Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Evrimsel Perspektifte ILAŞTIRMALI GENOMİK"

Transkript

1 Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK Fatih Dikmen

2 CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT TCATCCATCACTGTCCTTGTCAAATAGTTTGGAACAGGTATAATGATCACAA TAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGTTATCCCC GAGTGATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGA GTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCA CCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACT ACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATT CCATGACTTTATTCTGACACTACCTGGANedengenom?CCTTGTCAAATAGTTT ATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAG GTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTC ACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATA CAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAG TGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTG GTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCA GTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGC TCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATG ATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGA AAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTT

3

4 DNA Şifre Protein

5 Santral Dogma İnsan Genom Projesi nin motivasyon kaynağı belki de bu kavrama dayanmıştır diyebiliriz Şifrelerden birinin bilinmesi halinde diğerlerinin de şifre çözümü ortaya çıkar!?

6

7 İnsan genomu çözülmeden önce insanların n adet gene sahip olduğu u tahmin edilmekteydi. Genom sekansının n tamamlandığı ığının n söylendis ylendiği i 2001 yılında y bu tahmin 'e düştü. d Şimdi ise toplam sayının yaklaşı şık k olduğunu unu ama her an 'e bile düşebileceğini ini bilmekteyiz.

8

9 İGP-İnsanlığın Kendini Araması!

10

11 Ancak İnsan Genom Projesi, ne kendimizi ne dünyamızı anlamamızı sağlamadı. Sadece bir başlangıç yolunu açtı. Artık biliyoruz ki saece genom dizilerini bilmek yeterli değil. Esas önemli olan bu dizilerin fonksiyonunu bilmek! İşte bu nokta karşılaştırmalı genomik in çıkış noktasıdır. Karşı şılaştırmalı genomik (comparative genomics) ) farklı organizmaların n genomları arasındaki ilişkiyi (farklılık k ve benzerlikleri) inceleyen yeni bir bilim dalıdır.

12 The different topics in bioinformatics are thus: Comparative Genomics Studying similarities and differences between genomes Functional Genomics Cataloguing the activities of genes and characterizing interactions between all gene products (proteomics) Analysis of Gene Expression Studies Tools and techniques to follow up the level of gene expression in different stages in development or disease or in different tissues Structural Genomics Determining genome structure Trying to crystallize and/or predict protein structure ttp:// Genlerin dizisinin belirlenmesi ardından en önemli adım m karşı şılaştırmalı genomiktir!

13 Peki karşı şılaştırmalı genomik nasıl l yardımc mcı olur? Temelde 2 yardımı vardır: r: a- Sekansı bilinen dizilerde gen bulmayı kolaylaştırır. r. b- Evrimsel çalışmalar; biz kimiz???

14

15 Sekansı Bitmiş Genomlar

16 Gen Bulmak! Genom dizilerinin benzerliği üzerine yapılan araştırmalar fonksiyonel gen bölgeleri belirlemede en önemli yöntemdir. Bu konudaki en iyi örnek protein kodlayıcı bölge tespitinde bu analizlerin katkılarıdır. Bunun için normalde türler arası benzerliği analiz eden yazılımlar büyük genomların analizine uyarlanmıştır. Bu sayede 2003 verilerine göre memelilerde 1000 yeni gen seti tespit edilmiştir. Nematod genomlarının kıyaslanması ile de 1275 adet iyi desteklenmiş gen bölgesi önerilmiştir. Artık günümüzde kodlanmayan RNA bölgelerinin tespiti biyoinformatik ve genomik çalışmaların en önemli hedefi olmuştur. Ayrıca şunu da belirtmeliyiz ki, kodlanan bölgeler için kullanılan türler arasındaki benzerliği analiz eden programlar bu yeni hedef için de umut vaat etmektedir.

17 Evrimsel Analiz Karşılaştırmalı genomik ile yapılabilecek en basit değerlendirmelerden biri genomlar arası uyumun analizidir. Genomların karşılaştırılması işleminde organizmaların filogenetik mesafeler çok önemlidir. Eğer geniş ölçekli değerlendirmeler yapılacaksa uzak filogenetik ilişkide bulunan canlıların genomlarının kıyaslanması daha doğru olur. Mesela Rubin et. al (2000) a göre maya, solucanlar ve sineklerin genomlarının kıyaslandığı çalışmada ökaryotik proteinlerin çoğu ortak olarak bulunurken filogenetik olarak daha yakın akraba ola sinek ve solucanların bazı temel proteinleri (sinyal yolu proteinleri), mayalara göre iki kat daha fazla taşıdıkları bulunmuştur.

18 CCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACT TGTTATTCAGATGCATCAGGTGCAATGGGAAGCTCTTC TCCAGTTAAGGTGACATTGAAGCCAAGTCCTGAAAGAT GT Nothinginbiologymakessenseexceptinthelightofevolution GG GGGGGAGGTGGAGGGATGGGGAATGGGCCGGGATGGGA ACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTG AGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGT TGCGTATheodosiusDobzhanskyGACACAGTAATTTGCTTGT TGCCTGAGATTGCCTCTCCTATGCAGTTAAGCAGGTAGG AAAGCCCATGTTTGTCTCTACTCACACGACACCAGATTC CTGGATATTAACTGTCCCATEvolutionaryGenomicsGGCTT TTTCCGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAA GTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCAC CTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCAC GACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCT

19 Ancak milyon yıllık bir zaman dilimleri içinde birbirinden ayrılan organizmalarla çalıştığınızda hem fonksiyonel hem de fonksiyonsuz DNA ların korunabildiğini görebilirsiniz. Bu tür vakalarda fonksiyonel DNA sekanslarının durulaşma ve negatif seleksiyon izleri gösterir ki bu da, fonksiyonel DNA nın fonksiyonsuz veya nötral DNA dan daha az değişeceğinden kaynaklanır (??)

20

21 Veri tabanları ve Biyoinformatik Farklı DNA dizilerinin hizalanması (alingment) karşılaştırmalı genomik çalışmalarındaki ana işlemdir. Hizalama işlemi, bir dizideki nükleotid ile diğer dizideki nükleotidin çakıştırılarak iki dizi arasındaki uyumlu (matching) alanların belirlenmesidir. Bu yüzden en iyi şekilde hizalama yapılmalıdır ki ona göre en iyi uyumluluk sonuçları alınabilsin. Sadece iyi hizalama yapmak ya da iyi uyumluluk elde etmek yeterli olmaz. Çıkan verilerin analiz edilmesi de gereklidir. Miyarlarca baz dizisi verisini düşündüğünüzde bunları berim bilim yardımı olmadan çözmeniz olanaksızdır. BLAST, FASTA ve onların türevleri gibi arama algoritmaları yeni sekansların daha önce depolanmış tüm sekanslarla karşılaştırılmasına izin verir.

22 Nothing in (computational) biology makes sense except in the light of evolution after Theodosius Dobzhansky (1970) Bir Biyoenformatik Takımı Hacking the Genome

23 DNA RNA Protein Genomics (Sekans) Transcriptomics (micro-array/dna çipi) Proteomics (ilaç sanayisi) Collect nucleic acid and amino acid sequences, most important examples: European Molecular Biology Laboratory (EMBL) Nucleotide Sequence Database SWISS-PROT Annotated (curated( curated) ) protein sequence database GENBANK (NCBI National Center for Biotechnology Information) Nucleic acid and protein sequences Veri tabanı

24

25 243 organizma genomu!

26 ebi.ac.uk/genomes/eukaryota.html

27 Karşlaştırmalı Genomik Bize Neler Öğretti İnsan ile şempanze arasında gen farkı %1 den az Goriller veya Orangutanlarla %3 den az İnsan yüzlerce atasal (3,5 milyar yıllık) gen taşımakta. Mesela bakterilerle ortak 500 geni var. Drosophila ile ortak 1500 geni var. %80 genleri fare ile ortak. vs vs

28 rimat atalarımızdan çok uzak olmadığımız kesin

29

30 Deniz Cansaş ve Teknik, Nisan 2004 Bilim ve Teknik, Ekim 2005

31 Bilim ve Teknik, Ocak 2005

32

33 İnsanda protein kodlayan genlerin hemen hemen tümünü hizalandığında fare ile %99 homoloji ve %80 1:1ortholog luk göstermektedir. Çoğu durumda intronexon yapıları oldukça korunmuştur. Fare ile insan biyokimyası arasındaki benzerlik ve uyum düşünüldüğünde protein kodlayan bölgenin bu olağanüstü korunumu belki beklenebilir bir durumdur

34 Rhesus makakları Macaca mulatta, insan ve şempanzelerden sonra, tüm genom dizisi çıkarılan üçüncü primat türüdür Yapılan incelemeler, makak-insan genomlarının protein kodlayıcı dizi bakımından %97,5 aynı olduklarını ortaya çıkardı. Makaklarda, insanlarda ve şempanzelerde aynı olan 108 gen ailesinin farklı şekilde evrimleştikleri anlaşılmış oldu. Makaklar bağışıklık sistemi araştırmalarında sıkça kullanılan model organizmalardan biri olduklarından, bu bilgi araştırmacılar için son derece önemlidir

35 Caenorhabditis briggsae ve C. elegans genomlarının protein kodlayan bölgeleri arasında yapılan analiz %60 homolojiyi göstermiştir. Bu iki nematod arasında morfolojik fark bulmak çok zordur. Muhtemeldir ki gelişim basamakları da aynıdır. Ancak bu iki benzer nematodun bu kadar farklılık göstermesi bize bunların benzer fenotipleri farklı genetik yollarla sağladıklarını düşündürmektedir. Bu konuda yapılacak detaylı benzerlik/farklılık analizler belki de gelişim biyolojisi konusunda çok yeni ufuklar açabilecektir

36 Hox Gen Kompleksi

37 Tüm bu yorumların daha doğru yapılabilmesi başka türlerinde bu analizlere eklenmesi ve tekrarsız dizileri ve hizalanmayan genomları içeren kapsamlı açıklamaların yapılabilmesi ile mümkündür. Ayrıca sadece evrimleşme hızının değişebilirliği değil, genomların da epeyce varyasyona açık olduğunun göz önünde tutulması gerekmektedir. Özellikle memeli kromozomlarının nükleotid değişimine, transpozon eklenmelerine ve rekombinasyonlara açık olması, primat genomunda segmental duplikasyonların değişikliklerin temel kaynağı olduğunun bilinmesi ve ona göre analizlerin gözden geçirilmesi gerekmektedir Doolittle, Science 1999

38 Asgari Genom Mycoplasma genitalium Haemophilus influenzae Bacillus subtilis E. coli 1, H.influenzae 1, M.genitalium Yanai and Lancet, 2004;

39 Tanrı yı Oynamak Life 2.0 Yeni proteinlerin keşfi Evrimsel genomik Nişasta kullanarak bir hücre yaratmak! Yakıt üreten hücreler

40

41

42

43

44

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky.

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky. Evrimsel Perspektifte KARŞILAŞTIRMALI GENOMİK Fatih Dikmen http://cigbrowser.berkeley.edu/ Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky Santral Dogma kavramı 1958

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

Model Organizmalar. Yusuf DOĞAN

Model Organizmalar. Yusuf DOĞAN Model Organizmalar Yusuf DOĞAN Model Organizma Nedir? Model organizmalar çeşitli biyolojik olayların anlaşılması için üzerinde çalışılan bir türdür. Bu organizmaları laboratuvar ortamında üretmek ve üretimlerini

Detaylı

KOMPERATİF GENOMİK Principles of Genome Analysis and Genomics S.B. Primrose and R.M. Twyman Bölüm 7 s. 113-132 Amacı; farklı organizmaların genom yapısındaki farklılık ve benzerliklerin ortaya çıkarılmasıdır.

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti

Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti, Gökmen Zararsız, Dinçer Göksülük, Osman Saraçbaşı Hacettepe Üniversitesi Tıp Fakültesi Biyoistatistik Anabilim Dalı XVI. Ulusal Biyoistatistik Kongresi,

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü 7 İNSAN GENOM PROJESİ Ifl k YULU * In this article, the author has summarized the Human Genome Project and what it aims to achieve. Following the description of the human genome the history, applications,

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Evrimsel açıdan genlerin çoğaltılmasının önemi ilk defa Haldane (1932) ve Muller (1935 ) tarafından önerildi ve tanımlandı. *Evrimsel açıdan bir genin

Detaylı

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ]

Dersin Türü (Course Type) Zorunlu (Compulsory)[Χ] Seçmeli (Elective) [ ] Programın Adı (Program Name) Moleküler Biyoloji ve Genetik (Molecular Biology and Genetics) Dersin Kodu (Course Code) MBG 305 Dersin Adı (Course Name) Uygulamalı Biyoenformatik (Applied Bioinformatics)

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

Gen Organizasyonu ve Genomların Evrimi

Gen Organizasyonu ve Genomların Evrimi GENETĐK 111-503 Gen Organizasyonu ve Genomların Evrimi Doç. Dr. Hilâl Özdağ 1 RNA nın Kendi Kendini Kopyalayabiliyor Olmalıydı Đlkin zamanlardaki RNA dünyasında RNA moleküllerinin kopyalanması. RNA polimerazlar

Detaylı

NEDEN BİYOİNFORMATİK?

NEDEN BİYOİNFORMATİK? 127 NEDEN BİYOİNFORMATİK? Rengün Çetin ATALAY* Recent progresses in molecular biology have revealed the large fractions of the genome sequences of several species during the last decades. Public sequence

Detaylı

Gen haritasının ne kadarı tamamlandı DNA'nın şimdiye kadar yüzde 99'u deşifre edildi.

Gen haritasının ne kadarı tamamlandı DNA'nın şimdiye kadar yüzde 99'u deşifre edildi. Bilim dünyası, yaşamı alt üst edecek yeni bir gelişmeye daha imza atarak insan DNA'sının şifresini çözmeyi başardı. Çıkarılan 'gen haritası' sayesinde kalp ve kanser hastalığı tarihe karışacak ve insan

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Ders 10 - Diğer küçük kodlamayan RNA lar

Ders 10 - Diğer küçük kodlamayan RNA lar Ders 10 - Diğer küçük kodlamayan RNA lar ü Yüksek organizmalar ait proteomlar nispeten durağandır. ü Bir bireyde diğer insanlara göre her haploid genomun ~3.000.000 dizisinin farklı olmasına rağmen, bu

Detaylı

FİLOGENİ ve HAYAT AĞACI

FİLOGENİ ve HAYAT AĞACI FİLOGENİ ve HAYAT AĞACI Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER Giriş Filogenetik veriler ile canlılar arasında oluşturulan akrabalık ilişkileri, canlılığın gelişimine dair bize akrabalık ağaçlarını

Detaylı

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği sirna Doç.Dr. Metiner Tosun EÜ Eczacılık Fakültesi Farmakoloji AD Trabzon Ekim 07 Geleneksel ilaç geliştirme fazları: Doğrusal süreç 1-5 yıl

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Ders Bilgisi. Öğretim Görevlisi ORTA DOĞU TEKNİK ÜNİVERSİTESİ 9080506-1 DERS İZLENCESİ. Ders Kodu 9080506. Ders Bölümü.

Ders Bilgisi. Öğretim Görevlisi ORTA DOĞU TEKNİK ÜNİVERSİTESİ 9080506-1 DERS İZLENCESİ. Ders Kodu 9080506. Ders Bölümü. Ders Bilgisi Ders Kodu 9080506 Ders Bölümü 1 Ders Başlığı PROTEİN VE DNA DİZİ ANALİZİ Ders Kredisi 3 ECTS 8.0 Ders Katalog Tanımı Bu derste, homoloji analizi, motif ve alt-birimlerin(domain) belirlenmesi,

Detaylı

Non-coding RNA Molekülleri

Non-coding RNA Molekülleri Non-coding RNA Molekülleri Dersin Sorumlusu: Dr. Hatice MERGEN Dersin adı: Proteomik ve Genomik Hazırlayan: Çiğdem KAPLAN 2004 2005 GÜZ Non-Coding RNAs (Kodlama Yapmayan RNA lar) Genom projesinin ilk hedefi,

Detaylı

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI 12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların genlerine

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN: Dilek SADAK DANIŞMAN : Yrd. Doç. Dr. Dilek TURGUT-BALIK

Detaylı

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM Burcu GÜNGÖR, Sami ÖZGÜR Balıkesir Üniversitesi Necatibey Eğitim OFMA Biyoloji Eğitimi A.B.D Özet Ders kitapları, hem öğretmenlerin hem öğrencilerin

Detaylı

Kalem ve kağıtla biyoinformatik: filogenetik ağaç oluşturma

Kalem ve kağıtla biyoinformatik: filogenetik ağaç oluşturma GÖRÜŞ Resim: hometowncd / istockphoto Kalem ve kağıtla biyoinformatik: filogenetik ağaç oluşturma Biyoinformatik genellikle güçlü bilgisayarlarla yapılır. Ancak burada Cleopatra Kozlowski nin yardımıyla

Detaylı

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013])

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) BİYOLOJİ PROJE SUNUMU GRUP SUSTURUCU PROJE ADI Bazı Bitki Türlerindeki mirna

Detaylı

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11 İÇİNDEKİLER 1. BÖLÜM: EVRİME GİRİŞ...1 1.1. EVRİM VE BAŞLICA EVRİM TEORİLERİ...1 1.1.1. Darwin in Evrim Teorisi...2 1.1.2. Darwin Sonrasının Evrim Teorileri...4 1.1.3. Evrimsel Sentez Teorisi...5 1.2.

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI Moleküler biyolojiye giriş Doç.Dr.Pınar AKSOY SAĞIRLI Molecular biology terimi ilk kez Warren Weaver tarafından 1938 de kullanıldı. Hayatın fiziksel ve kimyasal olarak açıklanması olarak tanımlandı. 1977

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

03.05.2012. Homoloji: Homolog iki gen, yüksek seviyede dizilim

03.05.2012. Homoloji: Homolog iki gen, yüksek seviyede dizilim 3.5.22 Nezahat Karahan DN, RN veya Protein dizilerinin düzenlenerek benzer bölgelerinin tespit edilmesidir. Biyoinformatikte birçok inceleme, iki ya da daha çok sayıda DN veya protein dizisinin karşılaştırılmasına

Detaylı

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır.

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır. TIBBİ GENETİK I-DERS TANIMLARI 1-Tanım: DNA ve RNA yapısının öğretilmesi. b. Amaç: DNA nın genetik materyal olmasında moleküler yapısının önemi ve RNA yapısının proteine geçiş ve gen ekspresyonu kontrolündeki

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

Biyobankalar. Prof.Dr.Meral Özgüç

Biyobankalar. Prof.Dr.Meral Özgüç Biyobankalar Prof.Dr.Meral Özgüç Hacettepe Üniversitesi, Tıp Fakültesi, Tıbbi Biyoloji Anabilim Dalı 14.05.2014 Genetik Genombilim Yüksek ölçekli teknolojiler Örnek kalite sayı Biyobankalar & Çerçeve Kuralları

Detaylı

BİYOLOJİ EĞİTİMİNDE MOLEKÜLER EVRİM. Prof. Dr. Haluk Ertan İ.Ü. Moleküler Biyoloji ve Genetik Bölümü Biyologlar Derneği İstanbul Şubesi

BİYOLOJİ EĞİTİMİNDE MOLEKÜLER EVRİM. Prof. Dr. Haluk Ertan İ.Ü. Moleküler Biyoloji ve Genetik Bölümü Biyologlar Derneği İstanbul Şubesi BİYOLOJİ EĞİTİMİNDE MOLEKÜLER EVRİM Prof. Dr. Haluk Ertan İ.Ü. Moleküler Biyoloji ve Genetik Bölümü Biyologlar Derneği İstanbul Şubesi İKİ FARKLI DÜNYA GÖRÜŞÜ Statik bir evren, dünya ve doğa anlayışı Değişim=Doğaüstü

Detaylı

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml

Detaylı

Biyolojik Veritabanları ve Biyoinformatik Analiz Araçları

Biyolojik Veritabanları ve Biyoinformatik Analiz Araçları Biyolojik Veritabanları ve Biyoinformatik Analiz Araçları Aslı Yazağan Özet: Günümüzde bilgi üretimi, bu bilgilerin yorumlanmasından daha hızlı bir şekilde ilerlemektedir. Bu nedenle bilişim alanında öncelikli

Detaylı

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8 DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS BİYOİNFORMATİĞE GİRİŞ BTEC 513 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce

Detaylı

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz İnsan Mikrobiyom Projesi Prof. Dr. Tanıl Kocagöz Human Microbiome Project İnsan Mikrobiyom Projesi (İMP) 2007 yılında NIH tarafından başlatıldı 300 gönüllünün 5 vücut bölgesinden değişik zamanlarda, toplam

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ Değişik canlı gruplarında kalıtsal molekülün çeşidi, sayısı, biçimi ve organizasyonu bakımından farklılıklar bulunur. Ortak özellik: nükleik

Detaylı

HAFTA II Mendel Genetiği

HAFTA II Mendel Genetiği GENETĐK 111-503 HAFTA II Mendel Genetiği Doç. Dr. Hilâl Özdağ 1865 Gregor Mendel kalıtım kurallarının temellerini attı. http://www.dnaftb.org/dnaftb/1/concept/ 1 Seçilen Özellikler Hartl DL, Jones EW,

Detaylı

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni.

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni. BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr Özgeçmişimim Postdoctoral

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

LABORATUARDA SEKANSLARIN TOPLANMASI VE DEPOLANMASI. Ayhan YILMAZ

LABORATUARDA SEKANSLARIN TOPLANMASI VE DEPOLANMASI. Ayhan YILMAZ BİYOİNFORMATİK: LABORATUARDA SEKANSLARIN TOPLANMASI VE DEPOLANMASI Ayhan YILMAZ Sunum Taslağı DNA NIN NIN SEKANSLANMASI Genomik Sekanslama Shotgun Sekanslama Eksprese Olan Genlerin cdna Kütüphanelerini

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

BİO 775 PROTEOMİK ve GENOMİK

BİO 775 PROTEOMİK ve GENOMİK 1 BİO 775 PROTEOMİK ve GENOMİK SEQUENCE TAGGED SITES (STSs) EXPRESSED SEQUENCE TAG (ESTs) S. Esin SELÇUK 2006 2 SEQUENCE TAGGED SITES (STSs) STS; genomda 200-300 baz uzunluğundaki kısa bir bölgedir ve

Detaylı

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların

Detaylı

TEMEL VETERĠNER GENETĠK

TEMEL VETERĠNER GENETĠK DİKKATİNİZE: BURADA SADECE ÖZETİN İLK ÜNİTESİ SİZE ÖRNEK OLARAK GÖSTERİLMİŞTİR. ÖZETİN TAMAMININ KAÇ SAYFA OLDUĞUNU ÜNİTELERİ İÇİNDEKİLER BÖLÜMÜNDEN GÖREBİLİRSİNİZ. TEMEL VETERĠNER GENETĠK KISA ÖZET KOLAYAOF

Detaylı

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı.

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı. Bu dersin içeriği, Populasyonun tanımı, Alel ve genotip frekansı, Gen havuzu, Gen frekansı, Gerçek/Doğal populasyonlar ve ideal populasyonlar, Populasyon genetiğinin çalışma alanları, HW kanunu -giriş,

Detaylı

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ Seçici gen ifadesi embriyonun gelişmesini sağlayan 4 temel işlevi denetler: 1. Hücre çoğalması 2. Hücre farklılaşması 3. Hücre etkileşimleri 4. Hücre hareketi HÜCRE

Detaylı

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER Plazmid ve Epizomlar Bakterilerin kendi kromozomlarının yanı sıra, kromozom dışı bazı genetik parçacıklar bulunmaktadır Bakteri kromozomundan daha küçük yapıda

Detaylı

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

Differential Display. Özgür Çakır

Differential Display. Özgür Çakır Differential Display Özgür Çakır Differential gen anlatımı Gelişmeye bağlı gen anlatımı değişiklikleri Ortam uyaranları ile gen anlatımı değişimleri Doku veya hücreye özel gen anlatımları Farklı anlatım

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Türkiye'de 2015-2016 İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Dilek Güldemir 1,Ayşe Başak Altaş 1,Fatma Filiz Arı 1,Zekiye Bakkaloğlu 1,Özlem Ünaldı 1,Fatma

Detaylı

GENETĐK EPĐGENETĐK. Doç. Dr. Hilâl Özdağ EPĐGENETĐK

GENETĐK EPĐGENETĐK. Doç. Dr. Hilâl Özdağ EPĐGENETĐK GENETĐK 111-503 EPĐGENETĐK Doç. Dr. Hilâl Özdağ EPĐGENETĐK Epigenetik gen işlevinde çekirdek DNA sının diziliminde bir değişiklik olmaksızın gerçekleşen tersine çevrilebilir kalıtlanabilir değişiklikleri

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

GENOMİK VE PROTEOMİKİN İNFEKSİYON HASTALIKLARINDAKİ YERİ VE ÖNEMİ

GENOMİK VE PROTEOMİKİN İNFEKSİYON HASTALIKLARINDAKİ YERİ VE ÖNEMİ ANKEM Derg 2009;23(Ek 2):48-52 GENOMİK VE PROTEOMİKİN İNFEKSİYON HASTALIKLARINDAKİ YERİ VE ÖNEMİ Tanıl KOCAGÖZ Acıbadem Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı,

Detaylı

Mutasyon ve Genetik Sürüklenme

Mutasyon ve Genetik Sürüklenme Mutasyon ve Genetik Sürüklenme Bir popülasyondaki alel frekanslarını değiştiren doğal sebepler Doğal seçilim Mutasyon Genetik sürüklenme Kurucu etki (Founder effect) Popülasyon darboğazı, MUTASYON Genel

Detaylı

Nükleotid Dizilerinin Aminoasit Formatına Dönüştürülmesi ve Dünya Veri Tabanlarındaki Verilerle Karşılaştırılması

Nükleotid Dizilerinin Aminoasit Formatına Dönüştürülmesi ve Dünya Veri Tabanlarındaki Verilerle Karşılaştırılması Kafkas Univ Vet Fak Derg 19 (2): 359-363, 2013 DOI: 10.9775/kvfd.2012.7909 Journal Home-Page: http://vetdergi.kafkas.edu.tr Online Submission: http://vetdergikafkas.org REVIEW * ** Nükleotid Dizilerinin

Detaylı

TRANSLASYON ve PROTEİNLER

TRANSLASYON ve PROTEİNLER TRANSLASYON ve PROTEİNLER Prof. Dr. Sacide PEHLİVAN 13 Aralık 2016 mrna daki baz sırasının kullanılarak amino asitlerin doğru sıra ile proteini oluşturmasını kapsayan olayların tümüne Translasyon veya

Detaylı

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler)

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) PROKARYOTLARDA GEN EKSPRESYONU ve REGÜLASYONU (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) Nihal EYVAZ (050559015) Şerife OKAY (050559025) Prof. Dr. Figen ERKOÇ Gazi Eğitim Fakültesi Gen

Detaylı

Model Organizmalar, Deney Hayvanları Kullanım Alanları ve Etik

Model Organizmalar, Deney Hayvanları Kullanım Alanları ve Etik Hatice BALMUK Zeynep ZEYNELOĞLU Nazlı CANKILIÇ Model Organizmalar, Deney Hayvanları Kullanım Alanları ve Etik Model Organizma nedir? Model organizma, biyoloji alanındaki deney ve araştırmalarda kullanılmaya

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

Transkripsiyon ve Transkripsiyonun Düzenlenmesi

Transkripsiyon ve Transkripsiyonun Düzenlenmesi MBG 505 BAKTERİ GENETİĞİ Transkripsiyon ve Transkripsiyonun Düzenlenmesi Emrah ÖZÇELİK Ribonükleik asit (RNA) 3 tip RNA Mesajcı RNA (mrna) (genetik seviyede) Transfer RNA (trna) Ribozomal RNA (rrna) (fonksiyonel

Detaylı

EVRİM MÜHENDİSLİĞİ. Tuğrul Giray Porto Riko Üniversitesi (UPR) Orta Doğu Teknik Üniversitesi (ODTÜ)

EVRİM MÜHENDİSLİĞİ. Tuğrul Giray Porto Riko Üniversitesi (UPR) Orta Doğu Teknik Üniversitesi (ODTÜ) EVRİM MÜHENDİSLİĞİ Tuğrul Giray Porto Riko Üniversitesi (UPR) Orta Doğu Teknik Üniversitesi (ODTÜ) Bilim ve Teknoloji Basımevi Osmanlı da bir şeyhülislam fetvası ile 1727 de izin verilene kadar 300 yıl

Detaylı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

VEKTÖRLER Halime Nebioğlu

VEKTÖRLER Halime Nebioğlu VEKTÖRLER Halime Nebioğlu İstanbul Üniversitesi Gen klonlamasında kullanılan aracı moleküllere vektör denir. Vektörler konakçı organizmada, konakçı organizmadan bağımsız olarak replikasyon (çoğalma) gösterirler.

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

DÖNEM I DERS KURULU I

DÖNEM I DERS KURULU I DÖNEM I DERS KURULU I KONU: Hücre, Hücre Organelleri, Nükleus AMAÇ: Öğrenciler bu dersin sonunda, hücreyi, hücre organellerinin yapı ve işlevlerini tanımlayabilecek, hücre tiplerinin özelliklerini ve arasındaki

Detaylı

Hücre Biyolojisi ve Genetikte Güncel Laboratuvar Protokolleri Kerimi E. GÖKAY, M.D., Ph.D. 2008 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu

Hücre Biyolojisi ve Genetikte Güncel Laboratuvar Protokolleri Kerimi E. GÖKAY, M.D., Ph.D. 2008 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu Hücre Biyolojisi ve Genetikte Güncel Laboratuvar Protokolleri Kerimi E. GÖKAY, M.D., Ph.D. 2008 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu Önsöz: Bilimsel bir araştırmanın kalitesi araştırma ile oluşturulan

Detaylı

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ GENOM PROJELERĐ Doç. Dr. Hilâl Özdağ Genom Projeleri Dizileme Klon kütüphaneleri Stratejiler Genom Dizilemesi Tekrar eden DNA dizileri Biraraya getirme (Assembly) PHRAP, PHRED,CONSED Bitiş Boşlukların

Detaylı

Kromozom Biyolojisi. Tarihçe

Kromozom Biyolojisi. Tarihçe Kromozom Biyolojisi Tarihçe Kromozom Biyolojisi ve Sitogenetik -Son 300 yıldır önemli araştırma alanlarından -Moleküler biyolojideki gelişmeler de kromozomlar üzerindeki araştırmaları etkiledi -Kromozomlar

Detaylı

KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI

KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI MBG 111 BİYOLOJİ I Hazırlayan: Yrd.Doç.Dr. Yosun MATER GİRİŞ Mendel kalıtımında eğer genler bağımsız ise kalıtıldıklarında kabaca belli oranlarda ve sıklıkla

Detaylı

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ 1 Genetik mühendisliği canlıların kalıtsal özelliklerinin değiştirilerek onlara yeni işlevler kazandırılmasına yönelik araştırmalar yapan bilim dalıdır. Genetik mühendisleri

Detaylı

ÜNİTE 1: BİYOLOJİYE GİRİŞ

ÜNİTE 1: BİYOLOJİYE GİRİŞ ÜNİTE 1: BİYOLOJİYE GİRİŞ Anahtar kavramlar 1.1 Biyologlar mikroskobik türlerden dev türlere kadar bütün canlıları inceler. 1.2 Biyologlar yaşamdaki çeşitliliği açıklamaya çalışırlar. 1.3 Biyoloji de son

Detaylı

Gen Klonlanması. & DNA kütüphanelerinin oluşturulması. Mikrobiyoloji Anabilim Dalı

Gen Klonlanması. & DNA kütüphanelerinin oluşturulması. Mikrobiyoloji Anabilim Dalı 8. Ha&a Gen Klonlanması & DNA kütüphanelerinin oluşturulması Mikrobiyoloji Anabilim Dalı Gen Klonlanması Klonlama ne demektir? Gen klonlaması nedir? Bütün bir organizmayı klonlamadan farkı nedir? Gen klonlaması

Detaylı

BEDEN VE ZİHNİN EVRİMİ. Dr Ali Sever Prof. Mazhar Osman Ruh Sağlığı ve Sinir Hastalıkları Eğitim ve Araştırma Hastanesi

BEDEN VE ZİHNİN EVRİMİ. Dr Ali Sever Prof. Mazhar Osman Ruh Sağlığı ve Sinir Hastalıkları Eğitim ve Araştırma Hastanesi BEDEN VE ZİHNİN EVRİMİ Dr Ali Sever Prof. Mazhar Osman Ruh Sağlığı ve Sinir Hastalıkları Eğitim ve Araştırma Hastanesi 2 3 4 5 6 Evrim süreci nasıl işler? Mutasyon Varyasyon (genetik çeşitlilik) Doğal

Detaylı

Tanımlamalar PROTEİN SENTEZİ; TRANSLASYON. Protein sentezi ;translasyon. mrna ; Genetik şifre 1/30/2012. Prof Dr.Dildar Konukoğlu

Tanımlamalar PROTEİN SENTEZİ; TRANSLASYON. Protein sentezi ;translasyon. mrna ; Genetik şifre 1/30/2012. Prof Dr.Dildar Konukoğlu PROTEİN SENTEZİ; TRANSLASYON Prof Dr.Dildar Konukoğlu DNA SENTEZİ DNA DNA RNA sentezi DNA mrna Protein sentezi mrna Protein Tanımlamalar Replikasyon Replikasyon Transkripsiyon Transkripsiyon Translasyon

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

ÖZGEÇMİŞ. Expression Pattern Comparison of Two Ubiquitin Specific Proteases. Functional Characterization of Two Potential Breast Cancer Related Genes

ÖZGEÇMİŞ. Expression Pattern Comparison of Two Ubiquitin Specific Proteases. Functional Characterization of Two Potential Breast Cancer Related Genes ÖZGEÇMİŞ 1. Adı ve Soyadı: Shiva Akhavantabasi 2. Ünvanı: Yrd. Doç. Dr. 3. Email adresi: shiva.akhavan@yeniyuzyil.com 4. Öğrenim Durumu: Derece Alan Üniversite Yıl Lisans Mikrobiyoloji Jahrom Azad Üniversitesi

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI Uzm. Dr. Özgür APPAK Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D GİRİŞ:

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın Mitokondri, ökaryotik organizmanın farklı bir organeli Şekilleri küremsi veya uzun silindirik Çapları 0.5-1 μm uzunlukları 2-6 μm Sayıları

Detaylı

9. Hafta. DNA Aşıları

9. Hafta. DNA Aşıları 9. Hafta DNA Aşıları DNA İmmunizasyonu Vücuda etkeni, etkene ait bir antijeni vermek yerine, antijeni kodlayan DNA sekansını (geni) içeren plasmidin kontrollü koşullar, uygun yol, metodlar kullanılarak

Detaylı

Mikobakteriyolojide yeni nesil dizileme ile analiz

Mikobakteriyolojide yeni nesil dizileme ile analiz Mikobakteriyolojide yeni nesil dizileme ile analiz Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, İzmir Mikobakteriyolojide kullanım alanları Moleküller epidemiyoloji

Detaylı

Kök Hücre ve Farklılaşma

Kök Hücre ve Farklılaşma Kök Hücre ve Farklılaşma Kök Hücre Erişkin ve embriyonik kök hücreler farklılaşarak soma7k hücreleri oluştururlar. Kök hücre Progenitör hücre Farklılaşmış hücre Neden Farklılaşmaya İh7yaç Duyulur Tek hücreli

Detaylı