşluk karakteridir. 24

25 Kontrol Kısıtlamalarında Düzenli İfadeler \d{3} Tam üç basamaklı - Tire \d{4} Tam dört basamaklı $ Katarın bitimi. 25

26 Kontrol Kısıtlamalarında Düzenli İfadeler Aşağıdaki satır çalışmalı: Aşağıdaki satır çalışmamalı: 26

27 Kontrol Kısıtlamalarında Düzenli İfadeler Kontrol kısıtlamasında düzenli ifadelerin bir başka kullanımı VARCHAR2 veya CHAR sütununun numara almasına izin vermediğinden emin olmak olabilir: [[:digit:]] ifadesi rakam veya sayısal değerleri tespit eden son ek ifadesidir. REGEXP_INSTR herhangi bir rakamın pozisyonunu geri döndürür ve şayet dönen değer 0 değilse kısıtlama başarısız olur. 27

28 Kontrol Kısıtlamalarında Düzenli İfadeler Natacha Hansen iletişim ismi veritabanı tarafından kabul edilmelidir çünkü regexp_instr tarafından geri döndürülen sayı 0 olmalıdır. regexp_instr( Natacha Hansen,'[[:digit:]] ) ifadesi 0 döndürür bu nedenle ekleme çalışmaz. 28

29 Kontrol Kısıtlamalarında Düzenli İfadeler Örneğin Natacha Hansen 1 gibi bir isme numara eklemek istersek ekleme hata verir. regexp_instr( Natacha Hansen 1,'[[:digit:]] ) ifadesi 16 değerini geri döndürür. 16=0 doğru olmadığı için ekleme başarısız olur. 29

30 Alt İfadeler Oracle 11g de düzenli ifadeleri kullanırken ayrıca alt ifadeleri kullanabiliriz. Parantezler ifade içerisinde alt ifadelerin belirlenmesi için kullanılır ve REGEXP_INSTR ve REGEXP_SUBSTR fonksiyonlarında desteklenir. 30

31 Alt İfadeler Aşağıdaki ifadeye bakın: (1 2 3) (4 (5 6) (7 8) ) Buradaki alt ifadeler: A B C. 5 6 D

32 Alt İfadeler Alt ifadeler özellikle gerçek kelimelerde kullanışlıdır: örneğin DNA zincirlemesi ile çalışırken. Bir fare DNA zincirleri kısmi örneğine bakalım: ccacctttccctccactcagttctcacctgtaaagcgtccctccctcatccccatgcccccttaccg cagggtagagtaggctagaaaccagagagctccaagctccatctgtggagaggtgccatcctt gggctgcgagagaggagaatttgcccaaagctgcctgtttgaacgatggagacatgattgccg taaagggtcctgaatgcatgagatgtctttcgagagtaccggttacgggttaaaaggtcatgaga cttcgatcattacgatcgtggttaacacacatatgagtatagagacacattggccaagagttgag attgagag 32

33 Alt İfadeler DNA zincirlemesi ile çalıştığınızı ve gtc ile başlayan tcac ve daha sonra aaag ile devam eden belirli bir sıralamanın başlangıç pozisyonunu bulmak zorunda olduğunuzu hayal edin. Bu, eşleşmenin bulunduğu pozisyonu geri döndüren REGEXP_INSTR fonksiyonu ile kolay bir şekilde gerçekleştirilir. 33

34 Alt İfadeler 34

35 Alt İfadeler 35

36 REGEXP_COUNT Oracle 11g ayrıca yeni bir düzenli ifade fonksiyonuna sahiptir: REGEXP_COUNT. Bu fonksiyon bir katar içerisinde bir desenin kaç kez tekrar göründüğünü harika bir şekilde belirtir. 36

37 REGEXP_COUNT Fare DNA örneğini kullanarak, şayet DNA örneğinde gtc deseninin kaç defa sunulduğunu hesaplamak istersek, basitçe onları sayarız. 37

Veritabanı Tasarımı. SQL Deyimi Anatomisi

Veritabanı Tasarımı. SQL Deyimi Anatomisi Veritabanı Tasarımı SQL Deyimi Anatomisi Amaç Bu ders aşağıdaki hedefleri kapsamaktadır: Projeksiyon (projection), seçim (selection) ve birleştirme (join) ifadelerini doğru fonksiyonları/yetenekleri ile

Detaylı

Veritabanı Tasarımı. Dönüşüm Fonksiyonları

Veritabanı Tasarımı. Dönüşüm Fonksiyonları Veritabanı Tasarımı Dönüşüm Fonksiyonları Konular Açık veri türü dönüştürme ve örtülü veri türü dönüştürme örnekleri Bir dil için yerleşik veri dönüşüm yetenekleri neden önemli olduğunun bir iş perspektifinden

Detaylı

ÜNİTE NESNE TABANLI PROGRAMLAMA I. Uzm. Orhan ÇELİKER VERİTABANI SORGULARI İÇİNDEKİLER HEDEFLER

ÜNİTE NESNE TABANLI PROGRAMLAMA I. Uzm. Orhan ÇELİKER VERİTABANI SORGULARI İÇİNDEKİLER HEDEFLER VERİTABANI SORGULARI İÇİNDEKİLER Select İfadesi Insert İfadesi Update İfadesi Delete İfadesi Verileri Sıralamak Verileri Gruplandırmak Veriler Üzerinde Arama Yapmak NESNE TABANLI PROGRAMLAMA I Uzm. Orhan

Detaylı

Veritabanı. SQL (Structured Query Language)

Veritabanı. SQL (Structured Query Language) Veritabanı SQL (Structured Query Language) SQL (Structured Query Language) SQL, ilişkisel veritabanlarındaki bilgileri sorgulamak için kullanılan dildir. SQL, bütün kullanıcıların ve uygulamaların veritabanına

Detaylı

Laboratuvar 2 Tek Kayıt Fonksiyonları

Laboratuvar 2 Tek Kayıt Fonksiyonları Laboratuvar 2 Tek Kayıt Fonksiyonları Fonksiyonlar sıfır veya daha fazla bağımsız değişken alan ve sonuçta sadece bir değer döndüren programlardır. Oracle ile birlikte birkaç hazır fonksiyon gelmektedir.

Detaylı

Veri Tabanı Tasarım ve Yönetimi

Veri Tabanı Tasarım ve Yönetimi SAKARYA ÜNİVERSİTESİ Veri Tabanı Tasarım ve Yönetimi Hafta 5 Prof. Dr. Ümit KOCABIÇAK Bu ders içeriğinin basım, yayım ve satış hakları Sakarya Üniversitesi ne aittir. "Uzaktan Öğretim" tekniğine uygun

Detaylı

Veritabanı Tasarımı. Büyük/Küçük Harf ve Karakter İşleme

Veritabanı Tasarımı. Büyük/Küçük Harf ve Karakter İşleme Veritabanı Tasarımı Konular Büyük/küçük harf dönüşümü ve karakter işleme yapan tek satır fonksiyonlarını uygulama SQL sorgularında büyük/küçük harf dönüşümü fonksiyonları: LOWER, UPPER ve INITCAP SQL sorgularında

Detaylı

Veritabanı Tasarımı. Çoklu Satır Alt Sorgular

Veritabanı Tasarımı. Çoklu Satır Alt Sorgular Veritabanı Tasarımı Çoklu Satır Alt Sorgular Konular Çoklu satır alt sorgulardaki IN, ANY ve ALL karşılaştırma operatörlerinin doğru kullanımı WHERE ve HAVING yantümcelerinde çoklu satır alt sorguları

Detaylı

Veritabanı Tasarımı. Alt Sorgu Temelleri

Veritabanı Tasarımı. Alt Sorgu Temelleri Veritabanı Tasarımı Alt Sorgu Temelleri Konular Verilerin elde edilmesi için alt sorguların tanımlanması ve açıklanması WHERE yantümcesinde tek satır alt sorgu oluşturulması ve çalıştırılması Tek satır

Detaylı

Veritabanı Tasarımı. NOT NULL ve UNIQUE Kısıtlamaları Tanımlama

Veritabanı Tasarımı. NOT NULL ve UNIQUE Kısıtlamaları Tanımlama Veritabanı Tasarımı NOT NULL ve UNIQUE Kısıtlamaları Tanımlama NOT NULL ve UNIQUE Kısıtlamaları Tanımlama Konular Kısıtlama terimini veri bütünlüğü ile ilişkilendirerek tanımlama Sütun seviyesinde ve tablo

Detaylı

Veritabanı Tasarımı. DML İşlemleri ve Görünümler

Veritabanı Tasarımı. DML İşlemleri ve Görünümler Veritabanı Tasarımı DML İşlemleri ve Görünümler Konular Basit bir görünümde DML işlemlerini gerçekleştiren bir sorgu yazma ve çalıştırma DML işlemleri kullanarak bir görünümü değiştirme yeteneğini kısıtlayan

Detaylı

Lıke Joker Karakterler, Is [not] Null, Order By, Group By, As

Lıke Joker Karakterler, Is [not] Null, Order By, Group By, As LIKE (Joker Karakterler) Joker karakterleri kullanarak bir veri sütunu veya ifadeler içinde desen arayabilirsiniz. Örneğin, soyadları "Ak" ile başlayan veya "kaya" ile biten tüm çalışanları arayabilirsiniz.

Detaylı

SQL Komutları (2) Uzm. Murat YAZICI

SQL Komutları (2) Uzm. Murat YAZICI SQL Komutları (2) Uzm. Murat YAZICI Sıralama Sıralama işlemi için SELECT ifadesinde ORDER BY kullanılır. Bu ifadede ASC kelimesi kullanılırsa sıralama küçükten büyüğe doğru (A-Z), DESC kullanılırsa büyükten

Detaylı

VERİ TABANI YÖNETİM SİSTEMLERİ I

VERİ TABANI YÖNETİM SİSTEMLERİ I BÖLÜM 8 8. TEMEL SQL KOMUTLARI-II 8.1. SELECT (Seç) Komutu Veri tabanındaki tablo veya tablolardan istenilen özellikteki verileri seçip listeleme için kullanılan komuttur. Genel kullanımı aşağıdaki gibidir.

Detaylı

Veritabanı Tasarımı. Kartezyen Çarpım ve Join İşlemleri

Veritabanı Tasarımı. Kartezyen Çarpım ve Join İşlemleri Veritabanı Tasarımı Kartezyen Çarpım ve Join İşlemleri Konular Oracle özel join işlemlerini isimlendirme ve onların ANSI/ISO SQL: 1999 karşıtları Join durumlarının amacını açıklama Kartezyen çarpımdan

Detaylı

Microsoft Excel 4.BÖLÜM

Microsoft Excel 4.BÖLÜM Microsoft Excel 4.BÖLÜM İstatistiksel fonksiyonları kullanma: EĞERSAY, BOŞLUKSAY, KAÇINCI EĞERSAY fonksiyonu EĞERSAY işlevi, bir aralıkta yer alan ve belirtilen tek bir ölçüte uyan hücrelerin sayısını

Detaylı

Bilgisayar Teknolojileri Bölümü Bilgisayar Programcılığı Programı. Öğr. Gör. Cansu AYVAZ GÜVEN

Bilgisayar Teknolojileri Bölümü Bilgisayar Programcılığı Programı. Öğr. Gör. Cansu AYVAZ GÜVEN Bilgisayar Teknolojileri Bölümü Bilgisayar Programcılığı Programı Öğr. Gör. Cansu AYVAZ GÜVEN VERITABANI-I SQL Tek Tablo İçinde Sorgulamalar Tekrarlı Satırların Engellenmesi Aynı değerlere sahip satırlar

Detaylı

Veritabanı Tasarımı. Sütunlar, Karakterler ve Satırlar ile Çalışma

Veritabanı Tasarımı. Sütunlar, Karakterler ve Satırlar ile Çalışma Veritabanı Tasarımı Sütunlar, Karakterler ve Satırlar ile Çalışma Amaç Bu ders aşağıdaki hedefleri kapsamaktadır: Bir karakter ifadesi oluşturmak için diğer sütunları, aritmetik ifadeleri ya da sabit değerleri

Detaylı

Tablolar Arası İlşikiler ve Alan Özellikleri Siparis.musteri_no musteri.musteri_no Siparis.urun_kodu musteri.urun_kodu

Tablolar Arası İlşikiler ve Alan Özellikleri Siparis.musteri_no musteri.musteri_no Siparis.urun_kodu musteri.urun_kodu SQL'DE VERİ İŞLEME KOMUTLARI SQL'de verileri işlemek için kullanılan komutlara DML (Data Manipulation Language Veri İşleme Dili) denilmektedir. Bu komutlar ile oluşturulan ifadeler tablolara kayıt eklemek,

Detaylı

SP_RENAMEDB eski_isim, yeni_isim VEYA SP_RENAMEDB 'eski isim', 'yeni isim'

SP_RENAMEDB eski_isim, yeni_isim VEYA SP_RENAMEDB 'eski isim', 'yeni isim' Bu Derste Öğrenecekleriniz: 1- Veri Tabanı Adı Değiştirme 2- Nesnelerin Adını Değiştirme a. Tablo Adı Değiştirme b. Alan Adı Değiştirme c. Constraint (Kısıtlama) Adı Değiştirme 3- Tablo Düzenleme Komutları

Detaylı

3. Hafta Tablo İşlemleri BPR255 Veritabanı. Bu Derste Öğrenecekleriniz: 1. Tablo İşlemleri. 1.2. Kısıtlamalar (Constraints)

3. Hafta Tablo İşlemleri BPR255 Veritabanı. Bu Derste Öğrenecekleriniz: 1. Tablo İşlemleri. 1.2. Kısıtlamalar (Constraints) Bu Derste Öğrenecekleriniz: 1. Tablo İşlemleri 1.1. Tablo Oluşturma 1.2. Tablo Oluşturmada Kısıtlamalar Constraints 1.3. Tablo Silme a. NULL, NOT NULL b. PRIMARY KEY c. UNIQUE d. FOREIGN KEY e. CHECK f.

Detaylı

ÜNİTE NESNE TABANLI PROGRAMLAMA I. Uzm. Orhan ÇELİKER VERİTABANI SORGULARI İÇİNDEKİLER HEDEFLER

ÜNİTE NESNE TABANLI PROGRAMLAMA I. Uzm. Orhan ÇELİKER VERİTABANI SORGULARI İÇİNDEKİLER HEDEFLER VERİTABANI SORGULARI İÇİNDEKİLER Select İfadesi Insert İfadesi Update İfadesi Delete İfadesi Verileri Sıralamak Verileri Gruplandırmak Veriler Üzerinde Arama Yapmak NESNE TABANLI PROGRAMLAMA I Uzm. Orhan

Detaylı

Veritabanı Tasarımı COUNT, DISTINCT, NVL

Veritabanı Tasarımı COUNT, DISTINCT, NVL Veritabanı Tasarımı COUNT, DISTINCT, NVL Konular COUNT grup fonksiyonu kullanarak SQL sorgusu oluşturmak ve çalıştırmak Grup fonksiyonları ile DISTINCT ve NVL fonksiyonu kullanmak 2 Amaç SQL fonksiyonları

Detaylı

Oracle da kullanılan veri tipleri:

Oracle da kullanılan veri tipleri: ORACLE A GİRİŞ Oracle ile SQL Server ı karşılaştıralım, 1 Oracle da veritabanı yerine kullanıcı oluşturulur. Kullanıcılar veritabanı gibi davranır. 2 Tablo oluşturma, yapısını değiştirme, silme kodları

Detaylı

Excel Formuller ve Kullanımı

Excel Formuller ve Kullanımı Excel Formuller ve Kullanımı Mantıksal İslem Yapan Formuller 1 EĞER Fonksiyonu Belirttiğiniz koşul DOĞRU olarak değerlendirilirse bir değer, YANLIŞ olarak değerlendirilirse başka bir değer verir. Değerler

Detaylı

Veritabanı sistemlerinde veri bütünlüğünü sağlayabilmek için CONSTRAINTS olarak adlandırılan bazı zorlayıcı ifadeler kullanılabilir.

Veritabanı sistemlerinde veri bütünlüğünü sağlayabilmek için CONSTRAINTS olarak adlandırılan bazı zorlayıcı ifadeler kullanılabilir. VERİ BÜTÜNLÜĞÜ VTYS lerde veri bütünlüğünü sağlamanın iki temel yolu vardır; Tanımlanabilir veri bütünlüğü ve prosedürel veri bütünlüğü. Tanımlanabilir veri bütünlüğü, tanımlanan nesnelerin kendi özellikleri

Detaylı

Veritabanı Tasarımı. Sütun Değerlerini Güncelleme ve Satırları Silme

Veritabanı Tasarımı. Sütun Değerlerini Güncelleme ve Satırları Silme Veritabanı Tasarımı Sütun Değerlerini Güncelleme ve Satırları Silme Konular UPDATE komutunu oluşturmak ve çalıştırmak DELETE komutunu oluşturmak ve çalıştırmak Tabloda güncelleme yapmak ya da veri silmek

Detaylı

VERİTABANI. SQL (Structured Query Language)

VERİTABANI. SQL (Structured Query Language) VERİTABANI SQL (Structured Query Language) SQL'de Gruplama Bir tablonun satırları gruplara ayrılarak fonksiyonların bunlara uygulanması mümkündür. Gruplara ayırmak için SELECT deyimi içerisinde GROUP BY

Detaylı

Regular Expressions ve grep, awk, sed ile Kullanımı

Regular Expressions ve grep, awk, sed ile Kullanımı Regular Expressions ve Koray OKSAY koray.oksay@linux.org.tr 29 Mart 2014 1 Regular Expressions ve http://en.wikipedia.org/wiki/regular_expression http://en.wikipedia.org/wiki/deterministic_finite_automaton

Detaylı

Veritabanı Tasarımı. Veri Türleri Kullanma

Veritabanı Tasarımı. Veri Türleri Kullanma Veritabanı Tasarımı Veri Türleri Kullanma Konular TIMESTAMP ve TIMESTAMP WITH TIME ZONE sütun türlerini kullanarak tablo oluşturma INTERVAL YEAR TO MONTH ve INTERVAL DAY TO SECOND sütun türlerini kullanarak

Detaylı

FORMÜLLER VE FONKSİYONLAR

FORMÜLLER VE FONKSİYONLAR C FORMÜLLER VE FONKSİYONLAR Konuya Hazırlık 1. Excel de formül kullanmanın faydalarını açıklayınız. Formüller, bir sayfadaki verileri kullanarak işlem yapan denklemlerdir. Bir formülde, aynı sayfadaki

Detaylı

Like Joker Karakterler, Order By, Group By

Like Joker Karakterler, Order By, Group By Like Joker Karakterler, Order, Group Like joker karakterler, order by, group by Karakter Türü Bilgi İçinde Arama Yapma (Like Sözcüğü) Personel tablosu içinde adres adlı 50 karakter uzunluğunda bir alanımız

Detaylı

Öğr. Gör. Cansu AYVAZ GÜVEN VERİTABANI-II. Değişken Tanımlama Ve Akış Kontrol Deyimleri

Öğr. Gör. Cansu AYVAZ GÜVEN VERİTABANI-II. Değişken Tanımlama Ve Akış Kontrol Deyimleri Öğr. Gör. Cansu AYVAZ GÜVEN VERİTABANI-II Değişken Tanımlama Ve Akış Kontrol Deyimleri Değişken Nedir? Değişkenler, programın veya kodların icra süresince belirli bir değer tutan ve istenilirse bu değer

Detaylı

Veri Tabanı Programlamaya Giriş

Veri Tabanı Programlamaya Giriş Veri Tabanı Programlamaya Giriş Kitap özeti Veri Tabanı Programlamaya Giriş SQL insanların veritabanı sistemleri ile konuşmasını sağlayan popüler bir dildir. Bu dil sayesinde, bir veritabanından kayıtları

Detaylı

Aşağıdaki tabloyu inceleyin. Sorgulama işlemlerini bu tabloya göre yapacağız.

Aşağıdaki tabloyu inceleyin. Sorgulama işlemlerini bu tabloya göre yapacağız. Bu Derste Öğrenecekleriniz: 1- Basit Sorgulamalar a. Tablodan tüm alanları sorgulama b. Tablodan alanları belirterek sorgulama c. Tekrarlı satırları önleme d. Belirli sayıda veya oranda sorgulama yapma

Detaylı

ÜNİTE 9 ÜNİTE 9 MICROSOFT EXCEL - II TEMEL BİLGİ TEKNOLOJİLERİ İÇİNDEKİLER HEDEFLER

ÜNİTE 9 ÜNİTE 9 MICROSOFT EXCEL - II TEMEL BİLGİ TEKNOLOJİLERİ İÇİNDEKİLER HEDEFLER ÜNİTE 9 MICROSOFT EXCEL - II BAYBURT ÜNİVERSİTESİ UZAKTAN EĞİTİM MERKEZİ İÇİNDEKİLER Çalışma sayfasına yeni nesneler eklemek Veriler ile ilgili işlemler Grafikler ler Sıralama Yapmak Filtreleme Yapmak

Detaylı

SQL Kod ile Tablo Oluşturma

SQL Kod ile Tablo Oluşturma SQL Kod ile Tablo Oluşturma Aşağıdaki SQL kodları Veri tabanı hazırlama programında yazılıp çalıştırıldığı zaman PERSONEL adında bir tablo oluşturulur ve bu tablonun sütunları Personel_no, Adı, Soyadı

Detaylı

Aşağıdaki şemaya dikkat edin. Sorgulamalarımızı genellikle bu şemaya göre yapacağız.

Aşağıdaki şemaya dikkat edin. Sorgulamalarımızı genellikle bu şemaya göre yapacağız. Bu Derste Öğrenecekleriniz: 1- Sorgulama Yaparken Gruplama (GROUP BY) 2- Gruplamada Koşul Kullanımı (HAVING) 3- Sorgulama Yaparken Sıralama (ORDER BY) 4- Sorgulamalarda İşlem Yapma 5- Güncellemelerde İşlem

Detaylı

VERİ TABANI YÖNETİM SİSTEMLERİ I

VERİ TABANI YÖNETİM SİSTEMLERİ I BÖLÜM 7 7. TEMEL SQL KOMUTLARI-I SQL (Structured Query Language) kendisi bir programlama dili olmamasına rağmen bir çok kişi tarafından programlama dili olarak bilinir. SQL herhangi bir veri tabanı ortamında

Detaylı

VERĐTABANI YÖNETĐM SĐSTEMLERĐ

VERĐTABANI YÖNETĐM SĐSTEMLERĐ VERĐTABANI YÖNETĐM SĐSTEMLERĐ Öğr.Gör.Sedat Telçeken ANADOLU ÜNĐVERSĐTESĐ FEN FAKÜLTESĐ MATEMATĐK BÖLÜMÜ 2005 2006 Bahar Dönemi SQL Fonksiyonları Fonksiyonlar SQL içinde bazı hesaplamaları yapabilmektedir.

Detaylı

Dizgiler. C dilinde karakter m şeklinde tek tırnak içerisinde yazılan ifadelerdir. Bu karakterlerin her biri aslında bir tamsayı ile ifade edilir.

Dizgiler. C dilinde karakter m şeklinde tek tırnak içerisinde yazılan ifadelerdir. Bu karakterlerin her biri aslında bir tamsayı ile ifade edilir. DİZGİLER (STRINGS) Dizgiler char tipli karakterlerin gruplanmş haline dizgi(string) denilir. Bazen katar ismide kullanılabilir. C dilinde karakter m şeklinde tek tırnak içerisinde yazılan ifadelerdir.

Detaylı

SQL PROGRAMLAMA. Bir batch, bir arada bulunan bir dizi SQL deyimidir. Batch ayıracı GO deyimidir.

SQL PROGRAMLAMA. Bir batch, bir arada bulunan bir dizi SQL deyimidir. Batch ayıracı GO deyimidir. SQL PROGRAMLAMA BATCH Bir batch, bir arada bulunan bir dizi SQL deyimidir. Batch ayıracı deyimidir. SELECT. UPDATE...... DELETE.. BATCH BATCH Özellikleri 1- Bir batch içinde bir deyimde yazım hatası olduğunda

Detaylı

8 Oracle da tablo yapısı içinde otomatik artan kolon yoktur. (identity kolon

8 Oracle da tablo yapısı içinde otomatik artan kolon yoktur. (identity kolon ORACLE GİRİŞ Oracle ile SQL Server ın karşılaştıralım. 1 Oracleda veritabanı yerine kullanıcı oluşturulur. Kullanıcılar veritabanı gibi davranır. 2 Tablo oluşturma, değiştirme ve silme kodları aynı. 3

Detaylı

Veritabanı Tasarımı. İndeksler ve Eşanlamlar

Veritabanı Tasarımı. İndeksler ve Eşanlamlar Veritabanı Tasarımı İndeksler ve Eşanlamlar Konular Bir indeks tanımlama ve şema nesnesi olarak kullanma ROWID tanımlama ve veritabanında bilgileri yerleştirmede kullanma Otomatik olarak oluşturulan bir

Detaylı

Veritabanı Tasarımı. Kullanıcı Erişimini Kontrol Etme

Veritabanı Tasarımı. Kullanıcı Erişimini Kontrol Etme Veritabanı Tasarımı Kullanıcı Erişimini Kontrol Etme Konular Nesne ayrıcalıkları ve sistem ayrıcalıkları arasındaki farkı karşılaştırma Bir kullanıcının bir veritabanınaerişimini etkinleştirmek için gerekli

Detaylı

SQL e Giriş. Uzm. Murat YAZICI

SQL e Giriş. Uzm. Murat YAZICI SQL e Giriş Uzm. Murat YAZICI SQL (Structured Query Language) - SQL Türkçe de Yapısal Sorgulama Dili anlamına gelmektedir ve ilişkisel veritabanlarında çok geniş bir kullanım alanına sahiptir. - SQL ile

Detaylı

SQL Query and Table Application

SQL Query and Table Application SQL Query and Table Application Elbistan Meslek Yüksek Okulu 2012 2013 Bahar Yarıyılı Öğr. Gör. Murat KEÇECİOĞLU 24-25 Nis. 2013 Sorgulama İşlemleri SQL de sorgulama işlemleri SELECT deyimi yardımıyla

Detaylı

Uzaktan Eğitim Uygulama ve Araştırma Merkezi

Uzaktan Eğitim Uygulama ve Araştırma Merkezi JAVA PROGRAMLAMA Öğr. Gör. Utku SOBUTAY İÇERİK 2 Java Veri Tipleri ve Özelilkleri Değişken Tanımlama Kuralları Değişken Veri Tipi Değiştirme (Type Casting) Örnek Kodlar Java Veri Tipleri ve Özelilkleri

Detaylı

BİLGİSAYAR PROGRAMLAMA

BİLGİSAYAR PROGRAMLAMA BİLGİSAYAR PROGRAMLAMA Yrd. Doç. Dr. Beytullah EREN beren@sakarya.edu.tr 0264 295 5642 BAĞ_DEĞ_SAY ve BAĞ_DEĞ_DOLU_SAY İŞLEVİ BAĞ_DEĞ_SAY İşlevi: :Belirlenen aralıkta sayı içeren hücrelerin kaç tane olduğunu

Detaylı

Veritabanı Tasarımı. Basit Eşleme: Dönüşüm İşlemi

Veritabanı Tasarımı. Basit Eşleme: Dönüşüm İşlemi Veritabanı Tasarımı Basit Eşleme: Dönüşüm İşlemi Amaç Bu ders aşağıdaki hedefleri kapsamaktadır: Kavramsal model ile fiziksel modeli ayırt etme İki model arasındaki terminoloji eşleşmesini uygulama Tablolar

Detaylı

SP_RENAMEDB eski_isim, yeni_isim VEYA SP_RENAMEDB 'eski isim', 'yeni isim'

SP_RENAMEDB eski_isim, yeni_isim VEYA SP_RENAMEDB 'eski isim', 'yeni isim' Bu Derste Öğrenecekleriniz: 1- Veri Tabanı Adı Değiştirme 2- Nesnelerin Adını Değiştirme a. Tablo Adı Değiştirme b. Alan Adı Değiştirme c. Constraint (Kısıtlama) Adı Değiştirme 3- Tablo Düzenleme Komutları

Detaylı

Bir dizinin boyutları sabittir ve kullanılmadan önce belirlenmelidir. Dizi boyutunu belirlemek için başka bir değişkende kullanabilirsiniz.

Bir dizinin boyutları sabittir ve kullanılmadan önce belirlenmelidir. Dizi boyutunu belirlemek için başka bir değişkende kullanabilirsiniz. C# da Diziler Diziler için aynı tipteki verilerin tutulduğu bir koleksiyon diyebiliriz. Örneğin integer verinin bir yığın şeklinde tutulması için dizileri kullanırız. C# da diziler referans tipinde değişkenlerdendir.

Detaylı

DAO İLE SQL KOMUTLARI. Sql komutlarını artık veri tabanında kullanmaktan başka çaremiz yok arkadaşlar. Şimdi bu sql derslerimize başlayalım.

DAO İLE SQL KOMUTLARI. Sql komutlarını artık veri tabanında kullanmaktan başka çaremiz yok arkadaşlar. Şimdi bu sql derslerimize başlayalım. DAO İLE SQL KOMUTLARI Sql komutlarını artık veri tabanında kullanmaktan başka çaremiz yok arkadaşlar. Şimdi bu sql derslerimize başlayalım. SQL-1 SELECT En basit SQL cümleciği oluşturmak için SELECT sözcüğü

Detaylı

PHP, nesne-yönelimli (object-oriented) bir dil olduğu için, nesne oluşturma imkânına ve bunların kullanılmasını sağlayan metodlara da sahiptir.

PHP, nesne-yönelimli (object-oriented) bir dil olduğu için, nesne oluşturma imkânına ve bunların kullanılmasını sağlayan metodlara da sahiptir. PHP'nin Temelleri PHP Nedir? PHP, bir programlama dili olarak, değişkenler, değişkenlerin değerleriyle bir işlem yapmayı sağlayan işlemciler (operatörler), işlemcilerle oluşturulan deyimler ve nihayet

Detaylı

TEMEL BİLGİSAYAR. Ders Notları. Yrd. Doç. Dr. Seyit Okan KARA

TEMEL BİLGİSAYAR. Ders Notları. Yrd. Doç. Dr. Seyit Okan KARA TEMEL BİLGİSAYAR Ders Notları Yrd. Doç. Dr. Seyit Okan KARA İÇERİK Excel menü çubuğunda bulunan, Ekle menüsünün içerik ve uygulamaları Biçim menüsünün içerik ve uygulamaları Veri menüsünün içerik ve uygulamaları

Detaylı

3. Hafta Tablo İşlemleri BPR255 Veritabanı Yönetim. Bu Derste Öğrenecekleriniz: 1. Tablo İşlemleri

3. Hafta Tablo İşlemleri BPR255 Veritabanı Yönetim. Bu Derste Öğrenecekleriniz: 1. Tablo İşlemleri Bu Derste Öğrenecekleriniz: 1. Tablo İşlemleri 1.1. Tablo Oluşturma 1.2. Tablo Oluşturmada Kısıtlamalar Constraints 1.3. Tablo Silme a. NULL, NOT NULL b. PRIMARY KEY c. UNIQUE d. FOREIGN KEY e. CHECK f.

Detaylı

Veritabanı Tasarımı. Tablo Değiştirme

Veritabanı Tasarımı. Tablo Değiştirme Veritabanı Tasarımı Tablo Değiştirme Konular Tabloyu değiştirme neden önemlidir açıklama ALTER, DROP, RENAME ve TRUNCATE DDL komutlarının etkisini tablolar ve sütunlar üzerinde görme ALTER TABLE komutlarıadd,

Detaylı

Oracle Database 11g: Introduction to SQL

Oracle Database 11g: Introduction to SQL Oracle Database 11g: Introduction to SQL Mehmet Salih DEVECI GTECH-Kıdemli Veritabanı Yöneticisi Mehmetsalih.deveci@gtech.com.tr BÖLÜM- 1: SQL E GİRİŞ SELECT ifadesinin kabiliyetlerinin ortaya çıkarılması

Detaylı

Bölüm 4: DDL Veri Tanımlama Dili

Bölüm 4: DDL Veri Tanımlama Dili Bölüm 4: DDL Veri Tanımlama Dili -43- Dr. Serkan DİŞLİTAŞ DDL (Data Definition Language Veri Tanımlama Dili : Bu kategorideki SQL komutları ile veritabanları, tablo, görünüm ve indekslerin yaratılması,

Detaylı

YAPISAL SORGULAMA DİLİ (SQL)

YAPISAL SORGULAMA DİLİ (SQL) YAPISAL SORGULAMA DİLİ (SQL) OGRENCI Tablosu 1234 Zeynep Makina K 23.06.1984 1. Cad 3.4 CREATE TABLE VERİ TANIMLAMA DİLİ (VTD) Veritabanında yeni bir tablonun oluşturulmasını sağlar. Yukarıda tanımlanan

Detaylı

Temel Excel Kullanım Bilgisi

Temel Excel Kullanım Bilgisi Temel Excel Kullanım Bilgisi Excel Fonksiyonları Başlangıç Microsoft Excel in en zevkli olan formül kısmı hakkında kısa kısa bilgileri ve bazı formüllerin nasıl yazıldığını burada bulacaksınız.

Detaylı

SQL'e Giriş. SELECT Deyimi. SQL Komutları. 1. DDL (Data Definition Language - Veri Tanımlama Dili)

SQL'e Giriş. SELECT Deyimi. SQL Komutları. 1. DDL (Data Definition Language - Veri Tanımlama Dili) SQL'e Giriş SQL komutları kullanılarak aşağıdaki işlemler yapılabilir: Veritabanı nesnelerinin oluşturulması ve bu nesnelerle ilgili işlemlerin yapılması Bilgilerin istenilen koşullara göre görüntülenmesi

Detaylı

Veri Tabanı Hafta Dersi

Veri Tabanı Hafta Dersi Veri Tabanı - 1 13. Hafta Dersi Dersin Hedefleri Tek Tablo İçinde Sorgulamalar Tekrarlı Satırları Önlemek Sorgu Sonucunu Sıralama Sütunlar İçin Takma İsim Kullanma Sütunlar Üzerinde Matematiksel İşlemler

Detaylı

Elbistan Meslek Yüksek Okulu GÜZ Yarıyılı Ara Öğr. Gör. Murat KEÇECĠOĞLU

Elbistan Meslek Yüksek Okulu GÜZ Yarıyılı Ara Öğr. Gör. Murat KEÇECĠOĞLU Elbistan Meslek Yüksek Okulu 2015 2016 GÜZ Yarıyılı 28-29 Ara. 2015 Öğr. Gör. Murat KEÇECĠOĞLU Indexler İndeks, tablolardan veri çekmek için gerekli sorgular çalıştırılırken gereken süreyi azaltmak amacıyla

Detaylı

Daha önce bu işlemin iki tane dosya oluşturduğunu gördük. GecDenTest.aspx dosyasının source kısmında içeriğini inceleyecek olursanız en başta

Daha önce bu işlemin iki tane dosya oluşturduğunu gördük. GecDenTest.aspx dosyasının source kısmında içeriğini inceleyecek olursanız en başta Bu gün dersimizde Validation Geçerlik Dentimi Kontrollerine değineceğiz. Önce adı GecerlikDeneme isimli bir yeni site oluşturalım. Burada programın otomatik olarak oluşturacağı Default.aspx dosyasını ve

Detaylı

Veritabanı Tasarımı. İlişkisel Veritabanı Kavramlarına Giriş

Veritabanı Tasarımı. İlişkisel Veritabanı Kavramlarına Giriş Veritabanı Tasarımı İlişkisel Veritabanı Kavramlarına Giriş Amaç Bu ders aşağıdaki hedefleri kapsamaktadır: Birincil anahtar tanımlama İkincil anahtar tanımlama Sütun bütünlüğü kuralı tanımlama Satır,

Detaylı

Regular Expressions Version 0.1

Regular Expressions Version 0.1 Regular Expressions Version 0.1 Hüseyin Kaya hkaya@be.itu.edu.tr 2001 Özet Bu belge Linux and Unix Shell Programming adlı kitaptan faydalalınarak yazılmıştır. Kitabın yazarı David Tansley. İngilizce bilenler

Detaylı

=A3*15..A3 hücresindeki sayı ile 15 in çarpımı ) =a3-b2..a3 hücresindeki sayıdan b2 hücresindeki sayıyı çıkar.

=A3*15..A3 hücresindeki sayı ile 15 in çarpımı ) =a3-b2..a3 hücresindeki sayıdan b2 hücresindeki sayıyı çıkar. MİCROSOFT EXCEL 2003 DERS NOTLARI 1 Excel in dosya uzantısı xls dir.(2007 sürümü için xlsx dir.) Excelde temel olarak üç işlem yapılır.tablo,grafik,hesaplama Excel satır ve sütunlardan oluşur. Satırlar

Detaylı

Veri Tabanı Yönetim Sistemleri Bölüm - 6

Veri Tabanı Yönetim Sistemleri Bölüm - 6 Veri Tabanı Yönetim Sistemleri Bölüm - 6 İçerik Fonksiyonlar Tek Satır Fonksiyonlar Karakter Fonksiyonlar Sayısal Fonksiyonlar Tarih ve Saat Fonksiyonları Dönüştürücü Fonksiyonlar Çoklu Satır Fonksiyonlar

Detaylı

SORGULAR. Öğr.Gör.Volkan Altıntaş

SORGULAR. Öğr.Gör.Volkan Altıntaş SORGULAR Öğr.Gör.Volkan Altıntaş SORGULAR VE ÇEŞİTLERİ Seçme Sorguları: En sık kullanılan sorgu türüdür. Seçme sorguları, bilgileri veri sayfası görünümü nde gösteren veri tabanı nesnesi türüdür. Sorgu,

Detaylı

6 Aritmetiksel Operatörler ve Hazır Fonksiyonlar

6 Aritmetiksel Operatörler ve Hazır Fonksiyonlar 6 Aritmetiksel Operatörler ve Hazır Fonksiyonlar Veritabanı 1 1 Aritmetiksel Operatörler SELECT adi,soyadi, maas + maas*10/100 zamlimaas FROM tbl_personel select 3*5 select 5+3 select 3*5,3+5, 3/5 select

Detaylı

API v1.0 http://www.gazisms.com

API v1.0 http://www.gazisms.com API v1.0 http://www.gazisms.com GaziSMS API, GaziSMS müşterilerinin kendi geliştirdikleri programlar içerisinden SMS göndermelerine olanak sağlayan bir program parçasıdır. GaziSMS API kendisine gönderilen

Detaylı

Yrd. Doç. Dr. A. Burak İNNER

Yrd. Doç. Dr. A. Burak İNNER Yrd. Doç. Dr. A. Burak İNNER Kocaeli Üniversitesi Bilgisayar Mühendisliği Yapay Zeka ve Benzetim Sistemleri Ar-Ge Lab. http://yapbenzet.kocaeli.edu.tr Basit metin işlemleri (tek dizeler üzerinde arama

Detaylı

BÖLÜM -7: TABLOLARI OLUŞTURMA VE YÖNETME

BÖLÜM -7: TABLOLARI OLUŞTURMA VE YÖNETME BÖLÜM -7: TABLOLARI OLUŞTURMA VE YÖNETME Ana veritabanı nesnelerini sınıflandırmak Tablo yapısını inceleme Tablo sütunlarının veri tiplerini listeleme Basit bir tablo oluşturma Constraint oluşturma Şema

Detaylı

DİZİLER-KATARLAR ALGORİTMA VE PROGRAMLAMA II

DİZİLER-KATARLAR ALGORİTMA VE PROGRAMLAMA II DİZİLER-KATARLAR ALGORİTMA VE PROGRAMLAMA II DİZİLER Dizi, aynı tipteki verilere tek bir isimle erişmek için kullanılan bir kümedir. Bir dizi bildirildikten sonra, dizinin bütün elemanları bellekte peşpeşe

Detaylı

Göstericiler (Pointers)

Göstericiler (Pointers) C PROGRAMLAMA Göstericiler (Pointers) C programlama dilinin en güçlü özelliklerinden biridir. Göstericiler, işaretçiler yada pointer adı da verilmektedir. Gösterici (pointer); içerisinde bellek adresi

Detaylı

2005-2009 Tarihleri Arasında Avkom da Yazdığım Programlar 1 Avkomix Başlama Tarihi: Haziran 2007 Database LKS (Muhasebe Programından Gelen Veriler, Fatura, Konsinye, Banka, vb.) AvkomERP.mdb (Kendi veritabanımız,

Detaylı

Dr. Fatih AY Tel: 0 388 225 22 55 fatihay@fatihay.net www.fatihay.net

Dr. Fatih AY Tel: 0 388 225 22 55 fatihay@fatihay.net www.fatihay.net Bilgisayar Programlama Ders 9 Dr. Fatih AY Tel: 0 388 225 22 55 fatihay@fatihay.net www.fatihay.net Dizileri Fonksiyonlara Dizileri Fonksiyonlara Bir dizi argümanını fonksiyon içinde bir değer olarak kullanabilmek

Detaylı

Tablolar Arası İlşikiler ve Alan Özellikleri. Şekil 1. Magaza veritabanının tabloları ve tablolar arasındaki ilişkiler

Tablolar Arası İlşikiler ve Alan Özellikleri. Şekil 1. Magaza veritabanının tabloları ve tablolar arasındaki ilişkiler SQL'de Veri İşleme Komutları SQL'de verileri işlemek için kullanılan komutlara DML (Data Manipulation Language Veri İşleme Dili) denilmektedir. Bu komutlar ile oluşturulan ifadeler tablolara kayıt eklemek,

Detaylı

BLM-111 PROGRAMLAMA DİLLERİ I. Ders-12 Fonksiyonlar. Yrd. Doç. Dr. Ümit ATİLA

BLM-111 PROGRAMLAMA DİLLERİ I. Ders-12 Fonksiyonlar. Yrd. Doç. Dr. Ümit ATİLA BLM-111 PROGRAMLAMA DİLLERİ I Ders-12 Fonksiyonlar Yrd. Doç. Dr. Ümit ATİLA umitatila@karabuk.edu.tr http://web.karabuk.edu.tr/umitatilla/ Fonksiyonlar Fonksiyonlar C de modüller Programlar kullanıcı tanımlı

Detaylı

VERİTABANI Veritabanı Sorgulama

VERİTABANI Veritabanı Sorgulama VERİTABANI Veritabanı Sorgulama VERİ SORGULAMA DİLİ (DATA QUERY LANGUAGE) Veritabanı platformunda veri sorgulamak için geliştirilmiş en temel araç SQL (Structured Query Language)'dir. SQL'in veritabanı

Detaylı

SAB 103 TEMEL BİLGİSAYAR KULLANIMI

SAB 103 TEMEL BİLGİSAYAR KULLANIMI SAB 103 TEMEL BİLGİSAYAR KULLANIMI Kelime İşlemci - Word Prof.Dr. Fatih TANK Ankara Üniversitesi Uygulamalı Bilimler Fakültesi Sigortacılık ve Aktüerya Bilimleri Bölümü Prof.Dr. Fatih TANK - Temel - Ders

Detaylı

Dış Veri Alma ÜNİTE 6. Bu üniteyi çalıştıktan sonra; Veri Menüsü Dış Veri Al Bağlantılar Sırala ve Filtre Uygula Veri Araçları Anahat

Dış Veri Alma ÜNİTE 6. Bu üniteyi çalıştıktan sonra; Veri Menüsü Dış Veri Al Bağlantılar Sırala ve Filtre Uygula Veri Araçları Anahat Dış Veri Alma ÜNİTE 6 Veri Menüsü Dış Veri Al Bağlantılar Sırala ve Filtre Uygula Veri Araçları Anahat Bu üniteyi çalıştıktan sonra; Microsoft Excel hakkında temel işlemler öğrenildikten sonra veri alma

Detaylı

Veritabanı Tasarımı. Birincil Anahtar, İkincil Anahtar ve Kontrol Kısıtlamaları

Veritabanı Tasarımı. Birincil Anahtar, İkincil Anahtar ve Kontrol Kısıtlamaları Veritabanı Tasarımı Konular Birincil Anahtar, İkincil Anahtar ve Kontrol Kısıtlamasını tanımlamak ve örnek vermek Birincil Anahtar, İkincil Anahtar ve Kontrol Kısıtlamasının amacını tanımlamak CREATE TABLE

Detaylı

$ rm dosya1 dosya2 dosya3 dosya4 dosya5 dosya6 dosya7 dosya8

$ rm dosya1 dosya2 dosya3 dosya4 dosya5 dosya6 dosya7 dosya8 Joker karakterler Günlük Linux kullanımında çok defa bir operasyonu tek seferde birden fazla nesne için çalıştırmak isteyebileceğiniz (rm gibi) durumlarla karşılaşabilirsiniz. Böyle durumlarda, aşağıdaki

Detaylı

BMB202. Veritabanı Yönetimi Ders 5. İlişkisel Cebir ve SQL. Erdinç Uzun NKÜ Çorlu Mühendislik Fakültesi Bilgisayar Mühendisliği Bölümü

BMB202. Veritabanı Yönetimi Ders 5. İlişkisel Cebir ve SQL. Erdinç Uzun NKÜ Çorlu Mühendislik Fakültesi Bilgisayar Mühendisliği Bölümü BMB202. Veritabanı Yönetimi Ders 5. İlişkisel Cebir ve SQL Erdinç Uzun NKÜ Çorlu Mühendislik Fakültesi Bilgisayar Mühendisliği Bölümü Dersin Planı İlişkisel Cebir SQL e Giriş İlişkisel Cebir (Relational

Detaylı

Basit SQL Sorguları Veritabanından verilerin SELECT cümleleri ile alınması işlemine sorgulama denir.

Basit SQL Sorguları Veritabanından verilerin SELECT cümleleri ile alınması işlemine sorgulama denir. SQL SELECT CÜMLELERİ Oracle birçok kullanışlı ve güçlü özellikleri olan bir veritabanıdır. Bu özelliklerinin birçoğu SQL ile ilgilidir. VTYS lerinin çoğunluğunda veriler ile çalışmak için SQL kullanılmaktadır.

Detaylı

IN ve NOT IN Tablodaki alan içeriklerine ulaşmak için IN deyimi kullanılır.

IN ve NOT IN Tablodaki alan içeriklerine ulaşmak için IN deyimi kullanılır. Alt Sorgular SQL Serverda sorgu içinde sorgu da oluşturulabilir. Sorgu içinde sorgu, içteki sorgunun dışta olan sorguya değer üretmesidir. Bu, bir değer veya birden fazla değer olabilir. IN ve NOT IN Tablodaki

Detaylı

ALGORİTMA VE PROGRAMLAMA I

ALGORİTMA VE PROGRAMLAMA I ALGORİTMA VE PROGRAMLAMA I Yrd. Doç. Dr. Deniz KILINÇ deniz.kilinc@cbu.edu.tr YZM 1101 Celal Bayar Üniversitesi Hasan Ferdi Turgutlu Teknoloji Fakültesi Genel Bakış 2 Karakter Dizileri Karakter Dizilerini

Detaylı

20461C Querying Microsoft SQL Server Modül Seviye Belirleme Testi

20461C Querying Microsoft SQL Server Modül Seviye Belirleme Testi 20461C Querying Microsoft SQL Server Modül Seviye Belirleme Testi 1) Aşağıdaki SQL Server sürümlerinden hangisi ana sürümlerden bir tanesidir? a) Parallel Data Warehouse b) Express c) Standart d) Developer

Detaylı

5 Sorgulama İşlemleri. Veritabanı 1

5 Sorgulama İşlemleri. Veritabanı 1 5 Sorgulama İşlemleri Veritabanı 1 Select işlemleri SELECT sütunlar FROM tablo_adi SELECT * FROM tbl_personel SELECT adi,soyadi,gorevi FROM tbl_personel Distinct Tekrar eden satırları kaldırmak için kullanılır.

Detaylı

Uzaktan Eğitim Uygulama ve Araştırma Merkezi

Uzaktan Eğitim Uygulama ve Araştırma Merkezi JAVA PROGRAMLAMA Öğr. Gör. Utku SOBUTAY İÇERİK 2 Java da Fonksiyon Tanımlamak Java da Döngüler Java da Şart İfadeleri Uygulamalar Java da Fonksiyon Tanımlamak JAVA DA FONKSİYON TANIMLAMAK 4 Fonksiyonlar;

Detaylı

ALGORİTMA VE PROGRAMLAMA I

ALGORİTMA VE PROGRAMLAMA I ALGORİTMA VE PROGRAMLAMA I YZM 1101 Celal Bayar Üniversitesi Hasan Ferdi Turgutlu Teknoloji Fakültesi Genel Bakış 2 Karakter Dizileri Karakter Dizilerini Okumak ve Yazmak Karakter Dizilerinin Uzunluğunu

Detaylı

5 Sorgulama İşlemleri. Veritabanı 1

5 Sorgulama İşlemleri. Veritabanı 1 5 Sorgulama İşlemleri Veritabanı 1 Select işlemleri SELECT sütunlar FROM tablo_adi SELECT adi,soyadi,gorevi FROM tbl_personel Distinct Tekrar eden satırları kaldırmak için kullanılır. SELECT DISTINCT dersad,

Detaylı

KARİYER PLANLAMA Amaç ve Fayda Yayın Tarihi Kategori Ürün Grubu Modül Versiyon Önkoşulu Yükleme ve Gereken Dosyalar Yükleme Sonrası

KARİYER PLANLAMA Amaç ve Fayda Yayın Tarihi Kategori Ürün Grubu Modül Versiyon Önkoşulu Yükleme ve Gereken Dosyalar Yükleme Sonrası KARİYER PLANLAMA Amaç ve Fayda Yayın Tarihi Kategori Ürün Grubu Modül Versiyon Önkoşulu Yükleme ve Gereken Dosyalar Yükleme Sonrası İşlemler Bu doküman ile Netsis İnsan Kaynakları paketinde bulunan Kariyer

Detaylı

Chomsky Hiyerarşisi. Düzenli Diller ve Đfadeler 03/09/2014. Doç.Dr.Banu Diri

Chomsky Hiyerarşisi. Düzenli Diller ve Đfadeler 03/09/2014. Doç.Dr.Banu Diri Düzenli Diller ve Đfadeler Doç.Dr.Banu Diri Chomsky Hiyerarşisi 0 1 2 3 Karmaşıklık Özyinelemeli Sayılabilir Diller (Recursively Enumerable) Bağlama Bağımlı Diller (Context- Sensitive) Bağlamdan Bağımsız

Detaylı

Veri Tabanı Yönetim Sistemleri Bölüm - 5

Veri Tabanı Yönetim Sistemleri Bölüm - 5 Veri Tabanı Yönetim Sistemleri Bölüm - 5 İçerik SELECT deyimi (devam) Verinin Sınırlandırılması (WHERE) Karşılaştırma İşleçleri (=, >, =,

Detaylı

VERİTABANI ve YÖNETİMİ

VERİTABANI ve YÖNETİMİ VERİTABANI ve YÖNETİMİ Maltepe Üniversitesi Bilgisayar Mühendisliği Bölümü 2 BÖLÜM -7- VERİLERİ GRUPLAYARAK ANALİZ ETMEK 3 Genel Bakış Grup fonksiyonlarının tanımlanması, Gruplama işlemlerini, Gruplama

Detaylı

08221 Veri Tabanı II. Elbistan Meslek Yüksek Okulu GÜZ Yarıyılı. Hafta IV. Öğr. Gör. Murat KEÇECĠOĞLU

08221 Veri Tabanı II. Elbistan Meslek Yüksek Okulu GÜZ Yarıyılı. Hafta IV. Öğr. Gör. Murat KEÇECĠOĞLU 08221 Veri Tabanı II Elbistan Meslek Yüksek Okulu 2014 2015 GÜZ Yarıyılı Hafta IV Öğr. Gör. Murat KEÇECĠOĞLU T-SQL KOMUTLARI Devamı DISTINCT: Birbirinin ayni olan satirlarin listelenmemesi için bu ifade

Detaylı

Veritabanı Yönetim Sistemleri (Veritabanı Tasarımı) SQL (Structured Query Language)

Veritabanı Yönetim Sistemleri (Veritabanı Tasarımı) SQL (Structured Query Language) Veritabanı Yönetim Sistemleri (Veritabanı Tasarımı) SQL (Structured Query Language) Konular Yapısal SQL Komutları Gruplama İşlemi SQL Fonksiyonları Kaynaklar 2 SQL (Structured Query Language) SQL Carlos

Detaylı