KAFKAS ÜNİVERSİTESİ VETERİNER FAKÜLTESİ DERGİSİ

Transkript

1

2 ISSN: e-issn: KAFKAS ÜNİVERSİTESİ VETERİNER FAKÜLTESİ DERGİSİ THE JOURNAL OF THE FACULTY OF VETERINARY MEDICINE UNIVERSITY OF KAFKAS (MART - NİSAN) (MARCH - APRIL) Cilt/Volume: 8 Sayı/Number: 2 Yıl/Year: 202

3 This journal is indexed and abstracted by Thomson Reuters Services beginning with Volume 3 () 2007 in the followings: Science Citation Index Expanded (also known as SciSearch ) Journal Citation Reports/Science Edition This journal is also indexed and abstracted in: CAB Abstracts TÜRKİYE ATIF DİZİNİ ULAKBİM-TÜBİTAK EBSCO YAZIŞMA ADRESİ (Address for Correspondence) Kafkas Üniversitesi Veteriner Fakültesi Dergisi Editörlüğü Kars / TÜRKİYE Phone: /5228 Fax: vetdergi@kafkas.edu.tr ELEKTRONİK BASKI (Electronic Edition) ISSN: ONLINE MAKALE GÖNDERME (Online Submission)

4 Bu dergi Kafkas Üniversitesi Veteriner Fakültesi tarafından iki ayda bir yayımlanır. This journal is published bi-monthly, by the Faculty of Veterinary Medicine, University of Kafkas. Kafkas Üniversitesi Veteriner Fakültesi Adına Sahibi (Owner) Prof.Dr. Hidayet Metin ERDOĞAN Dekan (Dean) EDİTÖR (Editor-in-Chief) Prof.Dr. İsa ÖZAYDIN YABANCI DİL EDİTÖRLERİ (English Editors) Doç.Dr. Ahmet ÜNVER Doç.Dr. Şükrü Metin PANCARCI İSTATİSTİK EDİTÖRÜ (Statıstıcs Editor) Prof.Dr. Gül ERGÜN EDİTÖR YARDIMCILARI (Associate Editors) Prof.Dr. Mehmet ÇİTİL Doç.Dr. Özgür AKSOY Yrd.Doç.Dr. Oktay ÖZKAN Yrd.Doç.Dr. Duygu KAYA SEKRETER (Secretary) Fahri ALTUN BASKI (Print) ESER OFSET MATBAACILIK Tel: ERZURUM DANIŞMA KURULU (Advisory Board) Prof.Dr. Kemal AK İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Belma ALABAY Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Mustafa ALİŞARLI Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Prof.Dr. Feray ALKAN Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Çiğdem ALTINSAAT Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Kemal ALTUNATMAZ İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Mustafa ARICAN Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Sırrı AVKİ Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Prof.Dr. Metin BAYRAKTAR Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Burhan ÇETİNKAYA Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Nazir DUMANLI Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Hüdaverdi ERER Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Ayhan FİLAZİ Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Ekrem GÜREL Abant İzzet Baysal Üniversitesi Fen Edebiyat Fakültesi Prof.Dr. Tolga GÜVENÇ Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Prof.Dr. Ali İŞMEN Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Prof.Dr. Hakkı İZGÜR Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Zafer KARAER Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Arif KURTDEDE Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Erdoğan KÜÇÜKÖNER Süleyman Demirel Üniversitesi Mühendislik Mimarlık Fakültesi Prof.Dr. Kamil ÖCAL Adnan Menderes Üniversitesi Veteriner Fakültesi Prof.Dr. Metin PETEK Uludağ Üniversitesi Veteriner Fakültesi Prof.Dr. Sevim ROLLAS Marmara Üniversitesi Eczacılık Fakültesi Prof.Dr. Berrin SALMANOĞLU Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Nesrin SULU Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Ayşe TOPAL Uludağ Üniversitesi Veteriner Fakültesi Prof.Dr. Ş. Doğan TUNCER Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Cevdet UĞUZ Afyon Kocatepe Üniversitesi Veteriner Fakültesi Prof.Dr. Cengiz YALÇIN Dicle Üniversitesi Veteriner Fakültesi Prof.Dr. Halis YERLİKAYA Fırat Üniversitesi Veteriner Fakültesi

5 Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) AKHAN Süleyman AKTAŞ Abit AKYÜZ Bilal ALTUNOK Vahdettin ARSLAN Cavit ATAKİŞİ Emine TAŞÇI ATAKİŞİ Onur AVCI Mehmet AYAŞAN Tugay AYDENİZÖZ Meral BAKIREL Tülay BALCIOĞLU Murat Soner BALTA Fikri BAŞALAN Mehmet BAYDAN Emine BERİK Nermin BİLDİK Ayşegül BOLAT Duran BOZKURT Hakan CİRİT Ümüt ÇELEBİ Selahattin ÇOBAN Özlem EMİR DEĞER Yeter DİLER İbrahim DOĞAN Abdullah DURAK Yusuf DÜZLER Ayhan ERGÜN Emel ERGÜNAY Koray ERTEKİN Ali ERYAVUZ Abdullah EYDURAN Ecevit GÜL SATAR Nihal Y. GÜNER Yusuf HOŞTÜRK Gülhan Turkay İCA Anıl İNTAŞ Deniz Seyrek İŞCAN Muhsin Kaan KARABULUT Huriye ARIMAN KARAPEHLİVAN Mahmut KARATEPE Mustafa KART Asım KEÇECİ Tufan KILIÇ Engin KIRMIZIGÜL Ali Haydar KIRPIK Mehmet Ali KOCABAĞLI Neşe KOÇAK Ömür MADEN Mehmet NAZLIGÜL Ahmet NUR İsmail Hakkı Akdeniz Üniversitesi Su Ürünleri Fakültesi Yetiştiricilik Bölümü İstanbul Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı Erciyes Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Harran Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Doğu Akdeniz Tarımsal Araştırma Enstitüsü Müdürlüğü Kırıkkale Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı Akdeniz Üniversitesi Ziraat Fakültesi Zootekni Bölümü Rize Üniversitesi Su Ürünler Fakültesi Su Ürünleri Yetiştiriciliği Bölümü Kırıkkale Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Avlama ve İşleme Teknolojisi Bölümü Adnan Menderes Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Yüzüncü Yıl Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı Atatürk Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı Fırat Üniversitesi Su Ürünleri Fakültesi Su Ürünleri İşleme Teknolojisi Yüzüncü Yıl Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Süleyman Demirel Üniversitesi Eğirdir Su Ürünleri Fakültesi Yetiştiricilik Bölümü Kafkas Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı Selçuk Üniversitesi Fen Fakültesi Biyoloji Bölümü Erciyes Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı Kırıkkale Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Afyon Kocatepe Üniversitesi Veteriner Fakültesi Fizyoloji Anabilim Dalı Iğdır Üniversitesi Ziraat Fakültesi Zootekni Bölümü Uludağ Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı Ege Üniversitesi Su Ürünleri Fakültesi Yetiştiricilik Bölümü İstanbul Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Erciyes Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Uludağ Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı Erciyes Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Rize Üniversitesi Su Ürünler Fakültesi Yetiştiricilik Bölümü Kafkas Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı Niğde Üniversitesi Bor Meslek Yüksekokulu Kafkas Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Fizyoloji Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı Kafkas Üniversitesi Fen-Edebiyat Fakültesi Biyoloji Bölümü İstanbul Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı Adnan Menderes Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Erciyes Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı

6 Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) ODABAŞIOĞLU Fuat OĞAN Mustafa ORAL Hasan ÖZEN Abdullah ÖZKAN Muhip ÖZKUL Aykut ÖZSOY Bülent SAÇAKLI Pınar SARI Ebru KARADAĞ SARI Mehmet SERBEST Ayşe SOLMAZ Hasan ŞAHİN Tarkan ŞAKİ Cem Ecmel ŞEKER İbrahim ŞİMŞEK Gülcihan TEKİN Mehmet Emin TÜRKER Hakan ÜNVER Ahmet YARDIMCI Hakan YAŞAR Aşkın YILDIRIM Murat YILMAZ Muhittin Mustafa Kemal Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Uludağ Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı Fırat Üniversitesi Veteriner Fakültesi Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı Ankara Üniversitesi Ziraat Fakültesi Zootekni Bölümü Ankara Üniversitesi Veteriner Fakültesi Viroloji Anabilim Dalı Mustafa Kemal Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Uludağ Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı Mustafa Kemal Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı Kafkas Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı Fırat Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı Fırat Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Fırat Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Zootekni ve Hayvan Besleme Anabilim Dalı Abant İzzet Baysal Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Kafkas Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı Ankara Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı Selçuk Üniversitesi Veteriner Fakültesi Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı İstanbul Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı Kafkas Üniversitesi Fen-Edebiyat Fakültesi Biyoloji Bölümü

7 İÇİNDEKİLER (CONTENTS) ARAŞTIRMA MAKALELERİ (Research Articles) Kars İlinde Bulunan Mandıraların Etkinliğinin Veri Zarflama Analizi İle Ölçülmesi DEMIR P, DERBENTLI O, SAKARYA E... Effects of Starter Culture Types and Different Temperatures Treatments on Physicochemical, Microbiological and Sensory Characteristics, and Fattty Acid Compositions of Çökelek Cheese Made from Goat Milk SIMSEK B, SAGDIC O... Tıbbi Bitki Özütlerinin Melek Balığı (Pterophyllum scalare) Yumurtasının Açılımı Üzerine Etkisi YILMAZ S, ERGUN S... Mitochondrial DNA D-loop and 2S Regions Analysis of the Long-Crowing Local Breed Denizli Fowl from Turkey KARAMAN M, KIRDAG N... Isolation of Flavobacterium psychrophilum Causing Rainbow Trout Fry Syndrome and Determination of an Effective Antibacterial Treatment in Rainbow Trout (Oncorhynchus mykiss) Fry BOYACIOGLU M, AKAR F... Erzurum da Tüketime Sunulan Kaşar Peynirlerinin Mineral Madde İçeriği ve Ağır Metal Kontaminasyonu OZLU H, AYDEMIR ATASEVER M, URCAR S, ATASEVER M... Karın Kaymağı Peynirinden İzole Edilen Laktobasillerin Tanımlanması TURGUT T, ERDOGAN A, ATASEVER M... Determination of Pre-parturition and Post-parturition Behaviors of Norduz Goats YILMAZ A, KARACA S, KOR A, BINGOL M... Effects of Malathion in Fetal Kidney Tissues in Pregnant Rats: Teratogenic Effects Induced by Different Doses ALP H, SAK ME, EVSEN MS, FIRAT U, EVLIYAOGLU O, PENBEGUL N, SANCAKTUTAR AA, SOYLEMEZ H, TUZCU M... Kars Yöresinde Atık Yapmış İnek Sürülerinden Alınan Süt ve Vajinal Sıvap Örneklerinden Brusella Etkenlerinin Bakteriyolojik ve Moleküler Tanımlanması ARSLAN T, ERDOGAN F, ERDOGAN M... eqtl Analysis and Association of MYF6 mrna Expression with Meat Quality Traits in Pigs CINAR MU, FAN H, NEUHOFF C, GROßE-BRINKHAUS C... Investigation on Porcine Aromatase (CYP9) as a Specific Target Gene for Boar Testis CINAR MU, GUNAWAN A... Selective Gray and White Matter Staining of the Horse Spinal Cord BOLAT D, BAHAR S, SUR E, SELCUK ML, TIPIRDAMAZ S... Evaluation for Some Bacterial and Viral Abortions of Dairy Cattle Farms in Burdur District of Turkey OZTURK D, KALE M, PEHLIVANOGLU F, HASIRCIOGLU S, TURUTOGLU H... The Effect of Pepper Gas (OC) on Some Biochemical Parameters in Rats SEYHAN E, MERT N, MERT H... Erzurum Yöresinde Satışa Sunulan Kırmızı Etlerde 7 β-östradiol, Dietilstilbestrol ve Zeranol Kalıntılarının Araştırılması SEVER E, OKUMUS B, INCE S... Türkiye de Farklı Bölgelerde Yetiştirilen Holştayn Sığırlarda Bazı Süt ve Döl Verimi Özellikleri GURSES M, BAYRAKTAR M... Sayfa (Page)

8 Sayfa (Page) Determination of the Metal Contents of Honey Samples from Orumieh in Iran SAGHAEI S, EKICI H, DEMIRBAS M, YARSAN E, TUMER I... Production of Rhamnolipid (A Biosurfactant) Using Free and Immobilized Cells of Pseudomonas sp. SIDAL U, YILMAZ ES... Etlik Piliç Yemlerine Esansiyel Yağ Karışımı İlavesinin Büyüme Performansı, Karkas Randımanı ve Bazı İç Organ Ağırlıkları Üzerine Etkileri KUCUKYILMAZ K, CATLI AU, ÇINAR M... Alterations in the Hematological and Biochemical Parameters and Plasma Ion Concentrations of Common Carp, (Cyprinus carpio L., 758) After Short Term Exposure to Sub-lethal Concentrations of Lead ERGONUL MB, ATASAGUN S, KOCATURK K... Molecular Detection of Anisakis pegreffii in Horse Mackerels (Trachurus trachurus) Sold for Human Consumption in Erzurum Province of Turkey UTUK AE, PISKIN FC, BALKAYA I... Effects of Coenzyme Q0 on the Levels of some Trace Elements in Serum of Rats with Bleomycin Induced Pulmonary Fibrosis CEBI A, CELIKEZEN FC, ERTEKIN A... Effects of Sepiolite Usage in Broiler Diets on Performance, Carcass Traits and Some Blood Parameters ESER H, YALCIN S, YALCIN S, ŞEHU A... Psychological Symptom Profile of Butchers Working in Slaughterhouse and Retail Meat Packing Business: A Comparative Study EMHAN A, YILDIZ AS, BEZ Y, KINGIR S... A Comparative Study on Some Quality Properties and Mineral Contents of Yoghurts Produced from Different Type of Milks ERKAYA T, SENGUL M... Potential Nutritive Value of Field Binweed (Convolvulus arvensis L) Hay Harvested at Three Different Maturity Stages CANBOLAT O... Ophthalmoscopic, Ultrasonographic and Electrophysiologic Findings of Experimentally Induced Intraocular Pressure Increase in Rabbits ERGIN I, BESALTI O OLGU SUNUMU (Case Report) The Right Displacement of Abomasum with Ulceration in A Calf ALTAN S, ALKAN F, KOC Y... Partially Forelimb Amputation and Application of An Artificial Limb (Prosthetics) in A Free- Ranging Red Deer (Cervus elaphus) OLGUN ERDIKMEN D, OZSOY S, AYDIN D, HASIMBEGOVIC H, DONMEZ K

9 Kafkas Univ Vet Fak Derg 8 (2): 69-76, 202 DOI:0.9775/kvfd RESEARCH ARTICLE Kars İlinde Bulunan Mandıraların Etkinliğinin Veri Zarflama Analizi İle Ölçülmesi [] Pınar DEMİR * Özden DERBENTLİ ** Engin SAKARYA *** [] Bu çalışma AB Uyum Sürecinde Türkiye Hayvancılık Kongresi 20(Uluslararası Katılımlı), (20-22 Ekim 20, Ankara - Türkiye) de poster olarak sunulmuştur * Kafkas Üniversitesi Veteriner Fakültesi, Hayvancılık Ekonomisi ve İşletmeciliği Anabilim Dalı, TR-3600 Paşaçayırı, TR-3600 Kars - TÜRKİYE ** İlçe Gıda Tarım ve Hayvancılık Müdürlüğü, TR-7200 Biga, Çanakkale - TÜRKİYE *** Ankara Üniversitesi Veteriner Fakültesi, Hayvan Sağlığı Ekonomisi ve İşletmeciliği Anabilim Dalı, TR-060 Dışkapı, Ankara - TÜRKİYE Makale Kodu (Article Code): KVFD Summary Bu çalışmada, Kars ilinde üretimde bulunan 20 adet mandıraya ait etkinlik değerleri veri zarflama analizi yöntemi ile ortaya konulmaya çalışıldı. Analizler için üç girdi ve bir çıktı kullanılarak çıktı yönelimli model kuruldu. Hesaplamalar sonucunda Kars ilindeki mandıralara ait etkinlik değerleri saptandı. Analiz CCR metodu ve BCC metodu kullanılarak iki farklı şekilde çözüldü ve aralarında farklılık olup olmadığı karşılaştırıldı. CCR modelinin sonuçları uygulanabilirlik açısından uygun bulundu. Analiz sonucunda etkin olmayan işletmelerin etkin olması için tavsiye edilebilecek potansiyel iyileştirmeler elde edildi. İşletmeler yıllık süt işleme kapasiteleri dikkate alınarak ölçek büyüklüğüne göre dört eşit gruba ayrıldı. Gruplar etkinlik skorları bakımından kıyaslandı. Çalışma sonucunda BCC modeline göre yapılan hesaplamada birinci ve ikinci grupta ikişer adet, üçüncü ve dördüncü grupta birer adet olmak üzere toplamda 6 adet karar verme birimi etkin bulundu. CCR modeli üzerinden yapılan hesaplama her gruptan bir adet karar verme birimi etkin bulundu. Etkin olmayan karar verme birimleri için iyileştirmeler hesaplandı. BCC modeli sonuçlarının pratikte uygulanabilir olmadığı görüldü. CCR modeli sonuçlarına göre etkin olmayan işletmeleri etkinlik sınırına çekmek için gerekli olan iyileştirmeler ve ölçeğe göre getirilerin yönü hesaplandı. Anahtar sözcükler: Etkinlik, Veri zarflama analizi, Mandıra, Kars, Kaşar peyniri Measurement the Efficiency of Dairies in the Kars Province with Data Envelopment Analysis Summary In this study, 20 dairies in Kars province, values of the efficiency put forward by Data Envelopment Analysis method was attempted. Three inputs and one output used and output-oriented model is established. Efficiency scores are obtained by the dairies. Analysis is solved using the method in two different ways, CCR and BCC method. Differences between methods were compared. The results of the CCR model are found to be applicable. Potential improvements were obtained for inefficient enterprises. Considering an annual capacity of milk processing enterprises divided into four groups according to the size scale. Efficiency scores of groups were compared. In study 6 decision making unit found efficient, two in the first group, two in second group, one in the third and one in the fourth group. In the calculation one effective decision making unit found from each group. Improvements were calculated for the inactive decision making units. BCC model results were found not suitable in practice. Improvements were calculated to inefficient enterprises take on efficiency frontier and direction of returns to scale according to the results of the CCR model. Keywords: Efficiency, Data envelopment analysis, Dairy, Kars province, Cheddar cheese GİRİŞ Hayvancılığa dayalı sanayi, bugün gelişmiş ülkelerde ekonominin ayrılmaz bir parçası haline gelmiştir. Nitekim Türkiye de de hayvancılık sektöründe süt ve süt ürünleri sanayi oldukça önemli bir yere sahip olup gıda firmalarının İletişim (Correspondence) /5039 pinardemir80@hotmail.com

10 70 Kars İlinde Bulunan... yaklaşık %6 sını süt ve süt ürünlerine ait sanayi işletmeleri oluşturmaktadır. Kars ilinin, çayır-mera ve hayvan varlığı nedeniyle önemli bir hayvancılık bölgesi olması, coğrafi şartlarının uygunluğu, ekonomisinin büyük ölçüde hayvancılığa dayanması ve üretilen kaşar peynirinin Türkiye çapında tanınıyor olması bölgede süt hayvancılığını önemli bir konuma getirmiştir. Kars ilinde bulunan süt sanayi işletmelerini; geleneksel koşullarda üretim yapan ve genellikle mevsimlik çalışan küçük kapasiteli mandıralar ile modern teknoloji uygulayan büyük kapasiteli mandıra ve süt fabrikaları olarak iki grup altında değerlendirmek mümkündür 2. Ancak ilde kaşar peyniri üretiminin büyük bir bölümü, mandıra olarak adlandırılan ve mevsimlik olarak çalışan küçük işletmelerde gerçekleştirilmektedir 3. Süt çabuk bozulabilen bir ürün olması nedeniyle modern ve teknoloji düzeyi yüksek tesislerde, kalite ve hijyen koşullarına uygun olarak üretiminin rantabl ve verimli şekilde değerlendirilmesi gerekmektedir. Bu nedenle yapılan bu çalışmada Kars ilinde üretimde bulunan 20 adet mandıraya ait etkinlik değerleri ortaya konulmaya çalışılmıştır. Nitekim, Veri Zarflama Analizi (VZA) parametrik olmayan doğrusal programlama prensiplerine dayanan birimlerarası göreli etkinlik kıyaslaması yapan bir yöntemdir 4. VZA metodu başlangıçta bankacılık ve sigortacılık gibi sektörlere uyarlanmış sonrasında üniversiteler, oteller, telekomünikasyon, hastaneler, gıda, eğitim gibi çeşitli sektörlerde uygulanmaya başlanmıştır 4-2. VZA ile tarım ve hayvancılık sektörüne yönelik çalışmalar da yapılmıştır. Stokes et al. 3 Pensilvanya da süt sığırcılığı yapan 34 işletmenin etkinliğini veri zarflama analizi metoduyla incelemişlerdir. Bu çalışmada işletme arazi büyüklüğü, iş gücü ve inek sayısı olmak üzere 3 girdi, üretilen süt miktarı ve tereyağı miktarı olmak üzere 2 çıktı ele almışlardır. Theodoridis ve Psychoudakis 4, Yunanistan da 65 süt sığırı işletmesini ölçek büyüklüklerine göre 4 gruba ayırmış, girdi olarak iş gücü, değişken maliyetler ve sabit maliyetler, çıktı olarak brüt geliri ele almışlardır. Galanopaolus et al. 5 Yunanistan da 00 domuz çiftliğiyle yaptıkları veri zarflama analizinde ölçeğe göre sabit ve değişken etkinlikleri hesaplanmışlardır. Lilienfeld ve Asmild yılları arasında Batı Kansas eyaletinde sulu tarım yapan 43 işletmenin su kullanım etkinliklerini incelemişlerdir. Girdi olarak birim başına kullanılan su miktarı, iş gücü, sermaye, tohum, gübre, ilaç, toprağın su tutma kapasitesi alınmıştır. Çıktı olarak üretilen buğday, mısır, sorgum, soya fasulyesi, alfa alfa otu ve silajlık ürünler kabul edilmiştir. Kullanılan sulama tekniği ve teknolojinin su kullanım etkinliğinde fark oluşturduğu, su kullanımı tasarruflu olan işletmelerin etkinlik düzeylerinin kullanmayanlara oranla yüksek olduğu sonucuna varmışlardır. Özden ve Armağan 7, Aydın ilindeki bitkisel üretim yapan işletmelerde veri zarflama analizi metodu ile verimlilik düzeylerini incelemişlerdir. Analize alınan 84 işletmeden 4 ünün etkin diğerlerinin etkinsiz çalıştığını, girdi kullanımında azaltmaya gidilerek aynı üretim değerinin elde edilebileceği sonucuna varmışlardır. Candemir ve ark. 8 İzmir, Manisa, Aydın, Denizli, Bursa illerinde faaliyet gösteren 22 adet tarım kredi kooperatifinin 200 ve 2008 yılları arasındaki teknik etkinliklerini ölçeğe göre sabit getiri varsayımı altında veri zarflama analizi yöntemiyle hesaplamışlardır. Bayramoğlu ve ark. 9 Tekirdağ ilinde sözleşmeli kanola yetiştiriciliği yapan 30 işletmeye ait ekonomik etkinlik, kaynak kullanım etkinliği, teknik etkinlik, ölçek etkinliği ve saf teknik etkinliği hesaplanmışlardır. Sonuç olarak işletmelerin yaklaşık %40 ının ekonomik olarak etkinsiz olduğu ve bu işletmelerin maliyetlerinin yüksek olduğu sonucuna varmışlardır. Koyubenbe ve Candemir 20 Küçük Menderes Havzasında Ödemiş, Tire, Bayındır ve Torbalı ilçelerindeki 80 adet süt sığırcılığı işletmesinin ölçeğe göre sabit getiri varsayımı altında etkinliklerini veri zarflama analizi yöntemiyle hem ilçelere göre hem de grup halinde incelemiş, sonuçta kaynak kullanımında israfın olduğunu ve optimum ölçekte üretim yapılmadığını tespit etmişlerdir. Bu çalışma da ise Türkiye de yöresel özelliği itibariyle tanınan Kars kaşarı peynirinin üretildiği mandıralarda veri zarflama analizi yöntemi ile saf teknik etkinlikleri ve teknik etkinlikleri bulunarak, ölçek etkinlikleri ile ölçeğe göre getirilerinin yönü hesaplanmış, etkin olmayan işletmeler için girdi kullanımında ve çıktı miktarlarındaki iyileştirmeler incelenmiştir. MATERYAL ve METOT Kars Gıda Tarım ve Hayvancılık Müdürlüğü nden alınan verilere göre 2008 yılı itibariyle ilçeler hariç Kars-Merkez köylerinde süt ve süt ürünleri imal eden ve Gıda Tarım ve Hayvancılık İl Müdürlüğü nden üretim izni almış faal 50 adet süt sanayi işletmesi bulunmakta, bunların 45 adedi süt teşvik primi kapsamına alınmıştır. Bu çalışmanın materyalini Kars ilinde faaliyette bulunan 20 adet mandıradan elde edilen veriler oluşturmuştur 2. Çalışmada, veri zarflama analizi metodu kullanılarak işletmelerin verimlilikleri incelenmiş, etkin ve etkin olmayan işletmeler bulunmuştur. Veri Zarflama Analizi Veri Zarflama Analizi (VZA) Charnes, Cooper ve Rhodes isimli araştırmacılar tarafından literatüre CCR adıyla geçen (DEA) karar verme birimlerinin etkinliğinin ölçüldüğü nonparametrik bir metottur 2. Orijinal CCR modeli ölçeğe göre sabit getiri varsayımıyla karakterize teknik etkinliğin ölçüldüğü modeldir. Banker, Charnes ve Cooper modeli (BCC) ise ölçeğe göre değişen getiri varsayımına göre geliştirmişlerdir 22. VZA analize alınan işletmeler arasındaki göreceli verimliliği ölçen doğrusal programlama yaklaşımıdır. Analiz çok sayıda girdi ve çok sayıda çıktının söz konusu olduğu

11 7 DEMİR, DERBENTLİ SAKARYA sistemlerde rahatlıkla uygulanabilmektedir. Ancak aynı girdi ve çıktıya sahip işletmelerin karşılaştırmalı ölçümü yapılabilmektedir. Her karar verme birimi (Decision Making Unit = DMU) için model çözülür. Amaç fonksiyonu girdinin minimizasyonu veya çıktının maksimizasyonu şeklinde se- çilir ve model belirlenen amaç fonksiyon üzerinden kurulur. Çözüm sonucunda amaç fonksiyonu.00 e eşit olan karar verme birimleri etkin,.00 e eşit olmayanlar ise etkin olmayan karar verme birimi olarak adlandırılır 2. Model çözümü sonucunda etkin olmayan karar verme birimleri için referans olan KVB leri belirlenir ve her KVB ne ait girdi ve çıktı ağırlık değerleri elde edilir. Elde edilen ağırlık değerleri iyileştirme formülasyonuna yerleştirilerek KVB için hedeflenen girdi ve çıktı miktarları bulunur. Böylece KVB lerin daha etkin çalışması için önerilebilecek girdi ve çıktı miktarları bulunur 23. Analizin özelliği doğrusal programlama tekniklerini kullanarak, en iyi uygulama gözlemine dayanan bir etkin üretim sınırı oluşturulmasıdır. Etkinlik sınırı etkin karar ver- me birimlerini kapsayan (zarflayan) bir düzlem oluşturmakta, etkin birimler sınır üzerinde, etkin olmayanlar sını- rın altında yer almaktadır. Böylece hem karar verme birim- lerinin etkinliği hesaplanmakta hem de aralarında en iyi performansı gösterenler referans gösterilerek sınır altında kalanların etkinliğe ulaştırılması için yapabilecek iyileştirmeler belirlenebilmektedir 24. Teknik etkinlik aynı şartlar altında, belli miktardaki gir- diden en yüksek düzeyde çıktı üretilmesi veya aynı çıktının daha az girdi ile elde edilmesi olarak tanımlanabilir. BCC yöntemi saf teknik etkinliğin dikkate alındığı bir ölçüm metodudur. CCR yöntemi ise ölçek etkinliğini de dikkate alarak etkinliği ölçmektedir. Bu nedenle BCC analizi ile elde edilen sonuçlar CCR yöntemi ile elde edilen sonuçlardan farklı olabilmektedir. BCC etkinlik sınırı CCR sınırının her zaman altında yer almaktadır bu yüzden etkinlik skoru CCR skorundan büyük ya da ona eşittir. BCC modeli sadece teknik etkinliği ölçmektedir. E etkinliği göstermek üzere E CCR = E Ölçek * E BCC şeklinde yazılabilmektedir 5. Dual çözümü sonucunda elde edilen -λ jk değeri sıfırdan büyük olan tüm karar verme birimleri, etkin olmayan bir karar verme birimi için referans kümesi meydana getirmek- tedir. Etkin olmak isteyen bir KVB girdi ve çıktı değerlerini referans kümedeki rol model ile eşitlerse etkin duruma geçer. Şu şekilde formülize edilerek iyileştirmeler hesaplanmaktadır. Bir KVB referansa göre iyileştirildiğinde iyileştirme öncesindeki haline kıyasla girdi faktörlerini daha az kullanırken çıktı faktörlerini en az kendisi kadar üretir 25. Etkinlik ölçümünde girdilerin ağırlıklı ortalamasının çıktıların ağırlıklı ortalamasına oranı den küçük veya eşit kabul edilmektedir. Böylece karar verme biriminin etkinliği maksimize edilmeye çalışılır. Yukarıda gösterilen kesirli modelin doğrusal hale çevrilmesiyle elde edilen modelin kısıtları şu şekildedir. N tane karar verme birimi için yapılan analizde s adet çıktı, m adet girdi kullanılmaktadır. x girdiyi, y çıktıyı göstermektedir 23. x ij = Etkinliği ölçülen j karar birimine ait i. girdi miktarı y rj = Etkinliği ölçülen j karar birimine ait r. çıktı miktarı u r = Karar birimi tarafından r. çıktıya verilen ağırlık v i = Karar birimi tarafından i. girdiye verilen ağırlık Karar verme birimine ait lamda değerleri toplamı e eşitse ölçeğe göre sabit, den küçükse ölçeğe göre artan, den büyükse ölçeğe göre azalan getiri durumunu göstermektedir 26. CCR modeli bir kısıtın eklenmesiyle BCC modeline dönüştürülmekte böylece ölçeğe göre değişkenlik varsayımı sağlanmaktadır. Yukarıdaki model primal modeldir. Çıktıya göre etkinlik ölçülmek istendiğinde primal model dual modele çevrilir. Lamdalar toplamının e eşit olduğu kısıtı modele eklenerek BCC etkinliği hesaplanır 22. Analizde Kullanılan Girdiler ve Çıktı Çalışmada girdi olarak; mandıraların üreticilerden aldığı çiğ süt miktarı (kg) (Girdi ), işçi sayısı (adet) (Girdi 2) ve sütün taşınmasında ortaya çıkan nakliye gideri (TL) (Girdi 3) baz alınmıştır. Çıktı ise elde edilen kaşar peynirinin satışından elde edilen gelir olarak belirlenmiştir. Süt kalitesindeki değişim üretilen çıktıyı direkt etkilemekte, ürün miktarını değiştirmektedir. Kaliteli girdi; işlets r y Y m i x X k k R j rj jk rk R j ij jk ik,,,, m s r rj r x v y u s r y Y m i x X k k R j rj jk rk R j ij jk ik,,,, m i ij i s r rj r x v y u m i v s r u N j x v y u x v i r s r m i ik i rj r m i ij i,, 0,, 0,, 0 CRS IRS N n n N n n N n n N j j s r y Y m i x X k k R j rj jk rk R j ij jk ik,,,, m i ij i s r rj r x v y u m i v s r u N j x v y u x v i r s r m i ik i rj r m i ij i,, 0,, 0,, 0 CRS IRS N n n N n n N n n N j j s r y Y m i x X k k R j rj jk rk R j ij jk ik,,,, m i ij i s r rj r x v y u m i v s r u N j x v y u x v i r s r m i ik i rj r m i ij i,, 0,, 0,, 0 DR CRS IRS N n n N n n N n n N j j s r y Y m i x X k k R j rj jk rk R j ij jk ik,,,, m i ij i s r rj r x v y u m i v s r u N j x v y u x v i r s r m i ik i rj r m i ij i,, 0,, 0,, 0 DRS CRS IRS N n n N n n N n n N j j s r y Y m i x X k k R j rj jk rk R j ij jk ik,,,, m i ij i s r rj r x v y u m i v s r u N j x v y u x v i r s r m i ik i rj r m i ij i,, 0,, 0,, 0 DRS CRS IRS N n n N n n N n n N j j s r y Y m i x X k k R j rj jk rk R j ij jk ik,,,, m i ij i s r rj r x v y u m i v s r u N j x v y u x v i r s r m i ik i rj r m i ij i,, 0,, 0,, 0 CRS IRS N n n N n n N n n N j j

12 72 Kars İlinde Bulunan... me maliyetlerini artırmakta ancak çıktı miktarının artmasını sağlamaktadır. Girdi kalitesindeki olumsuzluk ise işletme maliyetlerini düşürmekte ancak çıktı miktarında azalmaya sebep olmaktadır. Bu nedenle analiz için girdi miktarının kg cinsinden alınması uygun görülmüştür. İşçi sayısı (Girdi 2) işletmede çalışan işçi sayısını ifade etmektedir. Üretimde bulunan yabancı ve aile işgücü esas alınmıştır. Yabancı işgücüne yapılan aylık ödemeler işletme sahibinin beyanı üzerinden değerlendirilmiştir. Aile işgücü ise yetişkin işgücü birimine çevrildikten sonra asgari ücret üzerinden değerlendirilmiştir. Nakliye giderleri (Girdi 3) işletme sahibinin beyanı esas alınarak birim süt toplama ve pazarlama-nakliye giderlerinin toplamı dikkate alınmıştır. Üretilen kaşardan elde edilen gelir (Çıktı) ise kaşar miktarı ile o yıla ait kg kaşarın ortalama fiyatın çarpımından elde edilmiştir. Yapılan çalışmada bölgedeki kg kaşarın ortalama fiyatının 6.5 kg/tl olduğu tespit edilmiştir. BULGULAR Elde edilen veriler doğrultusunda 20 mandıraya ait 3 girdi ve çıktıdan oluşan veri seti Tablo de gösterilmiştir. Analiz için Xpress-Mp Lineer Programming yazılımı kullanılmış olup veri seti üzerinde BBC yöntemi kullanılarak veri zarflama analizi uygulanmış, karar verme birimlerine (KVB) ait etkinlik değerleri Tablo 2 de gösterilmiştir. Tablo incelendiğinde 3, 4, 6, 0, 4, ve 6. KVB ler olmak üzere toplam 6 KVB teknik etkin olduğu görülmektedir. Etkin olmayan KVB lerin etkinlik değerleri 0.94 ile 0.78 arasında değişmektedir. Etkin olmayan KVB ler için rol model üzerinden iyileştirmeler hesaplanmıştır (Tablo 2). Sonuca göre KVB lerin etkin olmak için ölçeklerini artırmak zorunda kaldıkları görülmektedir. Sonuçların gerçeğe uyarlanabilir olması için CCR yöntemi ile analiz tekrarlanmış, sonuçları Tablo 3 te gösterilmiştir. CCR yöntemi sonucunda 20 işletmeden 4 ü (3, 6, 4 ve 6. KVB leri) teknik etkin bulunmuştur. Etkin olmayan KVB - lerin etkinlik skorları 0.96 ile 0.77 arasında değişmektedir. CCR yöntemi sonuçlarına etkin olmayan karar verme birimleri için girdi miktarlarında yapılması tavsiye edilen iyileştirmeler, girdi miktarlarındaki azalış yüzdeleri Tablo 4 te verilmiştir. Tablo 4 incelendiğinde etkin olmayan KVB ler etkin hale geçebilmek için girdi miktarlarında azaltmaya gidildiği görülmektedir. Örneğin. KVB işçi sayısında değişiklik yapmadan süt miktarını ve nakliye giderini %8. azaltabilirse etkin hale geçmektedir. Dördüncü ve 0. KVB lere ait etkinlik değeri BCC yöntemine göre analiz yapıldığında.00 değerini verirken CCR yöntemine göre analiz yapıldığında sırasıyla 0.96 ve 0.89 bulunmaktadır. Metot çeşidine göre sonuçlar değişmektedir. 3. KVB etkinlik sınırına yaklaşırken süt miktarını %9.53, işçi sayısını %7.4, nakliye giderini %9.49 azaltmaktadır. Etkin olan KVB leri için girdi ve çıktı düzeyinde değişiklik yapılmasına gerek olmamaktadır. BBC ve CCR yöntemi sonucuna göre işletmelerin etkinlik değerleri, referans seti ve ölçek etkinliklerine ilişkin elde edilen değerler Tablo 5 te verilmiştir. Tabloda her KVB ye denk gelen referans seti o işletmenin etkin çalışması için taklit edebileceği işletme numaralarını göstermektedir. Örneğin ilk sütunda görülen. KVB etkin olmak için isterse BCC referans seti olarak gösterilen 3. sütun hizasında yer alan 3, 4, 6 ya da 6. karar verme birimini taklit etmektedir. 3 numaralı KVB zaten etkin durumdadır, bu yüzden kendini taklit eder, dolayısıyla referans setinde yalnızca kendisi yer alır. Bütün etkin karar verme birimleri referans setinde yalnızca kendisini gösterir. Tablo 5 te CCR etkinlik değeri için de BCC yöntemine benzer şekilde referans setleri oluşturulmuştur, etkin olan KVB ler için yine kendiler referans setinde yer almakta, etkin olmayanlar için taklit edilecek KVB ler refere edilmiştir. Tablo. Veri zarflama analizinde kullanılan veri seti Table. Data used in data envelopment analysis KVB Süt Miktarı (kg) İşçi Sayısı (Adet) Nakliye Gideri (TL) Kaşar Peyniri Geliri (TL) KVB Süt Miktarı (kg) İşçi Sayısı (Adet) Nakliye Gideri (TL) Kaşar Peyniri Geliri (TL)

13 73 DEMİR, DERBENTLİ SAKARYA Tablo 2. Veri zarflama analizi BCC yöntemi sonuçları, etkin olan ve etkin olmayan karar verme birimleri, iyileştirilmiş girdi ve çıktı miktarları Table 2. Result of BCC metod, efficient and inefficient decision making units, improved inputs and output KVB Saf Teknik Etkinlik İyileştirilmiş Süt Miktarı İyileştirilmiş İşçi Sayısı İyileştirilmiş Nakliye Gideri Mevcut Kaşar Geliri İyileştirilmiş Kaşar Geliri Tablo 3. Veri zarflama analizi CCR yöntemi sonuçları, etkin olan ve etkin olmayan karar verme birimleri, iyileştirilmiş girdi ve çıktı miktarları Table 3. Result of CCR metod, efficient and inefficient decision making units, improved inputs and output KVB Teknik Etkinlik İyileştirilmiş Süt Miktarı İyileştirilmiş İşçi Sayısı İyileştirilmiş Nakliye Gideri Mevcut Kaşar Geliri İyileştirilmiş Kaşar Geliri

14 74 Kars İlinde Bulunan... Tablo 4. CCR yöntemi sonuçlarına göre etkin olmayan karar verme birimleri için girdi miktarlarında yapılması tavsiye edilen iyileştirmeler, girdi miktarlarındaki azalış (%) Table 4. Improvements for inefficient decision making units by result of CCR method, decreasing in input (%) KVB Süt Miktarındaki Değişim İşçi Sayısındaki Değişim Nakliye Giderindeki Değişim KVB Süt Miktarındaki Değişim İşçi Sayısındaki Değişim Nakliye Giderindeki Değişim Tablo 5. Etkinlik değerleri, referans seti ve ölçek etkinliği Table 5. Efficieny scores, referans set and scale efficieny KVB BCC Etkinlik Değeri BCC Refr. Seti CCR Etkinlik Değeri CCR Refr. Seti Ölçeğe Göre Getr. Yönü Ölçek Etkinliği , 4, 6, , 6, 6 Azalan , Azalan Sabit Artan , 6, , 6, 6 Azalan Sabit , 6, , 6, 6 Azalan , 4, , 6 Artan , 6, , 6, 4 Azalan , 6, 6 Artan , 6, , 6 Azalan , 4, , 6 Artan , , 6 Azalan Sabit , 6, , 6, 6 Azalan Sabit , 6, , 6, 6 Azalan , , 6 Azalan , 6, , 6 Azalan , , 6, 6 Azalan Tablo incelendiğinde 4. KVB BCC yöntemine göre model kurulduğunda, 8 ve 2. KVB lerine referans olurken CCR yöntemine göre model kurulduğunda hiçbir karar verme birimine referans olmadığı görülmektedir. Yine benzer şekilde 0. KVB BCC yöntemine göre etkin kabul edilerek sadece kendine referans teşkil etmekte, CCR yöntemine göre etkin kabul edilmemektedir. 6. KVB BCC modeline göre 3 defa referans olmaktadır. CCR modeline göre çözüm yapıldığında 6 kez referans olan 6. KVB ön plana çıkmaktadır. Tablo 5 te modele göre referans olma sıklığının değiştiği görülmektedir. Teknik etkinlik (CCR) değerinin saf teknik etkinlik (BCC) değerine oranı bize ölçek etkinliğini vermektedir. Yapılan çalışmada 3, 6, 4 ve 6 numaralı KVB leri ölçeğe göre sabit getiri altında çalıştıkları tespit edilmiştir. Tablo 5 te ölçeğe göre getirini yönü de gösterilmektedir. CCR model çözümü sonucunda elde edilen lamda değerleri toplamı.00 den büyük olan KVB ler ölçeğe göre artan,.00 e eşit olan yani etkin olan KVB ler ölçeğe göre sabit,.00 den düşük olan KVB ler ölçeğe göre artan

15 75 DEMİR, DERBENTLİ SAKARYA Tablo 6. Süt işleme kapasitesine (ton/gün) göre işletmelerin mandıraların BBC ve CCR etkinlikleri Table 6. BBC and CCR effficieny of dairies according to milk processing capacity (tonnes/day) KVB Süt İşleme Kapasitesi Ölçek Grubu BCC Etkinliği CCR Etkinliği KVB Süt İşleme Kapasitesi Ölçek Grubu BCC Etkinliği CCR Etkinliği getiri durumunu göstermektedir. Örneğin KVB 4 işletme ölçeğini artırabilirse CCR etkinlik sınır çizgisi üzerinde yer alabilmektedir. Aynı şekilde KVB 8, KVB 0 ve KVB 2 ölçeğe göre artan getiri durumundadır. KVB, KVB 2, KVB 5, KVB 7, KVB 9, KVB, KVB 3, KVB 5, KVB 7, KVB 8, KVB 9 ve KVB 20 ölçeğe göre azalan getiri durumunu sergilemektedir, işletmeler ölçeklerini azaltarak etkinlik sınırına çekilirler. Bahsedilen ölçeğe göre getiri durumu CCR model sonuçlarından yola çıkarak açıklanmıştır. Mandıraların günlük işledikleri süt miktarı dikkate alınarak ölçek büyüklüğüne göre dört sınıfa ayrılmıştır (Tablo 6). Yıllık süt işleme kapasitesi 0-9 ton arası birinci grup, ton arası ikinci grup, ton arası üçüncü grup, 50 ve üstü ton ise dördüncü grubu oluşturmaktadır. Her grupta 5 işletme yer almıştır. Mandıraların günlük süt işleme kapasitesine göre BBC ve CCR etkinlikleri Tablo 6 da verilmiştir. BCC modeline göre birinci grupta 2, ikinci grupta 2, üçüncü grupta, dördüncü grupta işletme etkin bulunmuşken CCR modeline göre her grupta birer adet işletme etkin bulunmuştur. Etkinlik gösteren KVB lerin her işletme grubunda da yer almaktadır. Belli bir grup için yapılan ve göreli etkinliğin ölçüldüğü bu çalışma, işletme ölçeği küçük olsa bile işletmelerin etkinliği yakalayabildiğini, etkin olmayan KVB ler için referans olabileceğini göstermektedir. Örneğin 3. KVB 0 ton/yıl süt işleme kapasitesine sahiptir ve CCR (.00), BCC (.00) ve ölçek (.00) etkin bulunmuştur. Oysa 6. KVB 3. KVB ye göre daha yüksek kapasiteye (50 ton) sahip olmasına rağmen CCR, BCC ve ölçek etkindir. Bu bağlamda yapılan bu çalışmada işletmelerin günlük süt işleme kapasitesi bakımından ölçek değişikliğinin etkinlik üzerinde belirleyici olmayabileceği söylenebilir. Çünkü KVB 6 CCR modeline göre, BCC modeline göre 6 kez referans olmaktadır. KVB 6 nın referans sıklığının bu kadar fazla olmasına rağmen onunla aynı grupta yer alan 7, 8, 9 ve 20. KVB ler etkinlik sınırından uzaklaşmaktadırlar. KVB 8 için etkinlik değeri 0.77 ye kadar düşmektedir. TARTIŞMA ve SONUÇ Kars ili süt hayvancılığı ve süt sanayinin önemli sorunları bulunmaktadır 2. Üretiminin yapıldığı süt sığırcılık işletmeleri genellikle dağınık yapıda, ölçekleri düşük ve üretimde geleneksel yapıya sahiptirler. Diğer taraftan bölgede süt üretiminin bütün yıla yayılmaması nedeniyle verimliliği düşük olan sütün hijyen ve kalitesinde yaşanan sorunlar önemini korumaktadır. İşletmelerdeki bu irrasyonel yapı, üretim sanayi entegresyonunun gelişimini de olumsuz etkilemektedir. Ayrıca süt sanayi işletmelerinin kaliteli hammadde temininde yaşanan sorunlar, süt sanayi işletmelerinin kapasite kullanım oranının düşük olması ve maliyetlerin yüksek olması bu işletmelerin karlı ve verimli çalışmalarına olanak vermemektedir 27. Veri zarflama analizinin en önemli avantajı belli bir modele bağlı kalmadan etkin birimleri göstererek iyileştirmeye olanak sağlamasıdır. Dezavantajı ise girdi ve çıktılardaki en ufak değişikliğin sonuçları değiştirmesidir. Bu nedenle analiz sonuçlarının gerçeği yansıtması için işletme bilgileri mümkün olduğunca sağlıklı alınmalı, girdilerin, çıktıların ve karar verme birimlerinin seçimine dikkat edilmesi gerekmektedir. Bu makalede temel olarak BCC ve CCR yöntemlerinden bahsedilmiştir, iki yönteme göre çözüm yapılmış sonuçlar kıyaslanmıştır. BCC yöntemi sonuçlarına göre işletmelere iyileştirme oranları verildiğinde bunun pratikte uygulanabilir olmadığı görülmüştür. Çünkü etkin olmayan işletmeler etkinliği yakalamak için girdi ve çıktı miktarlarını büyük oranda değiştirmek zorunda kalmaktadırlar. CCR yöntemi sonuçlarına göre elde edilen iyileştirmeler diğer yönteme göre pratiğe daha uygulanabilir olduğu görünmektedir. Bu çalışma ile kaşar peyniri üreten çeşitli ölçek büyüklüğüne sahip mandıraların veri zarflama yöntemi ile etkinlikleri tespit edilmeye çalışılmıştır. Veri zarflama analizinde mandıralardan elde edilen veriler doğrultusunda

16 76 Kars İlinde Bulunan... üreticilerden aldığı çiğ süt miktarı, işçi sayısı ve sütün taşınmasında ortaya çıkan nakliye giderleri girdi bazında, üretilen kaşar peynirinden elde edilen gelir ise çıktı bazında dikkate alınmıştır. Bu kapsamda Demir in 2 çalışmasındaki süt sanayi işletmelerine ait en önemli maliyet kalemlerinin sırasıyla çiğ süt alım gideri (%7-72), nakliye gideri (%5.9) ve işçilik giderinin (%5.) olması girdi seçiminin belirlenmesinde göz önünde bulundurulmuştur. Galanopaolus et al. 5, Yunanistan da çiftlikler üzerinde veri zarflama analizi yöntemini uygulamış, çıktı olarak hayvan başına düşen işletme brüt karı, girdi olarak ise hayvan başına düşen iş gücü, sermaye, yem ve diğer giderler kullanılmıştır arası domuza sahip işletmeleri küçük, arasını orta ve 400 ve üstü olanları büyük işletme grubu olarak alınmıştır. Büyük ölçekli işletmelerin küçük ölçekli işletmelerden daha etkin çalıştıkları sonucuna varılmıştır. Yapılan bu çalışmada ise ölçek büyüklüğüne göre dört grup oluşturulmuş, her grupta en az bir etkin işletme yer almıştır. Elde edilen veriler doğrultusunda sadece işletme ölçeklerinin etkinlik üzerinde belirleyici etkisinin olmayabileceği, işletmelerin girdi kullanımında yapabilecekleri değişiklikler sayesinde teknik etkinliği yakalayabilecekleri söylenebilir. Nitekim Tablo 4 incelendiğinde etkin olmayan bazı mandıraların etkin hale geçebilmek için üreticilerden aldıkları süt miktarlarında da azaltmaya gitmeleri gerektiği görülmektedir. Bu durum, mandıralarda işlenen süt miktarı kadar alınan sütün kalitesinin de ne kadar önemli olduğunu göstermektedir. Analize konu olan 20 işletmeye ait etkinlik düzeyleri ve varsayılan iyileştirmelerin bilimsel dayanağı VZA ile elde edilen sonuçlardır. İşletmelerin karlı ve verimli çalışabilmesi kaynakların etkin kullanımıyla mümkündür. İşletmelerdeki girdilerin azaltılması ve üretilen kaşar miktarının artırılmasıyla etkinliğin sağlanacağı göz önünde bulundurulmalı, kaynak kullanımındaki etkinliğin işletme geliri ve karlılığı açısından önemli olduğu unutulmamalıdır. KAYNAKLAR. Güneş E, Albayrak M, Gülçubuk B: Türkiye de Gıda Sanayii, Tek Gıda İş Yayınları, ISNB: X, s. 384, Ankara, Demir P: Kars ili süt sanayi işletmelerinde üretim ve sanayi entegrasyonunun ekonomik ve sosyo-ekonomik analizi. Doktora Tezi, Ankara Üniv Sağlık Bil Enst, Ankara, Demir P, Aral S: Kars ili süt sanayi işletmelerinde üretim ve sanayi entegrasyonunun ekonomik ve sosyo-ekonomik analizi. Kafkas Univ Vet Fak Derg, 6 (4): , Kutlar A, Babacan A: Türkiye deki kamu üniversitelerinde CCR etkinliğiölçek etkinliği analizi: Dea tekniği uygulaması. Kocaeli Üniv Sosyal Bil Enst Derg 5 (): 48-72, Kaynar O, Zontul M, Bircan H: Veri zarflama analizi ile OECD ülkelerinin telekomünikasyon sektörlerinin etkinliğinin ölçülmesi. CÜİİB Derg, 6 (): 37-57, Yalçıner K, Atan M, Kayacan M, Boztosun D: İMKB 30 endeksinde etkinlik analizi (Veri zarflama analizi - VZA) ile hisse senedi seçimi. I. Uluslararası Manas Üniversitesi Ekonomi Konferansı, Manas Üniversitesi, Bişkek, Kırgızistan (23-24 Eylül 2004), Akın O: Ekmek üretim işletmelerinin verimliliklerinin veri zarflama yöntemi ile mukayeseli analizi: Batı Akdeniz Bölgesi nde bir araştırma. Akademik Araş ve Çalış Derg, 2 (2): 89-06, Kula V, Özdemir L: Çimento sektöründe göreceli etkinsizlik alanlarının veri zarflama analizi yöntemi ile tespiti. AKÜİİBF Derg, 0 (): 55-70, Bircan H: Veri zarflama analizi ile Sivas ili merkez sağlık ocaklarının etkinliğinin ölçülmesi. CÜİİB Derg, 2 (): , Titiz İ, Demir Y, Onat K: Türkiye de şirket birleşmelerinde etkinliklerin veri zarflama analizi yoluyla belirlenmesi. AKÜİİBF Derg, 9 (): 7-39, Kutlar A, Gülcü A, Karagöz Y: Cumhuriyet üniversitesi fakültelerinin performans değerlendirmesi. CÜİİB Derg, 5(2): 37-57, Aksu A, Köksal CD: Bağımsız ve zincir otel işletmelerinin veri zarflama analizi ile etkinliklerin karşılaştırılması: Antalya bölgesinde bir çalışma. İİF Derg, 20 (235): 97-07, Stokes JR, Tozer PR, Hyde J: Identifying efficient dairy producers using data envelopment analysis. J Dairy Sci, 90, , Theodoridis AM, Psychoudakis A: Efficiency measurement in Greek dairy farms: Stochastic frontier vs. data envelopment analysis. IJESAR, (2): 53-67, Galanopoulos K, Aggelopoulos S, Kamenidou I, Mattas K: Assessing the effects of managerial and production practices on the efficiency of commercial pig farming. Agr Syst, 88, 25-4, Lilienfeld A, Asmild M: Estimation of excess water use in irrigated agriculture: A Data Envelopment Analysis approach. Agr Water Manage, 94, 73-82, Özden A, Armağan G: Aydın ili tarım işletmelerinde bitkisel üretim faaliyetlerinin verimliliklerinin belirlenmesi. Tar Eko Derg, (2): -2, Candemir M, Duran FM, Koyubenbe N: İzmir 6. bölge birliği tarım kredi kooperatiflerinde teknik etkinlik, ölçek etkinliği, teknik ilerleme, etkinlikteki değişme ve verimlilik analizi: AÜAİF Derg, (2): 3-35, Bayramoğlu Z, Aktürk D, Tatlıdil FF: Kaynakların rasyonel kullanımının üretim maliyetleri üzerine etkisi: Türkiye de kanola yetiştiriciliği örneği. STGBD, 24 (3): 62-68, Koyubenbe N, Candemir M: Küçük Menderes Havzasında Ödemiş, Tire, Bayındır ve Torbalı ilçelerindeki süt sığırcılığı işletmelerinin teknik etkinliklerinin karşılaştırılması. Hay Üret Derg, 47 (2): 9-20, Charnes A, Cooper WW, Rhodes E: Maesuring the efficiency of decision making units. Eur J Oper Res, 2 (6): 8-, Banker RD, Charnes A, Cooper WW: Models for estimation of technical and scale ınefficiencies in data envelopment analysis. Manage Sci, 30 (9): , Cooper WW, Seiford LM, Tone K: Data Envelopment Analysis A Comprehensive Text With Models, Applications, Referances And Dea Solver, Kluwer Academic Publishers, Dordreccht, Eroğlu E, Atasoy CM: Veri zarflama analizi ile etkinlik ölçümü ve etkin karar birimlerinin duyarlılık analizi. İÜİF Derg, 2, 73-89, Cingi S, Tarım A: Türk Banka Sisteminde Performans Ölçümü DEA- Malmquist Tpf Endeksi Uygulaması. Türkiye Bankalar Birliği Araştırma Tebliğleri Serisi, No: , Banker RD, Thrall RM: Estimation of returns to scale using Data Envelopment Analysis. Eur J Oper Res, 62, 74-84, Demir P, Aral S: Kars ilindeki süt sektörünün mevcut durumuna ilişkin veteriner hekim ve ziraat mühendislerinin görüşleri. YYU Vet Fak Derg, 22 (): -5, 20.

17 Kafkas Univ Vet Fak Derg 8 (2): 77-83, 202 DOI:0.9775/kvfd RESEARCH ARTICLE Effects of Starter Culture Types and Different Temperatures Treatments on Physicochemical, Microbiological and Sensory Characteristics, and Fattty Acid Compositions of Çökelek Cheese Made from Goat Milk Bedia ŞİMŞEK * Osman SAĞDIÇ ** * Suleyman Demirel University, Agricultural Faculty, Department of Food Engineering, TR Isparta - TURKIYE ** Yildiz Technical University, Faculty of Chemical and Metallurgical Engineering, Department of Food Engineering, TR-3420 Istanbul - TURKIYE Makale Kodu (Article Code): KVFD Summary Çökelek cheese produced with heated, filtrated and salted yogurt is a traditional cheese belong to Turkey. In this study, Çökelek cheeses were produced from the coagulums prepared by using cultures including Lactobacillus helveticus, yogurt culture or the mixture of Lb. helveticus and yogurt cultures (:). The Çökelek cheeses produced with the cultures were prepared after heating of the coagulums at two different temperatures, 85ºC or 95ºC for 30 min. The produced Çökelek cheeses were stored at 4 o C for 45 days. Therefore, in the Çökelek cheese production, using of Lb. helveticus (as a single or mix with yogurt starter cultures) as starter culture and heating at 85ºC may be proposed. Keywords: Çökelek cheese, Lactobacillus helveticus, Yogurt starter cultures, Goat milk Keçi Sütünden Üretilen Çökelek Peynirinin Fizikokimyasal, Mikrobiyolojik ve Duyusal Özellikleri ile Yağ Asidi Kompozisyonu Üzerine, Laktik Starter Kültür Tipi ve Farklı Sıcaklık Uygulamanın Etkisi Özet Çökelek peyniri, ısıl işlem uygulanıp, süzülen ve tuzlanmış yoğurttan yapılan Türkiye ye özgü geleneksel bir peynirdir. Bu çalışmada, Çökelek peynirleri, kültür olarak () Lactobacillus helveticus, (2) yoğurt kültürü veya (3) Lb. helveticus ve yoğurt kültürü karışımlarının (:) eklendiği süt pıhtılarından üretilmiştir. Çökelek peynirleri, belirtilen kültürlerle elde edilen pıhtılarından 85ºC veya 95ºC lik iki farklı sıcaklıkta ısıtılmasından sonra elde edilmiştir. Üretilen Çökelek peynirleri 4 o C de 45 gün depolanmıştır. Sonuç olarak, çökelek peyniri üretiminde starter kültür olarak Lb. helveticus un kullanımı (yoğurt bakterileri ile tek veya karışık olarak) ve 85 o C lik ısıl işlem önerilebilir. Anahtar sözcükler: Çökelek peyniri, Lactobacillus helveticus, Yoğurt starter kültürleri, Keçi sütü INTRODUCTION The dairy products produced from by yogurt such as yayik butter, tarhana and Çökelek cheese are very popular products in the Middle East where they are used in the preparation of some popular food dishes. Çökelek cheese is produced by heating of yogurts and then straining in a special cloth bag. It has been made from cow, goat milk and ewe milk for a long time. The goat milk production ranks third in the world after cattle and buffalo milk production. In the developing countries, dairy goat farming has an increasing important. Goat milks are very important for flavor and quality of Çökelek cheese. Yogurt bacteria and Lactobacillus helveticus are homofermentative thermophilic lactic acid bacteria widely used İletişim (Correspondence) bediasimsek@sdu.edu.tr

18 78 Effects of Starter Culture... in the dairy technology. In particular, yogurt bacteria is used in yogurt production 2. Additionally Lb. helveticus being of highly proteolytic activity is used as primary natural whey starter for the manufacture of some Swiss and Italian cheese varieties 3-5. Also Lb. helveticus can be used as starter culture in a variety of fermented dairy products and as a non-starter flavour enhancer, being capable of reducing bitterness and accelerating cheese flavour development 6-9. The main role of lactic acid bacteria used as starter during cheese production is the production of lactic acid through metabolism of lactose. This action improves the milk coagulation process, makes the curd stronger and protects the final product against contamination. Furthermore, glycolysis, proteolysis and lipolysis produced by the enzymes of lactic acid bacteria contribute to the flavour development of the cheeses during the ripening process 0. Heat has a great effect on proteins. Apart from denaturation, heat-induced chemical reactions involving amino acid residues can significantly alter protein properties. Such heat-induced chemical changes have not been characterized quantitatively so far. Traditionally, in the production of Çökelek cheese does not use starter culture. However, thermophilic yogurt cultures can grow aroma and can be alive during the heating process if Çökelek cheese is produced from yogurt. The aim of this study was to determine the suitable starter culture and heating temperature combination to produce better Çökelek cheese. For the reason, goat milk and thermophil cultures were selected for Çökelek cheese production. Thermophilic cultures including Lb. helveticus and yogurt bacteria are more heat stabile than other lactic starter cultures 2. Additionally Lb. helveticus has high proteolytic activity and it is a bacterium fast aroma-grown. Çökelek cheeses produced by using different starter cultures and two different temperatures were examined in respect of their physicochemical and microbiological properties, protein fractions, FFAs (free fatty acids), sensory properties during their ripening period. Additionally we added to the milk used in Çökelek cheese yogurt cultures and/or Lb. helveticus as thermophilic starter cultures. MATERIAL and METHODS Çökelek Cheese Production Çökelek cheeses were produced in Ün-Süt Dairy Plant of Suleyman Demirel University. In yogurt production, the method proposed by Tamime and Robinson 3 was followed with the exception that the homogenization and solid standardization stages were ignored. Firstly, goat milk was analyzed for physicochemical, microbiological and sensorial properties and fatty acid compositions. Then, goat milk was standardized to.5±0.2% fat and heated up to 95 C with gentle stirring and kept at this temperature for 5 min. (the first pasteurization), followed by cooling to o C. The pasteurized milk was divided into three groups. Each group was inoculated with a yogurt culture (Y) (Yomix 502, Gemak-Danisco, Ankara, Turkey), Lb. helveticus (H) (LH-B02, Peyma-Chr. Hansen, Istanbul, Turkey) or mixture culture (M) of these (:) at a rate of 3% (w/w) ratio. These groups were incubated at C until ph 4.6 and then cooled down to 4 C. After overnight refrigeration, the coagulums were manually stirred and then were heated up 85 C and 95 C for 30 min (the second pasteurization). In this respect, six treatment groups including control group were studied in this study: () Y95 (Control), (2) Y85, (3) H95, (4) H85, (5) M95, (6) M85 (Traditional Çökelek cheese usually made with yogurt bacteria. Then, yogurt is heated at high temperature. Therefore, the Y95 samples were evaluated as a control group in this study). All of these treatment coagulums were cooled down to 25 C and then, poured into a layer cheese cloth bag. A drainage procedure was accomplished in a temperature controlled room, set at 25 C. Çökelek cheese treatments were filled into the containers, salted with % salt and mixed gently to achieve homogeneity. Obtained Çökelek cheeses treatment groups were packaged as the lots weighing 500 g. and stored at 4 C for 45 days until analysis. Çökelek cheese is a fresh cheese consumed, although the duration of 45 days for sensorial, microbiological and chemical changes that occur in the content of fatty acids stored in order to observe. Physicochemical Analyses The titratable acidity (TA, as lactic acid %, acidity of milk - AOAC Official Method ), total solid (TS%, AOAC Official Method ) was determined as outlined by AOAC methods 4,5. Fat (%) of the raw milk was determined using the method of James 2. ph values were measured using a HANNA ph meter (HANNA Instruments, Padova, Italy). Percentage of NaCI and fat of cheese was determined using the method of James 6. NaCl content was expressed as salt concentration. Moisture contents of cheese were determined by AOAC methods (Official Method ) 7. Total nitrogen (TN) and water-soluble nitrogen (WSN) levels were determined according to the method of Grippon et al. 8. Protein content was calculated by multiplication of TN content with Ripening index of Çökelek cheese samples were calculated using following equation: Ripening index (%) = (WSN/TN) 00 Analysis of Fatty Acids Fatty acid composition was determined using a modified fatty acid methyl ester method as described by Marquard 9. The oil was extracted from 0 g sample by homogenisation with hexane. The reactive was 500 ml of total Na-metaoxid (0.5 g), isooctane (20 ml) and methanol (80 ml) added to the oil (50 µl). Isooctane (500 µl) was added

19 79 ŞİMŞEK, SAĞDIÇ into the sample following waiting overnight. The fatty acids methyl esters were analyzed in a Hewlett-Packard 6890 series gas chromatograph (Perkin Elmer Auto System XL, San Jose, CA, USA) equipped with a flame ionizing detector (FID), a fused silica capillary column Cp SIL 88, 00 m 0.25 mm i.d., film thickness 0.2 μm (Chrompack Inc, Bridgewater, NJ,USA). It was operated under the following conditions: oven temperature program, 60 C for 4 min. raised to 75 C at a rate of 3 C min - and than kept at 75 C for 27 min; than at 25 C for 5 min. and raising to 240 C at a rate of 4 C min - and then kept at 240 C for 5 min injector and detector temperatures, respectively. Carrier gas was helium at flow rate of 5 cm s - ; split ratio, /0 ml min -. The contents of palmitic (C6:0), stearic (C8:0), oleic (C8:), linoleic (C8:2) and linolenic (C8:3) acids were determined by computing integrator. Determination of Lactic Acid Bacteria Streptococcus thermophilus and lactobacilli were enumerated on M7 and MRS agars (Merck, Darmstadt, Germany), respectively, using the pour plate method with incubation at 30 C for 3 days 20,2. Results were expressed as log cfu g -. Sensorial Analysis Çökelek cheeses were tested by a panel of 25 panelists familiar with cheese grading. They scored the cheeses for appearance (9 points), flavour (9 points), odour (9 points) and texture (9 points). The hedonic scale of 9 points was used ( = dislike extremely; 5 = neither like nor dislike; 9 = like extremely). The panelists were provided with unsalted crackers and mineral water to rinse their palates when necessary. The panelists were asked to evaluate these cheeses and to record any unexpected or unpleasant flavour defects and total score 22. Statistical Analyses Analyses of variance for bacterial counts after a log transformation was performed on data obtained at different stages of production. Chemical, microbiological, fatty acids and organoleptic characteristics of the Çökelek samples were subjected to analyses of variance (one-way) using multivariate test using SPSS 5.0 Statistic Package (SPSS, Chicago, Illinois, USA). Statistical significance level was taken as 95%. RESULTS The ph, TA (%), TS (%), fat (%), density (g ml - ) and protein (%) of the raw goat milk used in this study were as follows: 6.76±0.46, 0.9±0.0, 3.6±0.25, 3.37±0.49,.033±0.00 and 3.8±0.03, respectively. Yield of cheese is basically important to cheese manufacturers to get large sums of money or profit. The yield values of Çökelek cheese treatment groups; Y95, Y85, M95, M85, H95 and H85 were found as 27.29%, 27.43%, 28.5%, 25.37%, 28.96% and 25.9%, respectively. Generally, the yield of Çökelek cheeses heated at 95 C was higher than those of cheese heated at 85 C (except Y95 and Y85 samples), which was thought to be due to the whey proteins, being effective on yield of cheese in heating process at 95 C. The physicochemical characteristics of Çökelek cheeses during the storage period are presented in Table. The ph value of the control sample (4.30±0.48) was higher than those of the other samples and the titratable acidity levels of the Çökelek samples ranged from % in the 45 th day. During the ripening period, titratable acidity increased in each treatment groups. Reason for this increase during storage, the products formed as a result of microbial and enzymatic activity may be due to the acidic character. The total solid, fat, NaCl varied between 25.87% and 28.98%, 4.08% and 5.50%, and.64% and.83%, respectively. The total solid value of M85 samples was statistically different from others on first days and 5 th days. In addition, this value of H95 significantly higher than other samples was identified in 45 th day. In general, total solid values of the Çökelek cheese heated at 95 o C were higher than those of the others. Lb. helveticus and secondary pasteurization process applied to the product may have an effect on TS%. The TN% and WSN% increased throughout the ripening period. The ripening indices were determined as 3.59% % in the all samples. The ripening index of the Çökelek cheese produced with yogurt cultures (85 C) was the highest. In this regard, proteolytic activity of lactic acid bacteria used as starter cultures are thought to have played an effective role. In our study, high temperature led to reduction of bacterial content, this reduction has been effective in reducing the content of the enzymes. TS%, TN%, WSN% or % ripening indexes (RI) were statistically significant among groups for each parameter during storage (P<0.05). Both lactococci and lactobacilli counts increased in the all samples during the storage period. While the log counts of lactococci were determined between 2.86 and 3.03, those of lactobacilli to ranged from during the storage period (Table ). The differences between the log counts of lactococci and lactobacilli in the Çökelek cheeses were found significant for each lactic acid bacteria group during storage (P<0.05). The fatty acid compositions of Çökelek cheeses are presented in Table 2. SFA contents in the treatment groups - (Y95, 85, M95, M85, H95, and H85) were 65.70, 66.88, 68.70, 67.62, and in the 45 th day of storage, respectively. The lowest SFA content was in the control group. The myristic acid level of control cheese (9.56%) was the highest, while palmitic acid level of the sample made with yogurt cultures at 85 C (28.05%) was the highest.

20 80 Effects of Starter Culture... Table. Chemical and microbiological (log cfu g - ) values detected in Cokelek cheeses Tablo. Çökelek peynirinde saptanan kimyasal ve mikrobiyolojik (log kob g - ) değerler Storage Time No ph* TA* [%] TS** [%] Fat* [%] Fat/TS* [%] NaCl* [%] NaCl/TS* [%] WSN** [%] TN** [%] RI** [%] Lactic Acid Bacteria (log cfu g - ) Streptococcus thermophilus ** Lactobacilli ** M SD M SD M SD M SD M SD M SD M SD M SD M SD M SD M SD M SD Y95:C ab fg a gh gh e-h 0.20 Y ab g bc h e-h e-h 0.25 First day M ab g abc h.4.73 e-h fgh 0.35 M b g abc h fgh h 0.26 H ab fg abc gh h g-h 0.30 H ab ef abc fg e-h g-h 0.28 Y95:C ab cd ab cde c-e bcd 0.35 Y ab ab abc ab bcd cde th day M ab ef abc efg abc c-f 0.40 M b cd c bcd cde d-h 0.23 H ab de bc cde d-g d-h 0.32 H ab cd abc cd abc d-g 0.20 Y95:C ab bcd a cd ab a 0.4 Y ab a abc a a a th day M ab de abc def a ab 0.46 M ab abc abc abc ab abc 0.5 H a abc abc abc abc a-d 0.26 H ab ab abc ab a abc 0.30 M - arithmetical mean, SD standard deviation. Means in the same column with different letters show statistically significant differences * statistically not significant different P>0.05, ** statistically significant different P<0.05 C - Control, Y85 and Y95 - inoculated with yogurt culture, and heated at 85 C and 95 C, respectively; M85 and M95 - inoculated with yogurt culture + Lb. helveticus (:), and heated at 85 C and 95 C, respectively; H85 and H95: inoculated with Lb. helveticus, and heated at 85 C and 95 C, respectively TA - titratable acidity, TS - total solids, TN - total nitrogen, WSN - water-soluble nitrogen, RI-Ripening Index

21 8 ŞİMŞEK, SAĞDIÇ Table 2. Fatty acid values detected in Cokelek cheeses Tablo 2. Çökelek peynirlerinde saptanan yağ asidi değerleri First Day 45 th Day Fatty Acids (%) Y95: C Y85 M95 M85 H95 H85 Y95: C Y85 M95 M85 H95 H85 SFA C 4: C 6: C 8: C 0: C 2: C 4: C 6: C 7: C 8: TUFA MUFA C : C 6: C 7: C 8: trans C 8: cis PUFA C 8: C 8: SFA - saturated fatty acids, TUFA - total unsaturated fatty acids, MUFA - mono unsaturated fatty acids, PUFA - poli unsaturated fatty acids C - Control, Y85 and Y95 - inoculated with yogurt culture, and heated at 85 C and 95 C, respectively; M85 and M95 - inoculated with yogurt culture + Lb. helveticus (:), and heated at 85 C and 95 C, respectively; H85 and H95: inoculated with Lb. helveticus, and heated at 85 C and 95 C, respectively Table 3. Sensorial values detected in Cokelek cheeses (points) Tablo 3.Çökelek peynirlerinde saptanan duyusal değerler (puan) Sample First Day Appearance** Odour* Texture* Flavour** Total* Y95:C 6.70±0.44 ab 6.7± ± ±0.78 ab 25.53±2.75 Y ±0.9 ab 6.36± ± ±0.78 ab 26.3±3.43 M ±0.47 ab 6.33± ± ±0.70 a 26.3±2.66 M ±0.70 ab 6.33± ± ±0.57 ab 25.90±2.55 H95 6.0±0.7 b 6.7± ± ±0.7 ab 24.40±0.26 H ±0.47 ab 6.27± ± ±0.37 ab 25.47± th Day Y95:C 7.07±0.5 a 6.60± ± ±0.46 a 26.40±2.25 Y ±0.34 ab 6.7± ± ±0.68 ab 25.60±2.6 M ±0.49 ab 6.3± ± ±0.57 ab 24.40±2.52 M ±0.60 ab 5.90± ± ±0.98 ab 23.67±3.30 H ±0.42 ab 6.30± ± ±0.38 b 24.50±0.75 H ±0.06 ab 6.30± ± ±0.87 ab 24.76±0.7 * Statistically not significant different P>0.05, ** statistically significant different P<0.05 C - Control, Y85 and Y95 - inoculated with yogurt culture, and heated at 85 C and 95 C, respectively; M85 and M95 - inoculated with yogurt culture + Lb. helveticus (:), and heated at 85 C and 95 C, respectively; H85 and H95: inoculated with Lb. helveticus, and heated at 85 C and 95 C, respectively

22 82 Effects of Starter Culture... During 45 days of ripening period, TUFA contents of the all groups increased. The sensory evaluation scores give to the treatment groups are shown in Table 3. We did not analysed sensory evaluation of the samples after 5 th days, because of bad taste and odour. In control group, the mean values given for appearance, odours, and flavours were the highest at the 5 th day. In addition, total sensory score of the samples made with yogurt culture in heating at 95 C was the highest (5 th days). Panelists preferred traditional Çökelek cheese produced from yogurt cultures. Statistical difference was found to be important for appearance and flavours during storage (P<0.05). Total sensory score of the control group was higher than the others, but the difference is not statistically significant between the samples. DISCUSSION The properties of raw goat milk were suitable for yogurt production. Cheese yield is of basic importance to cheese manufacturers as small differences in yield translate to large sums of money or profit. Kalantzopoulos 23 stated that the yield capacity of fresh cheese was related to the protein and fat contents of goat milk. Our study is the first research on the Çökelek cheese produced with starter cultures Therefore, the Çökelek cheeses produced in the study were compared to results of Çökelek cheese produced by different ways in previous very few study. The ph, TA%, TS%, NaCl%, TN% were relatively higher than the findings reported by some researchers Our results compared with the literature, different results were obtained. The reason for this difference, Çökelek cheeses raw material and/or production methods may be different. Lactococci and lactobacilli counts were lower than those reported by some researchers 24,25. The microbioligal quality of Çökelek cheese, which is sold without packaging in Diyarbakır (in Turkey), an average of total microorganism 8.49±0.79 log cfu g -, heterofermentative lactic acid bacteria 8.58±0.98 log cfu g - were determined 28. Discrepancy in the results could be due to the variations in production methods of Çökelek cheeses (especially due to the heating process at high temperature like 95 C in this study). Lipolysis plays an essential role in the sensory properties of cheese; some free fatty acids (FFAs) have been shown to contribute directly to the aroma characteristics of many types of cheese, or indirectly as precursors of aroma components 29. The fatty acids hexanoic, octanoic and decanoic acids have long been considered responsible for the characteristic aroma of goat cheeses, giving rise to the popular terms caproic, caprilic and capric acids. Additionally, certain branchedchain FFAs contribute, by themselves, to the goaty flavour of cheese Consistent with the results of the previous studies, Myristic (C4:0), palmitic (C6:0), stearic (C8:0) and oleic (C8:) acids were the main fatty acids present in the Çökelek cheeses 33,34. Palmitic and myristic acid are considered hypercholesterolemic, oleic acid and stearic acid are considered hypocholesterolemic 33. The findings of this study show similarity with recorded by Kondyli and Katsiari 35, and Dönmez 36. But the degree of lipolysis undergone by the sample cheeses here was comparatively low, as might be expected, since ripening tends to be relatively short. The results showed that Lb. helveticus (single or mixture) could be used as starter culture in Çökelek cheese made from goat milk; it did not produce very different results from the other samples. The yield and some physicochemical properties of the Çökelek cheese samples heated at 95 C were better than those of the samples heated at 85 C. However, it was found that the sensorial score, ripening index and lactic acid bacteria counts of the samples heated at 85 C were higher than those of the others. So, the heating of yogurt at 85 C may be preferred to another heating temperature. As a conclusion, both Lb. helveticus and yogurt cultures may be proposed as a starter culture (a single and mix) for Çökelek cheese production. Acknowledgements I am grateful to the Chair of Scientific Research Projects of Suleyman Demirel University for their financial support (Project number: 966, 2004). REFERENCES. Ereifej KI: Characteristics of milk, cheddar-like and white cheese obtained from three goat phenotypes during three lactation periods. Int J Food Prop, 9, 803-8, Yamani MI, Ibrahim SA: The differential enumeration of Lactobacillus delbrueckii subspecies bulgaricus and Streptococcus salivarius subspecies thermophilus in yoghurt and labneh using an improved whey medium. J Society Dairy Tech, 49, 03-08, Auffray Y, Lecesne E, Hartke A, Boutibonnes P: Basic features of the Streptococcus thermophilus heat shock response. Current Microbiology, 30 (2): 87-9, Gouesbet G, Jan G, Boyaval P: Lactobacillus delbrueckii ssp. bulgaricus thermotolerance. Lait, 8, , Di Cagno R, De Angelis M, Limitone A, Fox PF, Gobbetti M: Response of Lactobacillus helveticus PR4 to heat stress during propagation in cheese whey with a gradient of decreasing temperatures. Applied and Environmental Microbiology, 72 (7): , Hynes ER, Bergamini CV, Suarez VB, Zalazar CA: Proteolysis on Reggianito Argentino cheeses manufactured with natural whey cultures and selected strains of Lactobacillus helveticus. J Dairy Sci, 86, , Leblanc JG, Matar C, Valdéz JC, Leblanc J, Perdigon G: Immunomodulating effects of peptidic fractions issued from milk fermented with Lactobacillus helveticus. J Dairy Sci, 85, , Lombardi A, Maistro LD, De Dea P, Gatti M, Giraffa G, Neviani EA: Polyphasic approach to highlight genotypic and phenotypic diversities of Lactobacillus helveticus strains isolated from dairy starter cultures and

23 83 ŞİMŞEK, SAĞDIÇ cheeses. J Dairy Res, 69, 39-49, Perotti MC, Bernal SM, Meinardi CA, Zalazar CA: Free fatty acid profiles of Reggianito Argentino cheese produced with different starters. Int Dairy J, 5, 50-55, Fox PF, Law J, Mc Sweeney PLH, Wallace J: Biochemistry of Cheese Ripening. In, Fox PF (Ed): Cheese: Chemistry, Physics and Microbiology. Vol., General Aspects, pp , Chapman & Hall, London, Van Boekel MAJS: Heat-induced deamination, dephosphorylation and breakdown of caseinate. Int Dairy J, 9, , Flint S, Brooks J, Bremer P, Walker K, Hausman E: The resistance to heat of thermo-resistant streptococci attached to stainless steel in the presence of milk. J Ind Microbiol Biotechnol, 28 (3): 34-36, Tamime AY, Robinson RK: Yoghurt: Science and Technology. London : Pergamon Press, 600, ISBN , AOAC: Official Methods of Analysis of the Association of Official Chemists. Acidity of Milk AOAC Official Method , Chapter 33, 7 th ed., 7, USA, AOAC: Official Methods of Analysis of the Association of Official Chemists. Solids in Milk AOAC Official Method , Chapter 33, 7 th ed., 33, USA, James CS: Analytical Chemistry Of Foods. Oxford: Chapman & Hall, 78, London. ISBN , AOAC: Official Methods of Analysis of the Association of Official Chemists. Solids in Milk, AOAC Official Method , Chapter 33, 7 th ed., 70, USA, 2000c 8. Gripon JC, Desmazeaud MJ, Et Le Beas D, Bergere JH: Role des micro-organsmes et des enzymes du cours de la maturation. Le Lait, 55, , Marquard R: Qualitatsanalytik im dienste der olpflanzenzuchtung. Fat Sci Technol, 89, 95-99, De Man JC, Rogosa M, Sharpe ME: Medium for the cultivation of lactobacilli. J Appl Bacteriol, 23, 30-38, Terzaghi BE, Sandine WE: Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol, 29, , Yurdakul S: Degisik ph ve sicakliklarinda islenen lor peynirinin bazı nitelikleri uzerinde arastirmalar. MSc Thesis. Ankara Univ, Fen Bil Enst, Kalantzopoulos GC: Cheeses From Ewes And Goats Milk. In, Fox PF (Ed): Cheese: Chemistry, Physics and Microbiology: Major Cheese Groups. Vol. 2, 2 nd ed., pp , Chapman & Hall, New York, Ağaoğlu S, Ocak E, Mengel Z: Van ve yöresinde üretilen çökeleklerin mikrobiyolojik, kimyasal, fiziksel ve duyusal nitelikleri üzerinde bir araştırma. Ankara Üniv Vet Fak Derg, 44, 7-2, Öksüztepe GA, Patir B, Dikici A, Bozkurt OP, Calicioglu M: Microbiological and chemical quality of çökelek marketed in Elazig. Firat Univ Saglık Bilim Derg, 2, 27-3, Tarakcı Z, Yurt B, Kucukoner E: Darende Dumas cokeleginin yapilisi ve bazi ozellikleri uzerine bir arastirma. Gıda, 28, , Küçüköner E, Tarakçı Z: Van ve yöresinde üretilen cacığın (otlu çökelek) bazı özelliklerinin araştırılması. 5. Geleneksel Süt Ürünleri Sempozyumu, 2-22-Mayıs, Tekirdağ, Tekirdağ, s.75-84, Önganer AN, Kırbağ S: Diyarbakır da taze olarak tüketilen çökelek peynirlerinin mikrobiyolojik kalitesi. Erciyes Üniv Fen Bil Enst Derg, 25 (-2): 24-33, Forss DA: Review of the progress of dairy science: Mechanisms of formation of aroma compounds in milk products. J Dairy Res, 46, , Poveda JM, Cabezas L: Free fatty acid composition of regionallyproduced Spanish goat cheese and relationship with sensory characteristics. Food Chemistry, 95, 307-3, Le Quere JL, Pierre A, Riaublanc A, Demaizieres D: Characterization of aroma compounds in the volatile fraction of soft goat cheese during ripening. Le Lait, 78, , Rahmat A, Richter R: Formation of volatile free fatty acids during ripening of Cheddar-like goat cheese. J Dairy Sci, 79, , Salter AM: The influence of trans fatty acids on health. Clin Sci, 88, , Perotti MC, Bernal SM, Meinardi CA, Candioti MC, Zalazar, CA: Substitution of natural whey starter by mixed strains of Lactobacillus helveticus in the production of Reggianito Argentino Cheese. Int J Dairy Technol, 57, 45-5, Kondyli E, Katsiary MC: Fatty acid Composition of raw caprine milk of a native Greek breed during lactation. Int J Dairy Technol, 55, 57-60, Dönmez M, Seçkin AK, Sağdiç O, Şimşek B: Chemical characteristics, fatty acid compositions, conjugated linoleic acid contents and cholesterol levels of some traditional Turkish cheeses. Int J Food Sci Nut, 56, 57-63, 2005.

24 Kafkas Univ Vet Fak Derg 8 (2): 85-89, 202 DOI:0.9775/kvfd RESEARCH ARTICLE Tıbbi Bitki Özütlerinin Melek Balığı (Pterophyllum scalare) Yumurtasının Açılımı Üzerine Etkisi Sevdan YILMAZ * Sebahattin ERGÜN * * Çanakkale Onsekiz Mart Üniversitesi, Su Ürünleri Fakültesi, Yetiştiricilik Bölümü, TR-700 Çanakkale, TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada, bazı kimyasallar ve tıbi bitki özütlerinin melek balığı (Pterophyllum scalare) yumurta açılımı ve sudaki bakteri yükü üzerine etkisi incelenmiştir. Bu amaçla metilen mavisi 0.5 ppm ve potasyum permanganat 0.2 ve 0.4 ppm uygulanmıştır. Biberiye, civanperçemi ve sumak özütlerinin herbiri ise.000, ve ppm olarak uygulanmıştır. Metilen mavisi 0.5 ppm, potasyum permanganat 0.2 ppm, biberiye.000, 5.000, ve ppm ve civanperçemi ppm uygulamaları sudaki bakteri yükünü azaltmış ve yumurta açılımını önemli oranda arttırmıştır (P<0.05). Biberiye özütünün konsantrasyonu arttıkça bakteri yükü azalmış ve yumurta açılımı artmıştır. Tüm sumak uygulamaları bakteri yükünü azaltmış, ancak yumurta açılımınını olumsuz etkilemiştir. Elde edilen bulgular yumurta açılımı için en uygun tıbbi bitki özütünün biberiye olduğunu göstermiştir. Sonuç olarak bu çalışmada biberiye özütünün sentetitik kimyasallar yerine kullanımının daha uygun ve melek balığı yumurta açılımı için optimum biberiye özüt dozajının.000 ppm olduğu bulunmuştur. Anahtar sözcükler: Pterophyllum scalare, Yumurta açılımı, Metilen mavisi, Potasyum permanganat, Biberiye, Sumak, Civanperçemi Effects of Medicinal Herb Extracts on Egg Hatching of the Angel Fish (Pterophyllum scalare) Summary In this study, the effects of sythetic chemicals and medicinal herbs on the amount of bacteria in egg water and egg hatching of the angel fish (Pterophyllum scalare) were investigated. In this goal, methylene blue exposed to 0.5 ppm and potassium permanganate exposed to 0.2 and 0.4 ppm. Each rosemary, yarrow and sumac extracts exposed to.000, and ppm. Methylene blue (0.5 ppm), potassium permanganate (0.2 ppm), rosemary (.000, 5.000, and ppm) and yarrow (5.000 ppm) treatments were significantly decreased bacterial loads and increased egg hatching (P<0.05). With the increasing in the concentration of rosemary extract the bacterial loads decreased and egg hatching increased. All sumac treatments were significantly decreased total bacterial loads, but were negatively affected on egg hatching. The findings were shown that the best group was rosemary for egg hatching. Finally, this study showed that rosemary extract was more suitable to use instead of sythetic chemicals, and optimum rosemary extract dose was.000 ppm for the hatching of the angel fish eggs. Keywords: Pterophyllum scalare, Egg hatching, Methylene blue, Potassium permanganate, Rosemary, Sumac, Yarrow GİRİŞ Yetiştiriciliği yapılan balık türlerinde yumurta açılımının yüksek olması hedeflenmektedir. Bu amaçla ekonomik öneme sahip birçok balık türünde metilen mavisi, potasyum permanganat, hidrojen peroksit, formalin, bakır sülfat, glutaraldehit ve iyot gibi kimyasallar kullanılmıştır -3. Melek balıkları da ilk kez 909 yılında üretilmiş olup ticari ve hobi amaçlı olarak 50 yıldır üretilmektedir 4. Bu balıkların yetiştiriciliğinde en büyük sorunlardan biri yumurta açılımının bakteri ve mantar enfeksiyonları nedeniyle düşük olmasıdır. Melek balıklarının döllenmemiş veya mantarlaşan yumurtaları doğada anaç balıklar tarafından toplanmaktadır 5. Ancak, ticari olarak düşünüldüğünde bu durum mümkün gözükmemektedir. Bunun nedeni ) anaç balıkların yumurtaları ile aynı ortamda bırakıldıklarında yumurtaları İletişim (Correspondence) /589 sevdanyilmaz@comu.edu.tr

25 86 Tıbbi Bitki Özütlerinin... yemeleri, 2) yumurtalara ve devamında larvalara baktıkları dönemde daha az beslenmeleri ve bundan dolayı tekrardan yumurta üretimlerinin gecikebilmesi, 3) yumurtaların üreme ortamında bırakıldığında daha düşük açılım göstermeleridir. Genel olarak melek balıklarının yetiştiriciliğinde yumurtaların bulunduğu zemin üretim ortamından alınıp çeşitli kimyasallar ile yumurta açılım oranı arttırılmaktadır. Bu amaçla melek balığı yumurtalarında metilen mavisi, hidrojen peroksit, acriflavin ve chloramine-t önceki çalışmalarda kullanılmıştır 6,7. Günümüzde ise sentetik kimyasalların kullanımı yerine alternatif doğal kaynaklara yönelik çalışmalar hız kazanmıştır. Balık yetiştiriciliğinde de hormon, antibiyotik, vitamin ve diğer birçok kimyasala alternatif olarak tıbbi bitkilerin kullanılabilirliği araştırılmaktadır 8. Fakat balık yumurtalarında bitki özütlerinin kullanımına yönelik çalışma sayısı oldukça azdır. Daha önce kekik, ateş çiçeği, okaliptüs ve nane bitkilerinin esans yağı karışımları; alabalık 9 ve hint bademi özütü; tilapia 0 balıklarının yumurta açılımının artırılmasında ve mantar enfeksiyonlarının önlenmesinde kullanılmıştır. Ancak biberiye, civanperçemi ve sumak bitkilerinin melek balıklarının yumurta açılımına etkisi üzerine herhangi bir çalışmaya rastlanılmamıştır. Bu çalışmada potasyum permanganat, metilen mavisi, biberiye, civanperçemi ve sumak özütlerinin melek balığı yumurtalarının açılım oranına ve bakteri yükü üzerine etkilerinin tespit edilmesi amaçlanmıştır. MATERYAL ve METOT Balık, Yumurta ve Deneme Ortamı Çalışmada Tri Colour varyetesi melek anaçlarından (Pterophyllum scalare) elde edilen yumurtalar kullanılmıştır. Yumurta açılımı ve yumurta kalitesi üzerindeki fiziksel, kimyasal, mikrobiyolojik su koşulları, yem ve anaç balık gibi birçok parametrenin etkisinin en aza indirilmesi amacıyla aynı partinin yumurtalarında deneme yürütülmüştür. Kullanılan anaç balıklar ve yumurtalar 26± C, 400 μs iletkenlik, 6.7 ph suda ve 2 saat aydınlık, 2 saat karanlık ışık periyodunda tutulmuşlardır. Balıklar günde 2 defa Tetramin Flake Food (Tetra Germany) marka ticari yemle beslenmişlerdir. Balıkların bulunduğu akvaryum sisteminde günlük %0 su değişimi yapılmıştır. Balıklar 45 açılı yatay bir zemine yumurtladıktan saat sonra yumurtaları nazikçe sifonlanmıştır. Yumurtaların sifonlanmasından sonra oluşabilecek olası hasarın tespit edilmesi için bir pipet yardımıyla ışığa tutulan yumurtaların opaklaşmayan, döllenmiş ve hasarsız olanları seçilmiştir. Sağlıklı yumurtalar içerisinden 390 tanesi tesadüfen 3 tekerrürlü olarak, her biri 0.5 litrelik olan 39 adet silindire konik deneme ortamlarına yerleştirilmişlerdir. Deneme boyunca yumurtaların havalandırılması hava matoru yardımıyla yapılmış ve hava hortumuna takılan cam pisetler kullanılmıştır. Melek yumur- taları su değişimine hassas olduklarından dolayı bulundukları deneme ortamında su değişimi yapılmamıştır. Bitki Özütlerinin Çıkarılması Çalışmada kullanılan biberiye (Rosmarinus officinalis); Çanakkale, sumak (Rhus coriaria); Edirne ve civanperçemi (Achillea millefolium); Roiak (Kuzey Doğu Bulgaristan) dan toplanmıştır. Kurutulup öğütülen bitkilerin özütleri sulu özüt çıkartma metodu modifiye edilerek elde edilmiştir. Bitkiler 5 g tartılıp 95 ml saf suda saat süreyle oda sıcaklığında muhafaza edildikten sonra 0 dakika 50 C de bekletilip 2 dakika boyunca vortex ile karıştırılmışlardır. Bu karışımlar 0.45 mikronluk filtreden geçirilerek özütler elde edilmiştir. Sentetik Kimyasalların ve Özütlerin Uygulanması Yumurtalar deneme ortamına yerleştirildikten sonra sentetik kimyasallar ve doğal özütler bir defa olacak şekilde ilave edilmiştir. Yumurtalar açılıncaya kadar deneme ortamında yumurtalara uygulanmışlardır. Kontrol grubu (K) suyuna hiçbir uygulama yapılmamıştır. Metilen mavisi daha önce melek balıklarında yapılan bir çalışma referans alınarak ppm (M5), potasyum permanganat 0.2 ppm (P2) ve 0.4 ppm (P4), biberiye (B, B5, B0), sumak (S, S5 ve S0) ve civanperçemi (C, C5, C0) özütleri yumurtaların bulunduğu suya sırasıyla.000 ppm, ppm, ppm olacak şekilde uygulanmışlardır. Yumurta Açılımı Melek balığı yumurtaları 3. günün sonunda açılmıştır. Zeminde sağlıklı bir şekilde hareket eden besin keseli larvaların, açılmamış yumurtaların ve ölü larvaların sayımları yapılarak her bir grup için yüzde açılım oranları formül yardımıyla hesaplanmıştır 2. Mikrobiyal Yükün Tespit Edilmesi Yumurtaların açıldığı 3. günün sonunda her bir grubun mikrobiyal yükünü tespit etmek için alınan su örnekleri gerekli seyreltmeler (0-5 ve0-6 ) yapıldıktan sonra 3 gün Tryptic Soy Agar (TSA) ortamında 3 26± C derecede inkübe edilmiştir. Bakteri yükünün tespitinde aşağıdaki formül kullanılmıştır. -X (seyretme miktarı) cfu /ml = Katı besiyerindeki koloni miktarı 0 İstatistiksel Analizler İstatistiksel analizler için SPSS 7 paket programı kullanılmıştır. Yüzde açılım verilerine arcsin dönüşümü uygulandıktan sonra varyans analizi yapılmış ve ortalamalar Tukey testi ve açılımı değiştirme oranları Dunnett t-testi ile %5 önem düzeyinde karşılaştırılmıştır 3. BULGULAR Çalışmada farklı deneme ortamlarının kontrol grubuna

26 87 YILMAZ, ERGÜN göre yumurta açılımı üzerine arttırıcı veya azaltıcı etkileri (Tablo ) ve melek balığı yumurta açılım oranları (Şekil ) tespit edilmiştir. Kontrol grubunda açılım 50% bulunurken bu oranı M5: %20, P2: %23.33, B: %20, B5: %26.67, B0: %30 ve C5: %6.67 arttırmıştır (P<0.05). C (-%8.33), C0 (%3.33) ve S (-%3.33) grupları kontrol grubuyla benzer bulunmuştur (P>0.05). P4 (-%33.33), S5 (-%30) ve S0 (-%50) grupları ise yumurta açılımını azaltmıştır (P<0.05). Çalışmada toplam bakteri en fazla kontrol grubunda tespit edilmiştir (Şekil 2). M5, P2 ve P4 grupları bakteri miktarını azaltmıştır (P<0.05). Bitki özütlerinden biberiye, civanperçemi ve sumak uygulamalarının tamamı bakteri yükünü azaltmıştır (P<0.05). B5, B0, C5 ve C0 grupları bakteri miktarı üzerinde birbirleriyle benzer etki göstermiştir (P>0.05). TARTIŞMA ve SONUÇ Bu çalışmada melek balığı yumurtalarının bulunduğu ortama ilave edilen bitki özütlerinin ve sentetik kimyasalların bakteri yükü ve yumurta açılımı üzerinde etkili oldukları tespit edilmiştir. Sentetik kimyasallardan metilen mavisinin melek balığı yumurtalarında açılım oranını önemli miktarda arttırdığı (Şekil ) ve bakteri yükünü azalttığı (Şekil 2) bulunmuştur. Benzer olarak melek balıklarında 0, 0.5, 2.5 ve 5 ppm metilen mavisi uygulamaları arasında en yüksek açılımı 0.5 ppm sağlamış (%63.3), ancak gruplar arasında fark tespit edilememiştir 6. Melek balıklarında yapılan başka bir çalışmada ise metilen mavisi, hidrojen peroksit, acriflavin ve chloramine-t uygulamaları yumurta açılımına etki etmemiştir 7. Melek balıklarında yapılan çalışmalarda kimyasal Table. Changing hatching rates of the treatment groups Tablo. Deneme gruplarının açılımı değiştirme oranları Deneme Grupları Konsantrasyon (ppm) Açılımı Değiştirme Oranı (%) P Kontrol Metilen Mavisi * P. permanganat * * * Biberiye * * Civanperçemi * Sumak * * * Dunett t-testi sonuçlarına göre kontrol grubundan istatistiksel açıdan farklı olan grupları göstermektedir Açılım Oranı (%) de ab ab fg ab ab a K M5 P2 P4 B B5 B0 C C5 C0 S S5 S0 Gruplar Her bir deneme grubu ortalama ± standart hatayı temsil etmektedir (n=3) Farklı harfleri içeren gruplar arasındaki fark istatistiksel olarak önemlidir (P<0.05) de bc cd e f g Şekil. Deneme gruplarının yumurta açılımlarına etkisi Fig. The effects of treatment groups on egg hatching rates

27 88 Tıbbi Bitki Özütlerinin... Log N (cfu/ml) a b ef c cd de f g gh hi ghi i i Şekil 2. Deneme gruplarının yumurta suyundaki bakteri yüküne etksi Fig 2. The effects of treatment groups on bacterial loads in egg water K M5 P2 P4 B B5 B0 C C5 C0 S S5 S0 Gruplar Her bir deneme grubu ortalama ± standart hatayı temsil etmektedir (n=3) Farklı harfleri içeren gruplar arasındaki fark istatistiksel olarak önemlidir (P<0.05) uygulaması yapılmayan gruplarda dahi açılım oranının %4 ile %84 arasında değişim göstermesinin 7 nedeni, farklı partilerin yumurtalarının kullanılmasıyla açıklanabilir. Bu çalışmadaki melek balıklarında aynı parti yumurtaların kullanılması daha standart veriler elde edilmesini sağlamış olabilir. Melek balıklarında potasyum permanganatın (P2), metilen mavisine (M5) benzer olarak yumurta açılımını arttırdığı (Şekil ), ancak bakteri yükünü daha düşük oranda azalttığı (Şekil 2) tespit edilmiştir. Melek balığı yumurtalarının açılımı potasyum permanganatın 0.2 ppm uygulamasında %23.33 artmıştır (Tablo ). Afrika kedibalığı (Clarias gariepinus) nda yapılan farklı bir çalışmada ise potasyum permanganat 2 ppm dozunda yumurta açılımını %37.8 den %85.6 a çıkarmıştır 4. Kedibalığında potasyum permanganat daha yüksek konsantrasyon da kullanılmakla birlikte uygulamalar kısa süreli banyolar şeklinde yapılmıştır. Bu çalışmada ise potasyum permanganat düşük dozda uzun süre (3 gün) uygulanmış ve benzer olarak yumurta açılımının artmasını sağlamıştır. Ancak, artan oranda yumurta açılımını yaklaşık %33 oranında azaltmıştır (Tablo ). Bunun nedeni yüksek oranda potasyum permanganatın yumurtalarda öldürücü etki yapmasıyla açıklanabilir. Permanganatın farklı balık ve kabuklu türlerinin yumurta ve larvaları üzerinde öldürücü etkisi 5 bu sonucu desteklemektedir. Bu çalışmada suya uygulanan doğal ve sentetik ürünlerin antimikrobiyal etkileri sayesinde mikrobiyal yükü azalttığı düşünülmektedir. Ayrıca toplam bakteri miktarı bakımından kimyasal ve bitkisel kaynakların etkilerine bakıldığında tüm grupların bakteri miktarını azalttıkları bulunmuştur (Şekil 2). Ancak sumağın tüm dozajlarında yumurta açılımının daha az olduğu görülmektedir (Şekil ). Bunun nedeni sumağın potasyum permanganatta olduğu gibi yumurtalar üzerinde toksik etki göstermesiyle açıklanabilir. Benzer olarak farklı çalışmalarda kullanılan çeşitli sentetik kimyasalların kullanım konsantrasyonu arttıkça bakteri miktarı azalmış, ancak yumurta açılım oranı düşük bulunmuştur 7,6,7. Tıbbi bitkilerin sentetik kimyasallar gibi yüksek miktarda toksik etki göstermeleri içerdikleri komponentlerden kaynaklanabilir. Bu durumda yüksek miktarlarda uygulandıklarında yumurtaları öldürdükleri söylenebilir. Bu çalışmada deneme grupları arasında bakteri miktarının düşürülmesinde en etkili uygulamanın biberiye olduğu tespit edilmiştir. Melek balıklarında elde edilen bulgulara benzer olarak alabalıklarda enfekte yumurta miktarı farklı bitkilerin esans yağ karışımıyla azaltılmıştır 9. Yapılan çalışmalarda metilen mavisi 8, potasyum permanganat 9, biberiye 20, sumak ve civanperçeminin 2 antimikrobiyal ve antifungal etkileri bildirilmiştir. Bu etkileriyle sudaki bakteri yükünü azalttıkları ve dolayısıyla yumurta açılımınıda arttırdıkları düşünülmektedir. Benzer olarak çalışmalarda mikrobiyal yükün azalması yumurta açılımını arttırmıştır 3,6,22. Ancak bazı araştırmacılar mikrobiyal yük ile yumurta açılımının artması arasında önemli bir ilişki olmadığını bildirmemişlerdir 2,23,24. Elde edilen farklı sonuçlar yumurtalar üzerinde kullanılan kimyasalların dozajının uygun olmaması, mikrobiyal yük dışında çevresel faktörler, beçler arasındaki farklılıklar, yumurta kalitesindeki değişimler, mantar, virus, parazit gibi etkenler ve tümünün birlikte etkileriyle açıklanabilir. Çalışma sonunda biberiye özütünün.000 ppm, ppm ve ppm uygulamaları, yumurta açılımını benzer oranda arttırmıştır. Bu nedenle.000 ppm biberiye özütünün melek balıklarında kontrole göre yeterli yumurta açılımını sağladığı, potasyum permanganat ve metilen mavisi yerine kullanılabileceği sonucuna varılmıştır. İleriki çalışmalarda sumağın daha düşük dozları ve civanperçeminin ara dozları denenebilir. Teşekkür Çalışmada kullanılan kaynakların teminindeki katkılarından dolayı Sayın Dr. Özcan ÖZEN e teşekkürlerimizi sunarız. KAYNAKLAR. Wagner EJ, Arndt RE, Billman EJ, Forest A, Cavender W: Comparison of the efficacy of iodine, formalin, salt, and hydrogen peroxide for control

28 89 YILMAZ, ERGÜN of external bacteria on rainbow trout eggs. N Am J Aquacult, 70 (2): 8-27, Straus DL, Mitchell AJ, Radomski AA, Carter RR: Laboratory dose confirmation of copper sulfate for treating fungus on channel catfish eggs. N Am J Aquacult, 7 (4): , Can E, Saka Ş, Fırat K: Disinfection of gilthead sea bream (Sparus aurata), red porgy (Pagrus pagrus), and common dentex (Dentex dentex) eggs from sparidae with different disinfectants. Kafkas Univ Vet Fak Derg, 6 (2): , Yılmaz M, Mutaf BF, İkiz R: Melek Balıklarında (Pterophyllum scalare Lichtenstein, 823) birinci döl bireylerinde renk-desen açılımının izlenmesi ile ebeveyn genotiplerinin belirlenmesi. Turk J Fish Aquat Sci, 23 (-2): 73-76, Swann L: Reproduction of angelfish (Pterophyllum scalare). Illinois- Indiana Sea Grant Program Fact Sheet, Soyink, AS-489: 6 pp, Perlberg ST, Diamant A, Ofir R, Zilberg D: Characterization of swim bladder non-inflation (SBN) in angelfish, Pterophyllum scalare (Schultz), and the effect of exposure to methylene blue. J Fish Dis, 3 (3): , Sanabria C, Diamant A, Zilberg D: Effects of commonly used disinfectants and temperature on swim bladder non-inflation in freshwater angelfish, Pterophyllum scalare (Lichtenstein). Aquaculture, 292 (3-4): 58-65, Citarasu T: Herbal biomedicines: a new opportunity for aquaculture industry. Aquacult Int, 8 (3): , Mousavi SM, Mirzargar SS, Mousavi HEZ, Baigi RO, Khosravi A, Bahonar A, Ahmadi MR: Evaluation of antifungal activity of new combined essential oils in comparison with malachite green on hatching rate in rainbow trout (Oncorhynchus mykiss) eggs. Turk J Fish Aquat Sci, 4 (2): 03-0, Chitmanat C, Tongdonmuan K, Khanom P, Pachontis P, Nunsong W: Antiparasitic, antibacterial, and antifungal activities derived from a Terminalia catappa solution against some tilapia (Oreochromis niloticus) pathogens. Songklanakarin J Sci Technol, 27 (Suppl.): , Nasar-Abbas SM, Halkman AK: Antimicrobial effect of water extract of sumac (Rhus coriaria L.) on the growth of some food borne bacteria including pathogens. Int J Food Microbiol, 97 (): 63-69, Komar C, Turnbull JF, Roque A, Fajer E, Duncan NJ: Effect of water treatment and aeration on the percentage hatch of demersal, adhesive eggs of the bullseye puffer (Sphoeroides annulatus). Aquaculture, 229 (- 4): 47-58, Logan M: Single factor classification (ANOVA). In, Logan M (Ed): Biostatistical Design and Analysis Using r: A Practical Guide. st ed., pp , Wiley-Blackwell, London, Rasowo J, Okoth OE, Ngugi CC: Effects of formaldehyde, sodium chloride, potassium permanganate and hydrogen peroxide on hatch rate of African catfish Clarias gariepinus eggs. Aquaculture, 269 (-4): , Melendre PM, Celada JD, Carral JM, Sáez-Royuela M, Aguilera A: Effectiveness of antifungal treatments during artificial incubation of the signal crayfish eggs (Pacifastacus leniusculus Dana. Astacidae). Aquaculture, 257 (-4): , Treasurera JW, Cochrane E, Grant A: Surface disinfection of cod Gadus morhua and haddock Melanogrammus aeglefinus eggs with bronopol. Aquaculture, 250 (-2): 27-35, Mitchell AJ, Radomski AA, Straus DL, Carter R: The effect of hydrogen peroxide on the hatch rate and Saprolegnia spp. infestation of channel catfish eggs. N Am J Aquacult, 7 (3): , Peloi LS, Soares RRS, Biondo CEG, Souza VR, Hioka N, Kimura E: Photodynamic effect of light-emitting diode light on cell growth inhibition induced by methylene blue. J Biosciences, 33 (2): , Wakabayashi H: Effects of environmental conditions on the infectivity of Flexibacter columnaris to fish. J Fish Dis, 4(3): , Baratta MT, Dorman JD, Deans SG, Figueiredo AC, Barroso JG, Ruberto G: Antimicrobial and antioxidant properties of some commercial essential oils. Flavour Frag J, 3 (4): , Kokoska L, Polesny Z, Rada V, Nepovim A, Vanek T: Screening of some siberian medicinal plants for antimicrobial activity. J Ethnopharmacol, 82 (): 5-53, Holcomb M, Cloud JG Ingermann RL: Impact of bacteria on shortterm storage of salmonid eggs. Aquac Res, 36 (5): , Tendencia EA: Bacterial microbiota of eggs from cage-reared and tank-reared grouper, Epinephelus coioides. Bull Eur Ass Fish Pathol, 24 (3): 6-65, Miguez B, Combarro MP, Guisande C, Vergara AR Riveiro I: Effect of bacterial epiflora on egg hatching of the Atlantic sardine (Sardina pilchardus). FEMS Microbiol Ecol, 50 (2): -5, 2004.

29 Kafkas Univ Vet Fak Derg 8 (2): 9-96, 202 DOI:0.9775/kvfd RESEARCH ARTICLE Mitochondrial DNA D-loop and 2S Regions Analysis of the Long- Crowing Local Breed Denizli Fowl from Turkey Mesut KARAMAN * Nurside KIRDAG * * Kahramanmaras Sutcu Imam University, Agriculture Faculty, Animal Science Department, TR-4600 Kahramanmaras - TURKEY Makale Kodu (Article Code): KVFD Summary Aim of this study is to analyze the genetic structure of long-crowing Denizli chicken, a Turkish local fowl, using nucleotide sequences of the mitochondrial DNA 2S and D-loop regions. DNA isolation was carried out using feather samples of cocks of this local breed. D-loop and 2S regions were amplified using polymerase chain reaction technique and ca 230 bp and 950 pb PCR products were obtained respectively. Native genotype Denizli fowl s D-loop and 2S regions were sequenced and sequencing data were analyzed and compared with the related published data. Nucleotide content of the 2S region showed a 32% A, 9% T, 9% G and 30% C, whilst AT and GC ratios were found as 59.88% and 40.2% respectively for D-loop region. D-loop sequence data analysis clearly identified the Denizli fowl within the clade of long-crowing cocks. The results give the first informative data about the mitochondrial DNA D-loop and 2S regions of this local breed from Turkey. Keywords: 2S rdna, D-loop, Denizli fowl, Local breed, mt-dna Türkiye Uzun Ötüşlü Yerli Irkı Denizli Tavuğunun Mitokondriyal DNA D-loop ve 2S Bölgeleri Analizi Özet Çalışmanın amacını ülkemiz yerli tavuk ırklarından olan uzun ötüşlü Denizli tavuğunun mitokondriyal DNA 2S ve D-loop bölgelerinin gen dizi analizine göre genetik yapısının ortaya çıkarılması oluşturmaktadır. Bu amaçla DNA izolasyonu için Denizli horozlarından alınan tüy örnekleri kullanılmıştır. D-loop ve 2S bölgeleri polimeraz Zincir Reaksiyonu (PZR) ile amplifiye edilmiş ve sırasıyla 230 bç ve 950 bç uzunluğunda PZR ürünleri elde edilmiştir. D-loop ve 2S bölgelerinin gen dizi analizleri çıkarılmış ve daha önce yayınlanmış ilgili gen bölgeleriyle analize tabi tutulmuştur. 2S bölgesinin gen dizisi incelendiğinde %32A, %9T, %9G ve %30C olarak bulunmuştur. D-loop bölgesi için AT ve GC oranları ise sırasıyla %59.88 ve %40.2 olarak gözlemlenmiştir. D-loop bölgesi gen dizi analizi sonuçları Denizli ırkının uzun ötüşlü ırklar arasında yer aldığını açık olarak ortaya koymuştur. Sonuçlar bu lokal ırkın mitokondriyal DNA sı hakkında ilk informatif verileri ortaya koymuştur. Anahtar sözcükler: 2S rdna, D-loop, Denizli tavuğu, Lokal ırk, mt-dna INTRODUCTION Although most animal species were used and domesticated as work animals or as a food source, historical and archaeological findings strongly suggest that chicken was first functioned in religious ceremonials, decorative art or as entertainment. Domesticated fowl species are now widely distributed around the world and are bred in various categories for different purposes such as food source as egg type and meat type, decorative art as ornaments, fighting or game instrument. With regard to any role, human culture has had a strong influence on the domestication of chickens. Throughout history, however, chickens have been bred for various other purposes. Longcrowing chickens and fighting cocks are typical examples of chickens that have been bred for purposes rather than as human food or decorative ornament or adornment material, and are therefore excellent species for studying the relationship between selective breeding and human culture,2. Chickens have played an important role in the İletişim (Correspondence) GSM: karaman@ksu.edu.tr

30 92 Mitochondrial DNA D-loop and... development of human culture, particularly in Asian countries such as China, Thailand and Japan. Four species of Gallus have currently been reported as grey junglefowl (Gallus sonnerati), red junglefowl (Gallus gallus), ceylon junglefowl (Gallus lafayettei) and green junglefowl (Gallus varius), only Gallus gallus is suggested to be the main progenitor of all contemporary domesticated chicken breeds 3,4. This view is consistent with the discussion that the domestication and breeding of chickens was initiated with junglefowls, which then only inhabited Southeast Asian regions such as Indochina and South China 3,4. Exact location of domestication of Gallus gallus, however, is still remain controversial 5 since the findings of these researchers suggest that contemporary fowls have multiple origin in South Asia and Southeast Asia. Denizli chicken (Gallus gallus domesticus) is a local breed of Turkey and vast majority of them are habituated at Western Anatolia. Because of poor commercial performance they provide an excellent example of seriously threatened populations with immediate risk of extinctions, and therefore, Turkey has undertaken a conservation program operated by the Lalahan Livestock Central Research Institute and supported by Turkish Ministry of Agricultural and Rural Affairs since 997. The females of this breed are considered as layer type chicken breed although their egg production is about 0-20 eggs for 29 week laying period, whilst their cocks are famous for long-crowing 6. They can crow up to 20 seconds for -year-old and up to 24 seconds for 3-year-old mature cocks, and in some cases they could become unconscious following a long crowing session. There is no report (to our best knowledge) that Denizli chicken exists in nature, but semi-selectively bred by local people for their relatively robust body and longcrowing characters. One recent report by Kaya and Yildiz 7 about the estimation of genetic diversity by microsatellite markers seems the only study aiming the exploration of genetic structure of this local breed. Therefore, the origin, domestication story and pyhlogenetic relationship with other fowls in particular with long-crowing cocks of this local chicken remain unknown. This study aims to examine the mitochondrial DNA regions, D-loop and 2S, sequences of long-crowing Denizli chicken from the viewpoint of molecular phylogeny. The sequence data of the current study was also analyzed after combination with the earlier published data representing game cocks and long crowing cocks located in GenBank web site ( MATERIAL and METHODS Samples Feather samples of two pure bred cocks were obtained from the Denizli Provisional Directorate of Agriculture in where this bred is under conservation scheme. The feather samples were washed twice using 70 % EtOH and kept under aseptic conditions at -20 o C until required for DNA extraction. DNA Extraction Feather samples were cut by a sterile scissors into small pieces and treated using liquid nitrogen to disrupt the cells prior to DNA extraction. Phenol-chloroform based DNA isolation was performed according to Villalta et al. 8 (originally devised to extract fish tissue DNA) with the slight modification of the incubation time which was elongated to 48 h in extraction buffer at 55 o C. Extracted DNAs were either used freshly or kept in 00 ml of TE buffer [0 mm Tris-HCl (ph=8.0), mm EDTA] 9 at -20 for further studies. Primer Design for D-loop and 2S Regions Designing of forward and reverse primers for both D-loop and 2S mitochondrial regions were conducted using published mitochondrial DNA sequence data of Gallus gallus derived from the web server of National Center for Biotechnology Information ( nlm.nih.gov/). For amplification of the D-loop region forward 5 -TTA ACC TAA CTC CCC TAC TAA GTG TA-3 and reverse 5 -TCT TCC GTA AAA CAC AAA CC-3 primers were used, whilst forward 5 -GGT TTT TGC TAG ACA TAT ACA TGC-3 and reverse 5 -CAT CAG ATT CAC GTG GAA GGC -3 primers were designed for the amplification of 2S region. The designed primers for both mitochondrial D-loop and 2S regions were synthesized by a commercial company (Iontek, Istanbul-Turkey). PCR Amplification PCR amplification of the extracted DNAs was performed for 50 ml in size. Amplification primers were synthesized by a commercial company (Iontek, Istanbul), dntps and Hi-Fi Taq DNA polymerase were supplied by Favorgen (Favorgen Biotech Corp., Taiwan). The optimized denaturation, annealing and extension characteristics of PCR amplification steps for both regions are shown in Table. Following the amplification, all PCR products were run in % agarose gel and post stained using ethidium bromide solution 0.% (w/v) for 5min, and finally photographed with the aid of a digital camera (Canon Powershot S3 IS, Japan) under 32nm wavelength ultra violet (UV) translimunator light (UVP, UK). The PCR products were purified using PCR clean up kit (Favorgen Biotech Corp., Taiwan) according to manufacture s instruction prior to sequencing process. Sequencing Procedure and Data Analysis Sequencing process was performed by a commercial company (Iontek, Istanbul-Turkey) as direct sequencing from purified PCR products. Sequencing process for D-loop and 2S region were conducted in both forward

31 93 KARAMAN, KIRDAG and reverse directions and all sequence data were edited using Bioedit 7.0 ( bioedit.html) and FinchTV Version.4.0 ( geospiza.com/finchtv) following naked eye checking. The sequence data produced were aligned to earlier reported Gallus gallus sequence data using CLUSTAL X program 0 with default parameters. The bootstrap analysis of 000 replications was performed to assess the statistical confidence of the phylogenetic trees which were constructed by the neighbor joining method. Conversion of the data format and DNA polymophism analysis were carried out with the aid of DNaSP RESULTS PCR Amplification and Nucleotide Ratios of D-loop and 2S Regions A partial PCR amplification of the D-loop region of the Denizli fowl yielded a ca 20bp PCR product (Fig. ) and 094 bp of that fragment was successfully sequenced and analyzed. The sequence data of D-loop region of Denizli cock was submitted to the GenBank ( nih.gov) and located there with the accession number of EU Nucleotide ratios of the D-loop region were calculated as 26% A, 34% T, 4% G and 26% C. Relatively higher AT ratio compare to GC content for this region was observed, and ratios for these data were found as 59.8% and 40.2% respectively. For 2S region, newly designed primers amplified a ca 950bp PCR fragment (Fig b) and 872bp length of this product was successfully sequenced and analyzed. The sequence data of 2S region of Denizli fowl is deposited on the GenBank web site with the accession number of FJ60338 ( The nucleotide content of the sequenced data was calculated as 32% A, 9% T, 9% G and 30% C. Balanced AT and GC ratios were observed for 2S region since these values were found as 5.8% and 48.2% respectively. Table. The optimized polymerase chain reaction amplification characteristics of mitochondrial D-loop and 2S regions Tablo. Mitokondriyal DNA D-loop ve 2S bölgeleri için Polimeraz Zincir Reaksiyonu optimizasyonu PCR Steps D-loop 2S Initial Denaturation 94ºC 4 min Denaturation 94ºC min 94ºC min 55ºC 30 sec 55ºC 30 sec Annealing 35 cycle 63ºC 30 sec 58ºC 30 sec Extension 72ºC 2 min 72ºC 2 min 35 cycle M D-loop M 2S 20bp 950bp Fig. Polymerase chain reaction amplification of the D-loop (a) and 2S (b) regions yielded a ca20bp and 950bp PCR products respectively. M: kb ladder from Favorgen Biotech. corp. (Taiwan) Şekil. Polimeraz zincir reaksiyonu (PZR) amplifikasyonu D-loop (a) için ca 20bç 2S bölgesi (b) için ca950 bç PZR ürünü ortaya koymuştur. M: kb merdiven, Favorgen Biotech. corp. (Taiwan) a b 2 3 Fig. Polymerase chain reaction amplification of the D-loop (a) and 2S (b) regions yielded a ca20bp and 950bp PCR products respectively. M: kb ladder from Favorgen Biotech.

32 94 Mitochondrial DNA D-loop and... Phylogenetic Trees According to Sequence Data of D-loop and 2S Regions An unrooted tree was generated using the nucleotide sequence of D-loop region of mitochondrial DNA obtained from 30 samples of fighting, long-crowing and Denizli cocks. The unrooted Upgma tree of 30 samples revealed three divergent clades designated as A, B and C (Fig. 2). The haplotypes located in clades A and B represent the game-cocks, while clade C composed of long-crowing cocks and Denizli cock. Although Denizli cock shared the same clade with long-crowing cocks, a finer analysis showed that the sequence data of this Turkish local breed was differed from the remaining part of the clade by at least 7 single nucleotide mutations (see FJ Denizli fowls 2S region accession number). The sequencing data of mitochondrial 2S region was analyzed for phylogenetic purposes too (Fig. 3). To obtain a better alignment with the earlier reported data in GenBank, first 6 bases (GGAGGA) were excluded from the submitted 2S sequence of the Denizli fowl (Accession no: FJ60338). A rooted tree, for 2S region, was generated using the sequence data of local breed Denizli chicken and 8 published data belong to Gallus gallus derived from GenBank web site. As seen in Fig. 3, 2S region of the Denizli chicken is quite similar to those various subspecies of Gallus gallus. Less than % differences was observed among the studied 2S regions of 8 fowls. Further, genetic structure of 2S region of Denizli fowl was identical to the White Leghorn (Gallus gallus). Clade A Fighting cocks Clade B Long crowing cocks Clade C Fig 2. Unrooted phylogenetic tree of fighting and long-crowing cocks including Denizli local bred derived from mitochondrial D-loop region. Numbers of the samples and representing GenBank accession numbers are as follow; (AB098699); 2 (AB098698); 3 (AB098697); 4 (AB098695); 5 (AB098694); 6 (AB098693); 7 (AB098692); 8 (AB098686); 9 (AB098660); 0 (AB09865); (AB098649); 2 (AB098647); 3 (AB098644); 4 (AB098637); 5 (AB098662); Fig 2. Unrooted phylogenetic tree of fighting and long-crowing cocks including Denizli local bred derived from mitochondrial D-loop region. Numbers of the samples and representing GenBank accession numbers are as follow; (AB098699); 2 (AB098698); 3 (AB098697); 4 (AB098695); 5 (AB098694); 6 (AB098693); 7 (AB098692); 8 (AB098686); 9 (AB098660); 0 (AB09865); (AB098649); 2 (AB098647); 3 (AB098644); 4 (AB098637); 5 (AB098662); 6 (AB098654); 7 (AB098653); 8 (AB098646); 9 (AB098639); 20 (AB098638); 2 (AB4065); 22 (AB4064); 23 (AB4063); 24 (AB4062); 25 6 (AB098654); 7 (AB098653); 8 (AB098646); 9 (AB098639); 20 (AB098638); 2 (AB4065); 22 (AB4064); 23 (AB4063); 24 (AB4062); 25 (AB4059); 26 (AB4058); 27 (AB4066); 28 (AB4060); Denizli (EU94446) Şekil 2. Dövüşcü ve Denizli ırkınında içerisinde yer aldığı uzun ötüşlü ırkların mitokondriyal DNA D-loop bölgelerine göre oluşturulmuş köksüz filogenetik yapı. İlgili GenBank ulaşım numaraları ise şu şekildedir; (AB098699); 2 (AB098698); 3 (AB098697); 4 (AB098695); 5 (AB098694); 6 (AB098693); 7 (AB098692); 8 (AB098686); 9 (AB098660); 0 (AB09865); (AB098649); 2 (AB098647); 3 (AB098644); 4 (AB098637); 5 (AB098662); 6 (AB098654); 7 (AB098653); 8 (AB098646); 9 (AB098639); 20 (AB098638); 2 (AB4065); 22 (AB4064); 23 (AB4063); 24 (AB4062); 25 (AB4059); 26 (AB4058); 27 (AB4066); 28 (AB4060); Denizli (EU94446)

33 95 KARAMAN, KIRDAG Denizli Fig 3. A rooted phylogenetic tree is generated using Denizli fowl and 8 Gallus gallus samples derived from the 2S rdna sequence data reported in GenBank web server. The sample numbers representing GenBank accession numbers used to obtain the phylogenetic tree were as follow; (DQ648776), 2 (AP003323), 3 (AP003322), 4 (AP00339), 5 (AP00338), 6 (AP003580), 7 (AY23557), 8 (AP00337), 9 (X52392), 0 (AB08602), (AY235570), 2 (AP00332), 3 (EF373905), 4 (EF373873), 5 (DQ88556), 6 (AJ490505), 7 (AJ583547), 8 (AY309497), Denizli (FJ60338) Şekil 3. GenBank tan alınmış 8 Gallus gallus örneği ve Denizli ırkına ait 2S rdna bölgesi gen dizisine gore oluşturulmuş köklü filogenetik yapı. İlgili GenBank ulaşım numaraları ise şu şekildedir; (DQ648776), 2 (AP003323), 3 (AP003322), 4 (AP00339), 5 (AP00338), 6 (AP003580), 7 (AY23557), 8 (AP00337), 9 (X52392), 0 (AB08602), (AY235570), 2 (AP00332), 3 (EF373905), 4 (EF373873), 5 (DQ88556), 6 (AJ490505), 7 (AJ583547), 8 (AY309497), Denizli (FJ60338) DISCUSSION Domesticated fowls are widely distributed throughout the world and recent archaeological studies strongly suggest that their domestication has originated in China nearly years ago 2. Domesticated chickens are currently bred for various purposes, not only because of their usefulness for human nutrition but also for their long crowing, outstanding characteristic songs, colorful appearance (as religious symbols), entertainment and

34 96 Mitochondrial DNA D-loop and... ceremonial purposes 3. Turkey has two native chickens, Denizli and Gerze fowls, which are seriously threatened with extinction and they are under a governmental conservation program since 997. The former one, Denizli chicken, is bred mainly because of its long crowing characteristics as hobby pet, rather than egg or meat production. Although several studies were carried out about their egg- and meat production characteristics 4,5, quite few works has focused on their genetic structures 7,6. The current study is the first attempt which points out the mitochondrial DNA D-loop and 2S regions of this local breed of Turkey. The analysis of mitochondrial DNA D-loop region sequence data has clearly demonstrated that Denizli chicken is more closely related to long crowing fowls rather than fighting cocks. Finer analysis of D-loop sequence data suggested that within the long crowing clade, Denizli cocks could be separated into subclade. The lack of sequence data for mitochondrial DNA 2S region of long crowing cocks on web site of GenBank hampered the opportunity to discus the phlylogenetic position of Denizli chicken with other long crowing cocks using that particular informative region. 2S sequence data located in GenBank (for other Gallus gallus) were compared with the same region of Denizli fowl. The results of this comparison showed that 2S region of Denizli fowl were almost identical to the 2S nucleotide structure of 8 Gallus gallus samples. Long crowing fowls are in special interest for human all over the world and, in particular, for the people living in Asia. Komiyama et al. 7 conjectured that the culture of cockfighting was closely related with that of long crowing and therefore long crowing culture was derived from that of cock fighting. There is no scientific report or cultural knowledge, however, that Denizli fowl is used for cock fighting although they are famed for their long crowing characters and people would like to have them as hobby animals because of their colorful appearance and exclusive songs. Further studies are required to explore the genetic structure of this local breed which is under severe threaten in extinction. Complete mitochondrial DNA sequence analysis of this local breed will provide us more information and give as an opportunity to conjecture its possible origin and relationship with other chicken breeds in particular with long crowing cocks more accurately. REFERENCES. Komiyama T, Ikeo K, Gojobori T: Where is the origin of the Japanese gamecocks? Gene 37, , Liu YP, Zhu Q, Yao YG: Genetic relationship of Chinese and Japanese gamecocks revealed by mtdna sequence variation. Biochem Genet, 44, 9-29, Fumihito A, Myiake T, Takada M, Shingu R, Endo T, Gojobori T, Kondo N, Ohno S: Monophyletic origin and unique dispersal patterns of domestic fowls. Proceedings of the National Academy of Sciences, 93, , Niu D, Fu Y, Luo J, Ruan H, Yu XP, Chen G, Zhang YP: The origin and genetic diversity of Chinese native chicken breeds. Biochem Genet, 4, 63-74, Liu YP, Wu GS, Yao YG, Miao YW, Luikart G, Baig M, Beja- Pereira A, Ding ZL, Palanichamy MG, Zhang YP: Multiple maternal origins of chickens: Out of the Asian jungles. Mol Phylo Evo, 38, 2-9, Sarica M: Tavugun evciltilmesi, tavuk ırklari ve hibritler, in Turkoglu, M. and Sarica, M. (Eds): Poultry Sci, pp Kaya M, Yildiz MA: Genetic diversity among Turkish native chickens, Denizli and Gerze, estimated by microsatellite markers. Biochem Genet 24, , Villalta M, Lavado A, Obeso A, Larrayad R, Pavia P, Montoya J, Blasco JM: mtdna variation in Spanish brown trouts: Evidence of alien genotypes in restocking programmes. Servicio de Investigación Agroalimentaria, Diputación General de Aragón Zaragoza, Spain, Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning. A Laboratory Manual Appendixes 2 nd ed., Cold Spring Harbor Laboratory Press, USA Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Resc, 25, , Rozas J, Sanchez-DelBarrio JC, Messeguer X, Rozas R: DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics, 9, , West B, Zhou BX: Did chickens go North? New evidence for domestication. J Archaeol Sci, 4, , Komiyama T, Ikeo K, Tateno Y, Gojobori T: Japanase domesticated chickens have been derived from Shamo traditional fighting cocks. Mol Phylo Evol 33, 6-2, Sekeroglu A, Ozen N: Gerze ve Denizli tavuk ırklarının bazı verim özellikleri bakımından karşılaştırılması. Akdeniz Univ J Fac Agric, 0, 4-57, Atasoy F, Onbasilar EE, Apaydın S: Comparison of egg quality characteristics between Denizli and commercial layer flocks. Lalahan Hay Aras Enst Derg, 4, 89-00, Aksoy FT, Ertugrul O, Atasoy F. Gurler S, Erdogan M: A study on blood group alles of Denizli fowl. Turk J Vet Anim Sci, 24, , Komiyama T, Ikeo K, Gojobori T: The evolutionary origin of longcrowing chicken: Its evolutionary relationship with fighting cocks disclosed by the mtdna sequence analysis. Gene, 26, 9-99, 2004.

35 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Isolation of Flavobacterium psychrophilum Causing Rainbow Trout Fry Syndrome and Determination of an Effective Antibacterial Treatment in Rainbow Trout (Oncorhynchus mykiss) Fry [] Murat BOYACIOGLU * Ferda AKAR * [] This work was supported by the Adnan Menderes University, Scientific Research Projects Commission VTF * Department of Pharmacology and Toxicology, Faculty of Veterinary Medicine, Adnan Menderes University, TR-0906 Aydin - TURKEY Summary The bacterial pathogen Flavobacterium psychrophilum (F. psychrophilum) causes rainbow trout (Oncorhynchus mykiss) fry syndorme (RTFS) causes economic losses and widespread in many countries. The aims of the present study are isolation of F. psychrophilum, and determination of antibacterial susceptibility and an effective antibacterial treatment in rainbow trout fry. For this purpose, weighted 2-5 g fry were obtained from a private fish farm in west Aegean region of Turkey. It was estimated according to clinical findings that they were naturally infected with F. psychrophilum originate from the rearing unit. Following fenotipical, biochemical and enzyme tests aimed the identification of bacteria. Kirby-Bauer disc diffusion method was used for determination of antibacterial susceptibility. According to antibiotic susceptibility tests, F. psychrophilum was susceptible to oxytetracycline, enrofloxacin, ciprofloxacin and florfenicol. The antibiotic concentrations in the medicated feeds were to give a dose of 75 mg/kg/day oxytetracycline and 0 mg/ kg/day enrofloxacin, ciprofloxacin and florfenicol each antibiotics for 0 days. When considered the clinical signs and death rates among the infected rainbow trout fry, oxytetracycline, enrofloxacin and ciprofloxacin could not displayed enough efficacy. However, florfenicol showed much higher efficacy for controlling the infection and at the end of the treatment, the death rate caused by the infection was decreased significantly. Keywords: Flavobacterium psychrophilum, Antimicrobial Susceptibility, Florfenicol, Treatment Gökkuşağı Alabalıklarında (Oncorhynchus mykiss) RTFS ye (Rainbow trout Fry Syndrome) Neden Olan Flavobacterium psychrophilum Etkeninin Izolasyonu ve Antibakteriyel Sağaltım Seçeneğinin Belirlenmesi Özet Makale Kodu (Article Code): KVFD Gökkuşağı alabalık (Oncorhynchus mykiss) yavrularında Flavobacterium psychrophilum (F. psychrophilum) un neden olduğu Yavru Gökkuşağı Alabalığı Sendromu (Rainbow Trout Fry Syndrome, RTFS) birçok ülkede yaygın olarak görülen ve ekonomik kayıplara neden olan bakteriyel bir hastalıktır. Bu çalışmada F. psychrophilum suşunun izolasyonu ve identifikasyonu, antibakteriyel duyarlılığı ve etkili antibakteriyel ilaç/ilaçlarla sağaltım seçeneklerinin belirlenmesi amaçlanmıştır. Bu amaçla Ege Bölgesi nin batısında bulunan özel bir işletmede, doğal yolla F. psychrophilum ile enfekte olduğu tahmin edilen yavruhane bölümünde meydana gelen enfeksiyon sonucunda, canlı ağırlıkları 2-5 g arasında hastalıklı gökkuşağı alabalık yavrusu kullanıldı. İdentifikasyon amacıyla bakterilerin fenotipik, biyokimyasal ve enzim testleri gerçekleştirildi. Kirby-Bauer disk difüzyon yöntemine göre yapılan antibiyogram test sonuçlarına göre etkenin oksitetrasiklin, enrofloksasin, siprofloksasin ve florfenikole duyarlı olduğu belirlendi. Sağaltım gruplarına oksitetrasiklin 75 mg/ kg/gün dozda, enrofloksasin, siprofloksasin ve florfenikol 0 mg/kg/gün dozda ve her biri 0 gün süreyle uygulandı. Gökkuşağı alabalık yavrularında klinik bulgular ve ölüm oranları dikkate alındığında; oksitetrasiklin, enrofloksasin ve siprofloksasinin sağaltım için yeterli etkinlik gösteremedikleri, florfenikolün ise diğer sağaltım gruplarına göre enfeksiyonu kontrol almada önemli derecede etkin olduğu ve sağaltım sonunda enfeksiyondan kaynaklı ölüm oranlarını azaltığı belirlendi. Anahtar sözcükler: Flavobacterium psychrophilum, Antimikrobiyal duyarlilik, Florfenikol, Sağaltım İletişim (Correspondence) mboyacioglu@adu.edu.tr

36 98 Isolation of Flavobacterium... INTRODUCTION The bacterial pathogen Flavobacterium psychrophilum (formerly Cytopahaga psychrophila or Flexibacter psychrophilus) causes rainbow trout (Oncorhynchus mykiss) fry syndorme (RTFS) and also is the agent of bacterial coldwater disease in larger fish -6. RTFS widespread in many countries and causes severe mortalities and economic losses of rainbow trout fry in hatcheries in Turkey as well as in most other European countries. The RTFS is considered to be on of the most serious bacterial diseases of rainbow trout in Turkey, and cumulative mortility rates can be as high as 70% 7-. Similar mortality rates are seen in aquaculture in other countries 2-6,2-5. F. psychrophilum has been found in skin mucus, and connective tissue of the fins, gills and operculum of salmonid fish,6. Lorenzen 7 demonstrated F. psychrophilum in the lumen and the mucosa/submucosa of the stomach of naturally infected rainbow trout fry, pointing towards the involvement of the gastro-intestinal tract as a portal of entry. On the other hand, it has been isolated from diseased fish and from fish without any sign of disease,4. Handling and stress can exacerbate the disease 8. The most manifest sign is anaemia as revealed by pale gills, kidney, intestine and liver. Clinically, the fry appear lethargic, inappetant and hang at the water surface 9. Primarily observed splenomegali, a white, fragile intestine and a hemorrhagic, protruding anus. In some cases, skin erosions have been reported, and these usually are found behind the dorsal fin or on the flank 8. Fish infected with F. psychrophilum as fry may display ataxia, spiral swimming and eventually spinal column deformities 2,3. By comparison to other bacterial fish pathogens, there is no commercial vaccine available to prevent F. psychrophilum 4,20. Antimicrobial therapy is still the most effective (and used) way of combating F. psychrophilum infections 9. Proper management of fish culture conditions, monitoring and maintenance of high standards for water quality, and adequate sanitation procedures are other essential requisites that may help to avoid and/or limit the severity of RTFS epizootics 20. The risk of antibiotic treatments inadvertently selecting for drug resistance in bacterial fish pathogens that may also cause disease in humans remains a grave concern in fish health control practices 2,22. Antimicrobial agents are released into the surrounding water during medical treatment of bacterial disease 23. Many studies show that F. psychrophilum is resistant to most antibiotics, and antibiotic resistance may be different by geographic region. F. psychrophilum is capable of acquiring resistance quite easily as seen with oxytetracycline, oxolinic acid, and amoxicillin in Danish freshwater fish farms 23,24. Furthermore F. psychrophilum strains were resistante to both nalidixic acid and oxolinic acid in Japan and United States 5. In France, chloramphenicol resistance was more frequent than florfenicol resistance in F. psychrophilum isolated from cases of RTFS 22. F. psychrophilum spp. were resistante to cephalexin, cephalothin, chloramphenicol, florfenicol, nalidixic acid, gentamicin, kanamycin, erythromycin and oxytetracycline in Australia 25. Of the increasing resistance problem, it is imperative to base the antibiotic to be used upon susceptibility testing in the laboratory. The aim of the current study was to demonstrate the presence of F. psychrophilum in the west Aegean region of Turkey, and determination of antibacterial susceptibility and an effective antibacterial treatment in rainbow trout fry. Antibiotic susceptibility of strains were determined using disk diffusion method. MATERIAL and METHODS Rainbow Trout Samples A large fish hatchery located in the west Aegean region of Turkey were sampled. Increased mortality occurred in five concrete raceways of rearing unit. From the different raceways a total of 50 (0 of each raceways ) rainbow trout fry (weight = 2-5 g; total length = 3-6 cm) showing signs of infection with F. psychrophilum (dark skin, dorsal fin white spots or lysis, spiral swimming, spinal column deformities, and failure to feed) were brought to the laboratory. In the hatchery, mean (±SD) water temperature was 9.2±.5ºC, dissolved oxygen was 9.8±0.4 mg/l, and ph was 6.8±0.3. The living animals were carried in containers filled with freshwater, and dead fish were stored on ice in cold boxes. This study was approved by Animal Ethic Committee of University of Adnan Menderes (Decision date and number HEK/2007/0004). Isolation of F. psychrophilum Samples were taken from the gill, spleen, kidney, liver, intestine and brain of each fish and from observed caudal peduncle lesions. The samples were streaked onto Cytophaga agar (CA) containing.5% agar as modified by Bernardet and Kerouault 26 (0.05% tryptone, 0.05% yeast extract, 0.02% beef extract, and 0.02% sodium acetate; ph = ). All plates were incubated aerobically at 5ºC for h. After incubation, the yellow-pigmented colonies were stained using the Gram staining technique, and Gram negative isolates were observed by microscopic examination 27. Identification of F. psychrophilum Identification was based on colony morphology, Gram staining, and biochemical tests. Biochemical characteristics of the isolates were determined using catalase, oxidase, indol, urease, methyl red, Voges-Proskauer, hydrogen sulfide (H 2 S), nitrate reduction, oxidation-fermentation, and motility tests, gelatin, Congo red, Simmons citrate, flexirubin-like pigment (20% KOH), growth on CA for 48-

37 99 BOYACIOGLU, AKAR 96 h at 37ºC, and growth on CA and media containing 0.5,.5, and 3.0% NaCl (weight/volume). In addition, tests for fermentation (e.g., production of acid from glucose, lactose, and mannitol) were also carried out 27,28. Activities of 9 enzymes were tested using API ZYM strips (biome rieux, Marcy l Etoile, France). The API ZYM test was performed according to the manufacturer s instructions, but the strips were incubated at 5ºC for 6-20 h and F. psychrophilum NCIMB (National Collection of Industrial, Marine, and Food Bacteria) 947 was used as the control. Determination of Antimicrobial Susceptibility of F. psychrophilum Antimicrobial susceptibility was assessed by disk diffusion method. This method is used for more-routine screening, when sensitivity is not as important. The Kirby- Bauer disk diffusion method 29 was performed using multidisks (Oxoid, Ltd., Basingstoke, UK) of ampicillin (AMP; 0 µg), amoxicillin-clavulanic acid (AMC; 30 µg), enrofloxacin (ENR; 5 µg), erythromycin (E; 5 µg), florfenicol (FFC; 30 µg), gentamicin (CN; 0 µg), oxytetracycline (OT; 30 µg), penicilin G (P; 0 U), ciprofloxacin (CIP; 5 µg), and sulfamethoxazole-trimethoprim (SXT; 25 µg). Isolates were plated onto Mueller-Hinton agar (Oxoid) that was modified for testing F. psychrophilum, as described by Hawke and Thune 30. The plated isolates were incubated at 5ºC for h. The antimicrobial susceptibility was determined for each isolate by use of the disk diffusion method described by the National Committee for Clinical Laboratory Standards 3. Endpoint determinations were performed after 96 h. Disk diffusion was evaluated as the lowest zone diameter produced by an antimicrobial agent. Antibiotic Treatment Oxytetracycline (Terramycin, Pfizer, Turkey), enrofloxacin (Baytril, Bayer Turk, Turkey), ciprofloxacin (Ciprobiotik, Eczacıbaşı, Turkey) and florfenicol (Florocol, Schering- Plough, UK) were selected according to the in vitro study. Commercial rainbow trout fry pellets (-.5 mm) (Bayem, Pro-feed, Turkey) were moistened with cornflower oil to ensure attachment of the powdered drugs to the pellets. The drugs were added and carefully mixed with the pellets. The feed for the control fish was moistened with cornflower oil, without a drug 32. The antibiotic concentrations in the medicated feeds were to give a dose of 75 mg/kg/ day oxytetracycline and 0 mg/kg/day enrofloxacin, ciprofloxacin and florfenicol each antibiotics for 0 days 20,33,34. Five concrete raceways of rearing unit were used for this purpose. Each group consisted approximately naturally infected rainbow trout fry at the start of the experiment. Chi-square tests with Yates correction were used to compare the groups. RESULTS Twenty isolates that were phenotypically identified as F. psychrophilum were cultured from the gill (4% of 50 fish samples; n = 7 isolates gill), kidney (6%; n=3), liver (6%; n = 3), spleen (4%; n = 2), brain (4%; n = 2), intestine (4%; n = 2) and from observed pathological lesions of the caudal peduncle (2%; n=). Results obtained from biochemical, cultural, and physiological characteristics and API ZYM profile tests are given in Table. The biochemical and morphological characteristics of the isolates closely resembled those of the type srtain F. psychrophilum NCIMB 947. Mean zone diameter (mm) for each antimicrobial agent are presented in Table 2. The susceptibility of F. psychrophilum isolates to the antimicrobial agents, as indicated by the disk diffusion method, is shown in Table 3. Disk diffusion results showed that 00% of the isolates were resistant to AMC, 95% were resistant to AMP and SXT, 80% were resistant to P and, 65% were resistant to CN. However, 00% were susceptible to ENR and CIP, 70% were susceptible to FFC, and 55% were susceptible to OT. Also, 50% of the isolates were intermediate susceptible to E (Table 3). In the study, The number of daily death before and after application of antibiotics, depending on the RTFS are presented in Table 4. The mortality was very higher in the oxytetracycline group compared the other treatment groups. Although oxytetracycline significantly decreased the mortality on the second day (x 2 yates = 4.57, Degree of Freedom (DF) = 3, P<0.05). After the third day the mortality were reduced and blocked with florfenicol. However, that was not significantly (P>0.05). After the fourth day of therapy were not significanlty decreased the effects of enrofloxacin and ciprofloxacin (P>0.05). Deaths due to infection in both groups continued after the application of antibiotic. There was no significant difference between groups of enrofloxacin and ciprofloxacin (x 2 yates = 0.36, DF =, P>0.05) compared the cumulative mortality. Control (x 2 = , DF = 4, P<0.00), oxytetracycline (x 2 = , yates DF = 3, P<0.00) and florfenicol (x 2 yates = , DF = 2, P<0.00) groups were significantly different compared the cumulative mortality. There was no specific findings about RTFS in FFC group after the treatment. Between 5 to 0 fish died every day in this group. Bacteriological examination yielded no F. psychrophilum or other fish pathogens. Deaths continued to increase in the control group and the other treatment groups (OT, ENR and CIP) after the treatment. For this purpose 0 surviving fish in each raceway were bacteriological examined for 5 days. Eighteen isolates that were phenotypically identified as F. psychrophilum. The isolates were cultured from the control group (4 isolates spleen, one each from brain, liver and

38 200 Isolation of Flavobacterium... Table. Biochemical, cultural, physiological characteristics and API ZYM profile results for 20 F. psychrophilum isolates obtained from rainbow trout fry at a fish hatchery in the west Aegean region of Turkey Tablo. Ege Bögesi nin batısında bulunan Gökkuşağı alabalık işletmesine ait yavruhane bölümünden izole edilen F. psychrophilum (n=20) suşlarının biyokimyasal, kültürel ve fizyolojik karakterleri ile API ZYM profil sonuçları Character Reactions Reactions API ZYM Profile Isolates (r) Isolates (r) Color of coloni yellow yellow Alkaline phosphatase 20/20 + Gram 0/20 - Esterase 0/20 - Catalase 20/20 + Esterase lipase 20/20 +* Oxidase (cytochrome oxidase) 20/20 + Lipase 0/20 - Hydrogen sulfide 0/20 - Leucine arylamidase 20/20 + Glucose 0/20 - Valine arylamidase 20/20 +* Lactose 0/20 - Cystine arylamidase 0/20 - Mannitol 0/20 - Tyripsin 0/20 - Motility 0/20 - α-chymotrypsin 0/20 - Nitrate reduction 0/20 - Acid phosphatase /20 + Urease 0/20 - Napthol-AS-BI-phosphohydrolase 7/20 +* Indol 0/20 - α-galactosidase 0/20 - Oxidation-Fermentation 5/20 - β-galactosidase 0/20 - Gelatine 20/20 + β-glucuronidase 0/20 - Methyl red 0/20 - α-glucosidase 9/20 - Voges proskauer 0/20 - β-glucosidase 0/20 - Flexirubin pigment 20/20 + N-acetyl-β-glucosaminidase 0/20 - Congo red 0/20 - α-mannosidase 0/20 - Simmon s citrate 0/20 - α fucosidase 0/20 - Growth on CA 5 C 20/ C 0/20 - added 0.5 % NaCl 20/20 + added.5 % NaCl 20/20 + added 3 % NaCl 0/ = positive; +* = weak positive; - = negative included in results; r = NCIMB 947 F. psychrophilum referance strain; CA= Cytophaga agar intestine), OT group (2 isolates spleen, 2 isolates brain, one each from kidney and liver), ENR group (one each from spleen, kidney and brain) and CIP group (one each from spleen and kidney). DISCUSSION The method of susceptibility testing used most widely in diagnostic laboratories is the agar disk diffusion technique. It is simple to perform, and a single bacterial isolate can easily be tested with several antimicrobial agents 35. The diluted Mueller-Hinton Agar as described by Hawke and Thune 30 has been recommended by Bruun et al. 24 for susceptibility testing of F. psychrophilum. Data on the antimicrobial susceptibility of F. psychrophilum isolated from rainbow trout fry are limited in Turkey. Kum et al. reported that 20 isolates of F. psychrophilum were resistance to AMC (90%), SXT (75%), CN (70%), E (65%), and sensitive to ENR (0%), OT (20%) and FFC (25%). Didinen et al. 0 reported the resistance of 3 F. psychrophilum isolates to (84.6%), E (6.6%), P (53.9%), ENR (23.%), AMC (5.4%), and CN (7.7%). Ispir et al. 37 demonstrated sensitivity to AMC, CN, E, and OT and resistant to P for five isolates of F. psychrophilum. Using the disk diffusion method, Diler et al. 8 reported that two F. psychrophilum isolates were sensitive to AMP, AMC, CN, CIP and OT and were resistant to trimethoprim. Similarly, Korun and Timur 38 reported that 20 isolates of F. psychrophilum were sensitive to OT (00% of isolates) but resistant to sulfadimethoxine and trimethoprim (00%), as determined using the disk diffusion method. In the present study, disk diffusion method indicated that the 20 isolates of F. psychrophilum were susceptible to ENR and CIP (00%), FFC (70%), and OT (55%). Although

39 20 BOYACIOGLU, AKAR Table 2. Mean zone diameter (mm) from the disk diffusion method used to determine the susceptibility of 20 F. psychrophilum isolates to ten antimicrobial agents Tablo 2. İzole edilen F. psychrophilum suşlarının (n=20) disk difüzyon metoduyla on antimikrobiyal ajana karşı oluşan zon çapları (mm) Antimicrobial Agent Mean Zone Diameter (mm) R I S AMP AMC ENR E FFC CN OT P 4-5 CIP SXT AMP = ampicillin; AMC = amoxicillin-clavulanic acid; ENR = enrofloxacin; E = erythromycin; FFC = florfenicol; CN = gentamicin; OT = oxytetracycline; P=penicilin G; CIP = ciprofloxacin; SXT = sulfamethoxazole-trimethoprim. Results are presented for isolates demonstrating resistance (R), intermediate response (I), and susceptibility (S) to each agent Table 3. Number (percentage in parentheses) of F. psychrophilum isolates (n=20) demonstrating resistance, susceptibility, or an intermediate response to antimicrobial agents (codes defined in Table 2), as assessed using the disk diffusion method Tablo 3. İzole edilen F. psychrophilum suşlarının (n=20) disk difüzyon metoduyla antimikrobiyal ajanlara (kısaltmalar Tablo 2. de belirtilmiştir) karşı belirlenen duyarlılık ve dirençlilik durumları (parantez içindekiler; hesaplanan yüzdeliklerdir) Isolate Response Antimicrobial Agent AMP AMC ENR E FFC CN OT P CIP SXT Resistant 9 (95) 20 (00) - 9 (45) 6 (30) 3 (65) 4 (20) 6 (80) - 9 (95) Intermediate (5) (50) - (5) (25) - - (5) Susceptible (00) (5) 4 (70) 6 (30) (55) 4 (20) 20 (00) - Disk sizes: AMP = 0 µg, AMC = 30 µg, ENR = 5 µg, E= 5 µg, FFC = 30 µg, CN = 0 µg, OT = 30 µg, P = 0 U, CIP = 5 µg, and SXT = 25 µg Table 4. The number (percentage in parentheses; calculated by the number of live fish of that day) of daily death before and after application of antibiotics, depending on the RTFS Tablo 4. Antibiyotik uygulama öncesi ve sonrası RTFS ye bağlı günlük ölüm sayıları (parantez içindekiler; o günkü canlı alabalık sayısı üzerinden hesaplanan yüzdeliklerdir) Time (Day) Groups Control OT ENR CIP FFC Before application of antibiotics 397 (.59) 372 (.49) 373 (.49) 434 (.74) 365 (.46) 8.38 NS After application of antibiotics 2 (0.46) 4 (0.46) 06 (0.43) 30 (0.53) 06 (0.43) 3.42 NS 2 68 (0.69)* 86 (0.35)** 32 (0.54) 29 (0.53) 42 (0.58) (.28)* 35 (0.55) 96 (0.39) 06 (0.44) 2 (0.50) (.9)* 243 (.00)* 26 (0.52) 26 (0.52) 96 (0.40) (2.59)* 367 (.53)* 30 (0.54) 37 (0.57) 8 (0.34)** (3.84)* 335 (.4)* 40 (0.58) 36 (0.57) 63 (0.26)* (4.0)* 496 (2.2)* 56 (0.65) 46 (0.6) 4 (0.7)* (5.48)* 963 (4.2)* 33 (0.56) 37 (0.58) 22 (0.09)* (6.68)* 4 (5.09)* 87 (0.79) 48 (0.63) 8 (0.03)* (6.47)* 988 (4.76)* 95 (0.83) 74 (0.74) 6 (0.03)* Cumulative mortality 743 (28.57)* 4972 (9.89)* 524 (6.0) 494 (5.98) 804 (3.22)* OT = oxytetracycline; ENR = enrofloxacin; CIP = ciprofloxacin; FFC = florfenicol, * P<0.0; ** P<0.05, NS = Not significant x 2

40 202 Isolation of Flavobacterium... the deaths originate from the rearing unit of hatchery, it is noteworthy that the isolates exhibited quite a range in susceptibilities to the different antibiotics. This may suggest that the fish were infected with multiple clones of F. psychrophilum, each exhibiting different susceptibilities to the antibiotics. Nevertheless, antibiotics used in treatment are not effective except FFC. This reveals a negative correlation between in vitro and in vivo effect. In Europe, RTFS has been successfully controlled using OT at mg/kg/d for 0-4 day 20. However, isolates of F. psychrophilum with resistance to OT are increasingly being described in England 39 and Denmark 4,23,24,36. Previous investigations of antimicrobial resistance in F. psychrophilum have only dealt with the in vitro aspect. For example, MIC values can be useful indicators of the probable clinical efficacy, but these results have not been verified by in vivo testing 2,39,40. Branson 8 reported from the antibiotics tested, enrofloxacin, sarafloxacin and florfenicol showed potential for in in vivo trials but no therapeutic efffect has been found in subsequent trials with enrofloxacin. Therapeutic activity remained at low levels, although on the second day of OT treatment to reduce mortality. After the third day of this activity was decreased, while providing a significant therapeutic efficacy initially of CIP and ENR. The reason for this might be chelation or resistance. Burka et al. 4 reported OT and quinolones may be inactivated by exposure to Calcium 2+ and Magnesium 2+ in the water and the bowel of the fish. Resistance mechanisms have been examined in recent studies as potential causes of antimicrobial aquaculture treatment failures. Resistance to tetracyclines and/or oxytetracyclines has been commonly reported. Resistance to oxytetracycline in F. psychrophilum is caused by uptake of transposons carrying tetracycline resistance determinants or the resistance is caused by other unspecific changes in membrane permeability 36. Alvarez et al. 4 described the resistance genes tetq conferred tetracycline resistance. DNA gyrase (GyrA) is an important target for quinolones in F. psychrophilum 5 and can, as such, only be transferred vertically in bacterial populations 24. Most of the F. psychrophilum isolates in this study were sensitive to FFC (70%). FFC was found to be highly effective in controlling RTFS. After the second day was reduce mortality. Perhaps FFC resistance has not yet occurred. Resistance of F. psychrophilum to FFC has rarely been observed in England 39, and Nematollahi et al. 9 indicated that F. psychrophilum in salmonids exhibited no resistance to ENR or FFC. Michel et al. 22 and Akinbowale et al. 22 noted that F. psychrophilum resistance to FFC has not become widespread in France or Australia, despite the aquacultural use of FFC in those countries. However, because of the increasing resistance problem, it is imperative to base the antibiotic to be used upon susceptibility testing in the laboratory. The emergence of resistant bacteria may have resulted from improper use of antimicrobial agents. As a result of increasing incidence of resistant bacteria and recurrent outbreaks of disease shortly after a treatment, investigations on alternative treatments and prophylactic schemes should be given high priority. These results were considered indicative of FFC potential in controlling outbreaks of RTFS. Future studies of effective antibiotic application for the treatment of RTFS, this study can be used as a reference. REFERENCES. Holt RA, Rohovec JS, Fryer JL: Bacterial coldwater disease. In, Inglis V, Roberts RJ, Bromage NR (Ed): Bacterial Diseases of Fish. st ed., pp. 3-23, Blackwell Scientific Publications, London, Lorenzen E, Dalsgaard I, Bernardet JF: Characterization of isolates of Flavobacterium psychrophilum associated with coldwater disease or rainbow trout fry syndrome I: Phenotypic and genomic studies. Dis Aquat Organ, 3, , Madetoja J, Hannien ML, Koski VH, Dalsgaard I, Wiklund T: Phenotypic and genotypic characterization of Flavobacterium psychrophilum from Finnish fish farms. J Fish Dis, 24, , Alvarez B, Secades P, McBride MJ, Guijarro JA: Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum. Appl Environ Microb, 70, , Izumi S, Aranishi F: Relationship between gyra mutations and qinolone resistance in Flavobacterium psychrophilum isolates. Appl Environ Microb, 70, , Madsen L, Moller JD, Dalsgaard I: Flavobacterium psychrophilum in rainbow trout, Oncorhynchus mykiss (Walbaum), hatcheries: Studies on broodstock, eggs, fry and environment. J Fish Dis, 28, 39-47, Cagirgan H, Tanrıkul TT, Balta F: Characteristics of yellow pigmented bacteria isolated from diseased rainbow trout (Oncorhynchus mykiss). Eight International Conference Diseases of Fish and Shellfish. 4-9 September, Edinburg, Diler O, Altun S, Isıklı BI: Phenotypic characteristics of Flavobacterium psychrophilum isolated from diseased rainbow trout (Oncorhynchus mykiss). Süleyman Demirel Üniv Fen Bil Enst Derg, 7, -8, Timur G, Timur M, Korun J: A study on the outbreak of Flavobacterium psychrophilum infection in a rainbow trout (Oncorhynchus mykiss) hatchery in Turkey. İstanbul Üniv Su Ürünleri Derg, 7, 2-27, Didinen BI, Diler O, Ekici S, Altun S: Identification of Flavobacterium psychrophium isolates using API ZYM and determination of antimicrobial susceptibilities with ATB VET. Süleyman Demirel Üniv Egirdir Su Urunleri Fak Derg,, 64-70, Kum C, Kirkan S, Sekkin S, Akar F, Boyacioglu M: Comparison of in vitro antimicrobial susceptibilty in Flavobacterium psychrophilum isolated from rainbow trout fry. J Aquat Anim Health, 20, , Wiklund T, Kaas K, Lonnstrom L, Dalsgaard I: Isolation of Cytophaga psychrophila (Flexibacter psychrophilus) from wild and farmed rainbow trout (Oncorhynchus mykiss) in Finland. B Eur Assoc Fish Pat, 4, 44-46, Evensen O, Lorenzen E: An immunohistochemical study of Flexibacter psychrophilus infection in experimentally and naturally infected rainbow trout (Oncorhynchus mykiss) fry. Dis Aquat Organ, 25, 53-6, Dalsgaard I, Madsen L: Bacterial pathogens in rainbow trout, Oncorhynchus mykiss (Walbaum), reared at Danish freshwater farms. J Fish Dis, 23, , Madsen L, Arnbjerg J, Dalsgaard I: Radiological examination of the spinal column in farmed rainbow trout Oncorhynchus mykiss (Walbaum): Experiments with Flavobacterium psychrophilum and oxytetracycline. Aquac Res, 32, , 200.

41 203 BOYACIOGLU, AKAR 6. Madetoja J, Dalsgaard I, Wiklund T: Occurrence of Flavobacterium psychrophilum in fish-farming environment. Dis Aquat Organ, 52, 09-8, Lorenzen E: Studies on Flexibacter psychrophilus in Relation to rainbow trout fry Syndrome (RTFS). National Veterinary Laboratory, Royal Veterinary and Agricultural University, Copenhagen, Branson EJ: Rainbow trout fry syndrome: An update. Fish Veterinary J, 2, 63-66, Nematollahi A, Decostere A, Pasmans F, Haesebrouck F: Flavobacterium psychrophilum infections in salmonid fish. J Fish Dis, 26, , Cipriano RC, Holt RA: Flavobacterium psychrophilum, Cause of Bacterial Cold-Water Disease and Rainbow Trout Fry Syndrome. Fish Disease Leaflet 86, United States Department of the Interior, National Fish Health Research Laboratory, West Virginia, Gustafson RH, Bowen RE: Antibiotic use in animal agriculture. J Appl Microbiol, 83, 53-54, Michel C, Kerouault B, Martin C: Chloramphenicol and florfenicol susceptibility of fish-pathogenic bacteria isolated in France: Comparison of minimum inhibitory concentration, using recommended provisory standards for fish bacteria. J Appl Microbiol, 95, , Schmidt AS, Bruun MS, Dalsgaard I, Pedersone K, Larsen JL: Occurrence of antimicrobial resistance in fish-pathogenic and environmental bacteria associated with four Danish rainbow trout farms. Appl Environ Microb, 66, , Bruun MS, Schmidt AS, Madsen L, Dalsgaard I: Antimicrobial resistance patterns in Danish isolates of Flavobacterium psychrophilum. Aquaculture, 87, 20-22, Akinbowale OL, Peng H, Barton MD: Antimicrobial resistance in bacteria isolated from aquaculture sources in Australia. J Appl Microbiol, 00, 03-3, Bernardet JF, Kerouault B: Phenotypic and genomic studies of Cytophaga psychrophila isolated from diseased rainbow trout (Oncorhynchus mykiss) in France. Appl Environ Microb, 55, , Koneman EW, Allen SD, Janda WM, Schreckenberger PC, Winn WC: The Gram-Negative Cocci. In, Color Atlas and Textbook of Diagnostic Microbiology. 5th ed., Lippincott-Raven Publishers, Philadelphia, Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST: Gram- Negative Cocci. Bergey s Manual of Determinative Bacteriology, 9th ed. Group 7, Williams and Wilkins, Maryland, Bauer AU, Kirby WM, Sherris JC, Track M: Antibiotic susceptibility testing by a standardized single disc method. J Clin Pathol, 45, , Hawke JP, Thune RL: Systemic isolation and antimicrobial susceptibility of Cytophaga columnaris from commercially reared channel catfish. J Aquat Anim Health, 4, 09-3, NCCLS (National Committee for Clinical Laboratory Standards): Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved standard. 2nd ed., NCCLS, Wayne, Lunden T, Lilius EM, Bylund G: Respiratory burst activity of rainbow trout (Oncorhynchus mykiss) phagocytes is modulated by antimicrobial drugs. Aquaculture, 207, , Martinsen B, Horsberg TH: Comparative single-dose pharmacokinetics of four qinolones, oxolinic acid, flumequin, sarafloxacine and enrofloxacine, in Atlantic salmon (Salmo salar) held in seawater at 0 C. Antimicrob Agents Ch, 39, , Vatansever H: Antibekteriyel tedaviler. In, Roberts JR, Shepherd CJ (Ed): Alabalık ve Salmon Hastalıkları. st ed., pp , Yücel Ofset, Ankara, Hesami S, Parkman J, Macinnes JI, Gray JT, Gyles CL, Lumsden JS: Antimicrobial Susceptibility of Flavobacterium psychrophilum Isolates from Ontario. J Aquat Anim Health, 22, 39-49, Bruun MS, Madsen L, Dalsgaard I: Efficiency of oxytetracycline treatment in rainbow trout experimentally infected with Flavobacterium psychrophilum strains having different in vitro antibiotic susceptibilities. Aquaculture, 25, -20, Ispir U, Seker E, Saglam N, Dorucu M: A study of Flavobacterium psychrophilum infection in some cultured rainbow trout (Oncorhynchus mykiss) in Eastern Anatolia. Fırat Üniv Fen Müh Bil Derg, 6, , Korun J, Timur G: A study on the fry mortality syndrome (FMS) of the rainbow trout (Oncorhynchus mykiss). İstanbul Üniv Su Ürünleri Derg, 2, 5-30, Rangdale RE, Richards RH, Alderman DJ: Minimum inhibitory concentration of selected antimicrobial compounds against Flavobacterium psychrophilum the causal agent of rainbow trout fry syndrome (RTFS). Aquaculture, 58, 93-20, Schmidtke LM, Carson J: Characteristics of Flexibacter psychrophilus isolated from Atlantic salmon in Australia. Dis Aquat Organ, 2, 57-6, Burka JF, Hammel KL, Horsberg TE, Joohnson GR, Rainnie DJ, Speare DJ: Drugs in salmonid aquaculture. J Vet Pharmacol Ther, 20, , 997.

42 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Erzurum da Tüketime Sunulan Kaşar Peynirlerinin Mineral Madde İçeriği ve Ağır Metal Kontaminasyonu Hayrunnisa ÖZLÜ * Meryem AYDEMİR ATASEVER * Sevda URÇAR * Mustafa ATASEVER * * Atatürk Üniversitesi Veteriner Fakültesi Gıda Hijyeni ve Teknolojisi Bölümü, TR Erzurum - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Araştırma, Erzurum da tüketime sunulan taze ve olgunlaşmış kaşar peynirlerinde mineral madde ve ağır metal içeriklerinin belirlenmesi amacıyla yapıldı. Perakende satış yerlerinden toplanan 50 adet (37 taze ve 3 adet olgunlaşmış kaşar peyniri numunesi) peynir numunesinde mineral madde ve ağır metal kontaminasyon düzeyleri indüktif eşleşmiş plazma optik emisyon spektroskopisi (ICP-OES) ile belirlendi. Peynir örneklerindeki ortalama mineral madde ve ağır metal içerikleri; kalsiyum ±64.4 mg/kg, potasyum ±552.3 mg/kg, sodyum ±886.2 mg/kg, magnezyum 29.34±32.05 mg/kg, demir.65±0.80 mg/kg, çinko 5.66±3.4 mg/kg, bakır 0.39±0.35 mg/kg, mangan 0.5±0.09 mg/kg, nikel 0.27±0.24 mg/kg, kurşun.77±.72 mg/kg ve arsenik 0.000±0.00 mg/kg olarak tespit edildi. Taze ve olgunlaşmış kaşar peynirlerinin mineral madde ve ağır metal içerikleri arasında önemli fark (P>0.05) saptanmadı. Anahtar sözcükler: Kaşar peyniri, Mineral madde, Ağır metal, ICP-OES Mineral Contents and Heavy Metal Contamination in Kashar Cheeses Consumed in Erzurum Province, Turkey Summary This study was carried out to determine the mineral substances and heavy metal contents of fresh and ripened kashar cheeses consumed in Erzurum province, Turkey. A total 50 samples (37 fresh and 3 ripened kashar samples) were obtained randomly from retail outlets. Mineral substances and heavy metals contamination levels were detected with inductively coupled plasma-optical emission spectrometry (ICP-OES). The average levels of the mineral substances and heavy metals in the kashar cheeses were determined as; calcium ±64.4 mg/kg, potassium ±552.3 mg/kg, sodium ±886.2 mg/kg, magnesium 29.34±32.05 mg/ kg, iron.65±0.80 mg/kg, zinc 5.66±3.4 mg/kg, copper 0.39±0.35 mg/kg, manganese 0.5±0.09 mg/kg, nickel 0.27±0.24 mg/kg, lead.77±.72 mg/kg and arsenic 0.000±0.00 mg/kg. It was not determined any statistical differences in mineral substances and heavy metal levels between fresh and ripened kashar cheese samples. Keywords: Kashar cheese, Mineral substance, Heavy metal, ICP-OES GİRİŞ Süt ve ürünleri, yapısında bulunan makro ve mikro elementlerden özellikle kalsiyum içeriğinden dolayı beslenmede oldukça önemlidir. Sütün mineral içeriği; hayvanın genetik özelliklerine, laktasyon dönemine, çevresel koşullara, mera tipine ve toprağın kirliliğine bağlı olarak değişebilir 2. Birçok gıda sektöründe olduğu gibi süt sektöründe de ağır metal kontaminasyonu süt üretim ve ürüne işleme aşamasında gerçekleşebilmektedir. Süt üreten işletmelerde kontaminasyon, genellikle çevresel kaynaklardan (örn., toprak ve su gibi) ve yemlerden bulaşabilir. Ayrıca sağım, depolama ve işleme sırasında kullanılan makine ve ekipmanlardan kaynaklanabilir 3. Çünkü süt ve peynir gibi asidik nitelikli besinlerin sağımında veya üretiminde kullanılan alet ve ekipmanın bileşimindeki metallerin çözünerek ürüne geçme riski diğer gıdalara oranla daha kolay olabilir 4,5. Teknolojik işlemler sırasında süt ve süt ürünlerinin muhafazasında kullanılan metal kaplardan ve işletme suyundan kaynaklanan metalik kontaminasyondaki başlıca elementler bakır, çinko, demir, kalay, kurşun, kadmiyum ve arseniktir 6. İletişim (Correspondence) hayrunnisa@atauni.edu.tr

43 206 Erzurum da Tüketime Sunulan... Gelişen endüstrilerin ve daha modern bir yaşam sağlama amacıyla sürdürülen çabaların olumsuz sonuçlarından olan besinlerin yüksek düzeyde ağır metallerle kontaminasyonu günümüzde toplum sağlığını tehdit eden en önemli problemlerden biridir. Ağır metallerin bir kısmı (örn.; demir, çinko ve bakır gibi) yaşam için esansiyel olup önemli enzim sistemlerinin fonksiyonları için gereklidir. Bir kısmının ise insan fizyolojisinde ki fonksiyonları henüz belirlenememiştir. Bununla birlikte bazıları (örn.; kurşun, ve civa gibi) iz seviyelerde bile potansiyel olarak toksik etki gösterebilir. Metaller insan vücudunda özellikle belirli doku ve organlarda (örn.; karaciğer, kemik ve böbrek gibi) birikme eğilimindedir. Metallerin toksisitesi en çok beyin ve böbrekte olurken farklı şekillerde de zararlı etkileri olabilir (örn.; arsenik kansere neden olabilir). Besinlerle alınan ağır metallerin vücutta birikme oranı; metalin kimyasal formuna, kişinin yaşı ve beslenme durumuna bağlı olarak değişkenlik gösterebilir 7. Kaşar peynirinde mineral madde içeriği ve ağır metal kontaminasyonlarının belirlendiği çalışmaların 8-2 yanı sıra, üretim aşamalarında meydana gelen ağır metal kontaminasyonlarının incelendiği çalışmalara 3 da literatürde rastlanmıştır. Bu araştırmayla, Erzurum piyasasında tüketime sunulan taze ve olgunlaşmış kaşar peynirlerinin kalsiyum, potasyum, sodyum, magnezyum, mangan, demir, çinko, bakır, nikel, kurşun ve arsenik düzeylerinin belirlenmesi amaçlandı. MATERYAL ve METOT Örneklerin Alımı Erzurum piyasasında tüketime sunulan yerel ve ulusal firmalara ait orijinal vakum ambalajlı 37 adet taze ve 3 adet olgunlaşmış kaşar peyniri örneği satış yerlerinden temin edildi. Örnekler soğuk zincir altında laboratuvara getirildi ve analizleri yapılıncaya kadar 4± C de muhafaza edildi. Örneklerin Çözümlenmesi Analizi yapılacak kaşar peyniri örneklerinde organik bileşikleri yok etmek ve inorganik bileşikleri de çözünür faza geçirmek amacıyla yapılan çözümleme işlemleri kapalı sistem mikrodalga yakma metodu kullanıldı. Bu amaçla Ethos Touch Control (Milestone) mikrodalga çözümleme sistemi ve aksesuarları (TFM kaplar) ile Microwave Digestion Rotor (000/0 yüksek basınç) ve basınç-sıcaklık kontrol sensörleri kullanıldı. Örneklerin çözümlenmesinde %65 lik nitrik asit (Merck, ) ve %30 luk hidrojen peroksit (Merck, ) kombinasyonundan yararlanıldı. Çözünürleştirme işlemi sonrası oda sıcaklığında soğutulan kapların kapakları açıldıktan sonra çözünen numuneler ultra distile su ile 50 ml ye seyreltilerek viallere aktarıldı. Metal kontaminasyonunu önlemek amacıyla örneklerin çözündürülmesi esnasında kullanılan tüm malzemeler, +9 (v/v) HNO 3 /ultra distile su ile birkaç kez çalkalandı. Daha sonra ultra distile su ile çok sayıda yıkanan ve durulanan malzemeler etüvde kurutuldu. Örneklerin Mineral ve Ağır Metal Düzeylerinin ICP-OES ile Belirlenmesi Kaşar peyniri örneklerinde bulunan mineraller ve ağır metaller her biri için ICP-OES in software inde yer alan ve cihazın analizler için uygun gördüğü dalga boylarında standart kalibrasyon çözeltiler ile kalibrasyon eğrileri çizildi. Bu eğriler, cihaza verilen standart çözeltinin 5 farklı konsantrasyonuna karşılık cihazın ölçümleri sonucu hesapladığı konsantrasyonlara göre oluşturuldu. Çözünen örneklerin, ICP-OES (Optima 2000 DV) cihazında her metal için belirtilen dalga boyunda köre karşı okuması yapıldı. Çözelti halinde cihaza verilen örnekler argon gazı eşliğinde gaz fazına geçirildi ve bir süre sonrada yaydıkları rezonans ışınları tespit edilerek ölçümleri gerçekleştirildi. İstatistiksel Değerlendirmeler Elde edilen sonuçların değerlendirilmesinde SPSS paket programı kullanılarak örneklerin minimum, maksimum, ortalama değer ve standart hataları belirlendi. Taze ve olgunlaşmış kaşar peynir örnekleri arasındaki mineral madde içeriğindeki farklılıklar t- testi analiziyle incelendi. BULGULAR Erzurum ilinde çeşitli perakende satış yerlerinden alınan taze ve olgunlaşmış kaşar peynirlerinde mineral madde ve ağır metal içerikleri; kalsiyum ±64.4 mg/kg, potasyum ±552.3 mg/kg, sodyum ±886.2 mg/kg, magnezyum 29.34±32.05 mg/kg, demir.65±0.80 mg/kg, çinko 5.66±3.4 mg/kg, bakır 0.39±0.35 mg/kg, mangan 0.5±0.09 mg/kg, nikel 0.27±0.24 mg/kg, kurşun.77±.72 mg/kg ve arsenik 0.000±0.00 mg/kg olarak saptandı. Olgun kaşar peynirlerinde tespit edilen ortalama kalsiyum, sodyum, çinko, bakır, nikel ve kurşun miktarları taze kaşar peynirlerinde nispi olarak yüksek olmasına rağmen istatistiksel olarak önemli (P>0.05) bulunmadı (Tablo ). TARTIŞMA ve SONUÇ Kaşar peyniri numunelerinde kalsiyum ve sodyum içerikleri Mendil in 8 (3869±385 µg/g ve 4994±489 µg/g), Kılıç ve ark. nın 9 İzmir de (888.42±65.72 mg/00g ve 557.0±74.89 mg/00 g) ve Yüzbaşı ve Demirözü nün 0 Ankara da ( ±908 mg/kg ve ±972 mg/kg) yaptıkları çalışmalarda belirledikleri değerlerden daha düşük bulunmuştur. Potasyum içeriği ise Mendil in 8 322±32 µg/g, Kılıç ve ark. nın ±22.22 mg/00 g, Yüzbaşı ve Demirözü nün ±47 mg/kg olarak elde ettiği

44 207 ÖZLÜ, AYDEMİR ATASEVER URÇAR, ATASEVER Tablo. Kaşar Peyniri Örneklerinin Mineral Madde ve Ağır Metal İçerikleri (mg/kg) Table. Mineral Substance and Heavy Metal Contents in Kashar Cheeses (mg/kg) Taze + Olgunlaşmış Mineral ve Taze Kaşar Olgunlaşmış Kaşar t-değeri Kaşar Ağır Metaller n Ort±Std. hata Min. Mak. n Ort±Std. hata Min. Mak. Ort±Std. hata Ca ± ± , ±64.4 K ± ± , ±552.3 Na ± ± , ±886.2 Mg ± ± , ±32.05 Fe 37.7± ± ,376.65±0.80 Zn ± ± , ±3.4 Cu ± ± , ±0.35 Mn ± ± ,3 0.5±0.09 Ni ± ± , ±0.24 Pb 37.60± ± ,48.77±.72 As ± , ±0.00 Tablo 2. Kaşar peynirindeki ağır metal içerikleri ile ilgili literatürler Table 2. Heavy metal contents in kashar cheeses concerned with literatures Fe Zn Cu Pb Mn Ni Literatür 4.±.92 (mg/kg) 38.00±5.7 (mg/kg) 0.64±0.24 (mg/kg) Yüzbaşı ve Demirözü 0 7.5±0.65 (µg/g) 0.6±.05 (µg/g) 0.27±0.05 (µg/g) 0.53±0.055 (µg/g).0±0. (µg/g) 0.8±0.0 (µg/g) Mendil 8 8.9±0.3 (mg/kg) 86.9±3. (mg/kg).2±0. (mg/kg) 42.9±2.3 (µg/kg) - - Yüzbaşı ve ark ±. (mg/kg) 58.3±.7 (mg/kg).5±0. (mg/kg) 374.±89.0 (µg/kg) - - Yüzbaşı ve ark ± 0.7 (mg/kg) 5.3 ±.8 (mg/kg) 0.26±0.04 (mg/kg) 0.29±0.02 (mg/kg) Acar ±0.40 (mg/kg) 27.5±0.7 (mg/kg).35±0.04 (mg/kg) 0.2±0.02 (mg/kg) 0.43±0.03 (mg/kg) Yalçın ve Tekinşen bulgularından oldukça yüksek kaydedilmiştir. Kaşar peynirlerinin ortalama magnezyum içeriği Mendil 8 tarafından 36.8±2.9 µg/g olarak belirlenen değerden oldukça yüksek olarak tespit edilirken Yüzbaşı ve Demirözü nün mg/kg olarak belirlediği değerden daha düşük olduğu saptanmıştır. Olgunlaşmış kaşar peynir numunelerinin içerdikleri kalsiyum ve sodyum miktarları taze kaşar peynir numunelerine oranla biraz yüksek bulunurken; potasyum ve magnezyum içerikleri daha düşük bulunmuştur (Tablo ). Olgunlaşmayla birlikte peynirdeki nem kaybı sonucu özellikle sodyum miktarında oransal olarak bir artışın olması muhtemeldir. Kaşar peynirlerindeki mineral madde düzeylerindeki bu farklılıklar hayvanın yetiştirildiği toprağın yapısından, mevsimsel değişimlerden, kullanılan sütün içeriğinden ve farklı peynir üretim tekniklerinden kaynaklanmış olabilir. Nitekim birçok araştırmacı 3-5,3 da peynir üretim tekniklerinin ve çevresel şartların üretilen peynirlerin mineral madde içeriklerinde farklılığa yol açabileceğini vurgulamıştır. Kaşar peynirlerindeki demir içeriği Mendil in 8 7.5±0.6 µg/g, Yüzbaşı ve Demirözü nün 0 4.±.92 mg/kg ve Acar ın ±0.7 mg/kg olarak tespit ettiği değerlerden, çinko içeriği ise Yüzbaşı ve Demirözü nün 0 Ankara da yaptığı çalışmada 38.00±5.7 mg/kg, Yalçın ve Tekinşen in Konya da yaptığı çalışmada 27.5±0.7 mg/kg olarak elde ettikleri değerlerden düşük bulunmuştur. Bununla birlikte, kaşar peynirlerinin ortalama çinko içeriği Acar ın 2 Ankara da yaptığı çalışmada 5.3±.8 mg/kg olarak belirlediği çinko düzeyi ile paralellik gösterirken, Mendil in 8 0.6±.05 µg/g olarak tespit ettiği değerden daha yüksek bulunmuştur. Farklı araştırmalarda peynirlerin çinko içeriğinde saptanan farklılıkların, peynir yapımında kullanılan sütten ve üretim aşamasındaki alet ve gereçlerden kaynaklanmış olabileceği düşünülmektedir. Bu durum Yalçın ve Tekinşen tarafından da ifade edilmektedir. Ayrıca sütteki çinkonun %85 inin kazein misellerine bağlı olduğu ve asidik ph değerlerinde serbest hale geçerek pıhtıdan ayrıldığı bildirilmiştir 4. Araştırmada kaşar peyniri numunelerindeki ortalama bakır değerinin Mendil in ±0.05 µg/g, Yüzbaşı ve Demirözü nün ±0.24 mg/kg ve Acar ın ±0.04 mg/kg olarak elde ettiği değerlerden daha düşük olduğu tespit edilmiştir. Peynirlerde belirlenen bakır düzeyi sütün muhafaza edildiği metal kapların bileşiminde bulunan bakırın sütle etkileşime girerek çözünmesinden veya hayvanların beslenmesinde kullanılan yemlerin bakır içeriği yüksek olan tarım ilaçları ile kontaminasyonundan dolayı artabileceği, buna karşın üretim esnasında sütteki bakırın çözünerek peynir altı suyuna geçmesiyle azalabileceği düşünülmüştür. Bu durum Metin 5 ve Temurci ve Güner 5 tarafından da desteklenmiştir. Kaşar peynirlerinde ortalama kurşun düzeyi.77±.72

45 208 Erzurum da Tüketime Sunulan... mg/kg olarak saptandı. Peynir örneklerinin 4 tanesinde kurşun tespit edilmezken en yüksek değer 5.6 mg/kg olarak ölçülmüştür. Mendil in ±0.055 µg/g, Acar ın ±0.02 mg/kg ve Ayar ve ark. nın 6.0±0.0 mg/kg olarak belirlediği kurşun düzeyleri bu araştırmada elde edilen değerlerden düşük bulunmuştur. Farklılıkların süt üretimi yapılan çiftlikler, peynir işletmeleri ile satış yerlerinin sanayi kuruluşlarına ve otoyollara olan mesafesiyle ilişkili olabileceği sonucuna varılmıştır. Araştırmada mangan kontaminasyonu tüm örneklerde, nikel ise kırk yedi numunede tespit edilmiştir. Elde edilen ortalama nikel (0.27±0.24 mg/kg) ve mangan (0.5±0.09 mg/kg) içerikleri Mendil in 8 yaptığı çalışmada kaşar peynirlerinde 0.8±0.0µg/g ve.0±0.µg/g olarak belirlediği nikel ve mangan düzeylerinden daha düşük olduğu kaydedilmiştir. Peynir üretiminin ısıtma ve haşlama aşamalarında kullanılan çelik kapların bileşiminde bulunan nikel ve mangan gibi metallerin ürüne geçebileceği belirtilmiştir 7. İncelenen örneklerde ortalama arsenik düzeyi 0.000±0.00 mg/kg olup sadece 4 adet taze kaşar peynirinde tespit edilmiştir. Ayar ve ark. 6, kaşar peynirlerinde ortalama arsenik miktarını 0.02±0.307 mg/kg olarak saptamışlardır. Demirözü ve Saldamlı 8 ise taze ve olgunlaşmış beyaz peynirlerde arsenik düzeylerini sırasıyla 0.85±0.34 ng/g ve.35±0.29 ng/g olarak belirlemişlerdir. Son yıllara kadar gıdaların arsenik ile kontaminasyonu tarımda kullanılan ilaçlar sebebiyle daha yüksek düzeylerde seyrederken, günümüzde bu tür insektisit, herbisit ve pestisitlerin kullanılması yasaklandığından kontaminasyon riski azalmıştır 7. Sütün bileşimindeki mineral madde ve ağır metallerin ortalama içerikleri kalsiyum mg/l, potasyum mg/l, sodyum mg/l, magnezyum mg/l, demir mg/l, çinko mg/l, bakır mg/l, mangan mg/l, nikel µg/l, kurşun 4-00 µg/l ve arsenik µg/l olduğu belirtilmektedir 6,9. Kaşar peyniri üretiminde randıman ortalama %0 civarındadır 20. Mineral maddeler gibi ağır metallerde belirli oranda süte geçebilmektedir. Bu nedenle kaşar peynirindeki ağır metal düzeyinin peynir yapımında kullanılan sütün ağır metal kontaminasyonuna göre değişebilir. Yüzbaşı ve ark. nin 3 Ankara da yaptığı çalışmada da ağır metal içeriği daha yüksek olan sütten yapılan kaşar peynirinin de ağır metal içeriğinin yüksek olduğunu tespit etmişlerdir (Tablo 2). Ancak ağır metal kontaminasyonunun özellikle sütün pıhtılaştırılması aşamasında arttığını, daha sonraki işlem basamaklarında ise azaldığını gözlemlemişlerdir. Türk Gıda Kodeksi nin 2 Gıda Maddelerinde Bulaşanların Maksimum Limitlerinin Belirlenmesi Hakkındaki Tebliğ de kaşar peynirine ait maksimum limitler olmamasına karşın ağır metallerin bazı gıdalarda kabul edilebilir değerleri belirtilmiştir. Araştırmada elde edilen ortalama değerlerden sadece nikelin Kodekste belirtilen değerlerin ( mg/kg) üzerinde olduğu tespit edilmiştir. Ayrıca bazı kaşar peyniri numunelerinin kurşun içeriği de belirtilen limitlerden ( mg/kg) yüksek bulunmuştur. Peynir üretim tekniklerinin standart hale getirilmesi, üretim ve muhafaza aşamasında kullanılan alet ve ekipmanların inert yapıda olması, sanayi bölgelerinde veya trafiğin yoğun olduğu bölgelere yakın yerlerde hayvan yetiştiriciliğinin yapılmaması ve süt işletmelerinin bu tür yerlerden uzaklara kurulması önerilmektedir. KAYNAKLAR. Aydemir Atasever M, Çanakçı Adıgüzel G, Atasever M, Özturan K: Determination of aflatoxin M levels in some cheese types. Kafkas Univ Vet Fak Derg, 6, 87-9, Gonzalez-Martin I, Hernandez-Hierro JM, Revilla I, Vivar-Quintana A, Lobos Ortega I: The mineral composition (Ca, P, Mg, K, Na) in cheeses (cow s, ewe s and goat s) with different ripening times using near infrared spectroscopy with a fibre-optic probe. Food Chem, 27, 47-52, Yüzbaşı N, Sezgin E, Yıldırım Z, Yıldırım M: Changes in Pb, Cd, Fe, Cu and Zn levels during the production of kasar cheese. J Food Quality, 32, 73-83, Bakırcıoğlu D, Bakırcıoğlu Kurtuluş Y, Uçar G: Determination of some trace metal levels in cheese samples packaged in plastic and tin containers by ICP-OES after dry, wet and microwave digestion. Food Chem Toxicol, 49, , Belgaied JE: Release of heavy metals from Tunisian traditional earthenware. Food Chem Toxicol, 4, 95-98, Metin M: Süt Teknolojisi. Sütün Bileşimi ve İşlenmesi. 4. Baskı, s , Ege Üniversitesi Mühendislik Fakültesi, No: 33, Bornova, İzmir, Hu H: Human Health and Toxic Metals. In, McCally M (Ed): Life Support: The Environment and Human Health. MIT Press, Mendil D: Mineral and trace metal levels in some cheese collected from Turkey. Food Chem, 96, , Kılıç S, Karagözlü C, Uysal H, Akbulut N: İzmir piyasasında satılan bazı peynir çeşitlerinin kalsiyum, fosfor, sodyum ve potasyum düzeyleri üzerine bir değerlendirme. Gıda, 27 (3): , Yüzbaşı N, Demirözü B: Determination of some essential minerals in cheese and milk. Gıda, 27 (6): , Yalçın Ö, Tekinşen KK: Konya da tüketime sunulan beyaz salamura, tulum ve kaşar peynirlerinin ağır metal içeriklerinin araştırılması. Etlik Vet Mikrobiyol Derg, 22, 5-0, Acar O: Determination and evaluation of copper, lead, iron and zinc contamination levels in cheese and tahini halva by atomic absorption spectrometry. Int J Food Safety, 3, 45-53, Cichoscki AJ, Valduga E, Valduga AT, Tornadijo ME, Fresno JM: Characterization of Prato cheese, a Brazilian semi-hard cow variety: Evolution of physico-chemical parameters and mineral composition during ripening. Food Control, 3, , Fresno JM, Prieto B, Urdiales R, Sarmiento RM, Carballo J: Mineral content of some Spanish cheese varietes. Differentiation by source of milk and by variety from their content of main and trace elements. J Sci Food Agr, 69, , Temurci (Usta) H, Güner A: Ankara da tüketime sunulan süt ve beyaz peynirlerde ağır metal kontaminasyonu. Atatürk Üniv Vet Bil Derg, (-2): 20-28, Ayar A, Sert D, Akın N: The trace metal levels in milk and dairy products consumed in middle Anatolia-Turkey. Environ Monit Assess, 52, -2, Vural H: Ağır metal iyonlarının gıdalarda oluşturduğu kirlilikler. Ekoloji, 8, 3-8, Demirözü-Erdinç B, Saldamlı I: Variation in some heavy metals during the production of white cheese. Int J Dairy Technol, 53 (3): 96-99, Demirci M: Sütün mineral maddeleri ve insan beslenmesindeki önemi. Atatürk Üniv Zir Fak Derg, 2 (): , Tekinşen OC, Tekinşen KK: Süt ve Süt Ürünleri. s , Selçuk Üniversitesi Basımevi, Konya, Türk Gıda Kodeksi: Gıda Maddelerindeki Bulaşanların Maksimum Limitleri Hakkında Tebliğ. Tarım ve Köyişleri Bakanlığı Tebliğ No: 2008/26, Ankara, 2008.

46 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Karın Kaymağı Peynirinden İzole Edilen Laktobasillerin Tanımlanması Tamer TURGUT * Ahmet ERDOĞAN * Mustafa ATASEVER ** * Atatürk Üniversitesi, Erzurum Meslek Yüksekokulu, TR Erzurum - TÜRKİYE ** Atatürk Üniversitesi, Veteriner Fakültesi, TR Erzurum - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmanın amacı, geleneksel olarak üretilen Karın Kaymağı Peynirinden izole edilen laktobasilleri tanımlamak ve bu peynirin bazı fiziksel, kimyasal ve mikrobiyolojik özelliklerini belirlemektir. Araştırmada, Karın Kaymağı Peynirinden izole edilen 07 adet izolatın API 50 CHL kiti ile tanımlanması yapılmıştır. Tanımlanan Lactobacillus suşlarının (82 adet); %47.56 sının Lactobacillus plantarum tip ve tip 2, %2.9 unun L. brevis tip ve tip 3, %0.97 nin L. delbrueckii ssp. delbrueckii, %9.75 nin L. acidophilus tip 3 ve %2.43 ünün ise L. fermentum olduğu bulunmuştur. Tanımlanan izolatlardan Leuconostoc mesenteroides ssp. mesenteroides/dextranicum tip 2 nin ise (25 adet) floranın %24.4 ünü oluşturduğu bulunmuştur. Karın Kaymağı Peynir örneklerinde yapılan analizler sonucu; ortalama kurumadde, yağ, protein miktarlarının sırasıyla %74.66, %43.36 ve %25.5 olduğu bulunmuştur. Toplam aerobik mezofilik bakteri (TAMB) sayısının log kob/g, laktik asit bakteri (LAB) sayısının log kob/g ve maya ve küf sayısının ise log kob/g arasında değiştiği saptanmıştır. Peynir örneklerindeki koliform grubu bakteri, Enterobacteriaceae ve S. aureus sayılarının ise tespit edilebilir seviyenin altında olduğu bulunmuştur (<0 log kob/g). Anahtar sözcükler: Karın Kaymağı Peyniri, API 50 CHL, Laktik asit bakterileri, Tanımlama Identification of Lactobacilli Isolated from Cheese Karın Kaymak Summary This study was carried out to identify lactobacilli isolated from the Cheese Karin Kaymagi produced traditionally techniques and to determine some physical, chemical and microbiological properties. In this study, 07 isolates obtained from Cheese Karin Kaymagi were identified with the API 50 CHL system. The Lactobacillus strains were identified (82 pieces) as follows; 47.56% were Lactobacillus plantarum type and type 2, 2.9% were L. brevis type and type 3,.97% were L. delbrueckii ssp. delbrueckii, 9.75% were L. acidophilus type 3 and 2.43% were L. fermentum. Leuconostoc mesenteroides ssp. mesenteroides/dextranicum type 2 isolates as identified constituted 24.4% of bacterial flora. In the Cheese Karin Kaymagi samples analysed, the average dry matter, fat, protein amounts were found as 74.66%, 43.36% and 25.5%, respectively. The count of total aerobic mesophilic bacteria were found to vary between log cfu/g, lactic acid bacteria counts (LAB) log cfu/g, and yeast and mold counts log cfu/g. In the cheese samples, coliform group bacteria, Enterobacteriaceae and S. aureus counts were found under the acceptable limit (<0 log kob/g). Keywords: Cheeese Karin Kaymagi, API 50 CHL, Lactic acid bacteria, Identification GİRİŞ Peynir, sütün pıhtılaştırılıp peynir altı suyunun ayrılmasından sonra pıhtının değişik şekillerde işlenmesiyle elde edilen, besin değeri ve dayanıklılığı yanında çok sayıda çeşidiyle toplumun gelişen zevk ve isteklerine cevap verebilen önemli bir süt ürünüdür. Ülkemizde 50 den fazla peynir çeşidinin üretildiği bilinmektedir. Bu peynirlerin birçoğu yalnızca belirli bir coğrafi bölgede üretilmekte ve üretildiği yerde tüketilmektedir 2. Ekonomik değere sahip Beyaz, Kaşar ve Tulum peynirlerimizden başka yöresel olarak aile işletmelerinde üretilen peynir çeşitlerinden birisi de Karın Kaymağı Peyniridir. Karın Kaymağı Peynirinin ismi, üretimde kullanılan ambalaj materyali olan işkembeden gelmektedir. Karın Kaymağı Peyniri, iç tüketime yönelik olarak üretilen, olgun, yağ oranı yüksek, besin değeri oldukça İletişim (Correspondence) tmrturgut@yahoo.com

47 20 Karın Kaymağı Peynirinden... yüksek sarımsı renkte, düzgün tekstürde ve yapılışı yöreye özgü bir peynir çeşididir. Doğu Anadolu Bölgesinde Erzurum ve Kars İlleri ile özellikle Kars ın Sarıkamış ilçesi ve köylerinde üretilmektedir 3. Karın Kaymağı Peynirinin üretimine yönelik detaylı bilgi veren çalışmalar mevcuttur 3,4. Laktik asit bakterilerinden Lactobacillus genusu türleri Gram (+), katalaz (-), düzgün çubuk, kokobasil veya uzun zincir oluşturan çubuk şeklindeki bakterilerdir. Lactobacillus genusu türleri doğada oldukça yaygındır. Silajlarda, hayvan ve insanların sindirim sisteminde ve normal süt florasında bulunurlar. Protein parçalama özellikleri tür ve suşa göre değişmekle beraber peptitleri aminoasitlere kadar parçalarlar. Bu sebeple yoğurt ve benzeri ürünlerin yapımında ve sert peynirlerin olgunlaştırılmasında starter kültür olarak kullanılırlar 5. Lactobacillus türleri aynı zamanda gıdalarda en yaygın olarak kullanılan probiyotik bakterilerdir 6. Günümüzde probiyotik bakteri içeren birçok gıda ve özellikle süt ürünleri geliştirilip marketlerdeki yerini almıştır 7,8. Karın Kaymağı Peyniri sahip olduğu kendine has özellikleri ile önemli bir peynir çeşidimizdir. Karın Kaymağı Peyniri üzerinde yapılan araştırmalar üretim tekniği ile fiziksel, kimyasal ve mikrobiyolojik kalitesinin belirlenmesi üzerinedir. Yapılan çalışmalarda bulunan fiziksel kimyasal ve mikrobiyolojik değerlerin birbirinden farklı olduğu ve laktik asit bakteri ve maya ve küf sayısının oldukça yüksek olduğu dikkat çekmektedir 3,9-. Karın Kaymağı Peynirinin mikroflarasını oluşturan laktobasillerin belirlenmesi, üretiminin endüstriyel düzeyde gerçekleştirilmesi için zorunludur. Böylelikle bu peynir çeşidinin daha geniş kitlelere ulaştırılması ve ülkemiz peynir çeşitliliğinin artırılması mümkün olacaktır. Bu araştırmanın amacı, geleneksel olarak üretilen Karın Kaymağı Peynirinden laktobasilleri izole edip, API 50 CHL kitiyle tanımlanması ve örneklerin çeşitli kimyasal değerleri ile bazı mikrobiyolojik özelliklerini belirlemektir. MATERYAL ve METOT Peynir Örnekleri Araştırmada, yılları arasında Kars ili Sarıkamış İlçesi Isısu köyünden toplanan adet Karın Kaymağı Peyniri örneği kullanılmıştır. Kendi orjinal ambalajında (işkembe) alınan örnekler soğukta muhafaza edilerek mümkün olan en kısa süre içinde laboratuara getirilmiştir. Analiz süresince örnekler buzdolabı koşullarında (4 C de) muhafaza edilmiştir. Alınan örneklerde önce mikrobiyolojik analizler için numune alınmış, ardından kimyasal analizler yapılmıştır. Mikrobiyolojik Analizler Mikrobiyolojik analizler için, 0 g örnek steril plastik poşete tartılmış, üzerine 90 ml steril fizyolojik su (%0.85 NaCl (Merck 06404) ilave edilerek Stomacherde (IUL Masticator, Spain) homojenize edilmiştir. Daha sonra bu homojenizattan serum fizyolojik (%0. 85 NaCl) kullanılarak uygun dilüsyonlar hazırlanmıştır. Toplam aerobik mezofilik bakteri (TAMB) sayımı, Plate Count Agar (PCA) (Merck.05463) besiyerinde aerobik şartlarda 30 C de 72 saat süre ile Harrigan a göre 2, Laktik asit bakteri (LAB) sayımı De Man Rogosa Sharpe Agar (MRS) (Merck.0660) besiyerinde anaerobik ortamda (Anaerocult A sistem, Merck.3829) 37 C de 72 saat süre ile Hagen and Narvhus a göre 3, Koliform grubu bakteri ve Enterobacteriaceae sayısı sırasıyla Violet Red Bile Agar (VRB) (Merck.4606) ve Violet Red Bile Dekstrose (VRBD) agar (Merck.0275) besiyerinde 30 C de 24 saat süre ile S. aureus Egg-yolk Tellurite ilaveli Baird-Parker Agar (BPA) (Fluka 705) besiyerinde 37 C'de 24 saat süre ile Harrigan a göre 2 ve Maya ve küf sayısı Potato Dextrose Agar (PDA) (Merck.030) besiyerinde C de 4-5 gün süre ile Özkaya ve Kuleaşan a 4 göre yapılmıştır. Laktobasillerin İzolasyonu ve Tanımlanması Laktobasillerin tür düzeyinde tanımlanabilmesi için; standardize edilmiş tanımlama sistemi API (Analytical Profile Index) 50CHL test kitlerinden (Biomerieux, Marcy l Etoile, France) yararlanılmıştır. API kiti; 49 farklı karbonhidrat kaynağını, dehidre substart olarak içeren 50 adet kuyucuktan oluşmaktadır. Tanımlanması yapılacak olan izolatlar anaerobik ortamda MRS Agar üzerinde 37 C de 72 saat sureyle tek koloni düşecek şekilde aktifleştirilmiş ve bu süre sonunda her bir petri kutusunda gelişen 2-3 mm çapındaki beyaz - krem renkli, yuvarlak - eliptik koloniler seçilmiş ve 2 kez MRS agarda (Merck.0660) saflaştırılmıştır. Saflaştırılan bu izolatlardan Gram pozitif, katalaz negatif ve çubuk şeklindeki bakteriler tanımlama testleri için seçilmiştir. Seçilen izolatlardan her örmek için 0 koloni seçilip tekrar MRS Agara çizilerek ekilmiştir. Anaerobik ortamda gelişen 24 saatlik koloniler steril eküvyon çubuğuyla toplanıp 2 ml lik süspansiyon medyum (ref ) içerisinde 2 Mc Farland (ref ) yoğunluk elde edilinceye kadar inoküle edilmiştir. Bu işlemler her bir izolat için ayrı ayrı yapılmıştır. Karbonhidratların fermente edilmesiyle asidik ortam oluşmakta ve buna bağlı olarak ph düşmektedir. ph düşmesine bağlı olarak indikatörler sayesinde renk değişiklikleri oluşmaktadır. 24 saatlik inkübasyon sonunda tüplerdeki mavi-morumsu renk negatif, sarı, sarı-yeşil renk oluşumu ise pozitif olarak değerlendirilmiş ve suşun biyokimyasal profili elde edilmiştir. Sonuçlar pozitif ve negatif şeklinde sonuç kağıdına işaretlenmiş ve tanımlama, bilgisayar programı (API Lab Plus Program, Biomerieux) yardımıyla elde edilmiştir. Kimyasal Analizler Örneklerde toplam kurumadde miktarı (%) gravimetrik metotla, yağ miktarı (%) Gerber metodu ile yağsız kurumadde miktarı, toplam kurumadde miktarından yağ miktarının çıkarılmasıyla, asitlik derecesi % laktik asit cin-

48 2 TURGUT, ERDOĞAN ATASEVER sinden titrasyon metodu ile belirlenmiştir 5. Örneklerdeki % azot miktarı mikrokjeldahl yöntemiyle belirlenmiş ve bu miktarın 6,38 faktörü ile çarpılmasıyla protein miktarı (%), bulunmuştur. Tuz miktarı Mohr yöntemi ve ph değeri ph metre (WTW 350İ) kullanılarak belirlenmiştir 6. BULGULAR Karın Kaymağı Peynirine ait bazı fiziksel ve kimyasal analiz sonuçları Tablo de verilmiştir. Tablo de görüleceği gibi kurumadde oranı en düşük %59.73, en yüksek %85.43 ve ortalama olarak %74.66 bulunmuştur. Karın Kaymağı Peyniri örneklerinin yağ oranları %35-52 gibi geniş bir aralıkta değişmiş ve ortalaması %43.36 bulunmuştur. İncelenen örneklerde protein miktarı oranı ise ortalama %25.5 olmuştur Bu sonuçlar Karın Kaymağı Peynirinin yüksek besin değerine sahip olduğunu göstermektedir. Peynir örneklerin % asitlik değerleri ve ph değerleri arasında değişmiş ortalamaları ise sırasıyla %.665 ve 4.93 olmuştur. Araştırmada Karın Kaymağı Peyniri örneklerindeki % tuz miktarları arasında bulunmuş ve ortalaması %4. olmuştur. Kül miktarı ortalamasının ise %4.68 olduğu saptanmıştır (Tablo ). Karın Kaymağı Peynir örneklerine ait bazı mikrobiyolojik analiz sonuçları (log kob/g), Tablo 2 de verilmiştir. Tablo 2 den görüleceği gibi, Karın Kaymağı Peyniri örneklerin toplam aerobik mezofilik bakteri sayıları (TAMB) log kob/g, laktik asit bakteri (LAB) sayıları log kob/g, maya ve küf sayıları ise log kob/g arasında değişmektedir. İncelenen tüm peynir örneklerde koliform grubu bakteri, Enterobacteriaceae sayısı ve S. aureus sayısı tespit edilebilir seviyenin altında (<0 log kob/g) bulunmuştur. Bu sonuçlar Karın Kaymağı Peynirinin mikrobiyolojik kalitesinin yüksek olduğunu göstermektedir. Karın Kaymağı Peynirinin yapımında kullanılan işkembenin daha önceden temizlenmiş, 8-0 dak. haşlanmış ve kurutulmuş olduğu bildirilmektedir 4. Karın Kaymağı Peynirinden izole edilip API 50 CHL ile tanımlanan izolatların dağılımı Tablo 3 te verilmiştir. Tablodan izlenebileceği gibi izole edilip tanımlanan 07 adet suşun 82 tanesinin (%76.6) Lactobacillus türü olduğu tespit edilmiştir. Tanımlanan izolatlardan Leu. mesenteroides ssp mesenteroides/ dextranicum tip 2 ise (25 adet) floranın %24.4 nü oluşturmaktadır. Tablo. Karın Kaymağı Peyniri örneklerinin bazı kimyasal analiz sonuçları Table. Some chemical analysis results of Cheese Karın Kaymak samples Örnek No KM, % Yağ, % Yağsız KM, % Protein, % Asitlik, % ph Kül, % Tuz, % Ort ± ± ± ± ± ± ± ±0.53 KM: Kuru madde Tablo 2. Karın Kaymağı Peynirine ait bazı mikrobiyolojik analiz sonuçları (log kob/g) Table 2. Some microbiological analysis results of Karın Kaymagı Cheese (log cfu/g) Örnek No TAMB Sayısı LAB Sayısı Koliform Grubu Sayısı <0 <0 <0 <0 <0 <0 <0 <0 <0 <0 <0 Enterobacteriaceae Sayısı <0 <0 <0 <0 <0 <0 <0 <0 <0 <0 <0 S. aureus Sayısı <0 <0 <0 <0 <0 <0 <0 <0 <0 <0 <0 Maya - Küf Sayısı Ort. 7.94± ±0.36 <0 <0 < ±

49 22 Karın Kaymağı Peynirinden... Tablo 3. Karın Kaymağı Peynirinden izole edilen ve tanımlan suşların dağılımı Table 3. Distribution of the strains isolated and identified from the Karın Kaymagı Cheese Tanımlanan Suş Toplam L. brevis tip L. brevis tip3 L. plantarum tip L. plantarum tip 2 Leu. mesenteroides ssp. mesenteroides/dextranicum 2 L. delbrueckii ssp lactis tip L. delbrueckii ssp delbrueckii L. fermentum tip L. fermentum tip 2 L. acidophilus tip TARTIŞMA ve SONUÇ Araştırmada, adet Karın Kaymağı Peynir örneğinden izole edilen 07 adet suşun tanımlanması yapılmış ve peynirin bazı fiziksel kimyasal ve mikrobiyolojik nitelikleri belirlenmiştir. Bu çalışma sonucunda elde edilen bulgular daha önce Karın Kaymağı Peyniri üzerine yapılmış araştırmalarla karşılaştırıldığında; çalışmamızda bulduğumuz %74.66 kurumadde, %43.36 yağ, %25.5 protein ve %.665 asitlik değerleri ortalamalarının Çakmakçı ve ark. 9 ile Yangılar ve Dağdemir 7 tarafından bulunan değerlerden daha yüksek olduğu görülmektedir. Çakmakçı ve ark. 9 ortalama kurumadde oranını %69., yağ oranını %39.0 ve protein oranını %9.0 olarak bildirmişlerdir. Yangılar ve Dağdemir 7 tarafından verilen %44.98 kuru madde, %8.95 yağ ve %28.47 protein değerleri ise hem bizim hemde Çakmakçı ve ark. 9 tarafından bulunan değerlerden daha düşüktür. Bunun durum Karın Kaymağı Peynirinin yapımında belirli bir standardın olmadığını göstermektedir. Çalışmada, % kül ve tuz miktarı için bulduğumuz değerler her iki araştırmacı tarafından verilen değerlerden daha düşük olmuştur. Karın Kaymağı Peynirinin mikrobiyolojik özellikleri üzerine yapılan çalışmalarda, Özdemir ve ark. ortalama TAMB sayısının 7.08 log kob/g, LAB sayısının 6. log kob/g ve maya küf sayısının 4.96 log kob/g olduğunu, Çakmakçı ve ark. 0 ise TAMB sayısının log kob/g, LAB sayısının log kob/g ve maya küf sayısının log kob/g arasında değiştiğini belirtmişlerdir. Bizim bulduğumuz sonuçlar ise TAMB ve LAB sayısı için Çakmakçı ve ark. 0 tarafından bulunan sonuçlardan düşük, Özdemir ve ark. tarafından bulunan sonuçlardan yüksek olmuştur. Araştırmada saptadığımız maya küf sayısı ise diğer iki araştırıcı tarafından verilen değerlerden daha düşük bulunmuştur. Karın Kaymağı Peynir örneklerde koliform grubu bakteri, sayısı tespit edilebilir seviyenin altında (<0 log kob/g) bulunmuştur. Özdemir ve ark. tarafından yapılan çalışmada da koliform grubu bakteri sayısının <-.69 log kob/g arasında değiştiği saptanmıştır. Bu bakımdan sonuçlar birbirleriyle uyumludur. Tulum Peyniri ve Van Otlu Peyniri gibi diğer yöresel peynirlerdeki LAB nin belirlenmesi üzerine çalışmalar yapılmasına karşın Karın Kaymağı Peynirinde bu amaçla yapılmış çalışma bulunmamaktadır. Yaptığımız çalışmada tanımlanan suşların sayı ve oranları şu şekildedir: L. plantarum tip (33 adet) %40.24, L. brevis tip ( adet) %3.4, L. delbrueckii ssp. delbrueckii (9 adet) %0.97, L. acidophilus tip 3 (8 adet) %9.75, L. brevis tip 3 (7 adet) %8.53, L. plantarum tip ve L. delbrueckii ssp lactis tip (6 şar adet) %7.3 ve L. fermentum ise tip -2 (2 adet) %2.43. Çalışmamızda, laktobasil türleri Karın Kaymağı Peynirinin dominant florasını teşkil etmişlerdir. Sağdıç ve ark. 8, Van yöresine özgü otlu peynirden izole ettikleri suşların L. plantarum, L. casei ssp. casei, L. brevis, Pediococcus pentosaceus, P. acidilactici, Enterococcus faecalis ve E. faecium olduğunu, dominant florayı ise L. plantarum, L. casei ve P. pentosaceus un oluşturduğunu bildirilmişlerdir. Bizim çalışmamızda da L. plantarum ve L. brevis dominant florayı oluşturmaktadır. Öner ve ark. 9, Tulum peynirinde üzerine yaptıkları çalışmada izole edip tanımladıkları 202 adet suştan 98 tanesinin Lactobacillus ssp. (%48.5) olduğunu ve en fazla sayıda tanımlanan suşun ise L. paracasei ssp. paracasei (%2.4) olduğunu tespit etmişlerdir. Öksüztepe ve ark. 20 tarafından Tulum peynirlerinin olgunlaşması sırasında mikrofloranın değişimi üzerine yapılan başka bir çalışmada da, olgunlaşmanın ilerleyen safhalarında laktobasillerin tulum peynirinde baskın florayı oluşturduğunu, L. casei ssp. casei ve L. plantarum un olgunlaşmada önemli rol oynadığını belirtmişlerdir. Bu çalışma ile Karın Kaymağı peynirine özgü laktobasillerin tanımlanması yapılmış ve sonuç olarak laktobasil türlerinin Karın Kaymağı peynirinin dominant florasını teşkil ettiği saptanmıştır. Geleneksel usullerle üretilen Karın Kaymağı peynirinden izole edilip tanımlanan suşların gelecekte bu peynirin modern usullerle üretilmesi sırasında en uygun starter kültür tiplerinin belirlenmesi ve kullanılmasına katkı sağlayacağı ve bu peynire has tat,

50 23 TURGUT, ERDOĞAN ATASEVER koku ve yapının korunmasına yardımcı olacağı düşünülmektedir. Bu sayede yöresel peynir çeşitlerimize özgü mikrobiyal zenginliğin korunması ve gelecek kuşaklara aktarılması yolunda bir adım daha atılmış olacaktır. KAYNAKLAR. Kaynar Z, Kaynar P, Koçak C: Ankara piyasasında tüketime sunulan beyaz peynirlerin hijyenik kalitesinin belirlenmesi üzerine bir araştırma. Türk Hij Den Biyol Derg, 62 (-2-3): -0, Hayaloğlu AA: Türkiye nin peynirleri - Genel bir perspektif. Türkiye 0. Gıda Kongresi, s , 2-23 Mayıs, Erzurum, Turgut T, Çetin B, Şengül M, Çağlar A, Çakmakçı S: Karın Kaymağı Peyniri. II. Geleneksel Gıdalar Sempozyumu, Mayıs, Van, Çetinkaya A, Yaman H, Elmalı M, Karadağoğlu G: Geleneksel lezzetler - Kars Gravyer Peyniri. Gıda Müh Derg, 0 (22): 39-40, Kılıç S: Süt Endüstrisinde Laktik Asit Bakterileri. I. Baskı. Ege Üniv. Ziraat Fak. Yayınları No: 542, Bornova - İzmir, Ouwehand AC, Salminen S, Isolauri E: Probiotics: An overview of benefical effects. Anton Leeuw Int J G, 82, , Helland MH, Wicklund T, Narvhus JA: Growth and metabolism of selected strains of probiotic bacteria in milk- and water- based cereal puddings. Int Dairy J, 2, , Saarela M, Rantala M, Hallamaa K, Nohynek L, Virkajärvi I, Mättö J: Stationary-phase acid and heat treatment for improvement of the viability of probiotic lactobacilli and bifidobacteria. J Appl Microbiol, 96, , Çakmakçı S, Şengül M, Çağlar A: Karın kaymağı peynirinin üretim tekniği ve bazı fiziksel ve kimyasal özellikleri, Gıda, 20 (4): , Çakmakçı S, Şengül M, Çağlar A: The microbiological and chemical qualities of Karın Kaymağı Cheese produced in Turkey. Milchwissenschaft, 50 (): , Özdemir S, Yangılar F, Özdemir C: Determination of microbiological characteristics of Turkish Karin Kaymagi Cheese packaged in different materials. Afr J Microbiol Res, 4 (9): 76-72, Harrigan WF: Laboratory Methods in Food Microbiology, 3 rd ed., 532 p., Academic Press, London, Hagen M, Narvhus A: Production of ice cream containing probiotic bacteria. Milchwissenschaft, 54 (4): , Özkaya DF, Kuleaşan H: Maya ve Küf. Gıda Mikrobiyolojisi ve Uygulamaları. II. Baskı. Sim Matbaacılık, Ankara, Kurt A, Çakmakçı S, Çağlar A: Süt ve Mamulleri Muayene ve Analiz Metotları Rehberi. 7. Baskı. Atatürk Üniversitesi Ziraat Fakültesi Yayınları, No: 8, Erzurum, Metin M, Öztürk GF: Süt ve Mamulleri Analiz Yöntemleri. I. Baskı. Ege Meslek Yüksekokulu Basımevi, Bornova - İzmir, Yangılar F, Dağdemir E: Geleneksel bir lezzet: Karın Kaymağı Peyniri. Gıda Müh Derg, 33, 33-36, Sağdıç O, Şimşek B, Küçüköner E: Microbiological and physicochemical characteristics of Van herby cheese, a traditional Turkish dairy product. Milchwissenschaft, 58 (7-8): , Öner Z, Sağdıç O, Şimşek B: Lactic acid bacteria profiles and tyramine and tryptamine contents of Turkish tulum cheeses. Eur Food Res Technol, 29 (5): , Öksüztepe G, Patır B, Çalıcıoğlu M: Identification and distribution of lactic acid bacteria during the ripening of Şavak Tulum Cheese. Turk J Vet Anim Sci, 29, , 2005.

51 Kafkas Univ Vet Fak Derg 8 (2): 25-29, 202 DOI:0.9775/kvfd RESEARCH ARTICLE Determination of Pre-parturition and Post-parturition Behaviors of Norduz Goats Ayhan YILMAZ * Serhat KARACA ** Aşkın KOR ** Mehmet BİNGÖL ** * Department of Animal Sciences, Hizan Vocational School, Bitlis Eren University, TR-3000 Bitlis - TURKEY ** Department of Animal Sciences, Agricultural Faculty, Yüzüncü Yıl University, TR Van - TURKEY Makale Kodu (Article Code): KVFD Summary The objective of this study was to determine of pre-parturition and post-parturition behaviors of Norduz Goats. Animal subjects consisted of 8 primiparous single-birth does aged 2-3 years. During the kidding time, the goats were recorded with digital video cameras for one hour pre parturition and 24 h post-parturition in order to register parturition traits. Twelve does (67%) gave birth while being recumbent and six (33%) while standing (P<0.0). The majority of kidding (n=2, 67 %) occurred between h, followed by h (n=4, 22%) and h (n=2, %). The majority of does (n= 83 %) accepted and nursed their kids after parturition; however, 3 does (7%) rejected their kids after parturition. Of those does who accepted their kids, 4 (93%) refrained from feeding throughout the observation period, whereas only (7%) left her kid to feed during this period (/5). The duration of parturition, the duration of placenta expulsion, the latency to first sniffing, the latency to first licking, the latency to first suckling, the duration of first suckling, the latency to first standing, and the duration of standing at the birth site were 2.99±2.49 min., 20.74±6.98 min., 0.64±0.39 min., 0.82±0.22 min., 22.65±2.37 min., 0.62±0.3 min., 7.50±2.42 min. and 4> hrs., respectively. These results clearly suggest that in Norduz goats the parturition behavior occurs within four hours after the parturition, and also Norduz goats are observed to be having a normal maternal behavior regarding with investigated behavioral characteristics Keywords: Norduz goat, Licking, Rejection, Behavior Özet Norduz Keçilerinde Doğum Öncesi ve Doğrum Sonrası Davranışlarının Belirlenmesi Bu çalışmanın amacı doğum öncesi ve doğum sonrası Norduz keçilerinde doğum davranışını belirlemek amacıyla yapılmıştır. Hayvan materyalini 8 tekiz doğuran Norduz keçisi (2-3 yaşlı) oluşturmuştur. Keçilerin doğum davranışları barınakta kurulan dört kamera ile kaydedilmiştir. Deneme materyali keçilerin %67 si (n= 2) yerde yatarak doğum yaparken %33 ü (n= 6) ayakta durur pozisyonda doğum yapmıştır (P<0.0). Norduz keçilerinde doğumların %67 si (n= 2) arasında, %22 si (n= 24) saatleri arasında % i (n=2) ise saatleri arasında gerçekleşmiştir. Doğum sonrası 5 keçi (%83) yavrusuna ilgi göstermiş ancak 3 baş (%7) yavrusunu reddetmiştir. Yavrusunu kabul eden 5 baş keçiden 4 ü yem yeme davranışında bulunmazken sadece bir baş keçi yeme davranışı göstermiştir. Keçilerde doğum süresi, plasentanın atılma süresi, ilk koklamaya kadar geçen süre, ilk yalamaya kadar geçen süre, ilk emiştirmeye kadar geçen süre, ilk emiştirme süresi, oğlakların ayakta kalmasına kadar geçen sure ve doğum yerinde kalma süresi ortalamaları sırasıyla 2.99±2.49, 20.74±6.98, 0.64±0.39, 0.82±0.22, 22.65±2.37, 0.62±0.3, 7.50±2.42 dakika ve 4> saat olarak saptanmıştır. Bu sonuçlar tekiz doğuran Norduz keçilerinde doğum davranışının doğumdan sonra ilk dört saat içerisinde gerçekleştiğini ve aynı zamanda incelenen davranışsal özellikler bakımında normal bir analık davranışa sahip oldukları gözlemlendi. Anahtar sözcükler: Norduz keçi, Yalama, Reddetme, Davranış INTRODUCTION The present production systems have limited the opportunity to exhibit natural maternal care behavior of livestock species making some manipulative changes, especially in semi-intensive or intensive commercial farms. İletişim (Correspondence) yilayhan658@hotmail.com

52 26 Determination of Pre-parturition... In a plan of intensive livestock production system, however, it has been a vital issue to consider high standards of animal welfare and thus to develop the efficient management techniques which permit to exhibit the natural behavior requirements,2. Goat is different from sheep an in terms of the organization of maternal care. The goat, called as hider species, leaves her offspring behind while grazing during the first few days after parturition. In pre-parturient period the goats tended to isolate themselves from its flocks for proper maternal care and bonding. For goats, the organization of maternal care is established within 4 h after parturition 3-6. For mammals, although fertilization is an essential process, the ability to rear young is also a critical factor in this process. In fact, the presence of well-adapted maternal behavior at parturition is necessary for the survival of the newborn. Recently, pre-weaning mortality has been a growing problem in animal breeding worldwide, with the majority of deaths occurring during the neonatal or postnatal period. Abnormal parturition behavior in sheep and goats plays an important role in the post-parturition mortality of kids. Besides poor management systems, mismothering is the main cause of pre-weaning mortality. Improvements in management systems can reduce the likelihood of mismothering and improve survival rates among kids. In order to accurately assess the economic aspects of animal improvement programs, behavioral characteristics must be evaluated along with the other factors; however, little is known about the behavioral characteristics related to parturition behavior in goats. Knowledge of the material and topographic features of paddocks and the time periods during which births may be expected to occur are also important 7-9. The aim of the present study was to determine behavioral characteristics of primiparous goats of Norduz (single-birth) one hour pre-parturition and four hour postparturition pattern of goats. MATERIAL and METHODS The study was carried out on goat flock in the Yüzüncü Yıl University Faculty of Agricultural in Van, Turkey ( N, W). Eighteen primiparous Norduz goats (8 single-birth) were selected for the study. The pregnant does were housed as a single flock in a barn two weeks before the parturition and throughout the parturition period (about 25 does; minimum area:.5 m 2 per doe). Does were fed twice a day with alfalfa and barley mixture, and given to access the water (at and 4.00). All does were permitted to choose their own parturition sites within the barn in which they were normally housed and to remain there throughout the experiment. At the same time, does and their kids were permitted to remain together throughout the observation period. Digital video cameras (Sony Super Had CCD, mm :/4 lens) were placed in all four corners of the barn in order to provide a full, continuous view of all animals throughout the experiment. Images were transferred to computers and recorded on DVD. The video cameras were recorded continuously for 24 h, but we only evaluated during one h pre-parturition and at 4 h post-parturition for behavior parameters examined. The parturition behavior of Norduz goats was evaluated according to Ramίrez et al. 0, Romano and Piaggoi and Martinez et al. 9. These parturition behaviors were the birth shape (%), the time of birth (%), the rejection (%), the eating (%), the licking (%), the duration of parturition (min), the duration of placenta expulsion (min), the latency to first sniffing (min), the latency to first licking (min), the latency to first suckling (min), the duration of first suckling (min), the latency to first standing (min) and the duration of stay at birth site (h), respectively. Data was analyzed using the SAS 2 statistical software program, with the two-proportion Z test used to make comparisons between the groups. RESULTS The behavioral characteristics of Norduz primiparous does in pre-parturition are shown in Table. Twelve single-birth does (67%) gave birth while recumbent, the remaining six (33%) gave birth standing. There is significant differences regarding the shape of birth (P<0.0). Also, we found that in Norduz primiparous does a large proportion of kidding occurred between 2.00 and 8.00 h, with the lowest percentage occurring between and h. Table. Behavioral characteristics of Norduz goats during parturition Tablo. Doğum sırasında Norduz keçilerinde davranışsal özellikler Behavioral Characteristics % Birth shape Recumbent % Standing % Time of birth 67 (2) a 33 (6) b h 67 (2/8) a h 22 (4/8) b h (2/8) b Rejection (%) 7 (3/8) Eating (%) 6 (/5) Licking Head (%) 57 (8/5) a Genital area (%) 36 (5/5) a Rest of body (%) 7 (2/5) b a,b The differences among the values for every behavior characteristic are statistically important (P<0.0)

53 27 YILMAZ, KARACA KOR, BİNGÖL The 22% of Norduz primiparous does were kidded between 8.00 and h (P<0.0). At the same time, fifteen single-births does accepted their kids after parturition, and nursed near to their kids throughout observation while three single-births does (3/8) rejected their kids after the parturition. Fourteen single -births does accepting their kids did not eat throughout the observation, and stayed near their kids at postpartum, whereas only one doe ate (/5). The behavioral characteristics of Norduz primiparous does pre parturition are shown in Table. The areas of the newborns bodies were divided to evaluate the place of licking, where does first directed their actions, like the head, the genital area, the rest of body. The licking of head, the genital area, the rest of body in Norduz primiparous does were 57%, 36%, and 7%, respectively (P<0.0). All Does mainly directed to their kids head immediately after birth, except for the rejections. The behavioral characteristics of Norduz primiparous does pre parturition are shown in Table 2. The duration of parturition, the duration of placenta expulsion, the latency to first sniffing, the latency to first licking, the latency to first suckling, the duration of first suckling, the latency to first standing, and the duration of standing at the birth site were 2.99±2.49 min, 20.74±6.98 min, 0.64±0.39 min, 0.82±0.22 min, 22.65±2.37 min, 0.62±0.3 min, 7.50±2.42 min and 4> h, respectively. occurred between hr; Boch et al. 4 reported that goat parturition to have an unmodal distribution, with 90.6% of deliveries occurring between h, the majority at midday and the fewest at around midnight; Das and Tomer 5 found that 80% of births occurred between h, with a major peak at about 6.00 h; Yamin et al. 6 reported that Angora goats give birth more frequently during daylight hours; and Romano and Piaggio 0 found that 78% of births occurred during daylight hours, with 65.7% occurring between h (P<0.0). In contrast to these findings, Stevens 7 and George 8 found that 28% and 20%, respectively, of births occurred during daylight hours, and Lindahl 9 found no significant differences in the percentage of births occurring during the day ( h) and night ( h) (45.6% and 54.4%, respectively; P>0.05). The majority of does (n=5, 83%) accepted and nursed their kids after the parturition, 3 does (7%) rejected their kids after the parturition. Of those does who accepted their kids, 4 (93%) refrained from feeding throughout the observation period, whereas doe (7%) left her kid to feed during this period (/5). First licking was directed primarily at the head (57%), followed by the genitals (36%) and the remainder of the body (7%), with the differences between areas of first licking statistically significant (P<0.0). With the exception of those does that rejected their kids, licking was directed mainly at the head of the kid immediately after birth. Licking is known to stimulate the respiratory system, Table 2. Parturition-related characteristics of primiparous Norduz goats Tablo 2. Tekiz doğuran Norduz keçilerinde doğumla ilgili özellikleri Behavioral Characteristics n X±Sx Minimum Maximum Duration of parturition, min ± Duration of placenta expulsion, min ± Latency to first sniffing, min ± Latency to first licking, min ± Latency to first suckling, min ± Duration of first suckling, min ± Latency to first standing, min ± Duration of stay at birth site, h 5 4> - - DISCUSSION In this study, the majority of does (n=2, 67%) gave birth while recumbent, whereas the remaining does (n=6, 33%) gave birth standing. The difference in birth posture was statistically significant (P<0.0). These findings were in line with those of Ramίrez et al. 0, who reported most goats birthed while lying down (73%). The majority of kidding in primiparous goats (n=2, 67%) occurred between h, followed by h (n=4, 22%) and h (n=2, %). Differences in the time of kidding were statistically significant (P<0.0). Lickliter 3 found 72%of births thereby facilitating breathing; to help removing the fetal membrane; and to stimulate peripheral blood circulation of the kid following birth. The phenomenon of licking in goats has been outlined in numerous studies 0,3,20. In contrast to small ruminant animals, Owens et al. 2 found that the majority of cows (2/23) start licking their calves near the abdomen and sides, paying particular attention to breaking the umbilical cord. In sum, Norduz goats exhibited highly developed maternal behavior, in general caring exclusively for their offspring in the period immediately following birth, and most births occurred during day time and the birth shape was lying down.

54 28 Determination of Pre-parturition... The present study found the mean duration of parturition in Norduz primiparous does to be 2.99±2.49 min. This value was similar to the value given in Das and Tomer 5 for Beetal does (0-30 min), but lower than that given by Martinez et al. 9 for Murciano Granadina goats (60.48 mean). The differences between study findings may be due to differences in contraction times. In the present study, the mean duration of placenta expulsion was 20.74±6.98 min (minimum: min; maximum: 58.0 min) (Table 2). Although Das and Tomer 5 reported a lower mean value (49 min) for complete expulsion of the placenta, their finding is within the range of minimum and maximum values found in the present study. Immediately following birth, does in this study typically stood up, turned around and began vigorously sniffing and licking their kids. First sniffing was observed to occur immediately after birth (0.64±0.39 min). This finding is similar to that of Martinez et al. 9, who found a value of s for first sniffing, and to Lickliter 2, Sambraus and Wittmann 20 and Malfatti et al. 22, who indicated that sniffing and licking commenced immediately following parturition in small ruminants. However, this finding differed from that of Ramίrez et al. 0, who found a latency of 8.7±0.8 min for first sniffing among single-birth does. In fact, in our study, the range of latency to first licking varied widely from 0.05 min to 6.40 min. In the present study, latency to first licking was 0.82±0.22 min and occurred immediately after first sniffing. Latency to first licking was shorter than in Ramίrez et al. 0, who reported a time of 3.3±.0 s. for single-birth kids, but longer than Martinez et al. 9, who reported latency to first licking to be 98.6 s. In general, the findings of this study regarding suckling are in line with those of other authors 2,9,2. Most kids in this study (5 of 8) were able to suckle during the first hour post-partum; however, three kids were rejected by their mothers and were unable to suckle. Mean latency to first suckling was 22.65±2.37 min. This finding is in contrast to Martinez et al. 9, who reported min to mean suckling for single-birth kids. Duration of first suckling in the present study was 0.62±0.3 min, which is similar to that of Sambrauss and Wittmann 20, who reported the duration of first suckling to be 0.63 min, but it differs from Ramίrez et al. 0 and Martinez et al. 9, who reported shorter durations for first suckling. In line with Ramίrez et al. 0 and Martinez et al. 9, all kids in the present study succeeded in standing during the first hour of life. Mean latency to first standing of kids in the present study was 7.50±2.42 min, which is similar to the findings for single-birth kids reported by Martinez et al. 9, Sambrauss and Wittmann 20 and Ramίrez et al. 0, who observed latency to standing to be 6.87 min, 8.7 min and 9.37 min, respectively. In addition, with the exception of the 3 does who rejected their kids, the does in this study did not leave their kids during the 4-hour post-partum observation period. This finding is important in terms of the bond developed between mother and kid. In conclusion, in pre-parturient period Norduz goats isolated from themselves their flocks and most births occurred during day time, and the birth shape was lying down. Consistent with findings of other studies, the maternal care was established immediately following the birth. Immediately following the birth, does in this study typically stood up, turned around and began vigorously sniffing and licking their kids, and thus within 4 h after the parturition all postnatal behaviors evaluated except for the duration of standing at the birth was developed. Especially, in intensive selected populations, ability of parturition behavior shows an increasing decrease and causes seriously the lost of economic in developed countries using modern production systems. Therefore, in intensive production system planning based on natural behavioral characteristics of domestic animals, producers should be considered the selection related to maternal behavior because domestication decrease the ability of maternal behavior. Acknowledgements We would like to thank Dr. Abdullah Yeşilova for his statistical support and the Yüzüncü Yıl University, Faculty of Agriculture in Van, Turkey for providing the animals used. REFERENCES. Miranda-dela L, Mattiello GC: The importance of social behavior for goat welfare in livestock farming. Small Rumin Res, 90, -0, Arslan C: İneklerde beslenme davranışları. Kafkas Univ Vet Fak Derg, 5 (4): , Addae PC, Awotwi EK, Oppong-Anane K, Oddoye EOK: Behavioural interactions between West African dwarf nanny goats and their singleborn kids during the first 48 hours post-partum. Appl Anim Behav Sci, 67, 77-88, Poindoron P: Mechanisms of activation of maternal behavior in mammals. Reprod Nut Dev, 45, 34-35, Poindoron P, Terrazas A, Navarro Montes de Oca ML, Serafin N, Hernández H: Sensory and physiological determinants of maternal behavior in the goat (Capra hircus). Hormones and Behavior, 52, 99-05, Poindoron P, Levy F, Keller M: Maternal responsiveness and maternal selectivity in domestic sheep and goats: The two facets of maternal attachments. Developmental Psychobiology, 49, 54-70, Awemu EM, Nwakalor LN, Abubakar BY: Environmental influence on preweaning mortality and reproductive performance of Red Sokoto does. Small Rumin Res, 34, 6-65, Mellor DJ, Stafford KJ: Animal welfare implications of neonatal mortality and morbidity in farm animals. Vet J, 68,8-33, Martinez M, Otal J, Ramίrez A, Hevia ML, Quiles A: Variability in the behavior of kids born of primiparous goats during the first hour after parturition: Effect of the type of parturition, sex, duration of birth, and maternal behavior. J Anim Sci, 87, , Ramίrez A, Quiles A, Hevia M, Sotillo F: Behavior of Murciano- Granadino goat in the hour before parturition. Appl Anim Behav Sci, 44, 29-35, Romano JE, Piaggio J: Time of parturition in Nubian goats. Small Rumin Res, 33, , S.A.S: User s Guide: Statistics. SAS Inst. Inc., Cary, NC, 200.

55 29 KARABAĞ, ALKAN MENDEŞ 3. Lickliter RE: Bahviour associated with parturition in the domestic goat. Appl Anim Behav Sci, 3, , Bosc M, Guillimin P, Bourgy G, Pignon: Hourly distribution of time of parturition in the domestic goat. Theriogenology, 30, 23-33, Das N, Tomer OS: Time pattern on parturition sequences in Beetal goats and crosses: Comparison between primiparous and multiparous does. Small Rumin Res, 26, 57-6, Yamin M, Payne G, Blackshaw JK: The Time of birth and the choice of birth sites by Booroola Merino ewes and Angora goats. Appl Anim Behav Sci, 45, 89-96, Stevens D, Alexander G, Lynch JJ: Do Merino ewes seek isolation or shelters at lambing? Appl Anim Etiology, 7, 49-55, George JM: Variation in the time of parturition of Merino and Dorset Horn ewes. J Agri Sci (Camb.): 73, , Lindahl IL: Time of parturition in ewes. Anim Behav, 2, , Sambrauss HH, Wittmann M: Beoachtungen zu geburtsabrauf and saugverhalten von ziegen. Tierarztl Prax, 7, , Owens JL, Edey TN, Bindon BM, Piper LR: Parturient behavior and calf survival in a herd selected for twinning. Appl Anim Behav Sci, 3, , Malfatti A, Lucaroni A, Debenedetti A: Behaviour associated with parturition in the domestic goat. Appl Anim Behav Sci, 30, 9, 99.

56 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Effects of Malathion in Fetal Kidney Tissues in Pregnant Rats: Teratogenic Effects Induced by Different Doses Harun ALP * Muhammet Erdal SAK ** Mehmet Sıddık EVSEN ** Ugur FIRAT *** Osman EVLIYAOGLU **** Necmettin PENBEGUL ***** Ahmet Ali SANCAKTUTAR ***** Haluk SOYLEMEZ ***** Mehmet TUZCU ****** * Mustafa Kemal University, Medical Faculty, Department of Pharmacology, TR-3040 Hatay - TURKEY ** Dicle University, Medical Faculty, Department of obstetrics and gynecology, TR-2280 Diyarbakir - TURKEY *** Dicle University, Medical Faculty, Department of Pathology, TR-2280 Diyarbakir - TURKEY **** Dicle University, Medical Faculty, Department of Biochemistry, Diyarbakir- TURKEY ***** Dicle University, Medical Faculty, Department of Urology, TR-2280 Diyarbakir - TURKEY ****** Cumhuriyet University, Veterinary Faculty, Department of Pathology, TR-5840 Sivas - TURKEY Makale Kodu (Article Code): KVFD Summary The aim of this study was to investigate the teratogenic effects of Malathion (ML) induced by different doses on fetal kidney tissues in pregnant rats. A total of 28 Sprague-Dawley pregnant rats were randomly divided into 4 groups of 7 rats each. Depending on ML dose, four groups were formed, including (I) control, (II) ML 2.5 (ML 2.5 mg/kg/day, orally), (III) ML 5 (5 mg/kg/day, orally), and (IV) ML 0 (0 mg/kg/day, orally). ML application started when the male and female were put together (when mating started). Daily ML application was continued until birth. It was determined that in parallel with dose of ML, ML resulted in toxic effects on serum enzymes (acetyl-cholinesterase (AChE), amylase and lipase) and kidney tissues of pregnant rats, and also -regardless of ML dose in fetal kidneysit led to teratogenic effects in all the doses. Biochemical data wasconfirmed by histopathologic data. We concluded that ML leads to kidney damage in both pregnant and fetal rats as a result of its teratogenic and toxic effects. Keywords: Fetus, Pregnant rat, Organophosphate, Prenatal exposure, Teratogenic effect Özet Gebe Ratlara Farklı Dozlarda Uygulanan Malathionun Fetüs Böbrek Dokusu Üzerine Teratojenik Etkileri Bu çalışmanın amacı gebe ratlara düşük dozlarda subakut uygulanan Malathion (ML) un fetüs böbrek dokusu üzerine teratojenik etkisini araştırmaktır. Toplam 28 Sprague-Dawley gebe rat randomize olarak her grupta 7 adet gebe rat olacak şekilde 4 gruba ayrıldı. ML un dozuna bağlı olarak, gruplar; kontrol, ML 2.5 (2.5 mg/kg/gün dozunda oral yoldan (p.o) ML uygulandı), ML 5 (5 mg/kg/gün, p.o) ve ML 0 (0 mg/kg/gün, p.o) olmak üzere 4 gruba ayrıldı. ML uygulamsı erkekler ve dişilerin aynı ortama konulmasından itibaren başladı (çiftleşmeden itibaren). Günlük ML uygulamasına doğuma kadar devam edildi. ML un, dozuna paralel bir şekilde gebe ratlarda böbrek dokusu ve serum enzimleri (asetilkolinesteraz (AChE), lipaz, amilaz) üzerine toksik etkiler oluşturduğu, ayrıca yavru rat böbreklerinde ise ML un dozuna bağlı olmayarak, tüm dozlarda teratojenik etkiye neden olduğu belirlendi. Histopatolojik veriler biyokimyasal verileri doğruladı. ML un düşük dozlarının bile hem anne hem de yavru böbrekleri üzerine toksik ve teratojenik böbrek hasarına neden olduğu sonucuna varıldı. Anahtar sözcükler: Fetüs, Gebe rat, Organofosfat, Prenatal maruziyet, Teratojenik etki INTRODUCTION Toxicologic evidences indicate that low-level exposure to organophosphate pesticides (OP) may affect neurodevelopment and growth in developing animals and children. Several studies have revealed that fetotoxicity İletişim (Correspondence) alpharun@gmail.com

57 222 Effects of Malathion in... and marked neurochemical changes may occur due to repeated exposures to OP during gestation -9. Recent biological studies on females and children have reported that there is a widespread OP exposure 0-5. There are concerns about the potential health effects of pre- and post-natal exposure of children to pesticides, therefore the Food Quality Protection Act (FQPA) established a stringent health-based standard for pesticide residues in food to assure protection from pesticide exposure and to strengthen health protection from pesticide risks for sensitive populations,2. Children are particularly sensitive to the health risks of pesticide exposure since their internal organs are not fully developed. For instance, their immune systems may not be able to protect them against pesticides, and their excretory systems may not be able to excrete these toxic chemicals. Indeed, pes ticide exposure may permanently affect development negatively by blocking the absorption of nutrients. Especially children of farmworkers are at risk for pesticide exposure. Their parents may bring pesticide residues from the agricultural fields into the house and thus the pesti cides may drift from fields into areas where children play 6. Long-term exposure of the pregnant women to OP can cause toxic effects both on their bodies and their fetuses. However, the number of studies on subacute toxicity of OP on maternal and fetal organs is scarce. Also, there are no studies which compare maternal and fetal tissues in this sense. Malathion (ML) (O,O-dimethyl-S-.2-bis ethoxycarbonyl ethyl phosphorodithioate), which is a common OP in the world, was selected as the toxic material of the present study since it usually has lower toxicity than other pesticides. Malaoxon is the bioactivation metabolite of ML, causing higher toxicity. Malaoxon inhibits acetyl-cholinesterase (AChE), causing the accumulation of acetylcholine within synapses and consequently leading to the overstimulation of postsynaptic receptors and producing rapid twitching of voluntary muscles, incoordination, convulsions, paralysis and ultimately death The aim of this study was to investigate the teratogenic effects of ML induced by subacute low doses on fetus kidney tissues in pregnant rats. MATERIAL and METHODS The study was approved by Dicle University Animal Ethical Committee and was carried out in accordance with the Animal Welfare Act and the Guide for the Care and Use of Laboratory animals prepared by Dicle University Animal Ethical Committee. Female Sprague-Dawley rats (250±50 g) were obtained from the Animal laboratory at Dicle University. The rats were housed in clean polypropylene cages (having six rats per cage) and maintained under controlled room temperature (23±2 C) with a photoperiod of 2 h light and 2 h dark cycle. The rats were given standard pellet diet and water ad libitum throughout the experimental period. In the study, at first, a total of 40 Sprague-Dawley female rats were divided into 4 groups of 0 rats each. ML was applied in various low doses (2.5-5 and 0 mg/kg/day, orally). The rats were caged for 3 days with one male and one female in each cage. Once ML was applied, the rats were mated. After 3 days, male rats were removed from the cages and vaginal smear was applied to the female rats to determine pregnancy. Only the pregnant females were studied. A total of 28 Sprague-Dawley pregnant rats were randomly divided into 4 groups of 7 rats each. Depending on dose, the rats were divided into 4 groups including (I) control, (II) ML 2.5 (2.5 mg/kg/day, orally), (III) ML 5 (5 mg/ kg/day, orally), and (IV) ML 0 (0 mg/kg/day, orally). ML application started when the male and female were put together (when mating started). Daily ML application was continued until birth. After the birth and anesthesia with ketamine, (85 mg/ kg, intraperitoneal, Ketalar, Pfizer), blood samples were obtained from mother rats using intracardiac puncture in sterile tubes without anticoagulant. After a one-hour clotting in the room temperature and centrifugation (500 g, 0 minutes, 4 C), the sera were carefully harvested and stored at -20 C till biochemical analysis. Biochemical Analysis The enzyme amylase, lipase and AChE activities in serum were determined with Roche Cobas Integra 800 autoanalyser via enzymatic colorimetric method using Roche brand commercial kits in 409/659 nm. The enzyme activities were expressed as U / L. Measurement range of the tests were U/L (0,05-33 µkat/l) for amylase, U/L (3, µkat/l) for AChE and U/L (0,05-5,0 µkat/l) for lipase. All analyses were performed in Biochemistry Department of Dicle University Medical Faculty. Histopathologic Analysis Immediately after the death of the rats, kidney tissues were processed in 0% formaldehyde solution via cassette autotechnic tissue processing equipment (Leica ASP 300). Once the processing was completed, the tissues were embedded in paraffin blocks and the sections (5 μm in thickness) were taken by microtome instrument onto lysine laminin. The preparations stained with haematoxylin and eosin (H&E) were evaluated under a light microscope at x00 magnification (Olympus BX5) by a pathologist blinded to the study groups. Histopathologic evaluation consisted of tissue damages including the intensity of cellular hydropic degeneration along with neutrophil and mononuclear cell infiltration, degenerative changes, nuclear loss, necrosis and fibrosis. Each organ was graded 23 on a scale (Fig. ). For the kidney, for instance, the occurrence of tubular epithelium damage

58 223 ALP, SAK, EVSEN, FIRAT, EVLIYAOGLU PENBEGUL, SANCAKTUTAR, SOYLEMEZ, TUZCU and proteinous accumulation in the tubular lumen due to the filtration failure were examined and graded. Each parameter was scored between 0 and 3 (0: normal, : mild, 2: moderate, and 3: severe) depending on the situation of lesions (Table ). Statistical Analysis Activities of enzymes were analyzed using One-way ANOVA and Tukey test. A value of P<0.05 was considered statistically significant. RESULTS In the present study, depending on ML dose, histopathologically vacuolar degeneration, necrosis and spills were observed in kidney tubular epithelium of the ML groups. In the F and P groups, swelling of the tubular cells with brush border loss were present. In the P2 and F2 groups, in addition to swelling and brush border loss of the tubular cells, nuclear losses in the tubular cells were seen. Apart from these complications, the P3 and F3 groups presented with degenerations and numerous nuclear losses in the tubular cells (Fig. ). Moreover, regardless of ML dose, widespread degenerations and necrosis (nuclear loss) were observed in all the fetal groups. The lesions were scored depending on the scale (Fig. ). The results conclusively indicated that Malathion results in toxic effects on kidney tissues in pregnant rats depending on the dose, and it causes teratogenic effects in fetal kidneys at all doses. In the biochemical evaluation of pregnant rats, a significant difference was observed between the control group and the ML group in terms of enzyme results. It was determined that ML leads to a decrease in amylase and cholinesterase activities and an increase in lipase activities. Also, the in-group comparisons among ML groups revealed that, depending on dose, the use of ML inhibits AChE and amylase activities while increasing lipase activity (Table 2). DISCUSSION Widely used in agriculture, OP has several important features such as environmental safety, limited persistence, and selective toxicity to insects with respect to mammals 24. Therefore, ML was selected as the toxic material for the present study. Previous studies argued that ML inhibits AChE, causing the accumulation of acetylcholine within synapses, and consequently leading to overstimulation of postsynaptic receptors. Among these, Asini et al. 25 demonstrated that repeated ML administrations cause a decrease in the circulating AChE activity in rats. Akhgar et al. 26 and Rezg et al. 27 also observed that the plasma AChE activity in rats was seriously decreased in the case of subchronic exposure to ML. It has been accepted that a 20% AChE inhibition causes the deleterious effects of OP 28, and when the ratio is greater than 50%, there is a life-threatening situation 29. Thus, a decrease in the AChE activity is considered as a significant marker for OP poisoning. In the present study, depending on dose, the AChE inhibition ratio reached 0.4% in ML 2.5 group, 36.% in ML 5, and 44% in ML 0. These results indicated that the doses of 5 mg/kg/day and 0 mg/kg/ day may cause deleterious effects while the doses greater Table. Grades for kidney lesions Tablo. Böbrek lezyonlarının dereceleri Grades Grade 0 Grade Evaluation No Lesion Swelling of tubular cells coupled to the loss of brush border, Alteration of the tubule up to a third with nuclear loss without nuclear thickening and epithelial cells into the lumen Grade 2 Grade 3 Swelling of tubular cells coupled to the loss of brush border Alteration of the tubule up to 2 thirds with nuclear loss and proteinous mass into the lumen Cell degeneration Tubular alterations in more than 2 thirds with nuclear loss, proteinous mass into the lumen and neutrophil/mononuclear cell infiltrates in the interstitium Table 2. Comparison of serum enzymes among groups (mean ± Standard deviation) Tablo 2. Çalışma gruplarında serum enzimlerinin karşılaştırılması Group Amylase (U/L) Lipase (U/L) Cholinesterase (U/L) Control 2752± ± ±52 Malathion ±273 a 5.22± ±98 Malathion 5 80±02 b 5.70±0.62 b 68±9 b,d Malathion 0 688±99 c 7.74±.30 c,e,f 596±29 c,e a, b, c; difference between control with Malathion 2.5, 5, 0 respectively d, e; difference between Malathion 2.5 with Malathion 5, 0 respectively f; difference between Malathion 5 with Malathion 0 for a,c,d,e,f values: P<0.00, for b value: P = 0.0

59 224 Effects of Malathion in... Fig. Fetal (F) and Pregnant (P) rat kidney tissues (H&E stain, x00). Normal histomorphological appearance of the pregnant and fetal kidney tissues of control groups ( P control and F control respectively). Swelling of the tubular cells (down and left arrows) with brush border loss (right arrows) [P and F respectively]. Swelling and brush border loss of the tubular cells (right arrows) with some nuclear loss (up and down arrows) [P2 and F2 respectively]. In addition to swelling and brush border loss (right and left arrows), degeneration and many nuclear loss of the tubular cells (up and down arrows) are seen [P3 and F3] F: Fetal rats; F: Fetal rats treated with Malathion (2.5 mg/kg/day, p.o), F2: Fetal rats treated with Malathion (5 mg/kg/day, p.o), F3: Fetal rats treated with Malathion (0 mg/kg/day, p.o), P: Pregnant rats; P: Pregnant rats treated with Malathion (2.5 mg/kg/day, p.o), P2: Pregnant rats treated with Malathion (5 mg/kg/day, p.o), P3: Pregnant rats treated with Malathion (0 mg/kg/day, p.o) Şekil. Fetus (F) ve gebe (P) sıçan böbrek dokuları (H&E boyama, x00). Kontrol gruplarına ait fetal ve gebe sıçan böbrek dokularında normal histomorfolojik görünüm (sırasıyla P control ve F control ). Fırçamsı kenar kayıpları (aşağı ve sol oklar) ile birlikte tubuler hücrelerde şişme (sağ oklar) (Sırasıyla P ve F)). Tubuler hücrelerde bazı nükleer kayıpların ( yukarı ve aşağı oklar) eşlik ettiği fırçamsı kenar kaybı ve şişme (sağ oklar) (Sırasıyla P2 ve F2). Tubuler hücrelerde fırçamsı kenar kaybı ve şişme (sağ ve sol oklar) yanı sıra dejenerasyon ve birçok hücrede nükleer kayıp (yukarı ve aşağı oklar) görülmektedir (sırasıyla P3 ve F3) F: Fetal sıçan; F: Malathion uygulanmış fetal sıçan (2.5 mg/kg/gün, oral), F2: Malathion uygulanmış fetal sıçan (5 mg/kg/gün, oral), F3: Malathion uygulanmış fetal sıçan (0 mg/kg/gün, oral), P: Gebe sıçan; P: Malathion uygulanmış gebe sıçan (2.5 mg/kg/gün, oral), P2: Malathion uygulanmış gebe sıçan (5 mg/kg/gün, oral), P3: Malathion uygulanmış gebe sıçan (0 mg/kg/gün, oral)

60 225 ALP, SAK, EVSEN, FIRAT, EVLIYAOGLU PENBEGUL, SANCAKTUTAR, SOYLEMEZ, TUZCU than 0 mg/kg/day may be life-threatening. However, the toxic indicators of ML are not only limited to inhibition of AChE. OP may cause several effects on other parameters such as lipase and amylase activities. Precise measurement of these enzymes is very important in that they indicate organ damages. In previous studies, it was revealed that OP may change lipase and amylase activities depending on pancreatitis and other organ damages. Alp et al. found that ML (200 mg/kg, single dose, orally) markedly depletes the AChE activity while significantly increasing the GGT (g-glutamyltransferase) and amylase activities 23. Gokalp et al. 30 reported that high doses of diazinon, used as an OP, significantly inhibits and decreases serum amylase activities in rats due to pancreatitis. In the present study, in parallel with dose of ML, it was found that ML inhibits AChE activity while increasing lipase activity as suggested by Gokalp et al. 30, and decreasing amylase activity as contrary to the result by Alp et al. 23. According to the histopathologic analyses in previous studies, OP is likely to cause kidney damage. Alp et al. 23 stated that degenerative changes associated with necrosis and inflammatory cell infiltration were evident in the kidneys of the rats intoxicated with ML. In a study by Kalender et al. 3, vascular dilation and glomerular atrophy were observed in kidney tissues 4 weeks after the administration of methyl parathion as OP to rats. In another study, it was observed that diazinon leads to tubular swelling, hyperplasia and cell infiltration in rabbit kidneys 32. Sulak et al. 33 also administered the OP methidathion to male rats over a 4-week period, concluding that methidathion causes a reduction in AChE activity and kidney damage, together with tubular epithelial cell degeneration, focal tubular necrosis, fibrosis and infiltration. In the present study, similar to the studies aforementioned, it was revealed that ML, in parallel with the dose, causes vacuolar degeneration, necrosis and spills in kidney tubular epithelium. In addition, it leads to mono-nuclear cell infiltrations and intertubular bleeding. Regardless of ML dose, wide spread degenerations and necrosis was observed in all the fetal kidneys of the ML group. In the present study, similar to histopathologic results, it was found that ML, in parallel with dose of ML, inhibits AChE activity while increasing lipase activity and decreasing amylase activity. The biochemical results were verified by histopathologic results. According to these results, we conclude that even low doses of ML have strong toxic effects on both pregnant and fetal kidney tissues, causing teratogenic kidney damage. REFERENCES. Rosemary C, Asa B, Thomas EM, Dana BB, Martha EH, Brenda E: Cumulative organophosphate pesticide exposure and risk assessment among pregnant women living in an agricultural community: A case study from the CHAMACOS cohort. Environ Health Perspect, (3): , Chanda SM, Pope CN: Neurochemical and neurobehavioral effects of repeated gestational exposure to chlorpyrifos in maternal and developing rats. Pharmacol Biochem Behav, 53 (4): , Dam K, Seidler FJ, Slotkin TA: Developmental neurotoxicity of chlorpyrifos: Delayed targeting of DNA synthesis after repeated administration. Brain Res Dev Brain Res, 08 (-2): 39-45, Eskenazi B, Bradman A, Castorina R: Exposure of children to organophosphate pesticides and their potential adverse health effects. Environ Health Perspect, 07, , Gupta RC, Rech RH, Lovell KL, Welsch F, Thornburg JE: Brain cholinergic, behavioral, and morphological development in rats exposed in utero to methylparathion. Toxicol Appl Pharmacol, 77 (3): , Muto MA, Lobelle F Jr, Bidanset JH, Wurpel JN: Embryotoxicity and neurotoxicity in rats associated with prenatal exposure to Dursban. Vet Hum Toxicol, 34 (6): , Schulz H, Nagymajtenyi L, Desi I: Life-time exposure to dichlorvos affects behaviour of mature rats. Hum Exp Toxicol, 4 (9): , Song X, Seidler FJ, Saleh JL, Zhang J, Padilla S, Slotkin TA: Cellular mechanisms for developmental toxicity of chlorphyrifos: targeting the adenylyl cyclase signaling cascade. Toxicol Appl Pharmacol, 45, 58-74, Whitney KD, Seidler FJ, Slotkin TA: Developmental neurotoxicity of chlorpyrifos: Cellular mechanisms. Toxicol Appl Pharmacol, 34 (): 53-62, Berkowitz GS, Obel J, Deych E, Lapinski R, Godbold J, Liu Z: Exposure to indoor pesticides during pregnancy in a multiethnic urban cohort. Environ Health Perspect,, 79-84, CDC: Second National Report on Human Exposure to Environmental Chemicals. NCEH Pub No Atlanta, GA:Centers for Disease Control and Prevention. Accessed: March Fenske RA, Kissel JC, Lu C, Kalman D, Simcox NJ, Allen E: Biologically based pesticide dose estimates for children in an agricultural community. Environ Health Perspect, 08, , Loewenherz C, Fenske RA, Simcox NJ, Bellamy G, Kalman D: Biological monitoring of organophosphorus pesticide exposure among children of agricultural workers in central Washington State. Environ Health Perspect, 05, , Lu C, Fenske RA, Simcox NJ, Kalman D: Pesticide exposure of children in an agricultural community: Evidence of household proximity to farmland and take home exposure pathways. Environ Res, 84 (3): , O Rourke MK, Lizardi PS, Rogan SP, Freeman NC, Aguirre A, Saint CG: Pesticide exposure and creatinine variation among young children. J Expo Anal Environ Epidemiol, 0, , Elaine F: Reducing pesticide exposure in children and pregnant women. Northwest Bulletin: Family and Child Health, 2 (): -5, Buratti FM, D aniello A, Volpe MT, Meneguz A, Testai E: MAL bioactivation, in the human liver: The contribution of different cytochrome P450 isoforms, drug metabolism and disposition. Am Soc Pharmacol Exp Therap, 33, , Korhonen KE, Torronen R, Ylitalo P, Hannıren O: Inhibition of cholinesterases by DPR and induction of organophosphate-detoxifying enzymes in rats. Gen Pharmacol, 2, , Alp H, Aytekin I, Esen H, Basarali K, Kul S: Effects of caffeic acid phenethyl ester, ellagic acid, sulforaphane and curcumin on diazinon induced damage to the lungs, liver and kidneys in an acute toxicity rat model. Kafkas Univ Vet Fak Derg, 7 (6): , Sultatos LG: Mammalian toxicology of organophosphorus pesticides. J Toxicol Environ Health, 43, , Thompson CW, Frick JA, Natke BC, Hansen LK: Preparation, analysis and anticholin-esterase properties of O,O-dimethyl phosphothioate isomerides. Chem Res Toxicol, 2, , Timur S, Onal S, Karabay NU, Sayım F, Zıhnıoglu F: In vivo effects of MAL on glutathione-s-transferase and acetylcholinesterase activities in

61 226 Effects of Malathion in... various tissues of neonatal rats. Turk J Zool, 27, , Alp H, Aytekin I, Esen H, Alp A, Buyukbas S, Basarali K, Hatipoglu NK, Kul S: Protective effects of caffeic acid phenethyl ester, ellagic acid, sulforaphan and curcuma on malathion induced damage in lungs, liver and kidneys in an acute toxicity rat model. Revue Méd Vét, 62 (7): , Alp H, Aytekin I, Atakisi O, Hatipoglu NK, Basaralı K, Ogun M, Buyukbas S, Altintas L, Ekici H, Alp A: The effects of caffeic acid phenethyl ester and ellagic acid on the levels of malondialdehyde, reduced glutathione and nitric oxide in the lung, liver and kidney tissues in acute diazinon toxicity in rats. J Anim Vet Adv, 0 (): , Asını FL, Zanatte KD, Brocardo PS, Pandolfo P, Rodrıgues ALS, Takahashi RN: Behavioral effects and ChE measures after acute and repeated administration of MAL in rats. Environm. Toxıcol Pharmacol, 20, , Akhgari M, Abdollahi M, Kebryaeezadeh A, Hosseini R, Sebzevari O: Biochemical evidence for free radical induced lipid peroxidation as a mechanisim for subchronic toxicity of MAL in blood and liver of rats. Hum Exp Toxicol, 22, 205-2, Rezg R, Mornagui B, Kamoun A, El-fazaa S, Gharbı N: Effect of subchronic exposure to MAL on metabolic parameters in the rat. C R Biolog, 330, 43-47, Dembélé K, Haubruge E, Gaspar C: Concentration effects of selected insecticides on brain acetylcholinesterase in the common carp (Cyprinus carpio L.). Ecotoxicol Environm Safet, 45, 49-54, Day KE, Scott IM: Use of acetylcholinesterase activity to detect sublethal toxicity in stream invertebrates exposed to low concentrations of organophosphate insecticides. Aquat Toxicol, 8, 0-4, Gokalp O, Buyukvanli B, Cicek E, Ozer ME, Koyu A, Altuntas I, Koylu H: The effects of diazinon on pancreatic damage and ameliorating role of vitamin E and vitamin C. Pest Biochem Physiol, 8, 23-28, Kalender S, Kalender Y, Durak D, Ogutcu A, Uzunhisarcikli M, Cevrimli BS, Yildirim M: Methyl parathion induced nephrotoxicity in male rats and protective role of vitamins C and E. Pest Biochem Physiol, 88, 23-28, Yehia MAH, El-Banna SG, Okab AB: Diazinon toxicity affects histophysiological and biochemical parameters in rabbits. ExpToxicol Pathol, 59, , Sulak O, Altuntas I, Karahan N, Yildirim B, aakturk O, Yilmaz HY, Delibas N: Nephrotoxicity in rats induced by organophosphate insecticide methidathion and ameliorating effects of vitamins E and C. Pest Biochem Physiol, 83, 2-28, 2005.

62 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Fonksiyonel Erkekleştirilmiş Gökkuşağı Alabalığı (Oncorhynchus mykiss) Üretimi Tülin ARSLAN * Fatime ERDOĞAN ** Mete ERDOĞAN ** * Mugla University, Faculty of Fisheries, Department of Aquaculture, TR Mugla - TURKEY ** Mugla University, Ortaca Vocational School, Department of Fisheries, TR Mugla - TURKEY Makale Kodu (Article Code): KVFD Özet Bu çalışmada, sperm kanalları olan, abdominal masaj yoluyla gamet toplanabilen, fonksiyonel olarak erkekleştirilmiş gökkuşağı alabalığı (Oncorhynchus mykiss) anacı üretimi için uygun hormonal cinsiyet dönüşüm prosedürü araştırılmıştır. Bu amaçla 4 grup deneme yapılmıştır. Oral uygulama grubunda, serbest yüzmeye başlayan post larvalar ilk yem alma aşamasından itibaren 600 derecegün süresince kilogramında mg 7α-metiltestosteron içeren yemlerle beslenilmiştir. Banyo uygulama gruplarında ise, mg l - 7α-metiltestosteron, β-hidroksiandrostenedion ya da 7α-metildihidrotestosteron keseli larval dönem boyunca (döllenmeden itibaren derece-gün) kısa süreli (2 saatlik) tek, 48 saat aralı 2-3 ya da hafta aralı çift banyo şeklinde verilmiştir. Çalışma sonuçları, gökkuşağı alabalığında fonksiyonel erkekleştirilmiş dişi anaç üretimi için en uygun hormon prosedürünün döllenmeden sonraki derece-gün leri kapsayan, periyodik banyolar veya periyodik banyolar ve düşük dozda oral uygulamalar şeklinde bir prosedür olabileceğini, androjen banyolarının fonksiyonel erkekleştirilmiş dişi anaçlar üretmekte daha etkili olduğunu, düşük konsantrasyonlarda ( mg kg - yem) verildiğinde oral 7α-metiltestosteron uygulamalarının da yüksek oranda fonksiyonel erkek birey üretebileceğini göstermiştir. Anahtar sözcükler: Oncorhynchus mykiss, 7α-metiltestosteron, 7α-metildihidrotestosteron, β-hidroksiandrostenedion, fonksiyonel hormonal cinsiyet değişimi The Production of Functional Sex-Reversed Male Rainbow Trout (Oncorhynchus mykiss) Summary In this study, appropriate hormonal sex reversal procedure for the production of functional sex-reversed male rainbow trout (Oncorhynchus mykiss) brooders with intact sperm ducts was investigated. For this purpose, 4 groups of experiment were conducted. In oral administration group, free swimming larvae starting from the first feeding were fed mg 7α-methyltestosterone kg - diets for 600 degree-days. In the remaining experimental groups, mg l - 7α-methyltestosterone, β-hidroksiandrostenedione or 7α-methyldihydrotestosterone were administered throughout the sac fry stage ( degree-days post fertilization) as short (2 h) single, 48 h apart 2-3 or week apart double baths. Results of the study demonstrated that appropriate androgen procedure for the production of functionally masculinized rainbow trout females should be covering the degree-days post fertilization, but it could be periodic baths or periodic baths and oral administration of low concentrations, at low concentrations ( mg kg - feed) oral administration of 7α-methyltestosterone could yield high ratios of functional sex reversed males. Keywords: Oncorhynchus mykiss, 7α-methyltestosterone, 7α-methyldihydrotestosterone, β-hidroksiandrostenedione, functional hormonal sex reversal GİRİŞ Ülkemizde entegre kültürü yapılan tek tatlı su balığı olan gökkuşağı alabalığı, Oncorhynchus mykiss Walbaum 792, yetiştiriciliğinde çoğu ülke verimi artırmak amacıyla üretimde tamamı dişi populasyonlar kullanmaktadır -3. Çünkü gökkuşağı alabalığı erkekleri birinci yaşları içerisinde seksüel olgunluğa erişmeye başlarlar. Erginleşmeyle İletişim (Correspondence) atulin@mu.edu.tr, arslatu@yahoo.com

63 228 Fonksiyonel Erkekleştirilmiş... birlikte yemle alınan enerjinin büyük bir kısmı gonad gelişimine yönlendirildiğinden, erkeklerde büyüme yavaşlamakta, kaslarda depolanan protein ve lipit miktarlarındaki düşüşlere ve kas pigmentasyonunda değişime bağlı olarak et kalitesi de düşmektedir,3. Tek cinsiyetli balık populasyonlarının üretiminde ekonomik olması, yüksek teknoloji ve uzmanlık gerektirmemesi ve homozigotluk oranının artması gibi istenmeyen genetik yan etkilerinin olmaması dolayısıyla en çok tercih edilen üretim tekniği, hormonal cinsiyet dönüşüm metodudur 2,4-6. Pazara sunulan son ürün üzerinde hormon kullanılmasını gerektirmediğinden sofralık balık üretiminde bu metot dolaylı olarak uygulanır 2,4,7. Dolaylı hormonal cinsiyet dönüşüm uygulamasında, hormonlarla cinsiyeti değiştirilmiş bireyler (genotipik ve fenotipik cinsiyeti farklı bireyler) anaç olarak kullanılarak çaprazlama yoluyla tek cinsiyetli populasyonlar üretilir 2,4,7. Gökkuşağı alabalığında çaprazlama yoluyla tamamı dişi populasyonlar üretmekte kullanılan erkekleştirilmiş dişi anaçlar yavruların ilk yemleme aşamasından itibaren gün süreyle kilogramında mg 7α-metiltestosteron içeren yemlerle beslenmesiyle üretilmektedir,5,8,9. Bu prosedür gonadal cinsiyeti başarılı bir şekilde değiştirmekle birlikte, üretilen erkeklerde sperm kanalları oluşmamaktadır,0,. Sperm kanalları olmayan erkekleştirilmiş dişilerden gamet elde etmek ancak gonadların ameliyatla vücut dışına çıkarılmasıyla mümkündür. Bu yüzdende geç erginleşen ve 2-3 yılda büyütülen bu anaçlar ancak bir defa kullanılabilmektedir. Ayrıca normal (genotipik) erkekler gibi abdomene uygulanan yumuşak bir basınçla sperm bırakamadıklarından gonadal olgunluklarının önceden kontrol edilmesi de mümkün değildir. Vücut renginin koyulaşması, alt çenenin uzaması gibi karakterler genotipik erkeklerde olduğu gibi gonad olgunluğu hakkında bilgilendirici olmakla birlikte, ikincil cinsiyet karakterleri iyi gelişmiş erkekleştirilmiş dişilerin sperm kalitesi her zaman aynı derecede iyi olmayabilmektedir 2. Bunun sebebi olarak sperm kanalı olmayan bu erkeklerde, spermin son olgunlaşma aşamasını kanaldaki seminal plazma ortamında tamamlayamaması gösterilmektedir 2. Bu nedenle, erkekleştirilmiş dişi anaçlardan elde edilen sperm kullanılmadan önce bir süre olgunlaştırma solüsyonlarında bekletilir. Aksi halde olgunlaşmasını tamamlayamamış spermin yumurtaları dölleme kapasitesi çok düşük olabilmekte ve bu durum önemli ekonomik kayıplar yaşanmasına yol açmaktadır 2. Gökkuşağı alabalığında ilk yemleme sırasında gonadların somatik gelişimi zaten başlamıştır 3-5. Sitolojik değişim (primordial üreme hücrelerinin oogonia veya spermatogonia a dönüşümü) veya ilk mayoz (primer oositlerin oluşumu) ise ilk yemlemeden sonra olmaktadır 3-5. Dolayısıyla, ilk yemlemeyle başlatılan hormon uygulamalarından elde edilen erkekleştirilmiş dişilerde sperm kanallarının oluşmaması uygulamanın zamanlaması ile ilgili bir sorun olabilir. Fonksiyonel, sperm kanalları olan erkek- leştirilmiş dişi anaçlar üretmek için hormon uygulamalarının gonadların somatik değişimi sırasında, keseli larval dönemde başlatılması gerekebilir. İşte bu öngörü doğrultusunda gerçekleştirilen araştırmamızın amacı fonksiyonel, sperm kanalları olan ve abdominal masaj yoluyla sperm bırakabilen erkekleştirilmiş dişi gökkuşağı alabalığı anacı üretimi için uygun hormonal cinsiyet dönüşüm prosedürünü araştırmaktır. MATERYAL ve METOT Bu araştırmanın saha çalışmaları Muğla ili, Fethiye ilçesinde yıl boyu sabit sıcaklıkta (8.7±0.ºC) kaynak suyu ile üretim yapan ticari bir gökkuşağı alabalığı kuluçkahane işletmesinde gerçekleştirilmiştir. Saha çalışmalarına 2005 yılı Aralık ayı sonlarında, gökkuşağı alabalığının bölgedeki doğal üreme sezonu (Kasım-Ocak) içerisinde başlanılmıştır. Çalışmada, işletmede üretilen değişik yaşlardaki besin keseli ve besin kesesini tüketmiş larvalara doğal veya sentetik androjenler (β-hidroksiandrostenedion (OHA, Sigma A3009), 7α-metiltestosteron (MT, Sigma M7252), 7α-metildihidrotestosteron (MDHT, Sigma M5626)) oral ya da banyo yolu ile verilmiştir. Oral veya banyo yolu ile hormon uygulamaları için gerekli miktardaki androjen hassas terazide tartıldıktan sonra %96 lık etanol içerisinde çözdürülmüş ve mg androjen ml - konsantrasyonunda stok solüsyonlar hazırlanmıştır. Hazırlanan bu stok solüsyonlar denemelerde kullanılan konsantrasyonlara seyreltilerek hormonlu yemlerin hazırlanmasında ve banyo uygulamalarında kullanılmıştır. Hormonlu yemler Arslan ve ark. nın çalışmasında 4 tarif edildiği şekilde hazırlanmıştır. Hormon banyoları larvalara 40 L hacimli plastik küvetlerde verilmiştir. Küvetler banyo uygulamalarından hemen önce taze su ile doldurulmuş, planlanan konsantrasyonda androjen içeren stok solüsyonlar banyo suyuna eklenerek kuvvetli bir havalandırmayla tüm suya homojen bir şekilde karışmaları sağlanmıştır. Hormon banyoları sırasında, keseli larvalar işletmedeki dikey inkubatörlerden gözenekli tepsilerle birlikte alınarak, banyo küvetlerine yerleştirilmiştir. İki saatlik banyo süresi boyunca, küvetlerdeki su oksijen tüpüne bağlı hava taşı vasıtasıyla, büyük hava kabarcıkları oluşmasına müsaade etmeden hafifçe havalandırılmıştır. Banyo süresinin sonunda, larvalar yine tepsiler içersinde hormon banyosu küvetlerinden çıkarılarak, temiz su ile birkaç sefer yıkanmış ve dikey inkubatörlerine geri yerleştirilmiştir. Dikey inkübatörlerde besin kesesini tüketen larvaların bakımında ve oral yolla hormon uygulamaları sırasında 80x240 cm 2 boyutlarında kapalı alan, fiberglas yapay yeme alıştırma tankları kullanılmıştır. Bu tanklarda -2 g a ulaşan deneme balıkları gonad gelişimlerinin değerlendirildiği büyüklüklere ulaşıncaya kadar değişik boyutlarda, açık alan beton havuzlarda bakılmışlardır. Beton havuzlarda büyütme sürecinde deneme balıklarına hiç boylama yapılmamış, stoklama yoğunlukları düşük (<5 kg/m 3 ) tutulmuştur. Çalışma süresince deneme balıkları

64 229 ARSLAN, ERDOĞAN ERDOĞAN büyüklüklerine bağlı olarak doyana kadar günde -8 defa, ağız açıklıklarına uygun büyüklükte %45-57 oranlarında ham protein içeren alabalık yemleriyle (Trouw Nutrition TR) beslenilmiştir. Saha çalışmalarının ilk yılında, sonraki yıllarda anaç olarak kullanmak ve denemeleri tamamı dişi populasyonlar üzerinde yapabilmek amacıyla, mevcut hormonal cinsiyet değişim prosedürü kullanılarak erkekleştirilmiş dişi populasyonlar üretilmiştir. Bu amaçla, besin kesesini tüketip, serbest yüzmeye başlayan on biner adet post larva iki tekrarlı olarak ilk yemlemeden itibaren kilogramında 3 mg MT içeren yemle 600 derece-gün süresince beslenilmiştir. Saha çalışmalarının ilk yılında ve takip eden 2 yılın üreme sezonlarında, birbiriyle bağlantılı 3 grup banyo yoluyla hormon uygulama denemesi yapılmıştır. Bu denemelerde, eksternal hormonlara en duyarlı gelişim dönemi olarak rapor edilen 8,6 yumurtaların açılmasından-dış beslenmeye geçiş dönemi içerisindeki dört biner keseli larvaya yumurta açılmasının tamamlandığı 43. günden (döllenmeden itibaren 370 derece-gün) başlanarak haftalık periyotlarda 0.5 mg l - OHA, MT ya da 0.5- mg l - MDHT içeren tek veya iki farklı sıklıkta 2-3 hormon banyosu verilmiştir (Tablo ). Kontrol grupları hormon banyoları ile eş zamanlı olacak şekilde ve hormon banyolarıyla aynı miktarda etanol içeren alkol banyolarına tabi tutulmuştur. Çalışma boyunca yapılan tüm denemeler 2 tekrarlı olarak gerçekleştirilmiştir. Sadece son yıldaki banyo denemelerinde 4 tekrarlı bir kontrol grubu kullanılmıştır. Çalışmanın oral hormon uygulaması üzerine yapılan son grup denemesinde, mevcut hormonal cinsiyet değişim prosedürüne göre yeme katılan MT dozunun gökkuşağı alabalığının gonad gelişimi üzerine etkileri araştırılmıştır. Bu denemede, besin kesesini tüketip serbest yüzmeye başlayan on biner adet post larva iki tekrarlı olarak ilk yemlemeden itibaren kilogramında, 2 ya da 3 mg MT bulunduran yemler ile 600 derece-gün süresince beslenilmiştir. Hormon uygulamalarından bir sonraki üreme sezonunda, gonad gelişiminin tamamlandığı bilinen 7-8. ay sonrasında, 00 g ve üzerine ulaşan deneme balıkları hormon uygulamalarının gonad gelişimi üzerindeki etkisini değerlendirmek üzere örneklenmiştir. Örneklemelerde, uygulamaların her bir tekrarından rastgele olarak 00-0 adet balık alınmıştır. Örneklenen balıklar aşırı dozda anestetik (2-fenoksi ethanol) ile öldürüldükten sonra bir bistüri yardımıyla abdomenleri açılmış ve gonad morfolojileri önce makroskobik olarak incelenmiştir. Makroskobik incelemeler sonrası, bütün halde ve hava kesesine yapışık olarak çıkarılan gonadlar %0 luk nötralize-formalin içerisinde fikse edilmiştir. Fikse edilen gonad örneklerinden fast green boyası ve gonadal-ezme metodu kullanılarak yaş preparatlar hazırlanmıştır 7. Ayrıca gonadal dokunun detaylı incelenebilmesi için her bir hormon uygulamasından 5-0 balığın gonadları kullanılarak Harrishematoksilen ve eosin ile boyanmış kalıcı preparatlar hazırlanmıştır. Yaş ve kalıcı preparatların mikroskobik incelemesiyle gonadlar gözlemlenen hücre tiplerine ve iç morfolojik özelliklerine göre dişi, erkek veya interseks olarak sınıflandırılmıştır. Tablo. Gökkuşağı alabalığında fenotipik cinsiyeti değiştirmede kullanılan β-hidroksiandrostenedion (OHA), 7α-metiltestosteron (MT) ve 7α-metildihidrotestosteron (MDHT) banyolarının zamanları, uygulama yoğunlukları ve dozajları Table. Timing, intensities and dosages of β-hydroxyandrostenedione (OHA), 7α-methyltestosterone (MT) and 7α-methyldihydrotestosterone (MDHT) immersions used for changing the direction of phenotypic sex in rainbow trout Uygulama Başındaki Larval Gelişim Aşaması Uygulama Yoğunluğu Androjen (Doz) %00 yumurta açılması (Döllenmeden itibaren 370 derece-gün) %00 yumurta açılmasından hafta sonra (Döllenmeden itibaren derece-gün) %00 yumurta açılmasından 2 hafta sonra (Döllenmeden itibaren derece-gün) %00 yumurta açılmasından 3 hafta sonra (Döllenmeden itibaren 560 derece-gün) 48 saat aralı 2 banyo Kontrol OHA (0.5 mg l - ) MT (0.5 mg l - ) 48 saat aralı 3 banyo MT (0.5 mg l - ) Tek banyo 48 saat aralı 2 banyo Kontrol MDHT (0.5 mg l - ) MDHT ( mg l - ) OHA (0.5 mg l - ) MT (0.5 mg l - ) 48 saat aralı 3 banyo MT (0.5 mg l - ) hafta aralı 2 banyo Tek banyo MT (0.5 mg l - ) MDHT (0.5 mg l - ) Kontrol MDHT (0.5 mg l - ) 48 saat aralı 2 banyo MT (0.5 mg l - ) hafta aralı 2 banyo MDHT (0.5 mg l - ) Tek banyo MDHT (0.5 mg l - )

65 230 Fonksiyonel Erkekleştirilmiş... Başarılı sayılabilecek hormon uygulamalarında, örneklemelerden arta kalan balıklar sperm kanalı gelişimi ve cinsiyet dönüşümünün işlevselselliğinin tam olarak değerlendirilebilmesi için seksüel olgunluğa eriştikleri 2. yaşlarına kadar açık alan beton havuzlarda büyütülmüştür. Bu balıklarda sperm kanalı gelişimi ikinci yaşlarındaki üreme sezonunda kontrol edilmiş ve abdominal masaj yoluyla sperm veren kanallı (fonksiyonel) erkeklerin oranı tespit edilmiştir. Abdominal masajla yoluyla gamet toplanamayan bireyler aşırı dozda anestetik ile öldürüldükten sonra bir bisturi yardımıyla abdomenleri açılmış ve gonad morfolojileri makroskobik olarak incelenmiştir. Makroskobik incelemeler sonrası, bütün halde, hava kesesine yapışık olarak çıkarılan gonadlar %0 luk nötralize-formalin içerisinde fikse edildikten sonra gonadal-ezme metodu kullanılarak mikroskobik olarak değerlendirilmiştir. Bu değerlendirilmelerde grimsi veya süt beyaz renkte gonadları olgun ve/veya olgunlaşmakta olan sperm hücreleri içeren bireyler erkek, ipliksi pembe renkte gonadları yoğun bağ doku ve az sayıda değişime uğramamış hücre içeren bireyler steril (kısır) olarak sınıflandırılmıştır. Sınıflandırma gruplarındaki balık sayıları yüz ile çarpıldıktan sonra incelenen deneme tekrarındaki toplam balık sayısına bölünerek yüzde erkek, dişi, interseks ve steril birey oranları tespit edilmiştir. Veriler SAS (Statistical Analysis System, SAS Instute Inc., Carry, NC, ABD) yazılımının 8.2 sürümü kullanılarak analiz edilmiştir. Yüzde erkek ve interseks oranları analizler öncesi arcsin karekök transformasyonuna tabi tutulmuştur. Deneme gruplarının cinsiyet oranları arasında fark olup olmadığı tek yönlü varyans analizi (one way- ANOVA) ile saptanmıştır. ANOVA testinin a = 0.05 önem derecesinde istatistiki belirgin fark işaret ettiği durumlarda, hormon uygulamalarının ortalamaları önce Dunnett t-testi kullanılarak ilgili kontrol grubu ortalamaları ile karşılaştırılmıştır. Daha sonra uygun durumlarda, Duncan çoğul aralık testi kullanılarak, ortalamalar kendi deneme grupları içersinde etki derecelerine göre sınıflandırılmıştır. BULGULAR Oral ya da banyo yoluyla hormon uygulamaları, kullanılan dozlarda gökkuşağı alabalığında toksisiteye sebep olmamıştır. Hormon uygulamaları boyunca ve sonunda, bütün deneme gruplarının yaşam oranlarının benzer ve çalışılan kuluçkahanenin başarı standartları içerisinde (%70-80) olduğu gözlenmiştir. Banyo uygulamalarının tümü erkek oranlarında artışa sebep olmuştur. Fakat OHA banyoları ve %00 yumurta açılmasında ya da hafta sonra verilen 48 saat aralı 3 MT banyosunun erkek oranlarında oluşturduğu artış istatistiki olarak önemli (P>0.05) bulunmamıştır (Tablo 2). Farklı larval yaşlarda verilen tek ya da çift MT veya MDHT banyolarının tümü ise erkek oranlarında istatistiki belirgin (P<0.05) artışa sebep olmuştur (Tablo 2, 3). Erkekleşme oranları ile MT banyo uygulamalarının başlatıldığı larval yaşlar arasında belirgin bir bağlantı tespit edilemezken, MDHT banyo uygulamalarının başlatılması için en uygun larval yaşın %00 yumurta açılmasından 2 hafta (döllenmeden itibaren 470 derece-gün) sonra olduğu tespit edilmiştir (Tablo 3). Bu dönemde verilen 0.5 mg l - çift MDHT banyosu erkek oranlarında istatistiki olarak en yüksek artışa (ortalama %57.4) sebep olmuştur. Bunlara ilaveten, banyo denemeleri gökkuşağı alabalığını erkekleştirmek için 0.5 mg l - MDHT dozunun yeterli olduğunu, uygun larval gelişim aşamasında verildiğinde birden fazla MDHT banyosunun erkekleşme oranları üzerinde olumlu etki ettiğini ve MDHT banyolarının gökkuşağı alabalığında cinsiyet değişimini yönlendirmede MT banyolarından daha etkili olduğunu ortaya koymuştur (Tablo 3). Ayrıca periyodik androjen banyo uygulamalarında 48 saat yerine, haftalık aralıklar kullanılmasının daha uygun olduğunu göstermiştir (Tablo 3). Oral uygulamalar, ilk yemleme aşamasından itibaren 600 derece-gün süresince kilogramında -3 mg MT içeren yemlerle besleme, genotipik dişilerin tamamına yakınında gonadal gelişimi etkilemiş ve gonadal değişimin yönünü Tablo 2. Farklı yaşlardaki keseli larvalara verilen 48 saat aralı 2-3 periyodik β-hidroksiandrostenedion (OHA) ve 7α-metiltestosteron (MT) banyolarının gökkuşağı alabalığının cinsiyet oranları üzerine etkileri. Aynı sütunda farklı küçük harflerle işaretlenmiş ortalamalar istatistiki belirgin farklar göstermektedir (P<0.05) Table 2. Effects of administering 48 hours apart 2-3 periodic β-hydroxyandrostenedione (OHA) and 7α-methyltestosterone (MT) immersions at different pre-larval stages on sex ratios of rainbow trout. Means in the same column followed by different lower case letters are significantly different (P<0.05) Uygulama Başındaki Larval Gelişim Aşaması Uygulama Yoğunluğu Androjen (Doz) N (±SS) % Ortalama Erkek (±SS) % Ortalama İnterseks (±SS) % Toplam Etkilenen %00 yumurta açılması 48 saat aralı 2 banyo Kontrol OHA (0.5 mg l - ) MT (0.5 mg l - ) 9 (7) 03 (7) 87 (4) 58.0 (2.) b 66.5 (3.5) b 76.0 (2.8) a (.3) a saat aralı 3 banyo MT (0.5 mg l - ) 02 (5) 66.8 (2.7) b.0 (.3) a 9.8 %00 yumurta açılmasından hafta sonra %00 yumurta açılmasından 2 hafta sonra 48 saat aralı 2 banyo OHA (0.5 mg l - ) MT (0.5 mg l - ) 03 (0) 89 (3) 67.0 (.4) b 75.5 (0.7) a 48 saat aralı 3 banyo MT (0.5 mg l - ) 04 (8) 56.9 (2.6) b.4 (0.6) a saat aralı 2 banyo MT (0.5 mg l - ) 93 (4) 79.0 (.5) a 2. (.4) a

66 23 ARSLAN, ERDOĞAN ERDOĞAN Tablo 3. Farklı yaşlardaki keseli larvalara verilen tek ya da hafta aralı çift 7α-metildihidrotestosteron (MDHT) ve 48 saat ya da hafta aralı çift 7α-metiltestosteron (MT) banyolarının gökkuşağı alabalığının cinsiyet oranları üzerine etkileri. Aynı sütunda farklı küçük harflerle işaretlenmiş ortalamalar istatistiki belirgin farklar göstermektedir (P<0.05) Table 3. Effects of administering single or week apart double 7α-methyldihydrotestosterone (MDHT) and 48 hours or week apart double 7α-methyltestosterone (MT) immersions at different pre-larval stages on sex ratios of rainbow trout. Means in the same column followed by different lower case letters are significantly different (P<0.05) Uygulama Başındaki Larval Gelişim Aşaması Uygulama Yoğunluğu Androjen (Doz) N (±SS) % Ortalama Erkek (±SS) % Ortalama İnterseks (±SS) % Toplam Etkilenen %00 yumurta açılmasından hafta sonra Tek banyo hafta aralı 2 banyo Kontrol MDHT (0.5 mg l - ) MDHT ( mg l - ) MT (0.5 mg l - ) MDHT (0.5 mg l - ) 96 (4) 95 (0) 96 (5) 98 (4) 00 (2).2 (0.4) f.6 (2.5) e 3.5 (.5) e 28. (0.2) c 33.0 (.0) b -.6 (3.0) a 5.4 (.7) ab 3.4 (.5) b 6.4 (2.7) ab saat aralı 2 banyo MT (0.5 mg l - ) 07 (9) 20.9 (0.) d 4.7 (0.9) ab 25. %00 yumurta açılmasından 2 hafta sonra %00 yumurta açılmasından 3 hafta sonra Tek banyo Kontrol MDHT (0.5 mg l - ) 00 (8) 98 (3) 0.5 (0.4) f 37.0 (3.6) b (3.6) b hafta aralı 2 banyo MDHT (0.5 mg l - ) 96 (3) 57.9 (2.3) a 2.6 (2.3) b 60.0 Tek banyo MDHT (0.5 mg l - ) 98 (2) 29.7 (3.3) bc 2.5 (.7) b Tablo 4. Farklı dozlarda 7α-metiltestosteron (MT) içeren yemlerle beslemenin gökkuşağı alabalığının cinsiyet oranları üzerine etkileri. Aynı sütunda farklı küçük harflerle işaretlenmiş ortalamalar istatistiki belirgin farklar göstermektedir (P<0.05) Table 4. Effects of feeding with different dosages of 7α-methyltestosterone (MT) containing diets on sex ratios of rainbow trout. Means in the same column followed by different lower case letters are significantly different (P<0.05) Deneme Grubu N (±SS) % Ortalama Erkek (±SS) % Ortalama İnterseks (±SS) Kontrol 96 (6) 45.0 (2.) b - 3 mg MT/kg yem 93 (8) 99.5 (0.7) a - Kontrol 96 (4).2 (0.4) c - 3 mg MT/kg yem 92 (2) 98.0 (.0) a - 2 mg MT/kg yem 90 (3) 97.2 (2.6) a 2.8 (2.6) a mg MT/kg yem 85 (2) 98. (2.8) a.0 (.4) a * Post larvalar ilk yemlemeden itibaren 600 derece-gün sürecince kilogramında -3 mg MT içeren yemlerle beslenmiştir (Starting from first feeding post larvae were feed -3 mg/kg MT containing diets for a duration of 600 degree-days) değiştirmekte etkili olmuştur (Tablo 4). Yüzde ortalama erkek oranları % arasında değişmiş ve yemdeki MT miktarına bağlı herhangi bir farklılık göstermemiştir (P>0.05). Bununla birlikte, spermatogenezin başladığı 2. yaşta ( g) yapılan tetkiklerde önemli oranlarda steril bireyin tespit edilmesi (Tablo 5), spermatogenez öncesi 7-8. aylarda yapılan değerlendirmelerde steril bireylerin erkek olarak sınıflandırıldığını işaret etmiştir. Steril bireylerin oranları ise yemdeki MT miktarıyla doğru orantılı bir artış göstermiştir (Tablo 5). Spermatogenezin başladığı 2. yaşta yapılan tetkikler, oral uygulamaların %22 lere varan kısır birey oluşumuna sebep olduğunu gösterirken, hormon uygulamasına tabi tutulmayan kontrol populasyonlarının birinin de %2 oranında kısır birey içerdiğini ortaya koymuştur (Tablo 5). Ayrıca 48 saat aralıkla verilen kısa süreli MT banyolarının düşük oranlarda da olsa kısırlaşmaya sebep olabileceğini işaret etmiştir. Diğer yandan, oral uygulamalarda sperm kanalı gelişiminin yeme eklenen MT miktarına bağlı ol- duğu ve kullanılan MT miktarı düştükçe kanallı erkek oranın arttığı görülmüştür. Bununla birlikte, fonksiyonel, sperm kanalına sahip ve abdominal masajla sperm toplanabilen erkekleştirilmiş dişi anaç üretmekte androjen banyolarının oral MT uygulamalarından daha etkili olduğu tespit edilmiştir (Tablo 5). TARTIŞMA ve SONUÇ Hormonlarla cinsiyetin başarılı bir şekilde yönlendirilmesi ve fonksiyonel olarak fenotipik cinsiyeti değiştirilmiş bireylerin elde edilmesi hormon uygulamalarının gelişime bağlı zamanlamasına, uygulamanın süresine, kullanılan hormonun türüne ve dozuna bağlıdır 2,5,6. Gonokorist balıkların sitolojik değişime uğramamış gamet hücreleri uzun süre cinsiyet hormonlarının etkisine duyarlı kalabilmektedir. Fakat hormon uygulamalarının gonadların sitolojik değişimden hemen önce başlatılması her zaman fonksiyonel cinsiyet değişimi ile sonuçlanmayabilir. Sito-

67 232 Fonksiyonel Erkekleştirilmiş... Tablo 5. Banyo ya da oral yolla verilen β-hidroksiandrostenedion (OHA), 7α-metiltestosteron (MT) ve 7α-metildihidrotestosteron (MDHT) uygulamalarının gökkuşağı alabalığının gonad gelişimine etkileri Table 5. Effects of immersion or oral β-hydroxyandrostenedione (OHA), 7α-methyltestosterone (MT) and 7α-methyldihydrotestosterone (MDHT) administrations on gonadal development of rainbow trout Deneme Grubu Uygulama Başındaki Larval Gelişim Aşaması Uygulama Yoğunluğu % Ortalama Erkek (±SS) N % Ortalama Kanallı Erkek % Ortalama Steril Birey Kontrol %00 yumurta açılması 48 saat aralı 2 banyo 45.0 (2.) OHA (0.5 mg l - ) %00 yumurta açılması %00 yumurta açılmasından hafta sonra 48 saat aralı 2 banyo 66.5 (3.5) 67.0 (.4) %00 yumurta açılması 76.0 (2.8) MT (0.5 mg l - ) %00 yumurta açılmasından hafta sonra %00 yumurta açılmasından 2 hafta sonra 48 saat aralı 2 banyo 75.5 (0.7) (.5) MDHT (0.5 mg l - ) 3 mg MT/kg yem %00 yumurta açılmasından hafta sonra %00 yumurta açılmasından 2 hafta sonra hafta aralı 2 banyo hafta aralı 2 banyo 33.0 (.0) (2.3) (0.7) mg MT/kg yem 98.0 (.0) Yeme yeni kalkan - 2 mg MT/kg yem 97.2 (2.6) mg MT/kg yem 98. (2.8) lojik değişimden hemen önce başlatılan hormon uygulamalarının farklı balık türlerinde gonadların yalnızca gametik elementlerini etkilediği, ama somatik elementlerini değiştirmediği tespit edilmiştir 3,8-20. Çünkü gonadların somatik değişimi özellikle de gonadal kanal sisteminin oluşumu ve gonadal hücrelerin fizyojik değişimi arasında zamanlama türlere bağlı farklılıklar gösterebilmektedir 4. Yani gökkuşağı alabalığında olduğu gibi sperm kanalları oluşmamış, morfolojik olarak testisten çok ovaryuma benzeyen ama yalnızca erkek üreme hücresi içeren gonadlar gelişebilir,9,. Bu türlerde cinsiyetin fonksiyonel olarak değiştirilmesi ve üreme özellikleri ile fenotipik eşdeğerlerine benzer bireylerin oluşturulması, hormon uygulamalarının gonadların somatik değişimi sırasında başlatılmasını gerektirebilir. Nitekim gökkuşağı alabalığının yakın akrabası olan ve gonadlarının sitolojik değişimi larvaların serbest yüzme aşamasına denk gelen Pasifik salmonlarında, O. kisutch ve O. tshawytscha 2,22, ilk yemlemeden itibaren oral yolla verilen steroidler çok çeşitli sonuçlar üretmiş ve genelde fenotipik cinsiyeti yönlendirmede başarısız olmuştur 5. Gonadların somatik büyüme aşamasına denk gelen yumurtaların medyan açılması sırasında verilen 2 saatlik tek androjen veya östrojen banyoları ise fonksiyonel olarak tamamı erkek veya tamamı dişi populasyonlar üretmekte başarılı olmuştur Bu çok kısa steroid uygulamalarının yüksek başarısı uygulamaların gonadların fizyolojik olarak hormonların etkisine en açık olduğu dönemde verilmiş ol- masına 22 ve verilen steroidlerin salmon larvalarının nispeten büyük besin kesesi tarafından absorbe edilerek, banyo uygulamalarından çok sonra bile larvalara aktarılabilmesine bağlanmıştır 24. Buna karşılık gonadların sitolojik değişimi larvaların serbest yüzmeye başladığı ay içersinde gerçekleşen gökkuşağı alabalığı 4-6 ve Atlantik salmonunda, Salmo salar 2,5,4, ilk yemlemeden itibaren yemle verilen androjen veya östrojenler, fenotipik cinsiyeti yönlendirmede başarılı sonuçlar üretmekle birlikte, bu uygulamayla erkekleştirilen bireylerde sperm kanalı oluşmadığı rapor edilmiştir,0,. Bu durum uygulamaların zamanlamasıyla ilişkilendirildiğinden, gonadal değişimin hem somatik hem de sitolojik elementlerini etkileyebilmek için her iki türde de keseli larval dönemde banyo yoluyla steroid uygulamaları yapılmıştır. Atlantik salmonunda yapılan uygulamalar, yumurtaların medyan açılmasından sonra, 2-4. haftalarda (döllenmeden derece-gün sonra) verilen 3 saatlik 2 adet 0.4 mg l - MDHT banyosunun %00 erkek populasyonlar üretmekte başarılı olduğunu göstermiştir 25. Ayrıca bu yolla üretilen erkekleştirilmiş dişilerin %84-92 oranında fonksiyonel, kanallı bireylerden oluştuğu rapor edilmiştir 25. Feist ve ark. nın ön çalışmasında 8 ise, gökkuşağı alabalığı yumurtalarına (açılmadan hafta önce) ve larvalarına (medyan açılmada, açılmadan -2 hafta sonra) verilen -4 adet, 2 saatlik 0.4 mg l - MT ya da OHA banyosunun %0-76 oranında erkekleşmeye sebep olduğu ve bu yolla erkekleştirilen dişilerin %60-00 oranında kanallı fonksi-

68 233 ARSLAN, ERDOĞAN ERDOĞAN yonel bireylerden oluştuğu rapor edilmiştir. Ayrıca banyo uygulamaları için en uygun zamanın medyan açılmadan hafta (döllenmeden yaklaşık 425 derece-gün) sonra olduğu gözlenmiştir 8. Buna karşılık bu çalışmada, en yüksek başarı döllenmeden sonraki derece-gün lerde verilen banyo uygulamalarında elde edilmiş ve MDHT banyolarının MT banyolarından daha etkili olduğu tespit edilmiştir. Ama benzer şekilde, banyo yoluyla üretilen erkekleştirilmiş dişilerin yem uygulamalarına göre daha yüksek oranda (%80-96) fonksiyonel, kanallı bireylerden oluştuğu görülmüştür. Banyo uygulamaları daha yüksek oranda fonksiyonel, kanallı erkek üretmekle birlikte, keseli larval dönemin değişik zamanlarında verilen banyo uygulamalarının hiçbiri gökkuşağı alabalığında tamamı veya tamamına yakını erkek populasyonlar oluşturmakta başarılı olamamıştır. Pasifik veya Atlantik salmonlarındaki gibi populasyondaki tüm bireylerin etkilenebildiği, eksternal androjenlerin etkisine duyarlılığın maksimum olduğu kısa kritik bir gelişim dönemine rastlanmamıştır. Diğer yandan, yumurta açılmasından-keseli larval dönemin son haftasına kadar (döllenmeden itibaren derece-gün arası) verilen tüm tek veya çift MT ve MDHT banyoları erkek oranlarında önemli artışa sebep olmuştur. Fakat yumurta açılmasından sonraki 2. ve 3. haftalarda (döllenmeden sonraki derecegün lerde) verilen çift MDHT banyosu aynı dönemde verilen tek banyo uygulamalarından daha etkili olmuştur. Keseli larval dönem sonrasında, uzun bir süreçte (600 derece-gün boyunca) oral yolla verilen MT ise genotipik dişilerin tamamına yakınında gonadal gelişimi etkilemiş ve gonadal değişimin yönünü değiştirmekte daha etkili olmuştur. Ayrıca yeme eklenen MT miktarı düştükçe, erkekleştirilen dişilerde sperm kanallı, fonksiyonel birey oranının arttığı (%8 den %53 e yükseldiği) gözlenmiştir. Benzer bir çalışmada da, yemdeki MT oranının 3 mg dan mg/kg a düşürmenin fonksiyonel erkek oranını %26.4 ten %54.7 ye yükselttiği görülmüştür 4. Bu sonuçlar, kanal oluşumu ve fonksiyonel cinsiyet değişiminin, uygulamanın zamanlaması yanında uygulamada kullanılan hormonun dozajı ile de ilgili olduğunu ifade etmektedir. Ayrıca gökkuşağı alabalığında eksternal androjenlere en duyarlı periyodun döllenmeden sonraki 470 derece-gün civarında başlamakla birlikte, keseli larval dönem sonrasında da devam ettiğini işaret etmektedir. Dişi ovaryumlarında mayozun keseli larval dönemden sonraki haftalar içersinde (800 derece-gün civarında) başladığı da 5 göz önünde bulundurulursa, bu sonuçlar gökkuşağı alabalığında fonksiyonel monoseks erkek populasyonlar üretmek için uygun androjen prosedürünün en azından döllenmeden sonraki derece-gün leri kapsayan, periyodik banyolar veya periyodik banyolar ve düşük dozlu oral uygulamalar şeklinde bir prosedür olması gerektiğini ortaya koymaktadır. Yumurtaların açılmasından bir hafta (döllenmeden itibaren derece-gün) sonra birer hafta yerine daha yakın (48 saat) aralıkla verilen MT banyolarında, banyo sayısı artıkça erkekleşme oranlarının düştüğü görülmüştür. Banyo yoluyla verilen steroidler salmonid larvalarının nispeten büyük besin kesesi tarafından absorbe edilmektedir 24. Dolayısıyla sık periyotlarda androjen banyosu verilen larvalar, besin kesesinde birikim sonucu daha seyrek periyotlarda androjen banyosu verilen keseli larvalara göre daha yüksek dozajlarda androjene maruz kalmış olabilirler. Diğer yandan, birer hafta arayla verilen benzer konsantrasyonda MT banyolarında banyo sayısı arttıkça erkekleşme oranlarında azalma olduğu gözlemlenmiştir ve banyo uygulamalarının etkinsinin artan banyo sayısı ile azaldığı rapor edilmiştir 8. Ama o çalışmada 8, keseli larvalar daha yüksek su sıcaklığında (.5ºC) bakılmışlardır. Yüksek su sıcaklıklarında bakılan larvaların metabolik hızı ve besin kesesini tüketme süresi, dolayısıyla maruz kaldıkları gerçek androjen dozu, larvaların daha düşük bir sıcaklıkta (8.7±0.ºC) bakıldığı bu çalışmaya göre daha yüksek olmuş olabilir. MT östrojene aromatize olabilen bir androjen olduğundan 26, yüksek dozda MT verilen balıklarda aromatizasyon sonucu erkekleşme oranlarında düşüş ve hatta dişi oranlarında artışlar (paradoksal dişileşme) görülmüştür 23,27,28. Bu sebeple, periyodik MT banyo uygulamalarında gözlemlenen erkekleşme oranlarında azalma, banyo sayısından çok larvaların maruz kaldığı gerçek androjen dozajı ile bağlantılı olabilir. Öte yandan, östrojene aromatize olabilen androjenlerin yüksek dozları kısa süreli uygulamalarda paradoksal dişileşmeye sebep olurken, tüm androjenlerin yüksek dozları uzun süreli uygulamalarda sterilizasyona (kısırlaşmaya) sebep olabilmektedirler 5,6,27,28. Çalışmamızda da uzun süreli yem uygulamalarında, yemdeki MT konsantrasyonu arttıkça kısır birey oranlarının arttığı gözlenmiştir. Daha ilginci, kısa süreli uygulama olarak düşünülebilecek MT banyo uygulamalarında kısır birey oranın, kontrol populasyonun üzerinde olduğunun gözlenmesidir. Bu durum banyo uygulamalarında kullanılan 0.5 mg l - MT dozunun çalışmamızdaki gibi sık periyotlarda (48 saat arayla) verildiğinde, besin kesesinde birikim sonucu kısırlaşmaya sebep olabilecek kadar yüksek konsantrasyonlara ulaşabileceğini ve yüksek dozda kısa süreli uygulamalarında sterilizasyona sebep olabileceğini işaret etmektedir. Salmonidlerde cinsiyet temelde ikili kromozomal ve dişi homogametik (XX/XY), genetik bir mekanizma tarafından belirlenmektedir 29. Bu tür bir mekanizmanın katı kontrolü altında, erkekleştirilmiş dişi yavrularının tamamının dişi olması beklenir. Fakat çalışmamızda, erkekleştirilmiş dişi gökkuşağı alabalığı yavruları arasında %0-2 oranında erkeklerin olduğu tespit edilmiştir. Benzer şekilde salmonidlerde yapılan diğer çalışmalarda da erkekleştirilmiş dişi yavruları arasında az sayıda erkeğe rastlanmıştır 8,25,30. Bu durum, balıklarda cinsiyete etki eden genlerin spesifik kromozomlar üzerinde toplanarak cinsiyet kromozomlarını oluşturmasını, yani cinsiyet kromozomu evrimini tamamlamamış olmasına ve otozomal kromozomlar üzerindeki gen veya genlerinde cinsiyeti belirlemede etkili olabilme-

69 234 Fonksiyonel Erkekleştirilmiş... sine bağlanmaktadır Bu koşullar altında, tamamı dişi populasyonlar üretebilmek ancak üretimde kullanılacak anaçların cinsiyeti etkileyen bu otozomal gen veya genlere karşı seçilimi ile mümkün olabilecektir. Monoseks dişi populasyonlar üretmek isteyen üreticiler anaç olarak kullandıkları dişi ya da erkekleştirilmiş dişilerin %00 dişi yavrular ürettiğini takip etmeli ve yavruları %00 dişi olmayan bireyleri anaç populasyonundan çıkarmalıdır. Teşekkür Bu araştırma için ana finansal destek Türkiye Bilimsel ve Teknolojik Araştırma Kurumu tarafından 04V34 nolu proje kapsamında sağlanmıştır. Projenin destekleyici kuruluşu olan Önder Alabalık Şirketi saha çalışmaları için fiziki alan sağlamak yanında, yavru, yem ve işçilik anlamında projeye finansal katkıda bulunmuştur. Yazar ticari bir işletmenin yoğun üretim baskısı altında, böylesine uzun soluklu bir araştırmada desteklerini esirgemeyen tüm Önder Alabalık ailesine ve özellikle Su Ürünleri Müh. Aytaç Levent IŞIK a teşekkürü bir borç bilir. KAYNAKLAR. Bye VJ, Lincoln RF: Commercial methods for the control of sexual maturation in rainbow trout (Salmo gairdneri R.). Aquaculture, 57, , Piferrer F: Endocrine sex control strategies for feminization of teleost fish. Aquaculture, 97, , Piferrer F, Beaumont A, Falguiere JC, Flajshans M, Haffray P, Colombo R: Polyploid fish and shellfish: Production, biology and applications to aquaculture for performance improvement and genetic containment. Aquaculture, 293, 25-56, Arslan T, Güven E, Baltacı MA: Hormonal cinsiyet dönüşüm metodu kullanarak monoseks gökkuşağı alabalığı (Oncorhynchus mykiss) üretimi. Kafkas Univ Vet Fak Derg, 6 (Suppl-B): , Hunter GA, Donaldson EM: Hormonal Sex Control and Its Application to Fish Culture. In, Hoar WS, Randall DJ, Donaldson EM (Eds): Fish Physiology. Vol: 9B, pp , Academic Press, New York, Pandian TJ, Sheela SG: Hormonal induction of sex reversal in fish. Aquaculture, 38, -22, Beardmore JA, Mair GC, Lewis RI: Monosex male production in finfish as exemplified by tilapia: Applications, problems, and prospects. Aquaculture, 97, , Feist G, Yeoh CH, Fitzpatrick M, Schreck CB: The production of functional sex-reversed male rainbow trout with 7α-methyltestosterone and β-hydroxyandrostenedione. Aquaculture, 3, 45-52, Johnstone R, Simpson TH, Youngson HF: Sex reversal in salmonid culture. Aquaculture, 3, 5-34, Cousin-Gerber M, Burger G, Boisseau C, Chevassus B: Effect of methyltestosterone on sex differentiation and gonad morphogenesis in rainbow trout, Oncorhynchus mykiss. Aquat Living Resour, 2, , Van Der Hurk R, Van Oordt PGWJ: Effects of natural androgens and corticosteroids on gonad differentiation in the rainbow trout, Salmo gairdneri. Gen Comp Endocr, 57, , Geffen AJ, Evans JP: Sperm traits and fertilization success of male and sex-reversed female rainbow trout (Oncorhynchus mykiss). Aquaculture, 82, 6-72, Van Der Hurk RJ, Slof GA: A morphological and experimental study of gonadal sex differentiation in the rainbow trout, Salmo gairdneri. Cell Tissue Res, 28, , Nakamura M, Kobayashi T, Chang X, Nagahama Y: Gonadal sex differentiation in teleost fish. J Exp Zool, 28, , Baron D, Houlgatte R, Fostier A, Guiguen Y: Large-scale temporal gene expression profiling during gonadal differentiation and early gametogenesis in rainbow trout. Biol Reprod, 73, , Krisfalusi M, Nagler JJ: Induction of gonadal intersex in genotypic male rainbow trout (Oncorhynchus mykiss) embryos following immersion in estradiol-7β. Mol Reprod Dev, 56, , Guerrero RD, Shelton WL: An aceto-carmine squash method for sexing juvenile fishes. The Prog Fish-Cult, 36, 56, Arslan T, Phelps RP, Osbourne JA: Effects of oestradiol-7β or 7α-methyltestosterone administration on gonadal differentiation of largemouth bass Micropterus salmoides (Lacepede). Aquacult Res, 40, , Goetz FW, Donaldson EM, Hunter GA, Dye HM: Effects of estradiol- 7b and 7α-methyltestosterone on gonadal differentiation in coho salmon, Oncorhynchus kisutch. Aquaculture, 7, , Malison JA, Kayes TB, Best CD, Amudson CH, Wenworth BC: Sexual differentiation and use of hormones to control sex in yellow perch (Perca flavescens). Can J Fish Aquat Sci, 43, 26-35, Piferrer F, Donaldson EM: The comparative effectiveness of the natural and a synthetic estrogen for the direct feminization of chinook salmon (Oncorhynchus tshawytscha). Aquaculture, 06, 83-93, Piferrer F, Donaldson EM: Gonadal differentiation in coho salmon, Oncorhynchus kisutch, after a single treatment with androgen and estrogen at different stages during ontogenesis. Aquaculture, 77, , Piferrer F, Baker IJ, Donaldson EM: Effects of natural, synthetic, aromatizable, and nonaromatizable androgens in inducing male sex differentiation in genotypic female chinook salmon (Oncorhynchus tshawytscha). Gen Comp Endocr, 9, 59-65, Piferrer F, Donaldson EM: Uptake and clearance of exogenous estradiol-7b and testosterone during the early development of coho salmon (Oncorhynchus kisutch), including eggs, alevins and fry. Fish Physiol Biochem, 3, , Lee P, King H, Pankhurst N: Preliminary assessment of sex inversion of farmed Atlantic salmon by dietary and immersion androgen treatments. North Am J Aquacult, 66, -7, Crim LW, Peter RE, Bilar R: Onset of gonadotropic hormone accumulation in immature trout pituitary gland in response to estrogen or aromatizable androgen steroid hormones. Gen Comp Endocr, 44, , Piferrer F, Carillo M, Zanuy S, Solar II, Donaldson E M: Induction of sterility in coho salmon (Oncorhynchus kisutch) by androgen immersions before first feeding. Aquaculture, 9, , Solar II, Donaldson EM, Hunter GA: Optimization of treatment regimes for controlled sex differentiation and sterilization in wild rainbow trout (Salmo gairdneri Richardson) by oral administration of 7α-methyltestosterone. Aquaculture, 42, 29-33, Devlin RH, Nagahama Y: Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture, 208, 9-364, Quillet E, Aubard G, Quesu I: Mutation in a sex-determining gene in rainbow trout: Detection and genetic analysis. J Hered, 93, 9-99, Scheerer PD, Thorgaard GH, Allendorf F: Genetic analysis of androgenetic rainbow trout. J Exp Zool, 260, , 99.

70 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE eqtl Analysis and Association of MYF6 mrna Expression with Meat Quality Traits in Pigs Mehmet Ulaş ÇINAR * Huitao FAN * Christiane NEUHOFF * Christine GROßE-BRINKHAUS * * Institute of Animal Sciences, Animal Breeding and Husbandry Group, University of Bonn, 535 Bonn - GERMANY Makale Kodu (Article Code): KVFD Summary The aim of this research was to measure mrna expression of porcine MYF6 (myogenic factor 6, also known in the medical literature as herculin and myogenic regulatory factor 4, MRF4) and to perform association study with meat quality traits as well as to unravel the transcriptional regulation of this gene by expression QTL (eqtl) study. For this purpose, Duroc Pietrain F2 resource population (DuPi; n = 33) were used for association and eqtl study. The mrna levels in Longissimus dorsi muscle tissue of MYF6 gene were evaluated by using qrt-pcr to identify association between gene expression and meat quality traits as well as to analyse eqtl. The mrna expression of MYF6 associated with conductivity24l (P<0.0) and ph24l (P<0.). Expression of MYF6 gene was higher in animals with high ph and conductivity of muscle. Linkage analysis using GridQTL revealed 4 trans-regulated eqtl on four porcine autosomes. Significant eqtl [P<0.0, CW (chromosome-wide)] were found for MYF6 on SSC2. A suggestive eqtl (P<0.05, CW) was identified on SSC8. These results revealed that gene expression of MYF6 associated with the meat quality traits and this gene could be potential functional candidate gene for meat quality traits in pigs. However, the analysis of eqtl also suggested that additional genes encoding for transcription factors (TF) could be considered, via fine-mapping underlying the eqtl peaks, in order to understand interaction among these genes. Keywords: eqtl, Pig, MYF6, mrna expression, Meat quality traits MYF6 mrna İfadesinin Domuzlarda Et Kalitesi ile İlişkisi ve eqtl Analizi Özet Bu çalışmanın amacı literatürde herculin ve myogenic factor 4 (MRF4) olarak ta bilinen domuz MYF6 (myogenic factor 6) geninin et kalite özellikleri ile ilişkisi belirlenmesi ve transkripsiyon seviyesinde gen ifadesinin kontrölünün QTL (eqtl) yöntemiyle incelenmesidir. Bu amaçla, Duroc Pietrain F2 deneysel populasyonu (DuPi; n = 33) asosiyasyon ve eqtl analizleri icin kullanılmıştır. MYF6 geninin mrna düzeyleri Longissimus dorsi kas dokusu hücrelerinde asosiyasyon ve eqtl analizi icin qrt-pcr kullanılarak ölçülmüştür. MYF6 genin mrna düzeyi iletkenlik24l (P<0.0) ve ph24l (P<0.) ile ilişkili bulunmuştur. MYF6 ifade düzeyi iletkenliğin ve ph nın yüksek olduğu kaslarda daha yüksek olarak bulunmuştur. GridQTL kullanılarak yapılan bağlantı analizinde dört domuz otozomal kromozomu üzerinde 4 trans-kontrollü eqtl tespit edilmiştir. SSC2 üzerinde MYF6 ifadesi için istatistiki olarak önemli eqtl [P<0.0, KÇ (kromozomal çapta)] bulunmuştur. SSC8 üzerinde önerim düzeyinde bir eqtl tespit edilmiştir (P<0.05, KÇ). Bu sonuçlar MYF6 ifadesinin et kalite özellikleri ile ilişkili olduğunu ve bu genin domuzlarda et kalitesinden sorumlu fonksiyonel bir aday gen olabileceğini göstermiştir. Ancak eqtl analizleri sonucunda, genler arasındaki etkileşimin anlaşılabilmesi için, detaylı haritalama çalışmaları ile eqtl bölgesindeki transkripsiyon faktörlerini (TF) kodlayan genlerin incelenmesi gerekmektedir. Anahtar sözcükler: eqtl, Domuz, MYF6, mrna ifadesi, Et kalite kriterleri INTRODUCTION A significant number of genes -4 and quantitative trait loci (QTL) ( have been reported for meat and carcass quality traits in pig. The myogenic factor 6 (MYF6/myogenic regulatory factor 4, MRF4) gene codes for the basic helix-loop-helix (bhlh) transcription factor (TF) belonging to MyoD family 5. Its expression accompanies the processes of differentiation and maturation of myotubes during embryogenesis and İletişim (Correspondence) ucin@itw.uni-bonn.de

71 236 eqtl Analysis and Association... continues on a relatively high level after birth, affecting the muscle phenotype 6. The expressed MYF6 is involved in the processes of differentiation and maturation of myotubes during embryogenesis and dominates quantitatively over the other myogenic regulatory factors (MRFs) in adult muscle 6-9. Increases in MYF6 mrna and protein may play a role in the differentiation of adult fibers 0. This gene has 0-fold higher postnatal expression than the other genes of the MRF family 7. The lack of active MYF6 protein causes an anomaly in the growth of muscle, known as myopathy. On the other hand, it was demonstrated that MYF6 also acts as a determining factor in the absence of myogenic factor 5 (MYF5) and myogenic differentiation (MYOD) during the onset of myogenesis in mice. This is the main reason why MYF6 is regarded as the principal factor influencing skeletal muscle phenotype 2. Transcriptional regulation complexity of the genes encoding the myogenic regulatory factors has been reviewed in vertebrates and concluded as skeletal myogenesis is coordinated by the activation of the MRFs in response to signals that are interpreted by their associated regulatory elements in different precursor cells during development 3. This explains the existence of numerous regulatory elements such as cis-, trans- or mirnas at large distances to MYF6 points make very complex pattern of the gene regulation with significant differences between species. Growth rate and muscularity are economically important in pig breeding. The development of skeletal muscle depends on the number and size of muscle fibers. Because of its functions and supported by results of linkage studies, MYF6 is considered as candidate gene for growth related traits in meat-producing animal species 4. Wyszynska-Koko et al. 6 has shown the association between SNP in coding and promoter region of MYF6 and production traits in pigs. Porcine MYF6 was mapped to porcine chromosome 5 (SSC5) 5 where different QTLs for meat and carcass quality traits were identified in pigs ( org/cgi-bin/qtldb/ss/index, August 20). mrna expression of MYF6 was shown to be differentially regulated between different pig breeds due to genetic 6 or epigenetic factors 8. Association between mrna expression and meat quality traits were shown in pigs 7,8. Moreover, expression variation of meat quality related genes enables us to identify the effects of QTL for gene expression called expression QTL (eqtl) 9. However, to best of our knowledge, no study has been devoted to association between mrna expression of MYF6 and meat quality in pigs in a large animal population. Therefore, the aim of this work was to study MYF6 through association and expression as well as eqtl study to prove its candidacy for meat quality traits. MATERIAL and METHODS Populations and Phenotypes Genomic DNA and phenotypic data were obtained from a reciprocal cross of Duroc and Pietrain (DuPi, n = 33) F2. The structure and breeding of the DuPi population was described in a previous study 20. All pigs were kept at the experimental research farm Frankenforst, Institute of Animal Science, University of Bonn (Germany). All pigs were slaughtered in a commercial slaughter house. Meat quality traits analysed in this study cover indicators of water holding capacity including drip loss, thawing loss, cooking loss, ph at 45 min post-mortem (p.m.) in loin (ph L ), ph at 24 h p.m. in loin (ph 24L ), conductivity at 45 min p.m. in loin (Conductivity L ) and conductivity at 24 h p.m. in loin (Conductivity 24L ). Conductivity and ph-values were measured using Star-series equipment (Rudolf Matthaeus Company, Germany) in both the longissimus dorsi muscle between 3th/4th ribs. Drip loss was scored based on a bag-method with a size-standardized sample from longissimus dorsi collected at 24 h p.m. that was weighed, suspended in a plastic bag, held at 4 C for 48 h, and thereafter re-weighed. To determine cooking loss, a loin cube was taken from the longissimus dorsi, weighed, placed in a polyethylene bag and incubated in water at 75 C for 50 min. Shear force was recorded in Instron testing machine. The bag was then immersed in flowing water at room temperature for 30 min and the solid portion was re-weighed. Thawing loss was determined similarly after at least 24 h freezing at -20 C. Drip loss, cooking loss, and thawing loss were calculated as a percentage of weight loss based on the start weight of a sample. Carcass quality traits were collected according to guidelines of German performance test 2. The numbers of records, mean values and standard errors are shown in Table. Expression Study Using Quantitative Real-Time PCR (qrt-pcr) Total RNA from the skeletal muscle samples of the 33 DuPi animals were isolated using TriZol reagent (Sigma- Aldrich). cdna was synthesised by reverse transcription PCR using 2 μg of total RNA, SuperScript II reverse transcriptase (Invitrogen) and oligo(dt)2 primer (Invitrogen). Gene specific primers for the qpcr were designed using the Primer Express software (Applied Biosystem); primers are listed in Table 2. The qpcr was conducted using the following program: 95 C for 3 min, 40 cycles 95 C for 5 sec/60 C for 45 sec on the ABI Prism 7000 Sequence Detection System (Applied Biosystem). Each PCR reaction contained 0 μl itaqtm SYBR Green Supermix with ROX PCR core reagents (Bio -Rad), 2 μl of cdna and an optimized amount of primer were mixed with double-distilled water to a final reaction volume of 20 μl. All samples were analysed twice (technical replication) and the arithmetic mean of the Ct values were further used for association analysis using SAS v9.2 (SAS Institute Inc., Cary, NC). The geometric mean of three housekeeping genes GAPDH (glyceraldehyde-3-phosphate dehydrogenase), RPL32 (ribosomal protein 32) and TBP (TATA box binding protein) was used for normalisation of

72 237 CINAR, FAN, NEUHOFF GROßE-BRINKHAUS Table. Data collection in the DuPi population and traits measured with mean and standard errors Tablo. DuPi populasyonundaki veri seti ve ölçülen özelliklerin ortalaması ve standart hatası Trait N Mean Standard Error Minimum Maximum ph L ph 24L Con L (ms) Con 24L (ms) Drip loss (%) Thawing loss (%) Cooking loss (%) Shear force (N) ph L, ph 24L : ph in longissimus dorsi muscle at 3 th /4 th rib at 45 minutes and 24 h p.m., respectively; Con L, Con 24L : conductivity in longissimus dorsi muscle at 3 th /4 th rib at 45 min and 24 h p.m., respectively, N: Newton, ms: millisecond the target genes. The delta Ct (ΔCt) values were calculated as the difference between target gene and geometric mean of the reference genes: ΔCt = Ct target gene Ct housekeeping gene. Ct values were Logarithm (Log) transformed and used for further analysis. The higher Ct value indicated lower expression and lower Ct value indicated higher gene expression. Association of Expression Profiles with Meat Quality Traits Association of gene expression levels with meat quality traits was analysed using generalized linear model (PROC GLM) in SAS. In this model, season of slaughter, family (Dam Sire) and sex of the animal were assumed as fixed effects; slaughter weight and gene expressions were included as a linear covariate for meat quality traits. The following GLM model was used: y ijk = µ + sex i + ys j + family k + β SW + β GE + e ijk where y ijk is the observation of the trait (meat quality); µ is the population mean; Sex k is the effect of k-th sex (k = for male and 2 for female); ys j is the effect of j-th season of slaughter (j = through 2; four seasons in 3 years); Family k is the fixed effect of k-th family (k = through 9); β GE is the linear effect of normalized gene expression as covariate (β GE = MYF6) and β SW is the linear effect of slaughter weight as covariate and e ijk is the random residual error. Marker Analysis and eqtl Study A linkage map with the total length of cm and an average marker interval of 7.7 cm was constructed. F 0, F and F 2 animals of the DuPi population were genotyped at 22 markers loci covering all porcine autosomes. Marker positions and details of genotyping procedures were described by Liu et al. 20 and for SSC by Große-Brinkhaus et al. 22. F 2 QTL interval mapping was performed using the web-based program GridQTL 23 based on a least square method. Single line-cross QTL analysis was carried out. Relevant fixed effects for gene expression values including class effects and covariates were tested the using GLM procedure of SAS. Residuals of the GLM model were used for the QTL analysis. Therefore, the basic QTL regression model used for eqtl analysis was: y ijk = µ + sex i + ys j + family k + β SW + e ijk where y ijk is the observation of the trait (gene expression); µ is the population mean; sex k is the effect of k-th sex (k = for male and 2 for female); ys j is the effect of j-th season of slaughter (j = through 2; four seasons in 3 years); family k is the fixed effect of k-th family (k = through 9); and β SW is the linear effect of slaughter weight as covariate and e ijk is the random residual error. Chromosome-wide (CW) 5% significance thresholds were determined using 000 permutations 24. The confidence Table 2. Primer sequences used for qrt-pcr analysis Tablo 2. qrt-pcr analizi için kullanılan primer dizileri Gene Name Primers Sequence Tm Product Size GenBank ID MYF6 F: TGGATCAGCAGGACAAAATG R: TGTTTGTCCCTCCTTCCTTG 55 C 7 bp AY88502 GAPDH F: ACCCAGAAGACTGTGGATGG DQ C 247 bp R: ACGCCTGCTTCACCACCTTC RPL32 F: AGCCCAAGATCGTCAAAAAG AY C 64 bp R: TGTTGCTCCCATAACCAATG TBP F: AGCAGCACAGTACGAGCAA R: GATGGACGTTCGGTTTAGG 60 C 24 bp DQ7829

73 238 eqtl Analysis and Association... interval (CI) was calculated by bootstrapping in QTL Express. We considered only the QTL which cross LOD score.7 in this study. Percentage of F 2 variance explained by the model was calculated as Var % = Where MS R is the residual MS from the reduced model, omitting QTL but including all fixed effects, and MS F is the residual MS from the full model, including QTL and all fixed effects. RESULTS MS R MS MS Association of Expression with Meat and Carcass Quality Traits R F x 00 The gene expression as well as association study and 25 eqtl analysis were conducted in 33 DuPi animals. Association between gene expression and meat quality traits were estimated with a GLM model. The main fixed effects influencing meat quality characteristics were season of slaughter followed by sex (except Con 24L, drip loss and cooking loss) and family (except ph 24L, con L and drip loss). Slaughter weight has no effect on meat quality traits except for cooking loss and shear force. Significant (P values) values of the class effects were given in Table 3. According to the result of the linear model, estimated R-square value explained 58% of ph 24L and 58% of Con 24L variation by MYF6 expression (Table 3). Suggestive association was detected between MYF6 expression with ph 24L (P<0.). A significant association was detected between MYF6 mrna expression and Con 24L (P<0.0). Moreover, in the DuPi population, one of the important meat quality parameter drip loss was found to be negatively correlated with ph 24L and positively correlated with Con 24L (Table 4). Table 3. Association between MYF6 mrna expression and meat quality traits in the DuPi population Tablo 3. DuPi populasyonunda MYF6 mrna ekspresyonu ve et kalite kriterleri arasindaki asosiyasyon Class Effects Traits R 2 Gene Expression Season of Slaughter Sex Slaughter Weight Family ph L 0.60 ns *** * ns *** ph 24L 0.58 * *** *** ns ns Con L 0.48 ns ** *** ns ns Con 24L 0.58 *** *** ns ns *** Drip loss 0.47 ns *** ns ns ns Cooking loss 0.65 ns *** ns *** *** Thawing loss 0.54 ns *** * ns *** Shear force 0.63 ns *** ** ** *** ns = not significant Three significance levels were used: *** (P<0.0); ** (P<0.05); * (P<0.) P-values showed by the star, derived from total variation explained by the class effects (R 2 ) Table 4. Correlation among meat quality traits in the DuPi population Tablo 4. DuPi populasyonunda et kalite özellikleri arasındaki korrelasyon Trait r, (p) ph L ph 24L Con L Con 24L Drip Loss Thawing Loss Cooking Loss Shear Force ph L 0.4 (0.007) ph 24L (<.000) 0.0 (0.72) Con L (<.000) (0.98) 0.20 (0.0002) Con 24L (<.000) (0.0002) 0.23 (<.000) 0.38 (<.000) Drip loss 0.03 (0.57) -0.5 (0.005) -0.0 (0.82) 0.0 (0.8) 0.4 (0.007) Thawing loss -0.4 (<.000) -0.6 (0.0022) 0.04 (0.37) 0.0 (0.06) 0.5 (0.003) (0.50) Cooking loss Shear force -0.6 (0.004) 0.02 (0.7) 0.3 (0.0) 0.25 (<.000) 0.5 (0.0067) 0.04 (0.44) 0.23 (<.000)

74 239 CINAR, FAN, NEUHOFF GROßE-BRINKHAUS Differential Expression of MYF6 In the animals with extreme phenotype of ph L, ph 24L and Con 24L (n = 0) selected for differential expression, the gene expression was significantly higher in animals with low ph L compared to animals with high ph L (data not shown) (Fig. ). Animals with higher ph 24L had higher MYF6 gene expression compared to animals with low ph 24L (Fig. ). The MYF6 mrna expression was higher in animals with high conductivity at 24 h p.m. value compared to animals with low conductivity at 24 h p.m. (Fig. ). Expression QTL (eqtl) A total of four eqtl were detected for MYF6 expression on four porcine autosomes. On SSC2, a % chromosomewide significant eqtl at 26 cm close to the marker S04 explained 5.2% of the phenotypic variation (Table 5). A suggestive eqtl was identified on SSC5 at 6 cm close to marker IGF. Moreover, a 5% chromosome-wide significant eqtl was detected on SSC8 between the markers SW26 and S0086 which explains 3.4% of total variation. Another suggestive eqtl for MYF6 was detected on SSC0 at 33 cm close to marker SW95 (Table 5). Experiment-wide thresholds (8.36 and 9.80, P<0.05 and P<0.0, respectively) were also calculated; however no eqtl in this study reached the experiment-wide thresholds. DISCUSSION Expression of MYF6 Fig. Differential expression of MYF6 mrna (a) animals with high and low ph 24L, (b) animals with high and low Con 24L. Lower Ct values represent higher gene expression and vice versa Şekil. MYF6 mrna sının ifade farklılığı (a) yüksek ve düşük ph 24L özelliğe sahip hayvanlar, (b) yüksek ve düşük Con 24L özelliğine sahip olan hayvanlar. Düşük Ct değerleri yüksek gen ifadesini göstermektedir In recent few decades, pig breeding focused on improving growth rate and muscularity. This causes gradual decrease in meat quality and deterioration of carcass traits such as intramuscular fat content, colour, hardness or water content in meat 6. The commercial Duroc and Pietrain breeds differ extremely for their muscle phenotypes (i.e., myofiber numbers and myofiber types) 26. In vertebrates skeletal myogenesis is coordinated by the activation of the myogenic regulatory factors (MRFs) in response to signals that are interpreted by their associated regulatory elements in different precursor cells during Table 5. Expression QTL (eqtl) mapping results for the mrna expression of MYF6 gene on swine autosomes identified in the DuPi population Tablo 5. Domuz otozomlarında tanımlanan DuPi populasyonunda MYF6 geninin mrna ifadesi için ekspresyon QTL (eqtl) haritalama sonuçları SSC a Trait b F-ratio c Position (CI 95 ) d Closest Markers e Additive (SE) f Dominance (SE) g Variation (%) h 2 MYF6 8.** 26 (0 202) SW263 S (0.2) 2.43 (0.60) MYF ( 0 3) IGF (0.7) 0.82 (0.32).7 8 MYF6 5.26* 4 ( ) SW26 S (0.9) 0.7 (0.27) MYF (0 29) SW95 SWR (0.2) 0.55 (0.44) 2.22 a Sus scrofa chromosome b Gene abbreviations according to NCBI database c Significance level was used: 5% chromosome-wide significance level, as suggestive level. The eqtl those can reach the level marked by star d Positions of detected eqtl in Kosambi cm with the 95% confidence interval (CI 95 ) given in parentheses according to the bootstrapping approach e The closest markers were those markers around the peak, as near as possible f Additive effects, expressed as the deviation of the Duroc-Pietrain alleles. SE = standard error g Dominance effects, expressed as the deviation of the Duroc-Pietrain alleles. SE =standard error h Fraction of phenotypic variance explained by each eqtl as a percentage of the residual variance in the F 2 population * Significant on a chromosome-wide level with P 0.05 ** Significant on a chromosome-wide level with P 0.0

75 240 eqtl Analysis and Association... development 27. MYF6 is the most abundantly expressed myogenic factor in postnatal muscle where it quantitatively predominates over the other MyoD family transcripts 28. MYF6 is considered as one promising candidate gene for growth- and meat quality-related traits in adult pigs 5. Recently, MYF6 mrna and protein expression was shown to be significantly up-regulated in purebred Pietrain pigs compared to purebred Duroc pigs in the founder family of DuPi F 2 animals 8. Polymorphism in MYF6 in the promotor region and exon are signicantly correlated with weight of loin and ham, right half-carcass weight and daily gain 29. The same researchers did not observe any mrna expression differences among genotype classes. However, in our study, we found that MYF6 expression was associated with meat ph at 24 h post-mortem (Table 3) and showed that expression was higher in animal with high muscle ph and conductivity indicating that this gene was expressed higher in muscle with lower drip loss because in the DuPi population, muscle ph was negatively correlated with drip loss (r = -0.20, P = ). The same negative correlation between muscle ph and drip loss has also been reported 30. Similar results were also obtained by Liu et al. 3 ; they also identified association between MYF5 SNP and longissimus dorsi ph in pigs. Te Pas et al. 32 stated that genetic variation at the porcine MYF5 gene locus could also be used as a marker to study association of the MYF6 locus with muscle development-related meat traits. SNP in bovine MYF5 were found to be associated with meat traits in cattle 33. In chicken, although MYF5 found to be associated with several carcass traits, no polymorphism was detected in MYF6 gene 34. In the study of Ropka-Molik et al. 6 expression for the MYF6 gene did not show statistically significant differences between ages of development in analyzed Poland Landrace and Pietrain breeds. The highest mrna level of MYF6 gene was observed in gracilis muscle in this study among two breeds, but a statistically significant (P<0.0) difference was only found in Pietrain pigs. Expression QTL Analysis Analysis of expression quantitative trait loci (eqtl) provides a means for detecting transcriptional regulatory relationships at a genome-wide scale 35. Many investigations have reported the successful mapping of eqtl in rats, mice, humans or pigs with different sample sizes But experimental data from genetic investigations of gene expression in farm animals are still limited 37. Mapping of eqtl to the specific gene indicates that cis- changes are responsible for the different expression levels, whereas mapping positions of eqtl that are different from the positions of the corresponding genes indicate transregulation. In this study, four eqtls on four different porcine autosomes were detected. Different Lod scores were reported as threshold for a QTL 25,40,4. Here in our study a Lod score value of.7 was chosen based on the median of presented thresholds in literature 40,4 to indicate an eqtl as suggestive. Among them, an eqtl on SSC5 might be a putative cis-regulated eqtl since the confidence interval of this eqtl did incorporate the chromosomal location of the MYF6 gene. Moreover, the highest peak of this eqtl (6 cm) was closed to the marker IGF, very close to the chromosomal location of MYF6. The power of this putative eqtl on SSC5 is low which might be due to low number of animals in the population. However, the DNA variations of this gene in promoter and exon were not affecting the expression of the MYF6 gene in a previous study 6 and the confidence interval of this eqtl is very wide indicating that the eqtl on SSC5 is better to be considered as a trans-eqtl. The other three eqtls showed trans-regulation of this gene which were consistent with the previous reports for pigs 42 and other species 35,43. Most genes are regulated through complex networks, and function and expressions are influenced by itself as well as different other genes, transcription factors and mirnas 34. Moreover, distant eqtl may affect their target genes in many possible ways such as protein-coding regions, cis-regulatory DNA motifs, transcription factor that is polymorphic in its DNA binding region, or other functional nucleotide sequences 35. The MRFs trigger a cascade of transcription factors and downstream structural genes. Due to the close vicinity of MYF6 and MYF5 genes on SSC5, these two genes have a common regulatory region and the expression of both genes is in part activated together 44. Analyses of the mechanisms behind promoter-enhancer specificity in the MYF6/MYF5 locus have unveiled a new class of element, termed Transcription balancing sequences which explains the cis-acting effects observed in the various MYF6 and MYF5 alleles 3. On the other hand, Black et al. 45 showed that MYF6 promoter is trans-activated by myogenin, MyoD, MYF5 and by the myocyte enhancer factor-2 (MEF2) factors in mice. In our study a significant eqtl (Table 5) was detected close to marker S04. An important gene called insulin-like growth factor 2 (IGF2) locates distal part of the p arm on SSC2. Regulatory mutation of IGF2 and relation to muscle growth in pigs gene was shown previously 46. Alzhanov et al. 47 identified distal transcriptional enhancer directly stimulates the transcriptional activity of an IGF2 promoter-reporter gene in differentiating myoblasts. Ponsuksili et al. 37 stated that the expression of genes associated with traits that have low heritability, like drip loss or meat ph is under the control of several transregulated genes. The detected eqtl in this study explain a low proportion of phenotypic variation. Trans-eQTL usually reflects genetic regulation that is dispersed across many loci with small effects and each explains small phenotypic variance 48. Moreover, trans-regulated genes appear more in complex traits (i.e., under polygenic control) than the cis-regulated genes and are likely to reflect the additive outcome of genetic, epigenetic, and environmental regulation 49. In our study, all detected

76 24 CINAR, FAN, NEUHOFF GROßE-BRINKHAUS eqtls were found to have higher dominance effects (Table 5). Duroc and Pietrain pig breeds were divergent for meat quality and growth traits, recently their mrna expression for MYF6 gene was found to be differentially regulated 8. Heterosis might be one of the possible reasons for this over dominancy. However, it is not possible to proof this with the available data in our hand. To link an eqtl to the genetic background of a classical phenotypic trait of interest, it is necessary to establish a relationship between the variation of that classical phenotypic trait and its corresponding pqtl (pheneqtl) position on one hand and the expression level of that particular transcript or the mapping position of the eqtl on the other hand 37. Among these QTL, phenotypic QTL for ph and conductivity reported on SSC2 20,50 are close to our detected eqtl for MYF6 in the DuPi population. As a conclusion, significant and suggestive associations were found between gene expression and meat quality traits in the DuPi animals and higher expression of the MYF6 might contribute to lower drip loss and higher muscle ph. According to eqtl analyses it is difficult to say that our candidate gene is cis-regulated. Moreover, DNA variations in promoter of MYF6 including MYF5 were requested as further study to test whether SNPs affecting its transcription abundance. Therefore, MYF6 could be a trans-regulated gene which might be due to the presence of the widely distributed genetic regulators such as transcription factors and non-coding RNAs in the whole genome as well as non-genetic mechanisms (epigenetics). Finally, MYF6 could be suggested as a potential candidate gene for meat quality traits in pigs. However, further studies are necessary to validate these results with other breeds especially in larger outbreed populations and further analysis of detected overlapping eqtls and QTL regions can dissect genes and regulators that are responsible for meat quality traits in pigs. Acknowledgements This project was supported by the German Research Foundation (DFG), Functional Genetic Principles of Water Binding Capacity in Pork DRIP FOR 753 Germany. Authors are indebted to Ms. Nadine Leyer for technical assistance during the experiments. REFERENCES. Davoli R, Fontanesi L, Cagnazzo M, Scotti E, Buttazzoni L, Yerle M, Russo V: Identification of SNPs, mapping and analysis of allele frequencies in two candidate genes for meat production traits: The porcine myosin heavy chain 2B (MYH4) and the skeletal muscle myosin regulatory light chain 2 (HUMMLC2B). Animal Genet, 34 (3): , Fontanesi L, Colombo M, Tognazzi L, Scotti E, Buttazzoni L, Dall Olio S, Davoli R, Russo V: The porcine TBCD gene: Mapping, SNP identification, and association study with meat, carcass and production traits in Italian heavy pigs. Mol Biol Rep, 38 (2): , Srikanchai T, Murani E, Phatsara C, Schwerin M, Schellander K, Wimmers K, Ponsuksili S: Association of ZYX polymorphisms with carcass and meat quality traits in commercial pigs. Meat Sci, 84 (): 59-64, Rothschild MF, Fan B, Lkhagvadorj S, Cai W, Young J, Smith RM, Dekkers JCM, Huff-Lonergan E, Lonergan SM: Identification of genetic markers associated with residual feed intake and meat quality traits in the pig. Meat Sci, 84 (4): , Maak S, Neumann K, Swalve HH: Identification and analysis of putative regulatory sequences for the MYF5/MYF6 locus in different vertebrate species. Gene, 379, 4-47, Wyszynska-Koko J, Kuryl J: Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region. Anim Biotech, 5 (2): 59-73, Bober E, Lyons GE, Braun T, Cossu G, Buckingham M, Arnold HH: The muscle regulatory gene, Myf-6, has a biphasic pattern of expression during early mouse development. J Cell Biol, 3 (6): , Fan H, Cinar MU, Phatsara C, Tesfaye D, Tholen E, Looft C, Schellander K: Molecular mechanism underlying the differential MYF6 expression in postnatal skeletal muscle of Duroc and Pietrain breeds. Gene, Hinterberger TJ, Sassoon DA, Rhodes SJ, Konieczny SF: Expression of the muscle regulatory factor MRF4 during somite and skeletal myofiber development. Dev Biol, 47 (): 44-56, Lowe DA, Lund T, Alway SE: Hypertrophy-stimulated myogenic regulatory factor mrna increases are attenuated in fast muscle of aged quails. Am J Physiol, 275 ( Pt ): C55-62, Kassar-Duchossoy L, Gayraud-Morel B, Gomes D, Rocancourt D, Buckingham M, Shinin V, Tajbakhsh S: Mrf4 determines skeletal muscle identity in Myf5: Myod double-mutant mice. Nature, 43 (7007): , Buonanno A, Apone L, Morasso MI, Beers R, Brenner HR, Eftimie R: The myod family of myogenic factors is regulated by electrical-activity - Isolation and characterization of a mouse Myf-5 Cdna. Nucleic Acids Res, 20 (3): , Carvajal JJ, Rigby PWJ: Regulation of gene expression in vertebrate skeletal muscle. Exp Cell Res, 36 (8): , Pas MFWT, Harders FL, Soumillion A, Born L, Buist W, Meuwissen THE: Genetic variation at the porcine MYF-5 gene locus. Lack of association with meat production traits. Mamm Genome, 0 (2): 23-27, Vykoukalova Z, Knoll A, Dvorak J, Rohrer GA, Cepica S: Linkage and radiation hybrid mapping of the porcine MYF6 gene to chromosome 5. Animal Genet, 34 (3): , Ropka-Molik K, Eckert R, Piorkowska K: The expression pattern of myogenic regulatory factors MyoD, Myf6 and Pax7 in postnatal porcine skeletal muscles. Gene Exp Patt, (-2): 79-83, Gandolfi G, Cinar MU, Ponsuksili S, Wimmers K, Tesfaye D, Looft C, Jungst H, Tholen E, Phatsara C, Schellander K: Association of PPARGCA and CAPNS gene polymorphisms and expression with meat quality traits in pigs. Meat Sci, 89 (4): , Kayan A, Cinar MU, Uddin MJ, Phatsara C, Wimmers K, Ponsuksili S, Tesfaye D, Looft C, Juengst H, T holen E, Schellander K: Polymorphism and expression of the porcine Tenascin C gene associated with meat and carcass quality. Meat Sci, 89 (): 76-83, Jansen RC, Nap JP: Genetical genomics: The added value from segregation. Trends Genet, 7 (7): , Liu G, Jennen DGJ, Tholen E, Juengst H, Kleinwachter T, Holker M, Tesfaye D, Un G, Schreinemachers HJ, Murani E, Schellander K, Wimmers K: A genome scan reveals QTL for growth, fatness, leanness and meat quality in a Duroc-Pietrain resource population. Animal Genet, 38 (3): , ZDS: Richtlinie für die Stationsprüfung auf Mastleistung, Schlachtkörperwert und Fleischbeschaffenheit beim Schwein. Zentralverband der Deutschen Schweineproduktion ev, Ausschussfür Leistungsprüfung und Zuchtwertschätzung, Bonn, Grosse-Brinkhaus C, Phatsara C, Tholen E, Schellander K, Jonas ES: Finemapping of QTL for meat quality traits on porcine chromosome.

77 242 eqtl Analysis and Association... Zuchtungskunde, 8 (): 63-68, Seaton G, Grunchec JA, White I, Allen J, De Koning DJ, Wei W, Berry D, Haley C, Knott S: GridQTL: A Grid Portal for QTL Mapping of Compute Intensive Datasets. In: Proceedings of the 8th World Congress on Genetics Applied to Livestock Production: August ; Belo Horizonte, Brazil, Churchill GA, Doerge RW: Empirical threshold values for quantitative trait mapping. Genetics, 38, , Uemoto Y, Soma Y, Sato S, Shibata T, Kadowaki H, Katoh K, Kobayashi E, Suzuki K: Mapping QTL for fat area ratios and serum leptin concentrations in a Duroc purebred population. Anim Sci J, doi: 0./j x, Cagnazzo M, te Pas MF, Priem J, de Wit AA, Pool MH, Davoli R, Russo V: Comparison of prenatal muscle tissue expression profiles of two pig breeds differing in muscle characteristics. J Anim Sci, 84 (): -0, Pownall ME, Gustafsson MK, Emerson CP Jr: Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu Rev Cell Dev Biol, 8, , Miner JH, Wold B: Herculin, a fourth member of the MyoD family of myogenic regulatory genes. Proc Natl Acad Sci USA, 87 (3): , Wyszynska-Koko J, Pierzchala M, Flisikowski K, Kamyczek M, Rozycki M, Kuryl J: Polymorphisms in coding and regulatory regions of the porcine MYF6 and MYOG genes and expression of the MYF6 gene in m. longissimus dorsi versus productive traits in pigs. J Appl Genet, 47 (2): 3-38, Essén-Gustavsson B, Karlström K, Lundström K: Muscle fibre characteristics and metabolic response at slaughter in pigs of different halothane genotypes and their relation to meat quality. Meat Sci, 3 (): -, Liu M, Peng J, Xu DQ, Zheng R, Li FE, Li JL, Zuo B, Lei MG, Xiong YZ, Deng CY: Association of MYF5 and MYOD Gene polymorphisms and meat quality traits in Large White x Meishan F2 Pig Populations. Biochem Genet, 46 (-2): , te Pas MF, Verburg FJ, Gerritsen CL, de Greef KH: Messenger ribonucleic acid expression of the MyoD gene family in muscle tissue at slaughter in relation to selection for porcine growth rate. J Anim Sci, 78 (): 69-77, Robakowska-Hyzorek D, Oprzadek J, Zelazowska B, Olbromski R, Zwierzchowski L: Effect of the g.-723g -> T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein- Friesian Cattle. Biochem Genet, 48 (5-6): , Yin HD, Zhang ZC, Lan X, Zhao XL, Wang Y, Zhu Q: Association of MyF5, MyF6 and MyOG gene polymorphisms with carcass traits in Chinese Meat Type Quality chicken populations. J Anim Vet Adv, 0 (6): , Michaelson JJ, Loguercio S, Beyer A: Detection and interpretation of expression quantitative trait loci (eqtl). Methods, 48 (3): , Morley M, Molony CM, Weber TM, Devlin JL, Ewens KG, Spielman RS, Cheung VG: Genetic analysis of genome-wide variation in human gene expression. Nature, 430 (700): , Ponsuksili S, Murani E, Phatsara C, Schwerin M, Schellander K, Wimmers K: Expression quantitative trait loci analysis of genes in porcine muscle by quantitative real-time RT-PCR compared to microarray data. Heredity, 05 (3): , Stranger BE, Forrest MS, Clark AG, Minichiello MJ, Deutsch S, Lyle R, Hunt S, Kahl B, Antonarakis SE, Tavare S: Genome-wide associations of gene expression variation in humans. PLoS Genet, (6): e78, Wimmers K, Ponsuksili S, Murani E, Schwerin M, Schellander K: Identification of expression QTL (eqtl) of genes expressed in porcine M. longissimus dorsi and associated with meat quality traits. BMC Genomics, (): 572, DOI: 0.86/ Soma Y, Uemoto Y, Sato S, Shibata T, Kadowaki H, Kobayashi E, Suzuki K: Genome-wide mapping and identification of new quantitative trait loci affecting meat production, meat quality, and carcass traits within a Duroc purebred population. J Anim Sci, 89 (3): , Van Ooijen JW: LOD significance thresholds for QTL analysis in experimental populations of diploid species Heredity, 83, , Ponsuksili S, Jonas E, Murani E, Phatsara C, Srikanchai T, Walz C, Schwerin M, Schellander K, Wimmers K: Trait correlated expression combined with expression QTL analysis reveals biological pathways and candidate genes affecting water holding capacity of muscle. BMC Genomics, 9, 367, doi:0.86/ , Bystrykh L, Weersing E, Dontje B, Sutton S, Pletcher MT, Wiltshire T, Su AI, Vellenga E, Wang J, Manly KF: Uncovering regulatory pathways that affect hematopoietic stem cell function using genetical genomics. Nat Genet, 37 (3): , Carvajal JJ, Cox D, Summerbell D, Rigby PWJ: Control of the expression of the Mrf4 and Myf5 genes: A BAC transgenic approach. Inter J Dev Biol, 45, S39-S40, Black BL, Martin JF, Olson EN: The mouse Mrf4 promoter is transactivated directly and indirectly by muscle-specific transcription factors. J Biol Chem, 270 (7): , Georges M, Van Laere AS, Nguyen M, Braunschweig M, Nezer C, Collette C, Moreau L, Archibald AL, Haley CS, Buys N: A regulatory mutation in IGF2 causes a major QTL effect on muscle growth in the pig. Nature, 425 (6960): , Alzhanov DT, Rotwein P, McInerney SF: Long range interactions regulate Igf2 gene transcription during skeletal muscle differentiation. J Biol Chem, 285 (50): , Gibson G, Weir B: The quantitative genetics of transcription. Trends Genet, 2 (): , Petretto E, Mangion J, Dickens NJ, Cook SA, Kumaran MK, Lu H, Fischer J, Maatz H, Kren V, Pravenec M: Heritability and tissue specificity of expression quantitative trait loci. PLoS Genet, 2 (0): e72, Lee SS, Chen Y, Moran C, Cepica S, Reiner G, Bartenschlager H, Moser G, Geldermann H: Linkage and QTL mapping for Sus scrofa chromosome 2. J Anim Breed Genet, 20, -9, 2003.

78 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Investigation on Porcine Aromatase (CYP9) as a Specific Target Gene for Boar Testis Mehmet Ulaş ÇINAR * Asep GUNAWAN * * Institute of Animal Sciences, Animal Breeding and Husbandry Group, University of Bonn, 535 Bonn, GERMANY Makale Kodu (Article Code): KVFD Summary Cytochrome P450 aromatase is the key enzyme in estrogen biosynthesis, encoded by CYP9 gene. Impairment of spermatogenesis associated with a decrease in sperm motility and inability to fertilize oocytes in mice due to the lacking of CYP9 was observed. However, it is little known about the CYP9 roles in boar spermatogenesis and fertility. Therefore, the aim of this research was to investigate the mrna and protein expression of CYP9 in boar reproductive tissues from boars with different sperm quality. For mrna and protein expression study, a total of six boars were divided into two groups with Group (G-I) and Group 2 (G-II) where G-I was characterized for relatively a better sperm quality. The result showed that the CYP9 transcript was not expressed throughout the male reproductive system. mrna expression of CYP9 was higher only in testis. CYP9 expression was similar in testis collected from G-I and G-II boars. The CYP9 protein expression results from western blot were different with the results of qrt-pcr. The CYP9 protein was higher in testis collected from G-II than G-I boars. The CYP9 protein localization in testis showed a strong staining only in the cytoplasm Leydig cell. These results shed new light on the roles of porcine CYP9 in spermatogenesis as a specific target gene for testis. Keywords: mrna, Protein, Immunofluorescence, Testis, Boar spermatozoa Erkek Domuzlarda Testisler İçin Hedef Bir Gen Olan Aromataz (CYP9) Üzerine Araştırma Özet Sitokrom P450 aromataz östrojen üretiminde önemli bir enzim olup, CYP9 geni tarafından ifade edilir. CYP9 geninin yokluğunda farelerde sperm üretiminin zarar gördüğü ve ilişkili olarak spermlerin yüzme ve yumurtaları dölleme kabiliyetinin azaldığı gözlenmiştir. Buna karşılık CYP9 un domuz sperm üretiminde ve yumurtaların döllenmesinde nasıl bir rol oynadığı bilinmemektedir. Bu nedenle, bu calışmanın amacı CYP9 mrna ve protein ifadesini farklı sperm kalite özelliklerine sahip olan erkek domuzların üreme organı dokularında araştırmaktır. mrna ve protein ifadesi çalısması için altı erkek domuz, grup (G-I) ve grup 2 (G-II) olarak iki gruba ayrılmıştır. G-I hayvanlar göreceli olarak G-II hayvanlara göre daha iyi sperm özelliklerine sahiptir. Sonuçlar CYP9 mrna ifadesinin tüm erkek üreme organlarında ifade edilmediğini göstermiştir. CYP9 un mrna ifadesi en çok testis dokularında gözlenmiştir ve ayrıca G-I ve G-II domuzlardan alınan testis örneklerinde aynı düzeyde tespit edilmiştir. CYP9 un Western-Blot protein ifadesi sonuçları qrt-pcr sonuçlarından farklı olarak gözlenmiştir. CYP9 protein ifadesi G-II hayvanlarda G-I hayvanlara göre daha yüksek düzeyde gözlenmiştir. Testiste CYP9 protein lokalizasyonu sitoplazma Leydig hücrelerinde güçlü bir sinyal göstermiştir. Sonuçlar, CYP9 geninin domuzlarda sperm üretimi için testislerde spesifik bir hedef gen olduğuna dair yeni bulgular ortaya koymuştur. Anahtar sözcükler: mrna, Protein, İmmunfloresans, Testis, Domuz spermatozoa INTRODUCTION Aromatase is the only enzyme responsible for the irreversible bioconversion of androgens into estrogens. This enzyme is a complex composed of an ubiquitous NADPH cytochrome P450 reductase and a specific cytochrome P450 aromatase encoded by the CYP9 gene. Estrogens have been for a long time considered as a specific female hormone; however, the presence of estrogens in the male gonad is now well documented 2. Indeed the androgen/estrogen balance is essential for normal sexual development and reproduction in mammals. In İletişim (Correspondence) ucin@itw.uni-bonn.de

79 244 Investigation on Porcine... the mammalian testis, maintenance of this balance is under a fine tuning via endocrine and paracrine factors, but is also related to the aromatase activity 2. Although in humans and some higher primates, there is a more extensive distribution of estrogen biosynthesis including placenta, adipose tissue, liver and skin 3, according to the steroid levels assayed in the testicular artery and vein, testes are a major source of estrogens 4 and aromatase has been immunolocalized in Leydig cells 5,6. In the testis of mammals, gonadotropins and testosterone together with numerous locally-produced factors are responsible for the induction and/or the maintenance of spermatogenesis 7. Deficieny of CYP9 and effects on spermatogenesis were shown in different mammalian species. Impairment of spermatogenesis associated with a decrease sperm motility and inability to fertilize oocytes was reported due to lacking of CYP9 gene in mice 8. In buffalo, higher expression of CYP9 was found in spermatozoa obtained from good quality of semen as compared to spermatozoa from poor quality of semen 9. Similarly, the higher expression CYP9 was found in motile spermatozoa as compared to non-motile 0. CYP9 mrna and protein expressed higher in adult stallions compared to colts. In the adult stallions, the testis, among the tissues analyzed, found to be the major source of aromatase that shows gene expression is specifically enhanced at this level, and is responsible for the high estrogen synthesis. Testis is responsible for the induction and/or the maintenance of spermatogenesis and is the major source for CYP9 enzyme. However, there is no information regarding the expression of CYP9 in reproductive tissue from different quality of boar sperm and very few known about the role of CYP9 in boar spermatogenesis. Therefore, this research was aimed to investigate the mrna and protein expression of CYP9 in boar reproductive tissues from boars with different sperm quality. MATERIALS and METHODS Samples for mrna and Protein Expression Analysis Boars from the artificial insemination station SuisAG (Sempach, Switzerland) were selected based on extreme phenotypes [high/low sperm concentration (SCON), sperm motility (SMOT), and sperm volume (SVOL)]. The SCON (average sperm concentration) was highly negative (r = -0.8) correlated with SVOL (average semen volume), whereas SCON was highly positive (r = 0.7) correlated with SMOT (average sperm motility). Moreover, SVOL was highly negative (r = -0.8) correlated with SMOT. Therefore, grouping was done on the basis of SCON, SVOL and SMOT (Table ). A total of six animals were selected and equally divided into group I (G-I) with high SCON (> ml), high SMOT (>76.59%) and low SVOL (<25.24 ml/ejaculation) and group II (G-II) with low sperm concentration and motility, and high sperm volume (Table ). The difference between the two groups was calculated using proc t-test in SAS. There were differences for SCON (P<0.05) and for SVOL (P<0.0) between G-I and G-II, whereas for the SMOT the difference was not significant (P = 0.2). Reproductive tissues (testis, head of epididymis, body of epididymis, tail of epididymis, vas deferens, bulbourethral gland, vesicular glands and prostate gland), non reproductive tissues (brain, liver and skeletal muscle tissue) and semen samples (spermatozoa) of six boars (Duroc, Large White and Landrace) were collected for the mrna and protein study 2. Semi-Quantitative PCR Total RNA was isolated using TRI Reagent (Sigma- Aldrich) from different reproductive and non reproductive tissues of breeding boars mentioned in previous chapter. RNA was purified using RNeasy Mini Kit (Qiagen) according to the manufacturer s instructions. Total RNA was treated using on-column RNase-Free DNase set (Promega) and quantified sphectrophotometrically (Nano Drop, ND8000 Thermo Scientific). Furthermore, RNA integrity was checked by 2% agarose gel electrophoresis. First-strand cdna were synthesized from individual RNA using Superscript II enzyme (Invitrogen). cdna amplification was performed by using specific forward and reverse primers (forward: 5 -ttag caagtcctcaagtgtg -3 and reverse: 5 - ccaggaagaggttgtt agag-3 ) derived from porcine CYP9 sequence (GenBank accession: U373). Amplification was performed with an initial heating at 95 C for 5 min followed by 35 cycles of 95 C for 30 sec, annealing temperature at 52 C for 30 sec and 72 C for 30 sec, on the PCR Thermal Cycler (Bio-Rad). PCR product were electrophoresed on a.5% agarose gel and visualized upon staining with ethidium bromide. Amplification of GAPDH (forward: 5 -acccagaagactgtgga tgg-3 and reverse: 5 -acgcctgcttcaccaccttc-3 ) (GenBank accession No. AF07079) served as housekeeping gene. Table. Means, standard errors (S.E.), number of boars and ranges of traits selected for mrna and protein expression study Tablo. mrna ve protein ifadesi için seçilen erkek domuzlara ait özelliklerin ortalamaları, standart hataları, erkek domuz sayıları ve örneklem genişliği Traits Selected Animals (n = 6) G-I (n = 3) G-II (n = 3) Mean S.E. Mean S.E. Mean S.E. SCON (0 6 /ml) SVOL (ml) SMOT (%)

80 245 ÇINAR, GUNAWAN Quantitative Real-Time PCR (qrt-pcr) For qrt-pcr, total RNA and cdna synthesis from different reproductive tissues of two divergent groups of animals (G-I and G-II) were done as described above. The same primers pair used in semi-quantitative PCR were also used in qrt-pcr. Nine-fold serial dilution of plasmids DNA were prepared and used as template for the generation of the standard curve. In each run, the 96-well microtiter plate contained each cdna sample, plasmid standards for the standard curves and no-template control. To ensure repeatability of the experiments, each plate was run in three replications. Quantitative real-time RT-PCR (qrt-pcr) was set up using 2 μl first-strand cdna template, 7.6 μl deionized H 2 O, 0.2 μm of upstream and downstream primers and 0 μl Power SYBR Green I master mix with ROX as reference dye (Bio-Rad). The thermal cycling conditions were 3 min at 94 C followed by 40 cycles of 20 sec at 94 C and min at 60 C. Experiments were performed using the ABI prism 7000 (Applied Biosystems) qrt-pcr system. An amplification-based threshold and adaptive baseline were selected as algorithms. The housekeeping gene GAPDH (forward: 5 -acccagaagactgtggatgg-3 and reverse: 5 -acgcctgcttcaccaccttc-3 ) derived from porcine sequence (GenBank accession No. AF07079) was used for the data normalization. Final results were reported as the relative abundance level after normalizing with mrna expression level of the housekeeping gene. Differences in CYP9 mrna expression were analyzed with the simple t-test in SAS software (SAS Institute Inc., ver. 9.2). Values of P<0.05 were considered to indicate statistically significant differences. Western Blotting Total protein was isolated from the tissues of the six boars which were also used for mrna isolation. Total protein was isolated by using TRI Reagent (Sigma-Aldrich), before protein separation in SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) (gradient 4-8%) and transferring onto a nitrocellulose membrane (Amersham Biosciences). The membranes were further kept in blocking buffer (20 mm Tris ph 7.5, 50 mm NaCl, 0.05% Tween-20 and % Polyvinylpyrolidone) for h at room temperature; the membrane was incubated overnight at 4 C with the anti-cyp9 antibody purified from goat polyclonal antibody (Cat.nr.4245; Santa Cruz) in the blocking medium (diluted :500). Non-specific binding of antibody was washed off with six changes of 0.% PBST. The horseradish peroxidase conjugated donkey anti-goat IgG secondary antibody (Cat.No. Sc2020; Santa Cruz) was used as the secondary antibody (diluted :5000). The membrane was incubated for hour at room temperature with secondary antibody, followed by washing with six changes of 0.% PBST. The chemiluminesce was detected by using the ECL plus western blotting detection system (Amersham Biosciences) and visualized by using Kodak BioMax XAR film (Kodak). GAPDH was used as a loading control and for normalization. The membrane was stripped by incubation in 2% SDS, 00 mm Tris-HCl, 0.% betamercaptoethanol for 30 min at 60 C and re-probed with GAPDH antibody (Cat.No. Sc20357; Santa Cruz). Protein Localization by Immunofluorescence Due to the limitations of fresh samples from G-I and G-II boars, we collected fresh testis sample from a healthy breeding boar after slaughtering for protein localization. Immunofluorescence staining was performed on 8 μm cryostat sections of snap frozen tissues. All sections were kept in -80ºC for further analysis. To block unspecific staining, sections were incubated for 30 minutes at room temperature with 5% bovine serum albumin in PBS (50 nm sodium phosphate, ph 7.4; 0.9% NaCl). Sections were incubated overnight at 4ºC with the CYP9 goat polyclonal primary antibody (Cat.nr.4245; Santa Cruz) diluted at :50 in PBST followed by six times (0 min to time) washing with PBS. Then, the sections were incubated hour at room temperature with the biotinylated donkey antirabbit IgG-B conjugated with fluorescein isothiocynate (FITC) reactive water-soluble fluorescent dye (Cat nr. Sc2090; Santa Cruz) (dilution :200) which was used as a secondary antibody for CYP9. Then sections were washed six times (0 min to time) with PBS. Finally, the samples were counterstained with vectashield mounting medium (Vector Laboratories) containing 40,6-diamidino-2-phenyl indole (DAPI) and covered with a cover glass slip. The staining was observed by confocal laser scanning microscope (Carl Zeiss). In case of negative controls, PBS was used instead of the primary antibody. RESULTS mrna Expression by Semi-Quantitative PCR Among reproductive and non-reproductive tissues CYP9 gene expression was detected only in testis (Fig. ). When semi-quantitative PCR was applied in reproductive tissues from G-I and G-II boars, CYP9 mrna expression was observed in testis among all different reproductive tissues (Fig. 2a). The semi-quantitative reverse transcription PCR result of GAPDH showed no remarkable differences among tissues (Fig. & Fig. 2a). mrna and Protein Expression Study in Testis from G-I and G-II Boars Semi-quantitative PCR results showed that the CYP9 mrna was highly expressed in testis samples from G-I and G-II boars (Fig. 2a). Results of semi-quantitative PCR overlapped with the results of the qrt-pcr (Fig. 2b). qrt-pcr showed that no significant mrna expression difference in testis between G-I and G-II boars (Fig. 2b). CYP9 protein with 58 kda molecular weight was detected in testis of G-I and G-II boars (Fig. 3a). Protein expression result of western blot appeared to be inconsistent with

81 246 Investigation on Porcine... Fig. mrna expression of CYP9 in reproductive and non-reproductive tissues by semi-quantitative PCR Şekil. CYP9 geninin üreme ve üreme dışı dokularda yarı-kantitatif PCR mrna ifadesi Fig 2. mrna expression of CYP9 in reproductive tissues (testis, head, body and tail of the epididymis), (2a) CYP9 mrna expression in different reproductive tissues from G-I and G-II boars by semi-quantitative PCR, (2b) CYP9 mrna expression in different reproductive tissues from G-I and G-II boars by qrt-pcr Şekil 2. CYP9 geninin üreme dokularında (testis, epididimisin baş, vücut, ve kuyruk kısmı) mrna ifadesi, (2a) CYP9 mrna ifadesinin üreme dokularında yarı-kantitatif PCR ile G-I ve G-II erkek domuzlarda gösterimi, (2b) CYP9 mrna ifadesinin üreme dokularında qrt-pcr ile G-I ve G-II erkek domuzlarda gösterimi the results of the qrt-pcr (Fig 3b & Fig. 2b). The western blot result showed that the CYP9 protein expression was higher in the testis of G-II boars compared to G-I boars (Fig. 3b). Localization of CYP9 Protein in Boar Reproductive Tissues by Immunofluorescence Sections of testis were stained through the same Fig 3. CYP9 protein expression in testis from G-I and G-II boars by Western Blotting, (3a) Western-Blot results of CYP9 and GAPDH proteins in testis from G-I and G-II boars, (3b) Quantification of Western-Blot results between two group boars Şekil 3. G-I ve G-II erkek domuzlarda CYP9 protein ifadesinin Western- Blot ile gösterilmesi, (3a) G-I ve G-II erkek domuzlarda CYP9 ve GAPDH proteinlerinin Western-Blot ile gösterilmesi, (3b) Western-Blot sonuçlarının iki grup erkek domuz arasında sayısallaştırılmış görüntüsü optical panel for the cell surface CYP9 protein expression (Fig. 4). Immunoreactive CYP9 protein was observed as strong staining only in the cytoplasm of the Leydig cells in testis. No immunostaining was detected in Sertoli cells (Fig. 4a). DISCUSSION CYP9 mrna and Protein Expression in Boar Reproductive Tissues In this study, we measured the CYP9 mrna gene expression in various boar tissues for the first time. Moreover, CYP9 gene was measured in various reproductive organs from boars with divergent sperm quality traits.

82 247 ÇINAR, GUNAWAN Fig 4. Localization of CYP9 protein in testis of boar, (4a) Immunofluorescence detection of CYP9 in Leydig cells. Leydig cells were stained with CYP9 (arrows), (4b) The cell nuclei were counterstained with DAPI, (4c) Merged images, (4d) Negative control Şekil 4. CYP9 proteinin erkek domuz testisinde lokalizasyonu, (4a) CYP9 un Leydig hücrelerinde immunoflorasan tesbiti, (4b) Hücre cekirdeklerinin DAPI ile işaretlenmiş görüntüsü. (4c) Birleştirilmiş görüntü, (4d) Negatif kontrol mrna and protein expression of CYP9 was measured quantitatively by using qrt-pcr and western-blot respectively. CYP9 protein was also localized in testis section to proof the presence of this protein in Leydig cells. Results demonstrated that the porcine CYP9 mrna expression was observed only in testis (Fig. 2 & Fig. 3) and CYP9 transcript was not widespread throughout the male reproductive tract. Importantly, CYP9 expressed highly in testis of boars collected from G-I and G-II. In our study CYP9 transcript was not detected throughout the male reproductive system except in testis which is in accordance with the previous reports describing that CYP9 expression is found only in testis in human 3 and stallion. The porcine CYP9 gene is expressed in a tissue-specific fashion in three principal sites, the gonads, the placenta, and the preimplantation blastocyst 4. Tissuespecific expression of the CYP9 promoted survival of the CYP9 genes 5. Although promoter that drives ovarian CYP9 expression is well conserved in mammalian species, expression in the pig testis is driven by a different promoter than that utilized in the ovary 6. Testis is major source for CYP9 enzyme and corresponds to daily sperm production is supporting our findings. CYP9 enzyme catalyses the synthesis of estrogens from androgens and play roles in the sexual development, reproduction and in behaviour 4. In the mammalian testis, gonadotropins and testosterone together with numerous locally-produced factors are responsible for the induction and/or the maintenance of spermatogenesis 7. Levallet et al. 7 and Janulis et al. 8 showed that the highest amount of CYP9 mrna in testis is related to the estrogen production. Gist et al. 9 detected CYP9 in the testis and suggested that testicular estrogens might have a regulatory influence on the spermatogenesis in the testis. Investigation on spermatogenesis in knockout mice (ArKO) revealed that lack in functional aromatase (CYP9) enzyme is unable to convert C 9 steroids (androgens) to C 8 steroids (estrogens) 20. CYP9 deficient mice indicated that spermatogenesis required the presence estrodiol-7 beta (E2). E2 is necessary to stimulate glucose uptake, oxidative metabolism and motility. CYP9 deficient mice (ArKO) are reported to have disrupted spermatogenesis associated with a decrease in sperm motility and inability to fertilize oocytes 8,20,2. The presence of CYP9 transcripts could be a marker of male gamete quality since existence of it reported to be influence the motility and the acrosome reaction 22. However, our results showed that CYP9 mrna and protein expression are tended to be higher in G-II boars but the mrna and protein expression differences between G-I and G-II were not statistically significant. Moreover, it is important to note that all boars used in this study were used for breeding purpose by the breeding company which means all boars were good enough. The differences for SCON, SVOL and SMOT between two groups of boars were not extreme. The G-II boars had comparatively poor quality semen when compared to G-I. Protein Localization of CYP9 Immunoreactive CYP9 protein was observed strong staining only in cytoplasm of Leydig cells in testis. These results are in good agreement with the previous study in boar 23, horses 6,24, ram 25 and human 3,26. However, some studies detected immunoreactive CYP9 in both the Leydig cells and seminiferous tubules in rat 7,27, mouse 28 and rooster 29. Importantly, this study confirmed that immunoreactive CYP9 is restricted only to the Leydig cells in the testis in mammalian species like horses 5,30, pig 6,23 and rams 25. It has been reported that the major function of Leydig cells is to produce estrogen and being the source of estrogen biosynthesis in rat 30 and human 3. Moreover, Hess et al. 30 showed in male horse that there is an agedependent shift in the localization of immunoreactive CYP9 from the Leydig cell to Sertoli cells. In adult animals, highest CYP9 activity are found in the Leydig cells but in immature rat before puberty it is found more in Sertoli cell 30. The boar used for localization in this study was an adult breeding boar which supports our finding for localization of CYP9 only in the Leydig cells. The mrna and protein expression study of the CYP9 imply that it may have a role in spermatogenesis and specific target gene in testis in pigs. Therefore, the results of this study could be valuable to shed light on the roles of CYP9 in spermatogenesis in boars.

83 248 Investigation on Porcine... Acknowledgments This study was financially supported by FBF (Förderverein Biotechnologieforschung e. V.), Bonn, Germany. REFERENCES. Lemazurier E, Sourdaine P, Nativelle C, Plainfosse B, Seralini GE: Aromatase gene expression in the stallion. Mol Cell Endocrinol, 78 (-2): 33-39, Carreau S, Silandre D, Bourguiba S, Hamden K, Said L, Lambard S, Galeraud-Denis I, Delalande C: Estrogens and male reproduction: A new concept. Braz J Med Biol Res, 40 (6): , Simpson ER, Zhao Y, Agarwal VR, Michael MD, Bulun SE, Hinshelwood MM, Graham-Lorence S, Sun TJ, Fisher CR, Qin KN: Aromatase expression in health and disease. Recent Progress in Hormone Research, Proceedings of the 996 Conference, Vol. 52, 52, 85-24, Setchell BP, Cox JE: Secretion of free and conjugated steroids by the horse testis into lymph and venous blood. J Reprod Fertil, 32, 23-27, Almadhidi J, Seralini GE, Fresnel J, Silberzahn P, Gaillard JL: Immunohistochemical localization of cytochrome-p450 aromatase in equine gonads. J Histochem Cytochem, 43 (6): , Eisenhauer KM, Mccue PM, Nayden DK, Osawa Y, Roser JF: Localization of aromatase in equine Leydig-cells. Domest Anim Endocrin, (3): , Saez JM: Leydig-Cells - Endocrine, Paracrine, and Autocrine Regulation. Endocr Rev, 5 (5): , Robertson KM, O Donnell L, Jones MEE, Meachem SJ, Boon WC, Fisher CR, Graves KH, McLachlan RI, Simpson ER: Impairment of spermatogenesis in mice lacking a functional aromatase (cyp 9) gene. Proceedings of the National Academy of Sciences of the United States of America, 96 (4): , Singh D, Tiwari A, Kumar OS, Sharma MK: Expression of cytochrome P450 aromatase transcripts in buffalo (Bubalus bubalis)-ejaculated spermatozoa and its relationship with sperm motility. Domest Anim Endocrin, 34 (3): , Aquila S, Sisci D, Gentile M, Middea E, Catalano S, Carpino AVR, Ando S: Estrogen receptor (ER)alpha and ER beta are both expressed in human ejaculated spermatozoa: Evidence of their direct interaction with phosphatidylinositol-3-oh kinase/akt pathway. J Clin Endocr Metab, 89 (3): , Hoffmann B, Landeck A: Testicular endocrine function, seasonality and semen quality of the stallion. Anim Reprod Sci, 57 (-2): 89-98, Kaewmala K, Uddin MJ, Cinar MU, Grosse-Brinkhaus C, Jonas E, Tesfaye D, Phatsara C, Tholen E, Looft C, Schellander K: Association study and expression analysis of CD9 as candidate gene for boar sperm quality and fertility traits. Anim Reprod Sci, 25 (-4): 70-79, Inkster S, Yue W, Brodie A: Human Testicular Aromatase - Immunocytochemical and Biochemical-Studies. J Clin Endocr Metab, 80 (6): , Lauber ME, Sarasin A, Lichtensteiger W: Sex differences and androgen-dependent regulation of aromatase (CYP9) mrna expression in the developing and adult rat brain. J Steroid Biochem, 6 (3-6): , Corbin CJ, Hughes AL, Heffelfinger JR, Berger T, Waltzek TB, Roser JF, Santos TC, Miglino MA, Oliveira MF, Braga FC: Evolution of suiform aromatases: Ancestral duplication with conservation of tissue-specific expression in the collared peccary (Pecari tayassu). J Mol Evol, 65 (4): , Conley AJ, Corbin CJ, Hinshelwood MM, Liu Z, Simpson ER, Ford JJ, Harada N: Functional aromatase expression in porcine adrenal gland and testis. Biol Reprod, 54 (2): , Levallet J, Bilinska B, Mittre H, Genissel C, Fresnel J, Carreau S: Expression and immunolocalization of functional cytochrome P450 aromatase in mature rat testicular cells. Biol Reprod, 58 (4): , Janulis L, Bahr JM, Hess RA, Janssen S, Osawa Y, Bunick D: Rat testicular germ cells and epididymal sperm contain active P450 aromatase. J Androl, 9 (): 65-7, Gist DH, Bradshaw S, Morrow CMK, Congdon JD, Hess RA: Estrogen response system in the reproductive tract of the male turtle: An immunocytochemical study. Gen Comp Endocr, 5 (): 27-33, Fisher CR, Graves KH, Parlow AF, Simpson ER: Characterization of mice deficient in aromatase (ArKO) because of targeted disruption of the cyp9 gene. Proceedings of the National Academy of Sciences of the United States of America, 95 (2): , Robertson KM, Simpson ER, Lacham-Kaplan O, Jones MEE: Characterization of the fertility of male aromatase knockout mice. J Androl, 22 (5): , Carreau S, Delalande C, Galeraud-Denis I: Mammalian sperm quality and aromatase expression. Microsc Res Techniq, 72 (8): , Mutembei HM, Pesch S, Schuler G, Hoffmann B: Expression of oestrogen receptors alpha and beta and of aromatase in the testis of immature and mature boars. Reprod Domest Anim, 40 (3): , Hess RA, Carnes K: The role of estrogen in testis and the male reproductive tract: A review and species comparison. Anim Reprod, (): 5-30, Bilinska B, Lesniak M, Schmalz B: Are ovine Leydig cells able to aromatize androgens? Reprod Fert Develop, 9 (2): 93-99, Brodie A, Inkster S: Aromatase in the Human Testis. J Steroid Biochem, 44 (4-6): , Carpino A, Pezzi V, Rago V, Bilinska B, Ando S: Immunolocalization of cytochrome P450 aromatase in rat testis during postnatal development. Tissue Cell 200, 33 (4): Nitta H, Bunick D, Hess RA, Janulis L, Newton SC, Millette CF, Osawa Y, Shizuta Y, Toda K, Bahr JM: Germ-cells of the mouse testis express P450 aromatase. Endocrinology, 32 (3): , Kwon S, Hess RA, Bunick D, Nitta H, Janulis L, Osawa Y, Bahr JM: Rooster testicular germ-cells and epididymal sperm contain P450 aromatase. Biol Reprod, 53 (6): , Hess RA, Ruz R, Gregory M, Smith CE, Cyr DG, Lubahn DB, Hermo L: Role of the estrogen receptor alpha in sperm production and motility in mice. Biol Reprod (Special Issue): 3, Payne A, Kelch R, Musich S, Halpern M: Intratesticular site of aromatization in the human. J Clin Endocrinol Metab, 42, , 976.

84 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Selective Gray and White Matter Staining of the Horse Spinal Cord Summary The ratio of gray and white matter is an important clinical parameter in the diagnosis of diffuse and compressive diseases of the spinal cord. Although histological methods are used to determine this parameter, there are some difficulties encountered in histological studies related to tissue size. The aim of this study was to evaluate possible modifications to overcome these difficulties. In the study, nine tissue samples taken from the C6 segment of a female Shetland pony and selected by systematic random sampling were used. The dehydration process of the spinal cord of the horse was supported by applying a vacuum. Paraffin blocks were prepared and cut into 0 µm sections to be stained separately with the different staining methods. Six different staining methods, including Modified May - Grunwald - Giemsa (MMGG), were compared and used to image entire slides. The stains, Hematoxylin & eosin (H&E), May-Grunwald-Giemsa (MGG), Masson s trichrome (MT), AgNORs, Kluver Barrera (KB) and MMGG, were evaluated macroscopically and microscopically by participants who were unaware of which staining methods had been used. The staining methods were scored from worst () to best (5) using a Likert scale. Vacuum application was found to reduce the difficulties related to inadequate tissue dehydration. MMGG was selected as the best staining method in differentiating gray and white matter in the spinal cord of the horse. Keywords: Gray matter ratio, Horse, Imaging, Spinal cord, Stain comparison Özet Durmus BOLAT * Sadullah BAHAR ** Emrah SUR *** Muhammet L SELCUK ** Sadettin TIPIRDAMAZ ** * Kirikkale University, Faculty of Veterinary Medicine, Department of Anatomy, Campus, TR-745Yahsihan, Kirikkale - TURKEY ** Selcuk University, Faculty of Veterinary Medicine, Department of Anatomy, Campus, TR Selcuklu, Konya - TURKEY *** Selcuk University, Faculty of Veterinary Medicine, Department of Histology and Embryology, Campus, TR Selcuklu, Konya - TURKEY Makale Kodu (Article Code): KVFD At Omuriliğinin Gri ve Ak Maddesinin Seçici Boyanması Medulla spinalis te yer alan gri ve ak madde oranları diffuz ve kompresif omurilik hastalıklarının teşhisinde önemli klinik parametrelerdendir. Bu parametrelerin tespitinde histolojik metotlar kullanılmasına rağmen, histolojik çalışmalarda doku büyüklüğüne bağlı bazı güçlüklüklerle karşılaşılmaktadır. Bu çalışmanın amacı, bahsedilen zorlukları aşmaya yönelik olası modifikasyonları değerlendirmektir. Çalışmada, Shetland pony ırkına ait C6 segmentinden sistematik rastgele örnekleme kuralına sadık kalınarak elde edilen 9 doku kesiti kullanıldı. Medulla spinalis in dehidrasyon işlemi sırasında vakum uygulaması yapıldı. Dokuların parafin blokları hazırlandı, dokular 0 µm kalınlığında kesilerek farklı histolojik boyalar ile boyandı. Modifiye May - Grunwald - Giemsa (MMGG) nın yer aldığı 6 farklı boyama metodunun boyama performansları karşılaştırıldı. Hematoxylin & eosin (H&E), May-Grunwald-Giemsa (MGG), Masson s trichrome (MT), AgNORs, Kluver Barrera (KB) ve MMGG ile boyanan kesitler tek kör grup tarafından makroskopik ve mikroskopik olarak değerlendirildi. Boyaların performansları Likert skalası kullanılarak en kötü () en iyi (5) olmak üzere değerlendirildi. Vakum uygulamasının yetersiz doku dehidrasyonundan kaynaklanan problemleri ortadan kaldırdığı görüldü. MMGG, at medulla spinalis inde gri ve ak madde ayrımında en başarılı boya olarak tespit edildi. Anahtar sözcükler: Gri madde oranı, At, Görüntüleme, Medulla spinalis, Boya karşılaştırması INTRODUCTION The part of the central nervous system situated within the vertebral canal, namely, the spinal cord, is composed of segments in horses, 8 of which are cervical, 8 thoracic, 6 lumbar, 5 sacral and 5-6 caudal. The spinal cord, enveloped by the meninges, extends from the foramen magnum to the level in-between the first and second sacral vertebrae. In general, the spinal cord is dorso-ventrally compressed and elliptic with two enlargements at the cervical intumescence and the lumbar intumescence, and terminates forming the medullary cone. In histological İletişim (Correspondence) bolatdurmus@yahoo.com

85 250 Selective Gray and White... sections, the gray matter, resembling the letter H in shape and composed of nerve and glia cells and blood vessels, is observed to be situated centripetally, whilst the white matter, composed mostly of myelinated axons and blood vessels, is located peripherally. The central canal is located in the center of histological sections. Of all domestic animals, horses have the largest spinal cord, which measures cm in length and g in weight. The segmental anatomical features of the spinal cord have been demonstrated in the cat 2, monkey 3, dog 4, sheep 5, goat 6, impala 7, horse and cattle 8. Furthermore, histological and some histomorphometric features of the spinal cord have been ascertained in research conducted in humans 9-, rats 2, sheep 3, donkeys 4 and horses 5. However, during the conduct of research on sections pertaining to spinal cord segments of humans, goats, sheep, donkeys and horses, the necessity for full images arose in order to obtain histomorphometric data. For this purpose, several methods were applied, including direct drawings using millimetric paper and a calliper 6,3,4, indirect drawings 5, photograph combining 9, projection 0 and digital tablets. Literature review revealed that different fixation, processing and staining methods were applied for histological tissue processing in the researches referred to above, and yet limited information was provided by the researchers on the methods applied. The gray and white matter in the central nervous system have different anatomical and cellular properties. Investigation of chronic diseases that affect the central nervous system, such as multiple sclerosis and schizophrenia, using the ratio of gray and white matter is of great importance 6-8. Imaging techniques, for instance Magnetic Resonance Imaging (MRI) and Diffusion Tensor Imaging (DTI) 9-2, and histological methods are used routinely to determine this parameter 2,22. Although obtaining data using imaging methods is very rapid and practical, some difficulties (in tissue processing, staining and imaging) are encountered during application of the histological process, owing to the size of tissue samples. A search of the literature found that a limited number of morphometric and histological studies have been conducted on the spinal cord of the horse. The aim of this study was to overcome difficulties related to tissue processing, to decide which stain is best for the clear differentiation of gray and white matter of the spinal cord of horse, to acquire tissue images as a whole, and to compare the staining performance of various stains macroscopically and microscopically. MATERIAL and METHODS Material A 5-year-old female Shetland pony (230 kg) that was suffering from various orthopedic disorders was sent to the Department of Anatomy from the Equestrian Facility of the Faculty of Veterinary Medicine, Selcuk University for use in this study. The research was approved by the ethical committee of Faculty of Veterinary Medicine, Selcuk University (20/6). The animal was anesthetized by administration of 0% chloral hydrate (80 mg/kg, IV) 23 and killed under general anesthesia by draining blood from the common carotid artery. Ten percent neutral formaldehyde was administered to the animal through a cannula in the common carotid artery after death. The spinal cord was dissected out from the vertebral column by laminectomy after the cadaver had been kept in a container of 0% neutral formaldehyde for 0 days. Segmentation was performed over the spinal cord following removal of the dura mater and pia mater. The C 6 segment was used in this study; it was 68.8 mm in length and weighed 2.8 g. Methods Sampling and Tissue Processing The C 6 segment was divided into 8 pieces using a tissue slicer prior to histological processing. Each tissue sample was 3.8 mm in length. Systematic random sampling was performed on the separated pieces 24. A sampling ratio of /2 was used, and nine tissue samples were obtained for routine histological processing. The tissue samples were placed on trays, taking into account their cranialcaudal orientation, and dehydrated in an ethanol series. A vacuum was applied during the second application of 96% ethanol (200 mmhg, 30 min), the third application of 00% ethanol (200 mmhg, h), the third application of xylene (200 mmhg, 30 min), and in paraffin (56-58ºC, 300 mmhg, the last 2 h), and the samples were blocked in paraffin wax. Samples in paraffin blocks were sectioned consecutively on a rotary microtome at a thickness of 0 μm, and six sections were obtained from each block. The sections were kept in an incubator (37ºC) for 24 h, stained according to the order given in Table, and mounted with Entellan under a glass coverslip. Table. Section series and stains Tablo. Kesit sayısı ve boyalar Section Number Stain Reference H&E () 2 MMGG Table 2 3 MGG (2, 3) 4 MT (4) 5 AgNORs (5) 6 KB (6) H&E (Hematoxylin & eosin), MGG (May-Grunwald-Giemsa), MT (Masson s trichrome), KB (Kluver Barrera), MMGG (modified May-Grunwald-Giemsa)

86 25 BOLAT, BAHAR, SUR SELCUK, TIPIRDAMAZ Preparation of Giemsa Solution Giemsa stock solution (Merck KGaA, Darmstadt, Germany) was added at drop per ml to 250 ml distilled water using a Pasteur pipette (The solution prepared in this way is not recommended to be used more than two times). Acquiring Images from Slides Using an Office Scanner on the scanned images were calculated three times by each of six different operators using the random function of the software. The results were analyzed using ANOVA (Table 3). Evaluation of the Ability of White and Gray Matter Staining with A Survey This part of the study was designed as a single blinded experiment. The survey group was composed of 20 healthy and non-colorblind students who were selected randomly Table 2. Modified May-Grunwald-Giemsa staining procedure Tablo 2. Modifiye edilmiş May-Grunwald-Giemsa boya prosedürü Staining Stages Xylene, 5 min 8 Rinse in distilled water 5 96% alcohol dip once 2 Xylene, 5 min 9 Tap water for 5 min. 6 96% alcohol dip once 3 00% alcohol, 3 min 0 Rinse in distilled water 7 00% alcohol dip once 4 00% alcohol, 3 min Place in 250 ml May-Grunwald stock solution at room temperature for 0 min 8 00% alcohol dip once 5 96% alcohol, 3 min 2 Rinse in distilled water 9 Xylene 2 min 6 80% alcohol, 3 min 3 Place in Giemsa solution (250 ml) in 56 C incubator for 45 min 20 Xylene 2 min 7 70% alcohol, 3 min 4 Cool at room temperature 2 Xylene 2 min Table 3. The mean cross-sectional areas of gray matter and gross section and responses of survey participants (median) Tablo 3. Transversal kesitlerde ortalama gri ve ak madde oranları (mean±se) ve anket sonuçları (median) Stain Gray Matter (mm 2 ) Spinal Cord (mm 2 ) Median Score H&E.97± ±0.577 d MMGG.9± ± a MGG.72± ± b MT 2.00± ± c AgNORs.64± ± cd KB.99± ± a There was no statistical difference among the areas of the structures with different staining methods (P>0.05, ANOVA) a,b,c,d Different letters in the same column are significantly different (P<0.05, Mann-Whitney U test) Images of gross biological structures (brain or cerebellum) that are difficult to view under the microscope can be obtained with the help of a standard office scanner 3. In this study, all slides were scanned as positive image using a standard office flatbed scanner (Hp Scanjet G400) at 300 dpi for macroscopic evaluation. Area Calculation and Evaluation of Variations among Stains with Point Counting Frame The point counting method has been used frequently to assess morphological parameters such as the area, volume, and area or volume ratio This method was used to predict possible variations among stains that could affect measurement of the areas of gray matter and gross section. For this purpose, the grid function of the image analysis software ImageJ was applied to the scanned images. The area per point value was set at 0.4 mm 2 ( mm) and 4 mm 2 (2 2 mm) to acquire an optimum CE value 24 for gray matter and the gross section respectively (Fig. ). The areas of gray and gross section Fig. Superimposed point counting frame on cross-section of spinal cord using ImageJ (area per point = 4 mm 2, bar=5 mm) Şekil. Medulla spinalis kesitleri üzerine ImageJ kullanılarak uygulanan noktalı alan ölçüm cetveli (bir noktanın alanı = 4 mm 2, bar=5 mm)

87 252 Selective Gray and White... from the senior students of the Faculty of Veterinary Medicine. The students were given a figure (Fig. 2) that showed six different stains and were asked to evaluate these stains in terms of the differentiation of gray and white matter according to a Likert scale (: worst, 5: best). The results were analyzed using the Mann-Whitney U test (Table 3). Light Microscopic Evaluation of Sections The ability of the six dyes to stain neurons, glia, ependymal cells, endothelium, axon and dendrites were investigated using a Likert scale and the results are given in Table 4. RESULTS Collapsed areas were detected particularly in the gray matter region in paraffin blocks of tissues to which vacuum had not been applied during dehydration. Ruptures occurred during the cutting of these blocks with the rotary microtome, and low quality staining was observed especially in that area. This problem was solved by the application of vacuum. As a result of calculations made using the point counting frame superimposed on each slide stained with the different staining methods, the mean cross-sectional surface area of C 6 was found to be 38±0.97 mm 2 and the mean area of gray matter Fig 2. The image used by the survey group to evaluate the performance of stains using a Likert scale (bar= 5mm) (A: H&E, B: MMGG, C: MGG, D: MT, E: AgNORs, F: KB) Şekil 2. Anket grubu tarafından Likert skalası kullanarak boya performanslarının değerlendirilmesinde kullanılan resim dosyası (bar= 5mm) (A: H&E, B: MMGG, C: MGG, D: MT, E: AgNORs, F: KB) Table 4. Microscopic assessment using Likert scale Tablo 4. Likert skalası kullanılarak mikroskopik değerlendirme Stains Axon White Matter Glia Endothel Gray Matter Neuron N C N C N C N C N C N C Glia H&E MMGG MGG MT AgNORs KB N: Nucleus, C: Cytoplasm Endothel Ependymal cells Differantiatıon of gray and white matter Differantiatıon of axon and dendrite Appearance of Nissl bodies

88 253 BOLAT, BAHAR, SUR SELCUK, TIPIRDAMAZ Fig. 3. Cross-sectional images obtained by 4 and 00 objectives under a light microscope (A: H&E, B: MMGG, C: MGG, D: MT, E: AgNORs, F: KB; Upper-case letter: 4, Lower-case letter: 00 ) Şekil 3. Işık mikroskopu ile 4 ve 00 objektif kullanılarak elde edilen kesit görüntüleri (A: H&E, B: MMGG, C: MGG, D: MT, E: AgNORs, F: KB; Büyük harf: 4, Küçük harf: 00 ) was estimated to be.87±0.70 mm2. The ratio of gray matter to gross section was determined to be 8.58%. A statistical difference was not detected (P>0.05, Table 3) among the areas of gray and white matter calculated from sections made using the six different stains. The calculated coefficient of error value (CE) for the gray matter was and for the spinal cord was Statistical analysis of the responses given by the survey group showed that MMGG and KB were thought to be the best staining methods for differentiation of gray and white matter (Table 3, Fig. 2). DISCUSSION The application of a vacuum during the dehydration process is not recommended because of the fragile character of central nervous system tissue 25. In the present study, collapse caused by inadequate dehydration of the surface of paraffin blocks were seen, especially in the gray matter region, as a result of the routinely applied dehydration process without vacuum application. These problems were solved with vacuum application, as described in the section describing sampling and tissue processing. Different staining techniques have been utilized to differentiate gray and white matter macroscopically 35,36 and microscopically 9,37 because of the poor contrast between these structures. Although KB is the staining method used most commonly for the central nervous system, MMGG (Table 2) is a preferable staining method to differentiate gray and white matter in the spinal cord of the horse because of its selective quality for this area and rapid reliable results (Fig. 3, Table 4). The ratio of gray and white matter is used as an important parameter in the diagnosis of several diseases (schizophrenia, multiple sclerosis) in the central nervous system. Although imaging methods such as MRI are used most commonly to obtain this information 6,7,2, its use is limited in large domestic animals. Histological methods are frequently preferred when investigating the spinal cord of these animals 3,5. However, the entire structure must be displayed to estimate the ratio from histological sections. For this reason, a photographic camera 9,0, Edingerschen Apparatus 5, slide scanner 38 and office scanner 3 have been used to view the entire sections taken from large biological structures. In the current study, stained slides were scanned as JPEG files using a standard flatbed office scanner with a positive image scan option at 300 dpi. Measurement of the scanned images with a point counting frame estimated the ratio of gray matter to be 8.58% in the C6 segment (Table 3). The ratios of gray matter in C6 segments were reported as.86% of donkey 4, 8.3% of human 0, and 35-40% of rat 2 respectively. Braun 5 reported that the ratio of gray matter was 2.7% in the C6 segment of horse. It is thought that the dissimilarity between the two results could have resulted from differences in methodology. However, use of an office scanner to obtain images of large structures such as the brain and cerebellum was found to be a rapid method to view the spinal cord of the horse. Under microscopic examination, H&E, AgNORs, MT and KB for glia, MT and AgNORs for endothelial cells, KB for differentiation of axons and dendrites and also Nissl bodies, MT and AgNORs, especially for ependymal cells, were found to be good staining options (Fig. 3, Table 4).

89 254 Selective Gray and White... The current study showed that a vacuum can be applied during dehydration of large structures such as the spinal cord of the horse in order to acquire acceptable results. MMGG is a useful staining method for the differentiation of gray and white matter, and it is advised to be used when the spinal cord is examined both macroscopically and microscopically. Use of an office scanner is a cheap and practical method to view and scan large biological tissues. These methods are suggested as tools for use in morphometric studies related to the central nervous system. Acknowledgements The Authors are grateful to senior students of Faculty of Veterinary Medicine, Selcuk University for their kindly assistance. REFERENCES. Nickel R, Seiferle E. Eingeweide: Lehrbuch der Anatomie der Haustiere. Band 4 Nervensystem, Sinnesorgane, Endokrine Drüsen. 3th ed., pp , Stuttgart, Parey, Thomas CE, Combs CM: Spinal cord segments. A. Gross structure in the adult cat. Am J Anat, 0 (): 37-47, Thomas CE, Combs CM. Spinal cord segments. B. Gross structure in the adult monkey. Am J Anat, 6 (): , Fletcher T, Kitchell R: Anatomical studies on the spinal cord segments of the dog. Am J Vet Res, 27 (2): , Rao GS: Anatomical studies on the ovine spinal cord. Ann Anat, 7, , Kahvecioğlu K, Özcan S, Çakır M: Anatomic studies on the medulla spinalis of the Angora goat (excluding the coccygeal segmentis). YYÜ Vet Fak Derg, 6 (-2): 76-80, Rao G, Kalt D, Koch M, Majok A: Anatomical studies on the spinal cord segments of the impala. Anat Histol Embryol, 22 (3): , Habel R. The topography of the equine and bovine spinal cord. J Am Vet Med Assoc, 8, , Makino M, Mimatsu K, Saito H, Konishi N, Hashizume Y: Morphometric study of myelinated fibers in human cervical spinal cord white matter. Spine, 2, 00-06, Kameyama T, Hashizume Y, Sobue G: Morphologic features of the normal human cadaveric spinal cord. Spine, 2, , Ko H, Park JH, Shin YB, Beak SY: Gross quantitative measurements of spinal cord segments in human. Spinal Cord, 42, 35-40, Portiansky EL, Barbeito CG, Goya RG, Gimeno EJ, Zuccolilli GO: Morphometry of cervical segments grey matter in the male rat spinal cord. J Neurosci Meth, 39, , Done J, Woolley J, Barnard V, Upcott D, Hebert C, Terlecki S: Border disease of sheep: Spinal cord morphometry. J Comp Pathol, 95, , Ocal M, Hazıroglu RM: Comparative morphological studies on the spinal cord of the donkey. I. The cross-sectional areas of the spinal cord segments. Ankara Üniv Vet Fak Derg, 35, 55-68, Braun A: Der segmentale feinbau des rückenmarks des pferdes. Cells Tissues Organs, 0, 5-75, Sastre-Garriga J, Ingle G, Chard D, Cercignani M, Ramio-Torrenta L, Miller D, Thompson A: Grey and white matter volume changes in early primary progressive multiple sclerosis: A longitudinal study. Brain, 28, , Fornito A, Yücel M, Patti J, Wood S, Pantelis C: Mapping grey matter reductions in schizophrenia: an anatomical likelihood estimation analysis of voxel-based morphometry studies. Schizophr Res, 08, 04-3, Gilmore C, Geurts J, Evangelou N, Bot J, Van Schijndel R, Pouwels P, Barkhof F, Bö L: Spinal cord grey matter lesions in multiple sclerosis detected by post-mortem high field MR imaging. Mult Scler, 5, 80-88, Tench CR, Morgan PS, Jaspan T, Auer DP, Constantinescu CS: Spinal cord imaging in multiple sclerosis. J Neuroimaging, 5, 94S-02S, Ellingson BM, Ulmer JL, Schmit BD: Morphology and morphometry of human chronic spinal cord injury using diffusion tensor imaging and fuzzy logic. Ann Biomed Eng, 36, , Hassen WB, Bégou M, Traore A, Moussa AB, Boehm N, Ghandour MS, Renou JP, Boespflug-Tanguy O, Bonny JM: Characterisation of spinal cord in a mouse model of spastic paraplegia related to abnormal axono-myelin interactions by in vivo quantitative MRI. Neuroimage, 46, -9, Bjugn R, Gundersen HJG: Estimate of the total number of neurons and glial and endothelial cells in the rat spinal cord by means of the optical disector. J Comp Neurol, 328, , Taylor P: Effects of surgery on endocrine and metabolic responses to anaesthesia in horses and ponies. Res Vet Sci, 64, 33-40, Gundersen HJ, Jensen EB, Kieu K, Nielsen J: The efficiency of systematic sampling in stereology--reconsidered. J Microsc, 93, 99-2, Culling CFA, Allison R, Barr W: Cellular pathology technique: Butterworth-Heinemann, Serviere J, Dubayle D, Menetrey D: Increase of rat medial habenular mast cell numbers by systemic administration of cyclophosphamide. Toxicol Lett, 45, 43-52, Beghdadi W, Porcherie A, Schneider BS, Dubayle D, Peronet R, Huerre M, Watanabe T, Ohtsu H, Louis J, Mécheri S: Inhibition of histamine-mediated signaling confers significant protection against severe malaria in mouse models of disease. JEM, 205, , Clark G: Staining procedures: 3rd. ed., Baltimore, Williams & Wilkins Co, Plate K, Ruschoff J, Mennel H: Cell proliferation in intracranial tumours: selective silver staining of nucleolar organizer regions (AgNORs). Application to surgical and experimental neuro-oncology. Neuropath Appl Neuro, 7, 2-32, Sandoz P, Meier E: A differential stain for neuronal nucleoli in unfixed cryostat sections. Biotech Histochem, 53, 95-97, Bush EC, Allman JM: The scaling of white matter to gray matter in cerebellum and neocortex. Brain Behav Evol, 6, -5, Zacha ová G, Kubínová L: Stereological methods based on point counting and unbiased counting frames for two-dimensional measurements in muscles: Comparison with manual and image analysis methods. J Muscle Res Cell M, 6, , Acer N, Sahin B, Usanmaz M, Tatoglu H, Irmak Z: Comparison of point counting and planimetry methods for the assessment of cerebellar volume in human using magnetic resonance imaging: A stereological study. Surg Radiol Anat, 30, , Bas O, Acer N, Mas N, Karabekir HS, Kusbeci OYI, Sahin B: Stereological evaluation of the volume and volume fraction of intracranial structures in magnetic resonance images of patients with Alzheimer s disease. Ann Anat, 9, 86-95, Heller MW, Stoddard SL: Procedure for staining fixed human brain slices. Biotech Histochem. 6, 7-73, Loftspring M, Smanik J, Gardner C, Pixley S: Selective gray matter staining of human brain slices: Optimized use of cadaver materials. Biotech Histochem, 83, 73-77, Deb C, Francis C: Modified romanowsky staining of the spinal cord and the cerebellum. Proc Nat Inst Sci, 26, 89-9, Huisman A, Looijen A, van den Brink SM, van Diest PJ: Creation of a fully digital pathology slide archive by high-volume tissue slide scanning. Hum Pathol, 4, , 200.

90 Kafkas Univ Vet Fak Derg 8 (2): , 202 DOI:0.9775/kvfd RESEARCH ARTICLE Evaluation for Some Bacterial and Viral Abortions of Dairy Cattle Farms in Burdur District of Turkey Summary In this study, the presence of antibodies to Brucella abortus, Chlamydophila abortus, Coxiella burnetii, Bovine herpesvirus- (BHV-), Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-4 (BHV-4) were investigated in dairy cattle herds with abortion history in Burdur province, Southwest region of Turkey. The blood samples were collected from 932 dairy cattle 2 years of age from 0 herds not vaccinated against for mentioned infections and all of the serum samples were tested for B. abortus by ELISA. Seronegative herds for B. abortus were investigated for C. burnetii and C. abortus. While seropositivity for B. abortus and C. burnetii were detected 25.3% (236/932) and 0.2% (9/86), antibodies against C. abortus was not detected. Seronegative herds for B. abortus, C. burnetii and C. abortus were analysed for antibodies to BHV-, BVDV and BHV-4 and seropositivity were found as 43.5% (40/92), 8.5% (75/92), 42.4% (39/92), respectively. BVDV antigen was determined in 2.2% (2/92) of the samples. As a result, we determined that C. abortus is not an important agent causing abortion in dairy herds in Burdur, but the seropositivity of B. abortus, C. burnetii, BHV-, BVDV and BHV-4 are high. Thus, the herds should be tested for these infections regularly and control measures must be taken. Keywords: Abortion, ELISA, Dairy cattle, Brucella abortus, Chlamydophila abortus, Coxiella burnetii, Bovine herpesvirus-, Bovine viral diarrhea virus, Bovine herpesvirus-4 Burdur Yöresinde Süt Sığırı İşletmelerinin Bazı Bakteriyel ve Viral Abortlar Yönünden Değerlendirilmesi Özet Dilek OZTURK * Mehmet KALE ** Faruk PEHLIVANOGLU * Sibel HASIRCIOGLU ** Hulya TURUTOGLU * * Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Department of Microbiology, TR-500 Burdur - TURKEY ** Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Department of Virology, TR-500 Burdur - TURKEY Makale Kodu (Article Code): KVFD Bu çalışmada, Türkiye nin güneybatı bölgesinde yer alan Burdur ili nde yavru atma problemli süt sığırlarında Brucella abortus, Chlamydophila abortus, Coxiella burnetii, Bovine herpesvirus- (BHV-), Bovine viral diarrhea virus (BVDV) ve Bovine herpesvirus-4 (BHV-4) e karşı antikorların varlığı araştırıldı. Kan örnekleri araştırılan enfeksiyonlara karşı aşılanmamış 0 sürüden 2 yaş ve üzeri 932 hayvandan toplandı. Serumlar önce B. abortus yönünden ELISA ile test edildi. B. abortus negatif bulunan serum örnekleri C. burnetii ve C. abortus a karşı antikorların varlığı yönünden araştırıldı. B. abortus ve C. burnetii için pozitiflik sırasıyla %25.3 (236/932) ve %0.2 (9/86) belirlenirken, C. abortus antikorları tespit edilemedi. B. abortus, C. burnetii ve C. abortus negatif bulunan sürülerde BHV-, BVDV ve BHV-4 e karşı antikorların varlığı araştırıldı. Seropozitiflik bu hastalıklar için sırasıyla %43.5 (40/92), %8.5 (75/92), %42.4 (39/92)olarak belirlendi. BVDV antijen ise örneklerin %2.2 sinde tespit edildi. Sonuç olarak, C. abortus un Burdur da süt sığırı işletmelerinde aborta neden olan önemli bir ajan olmadığı, B. abortus, C. burnetii, BHV-, BVDV ve BHV-4 ün seropozitifliğinin yüksek olduğu belirlendi. Bu nedenle, sürülerin bu enfeksiyonlar yönünden düzenli olarak test edilmesi ve gerekli kontrol önlemlerinin alınması gerektiği sonucuna varıldı. Anahtar sözcükler: Abort, ELISA, Süt sığırı, Brucella abortus, Chlamydophila abortus, Coxiella burnetii, Bovine herpesvirus-, Bovine viral diarrhea virus, Bovine herpesvirus-4 INTRODUCTION Bovine abortion is a significant cause of economic losses in dairy cattle herds. Although the cause of abortion depends on several factors including idiopathic, metabolic or hormonal abnormalities, nutritional deficiencies, trauma and infections, the infectious agents including bacterial, viral, fungal and protozoan agents are the most important İletişim (Correspondence) sedilek@yahoo.com

91 256 Evaluation for Some Bacterial... factors associated with abortions among dairy herds worldwide 2,3. The infections causing abortion may vary, presumably due to climate, production types, management practices and geographic factors in different regions 4. Effective preventive measures for abortions require not only prompt and accurate diagnosis, but also understanding of the multicausal factors involved 5. The aim of this study was to investigate Brucella abortus, Chlamydophila abortus, Coxiella burnetii, Bovine herpesvirus-, Bovine viral diarrhea virus and Bovine herpesvirus-4 infections of dairy cattle herds with abortion history. MATERIAL and METHODS Samples This study was conducted in 0 dairy cattle herds with abortion history in Burdur province, Southwest region of Turkey. Blood samples were collected from 932 dairy cattle 2 years of age. Blood samples were taken into tubes without anticoagulant. After clotting, the tubes were centrifuged, and the serum samples were separated and kept at -20 C until used. All of the serum samples were tested for B. abortus by ELISA. The seronegative samples for B. abortus were investigated for C. abortus and C. burnetii by ELISA. After, seronegative herds for B. abortus, C. burnetii and C. abortus were analysed for antibodies to BHV-, BVDV and BHV-4. Leucocyte were obtained from blood samples, taken into tubes with EDTA, by centrifugation at rpm/25 min. and stored in deep freezer at -20 C till used. All of animals were not vaccinated against BHV-, BVDV, BHV-4 and B. abortus before. Antibody Detections in Sera by ELISA Presence of antibodies against B. abortus, C. burnetii and C. abortus (Institute Pourquier, France), BHV-, BVDV and BHV-4 (Bio-X Diagnostics, Belgium) were investigated by ELISA. The tests were carried out according to the kit procedure. BVDV Antigen - ELISA The kit of BVD/MD Antigen Mix Screening ELISA (Institute Pourquier, France) was used to determine the existence of antigen in the leucocyte samples. The test was carried out according to the kit procedure. RESULTS The seropositivity for B. abortus was found in 25.3% (236/932) of the sera. While seropositivity for C. burnetii was found in 0.2% (9/86) of the samples, C. abortus was not detected in any of the sera (0/225). In seronegative herds for B. abortus, C. burnetii and C. abortus, seropositivity for BHV-, BVDV and BHV-4 were found as 43.5% (40/92), 8.5% (75/92), and 42.4% (39/92), respectively (Table ). Antibodies rates of BHV- + BVDV + BHV-4, BHV- + BHV- 4, BHV- + BVDV and BVDV + BHV-4 were 2.7% (20/92), 2.7% (20/92), 40.2% (37/92), 37% (34/92), respectively. Also, the rates at which cattle were detected for both BHV- + BVDV (antigen) + BHV-4 and BHV- + BVDV (antigen) were.% (/92) (Fig. ). BVDV antigen was only detected as 2.2% (2/92) in the leucocyte samples in aborted cattle. Table. The rates of seropositivity for B. abortus, C. burnetii, C. abortus, BHV-, BVDV, BHV-4 in dairy cattle herds with abortion history Tablo. Abort hikayesi bulunan süt sığırı işletmelerinde B. abortus, C. burnetii, C. abortus, BHV-, BVDV, BHV-4 ün seropozitiflik oranları Bacterial and Viral Agents Number of Serum Samples Positive % B. abortus C. burnetii C. abortus BHV BVDV BHV Fig. Multiple infection rates of BHV-, BVDV and BHV-4 in dairy cattle herds with abortion history (Ab: Antibody, Ag: Antigen a: BHV- (Ab) + BVDV (Ab) + BHV-4 (Ab), b: BHV- (Ab) + BHV-4 (Ab), c: BHV- (Ab) + BVDV (Ab), d: BVDV (Ab) + BHV-4 (Ab), e: BHV- (Ab) + BVDV (Ab-/Ag+) + BHV-4 (Ab), f: BHV- (Ab) + BVDV (Ab-/ Ag+)). Şekil. Abort hikayesi bulunan süt sığırı sürülerinde BHV-, BVDV and BHV-4 için çoklu enfeksiyon oranları