İşlevsel Genomik Nedir?

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "İşlevsel Genomik Nedir?"

Transkript

1 İşlevsel Genomik Nedir? İşlevsel Genomik, yapısal genomik tarafından sağlanan bileşenlerin ve bilginin kullanımı ile gen işlevinin değerlendirilmesinde, deneysel yaklaşımların (genom veya sistem boyunca) geliştirilmesini ve uygulanmasını içermektedir. Geniş ölçekte uygulanan deneysel teknolojilerin, elde edilen sonuçlarla istatistiksel veya bilgisayar analizleriyle birleştirilmesiyle tanımlanabilir. Klasik bir gen anlatımı araştırmasında, in vivo da bir organizmanın gelişimiyle birlikte bir genin anlatımının nasıl değişeceği araştırılırken, modern işlevsel genomik yaklaşımı, organizmanın gelişimiyle birlikte sayıca 1,000 den 10,000 e kadar değişen genin anlatımının nasıl değiştiğini incelemektedir.

2 İşlevsel Genomik Amaç: Genomik bilgiye biyolojik bir anlam kazandırma Çeşitli sistematik yaklaşımlar, bir genomdaki genlerin bir çoğu için sorulan basit sorulara cevaplar oluşturabilirler Gen anlatımı ne zaman gerçekleştirilir? Gen ürününün yerleşimi nerede olur? Bir gen hangi genlerle etkileşime girer? Bir gende mutasyon yapılırsa hangi fenotip ile sonuçlanır?

3 Klasik dizi analizi İşlevsel Genomik in Üç Merkezi Uygulaması: - Genome-wide knock-out - Gen Anlatımı - Genetik Haritalama Çalışmaları

4 Dizileme İçin Gerekli Olan Teknikler Restriksiyon Enzimleri DNA yı parçalara ayırmada Klonlama DNA yı 2-200kb lık bazlık diziler halinde çoğaltma Dizileme Kısa DNA dizisinin okunması. fluoresan maddeler ve jel-elektroforezi kullanılarak. Dizilerin Birleştirilmesi parçaların bir araya getirilmesinde kullanılan bilgisayarlı aşama.

5 Genom Dizilemesi - Büyük genomlar robotik ve otomasyon gerektirir. Ortak dizilerin birleştirilmesi - ideal olan, kromozom başına bir ortak dizi - standart, her bir nükleotidin 10 kez okunması - bilgisayar kullanımı ile birleştirme

6 İki temel dizileme stratejisi - Düzenli klon dizilemesi * fiziksel bir haritayı oluşturan klonlardan yapılan birleştirme * pozisyonların bilinmesinden dolayı tekrarlı diziler için uygun yerleştirilme

7 Tüm genom shot-gun dizilemesi - rastgele dizilenen klonların birleştirilmesi - küçük (ör:bakteri) genomlar için uygun - boşluklar primer yürüme ile doldurulur

8 WGS: Whole Genome Shotgun sequencing 1. Klon Kitaplığının Oluşturulması 2. Her bir Klonun iki ucunun dizilenmesi 3. Çakışan okumaların kontigler içine birleştirilmesi 4. Kontiglerin super-kontigler içine birleştirilmesi 5. Super kontiglerin genom içine dahil edilmesi 6. Genomun Tamamlanması

9 DNA Dizilenmesinde Otomasyon

10 Dzi analiz cihazı: MegaBACE Dizi analiz cihazı: ABI 3700

11 Otomatik jel okuyucu

12 Kapiler elektroforez cihazı

13

14

15

16 Klon Temelli Fiziksel Haritalama

17

18

19 DNA Dizilemesi Çoğunlukla dideoksi metodu (zincir sonlandırma metodu) ile yapılır. Dizilemesi yapılacak olan DNA dizilerinin birçok kopyası aşağıdaki bileşikler ile karıştırılır. Primer DNA tek zincirine bağlanan kısa dizi (~20bp) Normal (deoksi) nükleotidler dntp datp, dgtp, dctp, dgtp dideoksi nükleotidler ddntp DNA polimeraz I Enzim ddatp, ddgtp, ddctp, ddgtp

20 DNA Dizilemesinde Zincir Sonlandırma Metodu Voet Fig. 3-23

21

22

23 Sequencing 2

24 Sequencing 3

25 Bir Klonun Okunması 2,4,6,10, 12 ve 40 kb lik büyüklüklerdeki parçalardan oluşan kitaplıkların elde edilmesi Her bir ayrı klon, her bir kitaplıktan seçilir.

26 Bir Klonun Okunması >clone47_f AAGCAATTTCATAAGAATAACTTTGAGCACAAGCCCGTAAACCACCAATAAAAGAATACT TACCACCACTAAAAATTCCAGATAGCATAATAAAATACGCAGAAACCCCCATTAAGCAAA ATAAAAAAACACCAGAATAATCAAAAGACATAAAAACAAAAAAATAAGGCAAAGTAAACC AAAAAAAAATCATCAAAATAAAACTACAAACAGGCATCAATAAAAAAGATAGTCATGAAGA AAAATAAAAAAAAAGCTGTTCTTTCTTTAATAATTTAAGACCATCAAACAACGCCTGAAAA ATACCAGAGTAACCAACTTTATTGGGACCAATACGACACTGAGTGCCACCCAAAAAATGA CGTTCTATTAAAGTTAAAAAAGCAATGGCTTGTAAAATAAAAATAATTATAAGAAAAATAC CAATATAATAAAAAATAAACAAAGTAAAATCCAAAGAATTTACnnTTCTTTATTCTAATATAA ACTAATACTTTAAAAAATAGAGACAAGTTTCCTTACCTCTACCATACTACAACTTACGCCC CTATAGGCCATTGACGGATGGTTTGTACCACTTTGTTTATTAAATTCATTAATATATAAAAA AAAAATTACTTTCTTTTCCAATTTCAAAAAAAAATAAAAAAATA >clone47_r TGATTGGTGTTTGTTTTCTTATTGTTAATTTTTTTCGTGCTAAATTACATAATTTTAATTGGT ATCATACTCAAGCTTATGATATGTCTATTGACTATTGACGGTTCTTAGAATGAATGTGAGG TATTATATTTTGTTTATTATATGTTTGAGGTTCTTAATTTTTAATTGTAAGATATCTGTTTTA CTTCATTATTTTTTATAGCTTATTTTTAATGATGATTTTTTTAATTATTTCTTCTTTTTTTTTTT TGGTTTTTTTATTTTTTGTACGTTCAATATAATTATGAATAATTATTAGTAATTATTTAAAAA TAATTACTAAATTAAATACAATTCTCAGAGTATTATAACATTAAAGTTATAATACTCTGTTA GAATTGTATTTATTTAATAGACCAACTACTTAAATTACTAACTAAAGATTATTTTTTTACTAT AGTGTATATATTATAnAGTTATTATATTTGATTTGCAATCTTAAGATTTTTATACACTATGGC TTTTTAGTATAATAAGTATATTCGTTTTAAGCGCGGCTGGTTTTAAGCTATTAGAATTTTA

27 Dizilerin Birleştirilmesi Direkt dizi okuma tekniği, 10kb. a kadar olan bir diziyi okuyabilir. Uzun dizi bilgisi elde edebilmek için, kısa okumaların birbirleriyle birleştirilmelerinde bilgisayara gereksinim duyulur.

28 Kontiklerin Birleştirilmesi Okumaların ucunda dizilerin üst üste çakışması belirlendiğinde, iki okuma tek bir dizi şeklinde birleştirilebilir

29 Superkontiklerin Oluşturulması scaffolds olarak da tanımlanmaktadır.

30 BCM- HGSC

31 Büyük Genomlar İnsan Genomu, daha büyüktür ve süperkontiklerin bir şekilde birleştirilmesi gerekir. Bu da genetik haritalama ile yapılmaktadır.

32 Birleştirmeler Sonucunda Genom Üzerinde Yerleştirme Bir dizi etiketi tüm genom boyunca tek olan kısa bir dizidir. Genetik Harita,bir çok dizi etiketini ve onların yerleşimini içermektedir. Böylelikle, etiketlere göre süper kontiklerin genom içinde sıraya dizilmeleri sağlanır.

33 Primer Yürüme: Genom Dizilemesinin Sonlandırılmasında Bir Yol Eğer bir baz üç okuma ile belirlendiyse kesin olarak tanımlanabilmektedir. Kesin olmayan pozisyonlar da mevcuttur. There are gaps in the Süperkontiklerde ve süperkontikler arasında boşluklar vardır. Primer Yürüme bu bölgelerin daha ileri dizilemesinin yapılmasında kullanılabilir.

34 Primer Walking Seq 1 primer1 Seq 2 primer2 Time consuming

35 Yeni Dizileme Metotları 1. MALDI-TOF Mass Spektrometri ile Dizileme 2. Hibridizasyon ile Dizileme 3. Pirodizileme 4. Atomic-Force Mikroskopisi 5. Tek Molekül Fluoresans Mikroskopisi 6. Nanopor Dizileme

36 MALDI-TOF Mass Spektrometrisi Kullanılarak Dizileme MW spectrum of 33-mer 5 -ACT AAT GGC AGT TCA TTG CAT GAA TTT TAA AAG-3

37 Hibridizasyon ile DNA Dizilemesi Bu strateji, bilinmeyen etiketli DNA parçasının tüm kısa oligonükleotidlere bağlanmasını (ör: 8-merlik 65,336 kombinasyon ) ve bilinmeyen dizinin bağlanma kalıbından görüntülenmesini İçerir.

38 Pirodizilemenin Temeli Basamak 1 Bir dizileme primeri tek zincirli, PCR ile çoğaltılmış, DNA kalıbına, hibridize edilir ve DNA polimeraz, ATP sulfurilaz, lusiferaz ve apiraz, enzimleri, adenozin 5 fosfosülfat (APS) ve lusiferin substratları ile inkübasyona bırakılır. Basamak 2 İlk önce dört adet deoksinükleotidtrifosfat (dntp) reaksiyona ilave edilir. DNA polimeraz deoksinükleotid trifosfatların, DNA zincire katılmalarını kataliz eder. Yapıya katılan dntp ile orantılı olarak PPi (pirofosfat) açığa çıkmaktadır.

39 Basamak 3 ATP sülfürilaz, adenozin 5 fosfosülfat varlığında kantitatif olarak PPi yi ATP ye dönüştürür. Bu ATP molekülü, lusiferaz temelli reaksiyon lusiferinin oksilusiferine dönüşümünü sağlarken, ATP miktarı ile orantılı olarak görünür ışık oluşumu gerçekleşir. Lusiferaz katalizli reaksiyon sonucunda üretilen ışık CCD kamera (charge coupled device) ile belirlenir bir pirogramda pikler halinde görüntülenebilir. Her bir ışık sinyali yapıya katılan nükleotid sayısı ile orantılıdır.

40 Basamak 4 Bir nükleotid parçalayıcı enzim apiraz, sürekli olarak; yapıya girmeyen dntpleri ve fazla ATP yi parçalar. Parçalama bittiğinde, diğer dntp eklenir. Basamak 5 Her bir işlem için dntplerin eklenmesi bir kez gerçekleştirilir. Doğal deoksiadenozin trifosfat (datp) DNA polimeraz tarafından etkin bir şekilde kullanılmasına rağmen, lusiferaz tarafından tanınmadığından deoksiadenozin alfa-tiyo trifosfat (datpas) kullanılmaktadır. Süreç devam ederken, kalıp DNA zinciri yapılır ve nükleotid dizisi pirogramdaki piklerin oluşturduğu sinyaller ile belirlenir.

41 Pirodizilemenin Özeti Pirodizileme, DNA nın enzimatik DNA sentezi ile dizilenmesidir, DNA dizisi sentezi sırasında açığa çıkan fotonların oluşturduğu sinyallerin şiddetine göre belirlenir.

42 Zipper-sequencing of DNA

43 Polinükleotidlerin Nanopor Dizilemesi Bu yöntemde, tek zincirli polinükleotidlerin ince bir filmdeki nanopor boyunca ilerlemelerini sağlayan elektrik alan sonucu oluşan iyonik akım değişimi görüntülenmektedir.

44 DNA nın bir yön değiştiren alanda dizilemesi DNA E 2nm E E cos( wt)ˆ i E sin( wt) ˆj

45 DNA nın Zaman ile Translokasyonu

46 Bir Dizileme Düzeneği

47 Sonuçlar - Geleneksel Sanger metodu yavaş, pahalı, ve kesin değildir. İnsan Genom Projesindeki dizileme 15 yıl almış ve 3 trilyon US dolarına mal olmuştur. - Nanopor dizileme daha hızlı, pahalı olmayan, kesin bir yöntemdir. 100 milyon bazın dizilemesi yaklaşık bir gün almaktadır, yüksek oranda kesinlik, örnek serilerinin çok zamanlı incelenmeleri sonucunda sağlanmaktadır.

MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ

MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ DNA dizi analizleri ya da sekanslama; DNA birincil (temel) yapılarının belirlenmesinde kullanılan yöntemlerdir, DNA nın nukleotid dizilerinin saptanması anlamına gelir.

Detaylı

DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY

DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY DNA Sekanslama ve Filogenetik Analizler Dr. Eda UĞURTAY DNA baz dizilimlerinin belirlenmesidir. İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. Kullanım

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara 24-25 Şubat 2011, İzmir Sunum Planı Teorik

Detaylı

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.

Detaylı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil

Detaylı

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler

Detaylı

İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır.

İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine hibridizasyonuna dayanır.

Detaylı

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7

Detaylı

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ Nükleik asitler Sıcaklıkla öldürülmüş S suşları Canlı R suşlarını canlı S suşuna dönüştürür a) Farelere virulan S suşu enjekte edildiğinde ölür b) R suşu enjekte edildiğinde yaşar c) Isıyla öldürülmüş

Detaylı

DNA ARAÇLARI ve BİYOTEKNOLOJİ

DNA ARAÇLARI ve BİYOTEKNOLOJİ DNA ARAÇLARI ve BİYOTEKNOLOJİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER DNA Düzenlenmesi İnsan DNA sı ile yapılan ilk çalışmalar için yani çalışma yöntemi geliştirilmesi için yaklaşık 1 milyon dolar

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi SEKANS TEKNİKLERİ DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un

Detaylı

MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL

MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL MİKROBİYOLOJİDE BİYOTEKNOLOJİ Doç. Dr. Funda BAĞCIGİL Biyoteknoloji; Genetik materyallerde moleküler düzeyde yapılan manipulasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde etmektir

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

MİKROBİYAL GENOTİPLENDİRMEDE YENİ TEKNOLOJİLER

MİKROBİYAL GENOTİPLENDİRMEDE YENİ TEKNOLOJİLER MİKROBİYAL GENOTİPLENDİRMEDE YENİ TEKNOLOJİLER Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. DNA dizi analizi esaslı yöntemler Tek lokus dizi

Detaylı

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara Taksonomik terimler Alem (Kingdom) Bölüm veya şube (divisio, filum)

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

Genetik materyal: DNA replikasyonu

Genetik materyal: DNA replikasyonu Genetik materyal: DNA replikasyonu Umut Fahrioglu, PhD MSc DNA Replikasyonu DNA replikasyonu genomların ve içerdikleri genlerin nesilden nesile aktarılmasında çok önemli bir rol oynar. Hücreden hücreye

Detaylı

III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.

Detaylı

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D 1. DNA replikasyonu.. için gereklidir A) sadece mitoz B) sadece mayoz C) mitoz ve mayoz D) sadece gamet oluşumu E) sadece protein sentezi 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Moleküler Dizileme Teknolojileri

Moleküler Dizileme Teknolojileri Moleküler Dizileme Teknolojileri Dr. Güven Toksoy, PhD İstanbul Üniversitesi İstanbul Tıp Fakültesi Tıbbi Genetik AD 31.10.2014 22:44 1 Klasik dizileme Sanger dizileme Maxim Gilbert dizileme tekniği Yeni

Detaylı

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir.

Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. METABOLİZMA ve ENZİMLER METABOLİZMA Hücrelerde gerçekleşen yapım, yıkım ve dönüşüm olaylarının bütününe metabolizma denir. A. ÖZÜMLEME (ANABOLİZMA) Metabolizmanın yapım reaksiyonlarıdır. Bu tür olaylara

Detaylı

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006 SEKANS TEKNİKLERİ GENOMİK-PROTEOMİK Ders Sorumlusu: Doç.Dr. Hatice MERGEN Hazırlayan: Levent ZORBEK Ankara,2006 DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem;

Detaylı

Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2

Detaylı

ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ

ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ Genetik mühendisliği gelişmeden önce insanlar yapay seçilim yoluyla istenen özelliklerin yavru canlılarda görülmesini sağlamışlardır. Örneğin seçici üretim

Detaylı

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 12 Prokaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade

Detaylı

DİZİ ANALİZİ (SEKANS) TEKNİKLERİ

DİZİ ANALİZİ (SEKANS) TEKNİKLERİ DİZİ AALİZİ (SEKAS) TEKİKLERİ DA dizi analizi, gen yapısı ve genetik kontrol mekanizmaları hakkında bir çok bilgi edinmemizi sağlamıştır. erhangi bir organizmadan çok miktarda saf DA elde edilmesini sağlayan

Detaylı

Prof. Dr. Turgut Ulutin

Prof. Dr. Turgut Ulutin TIBBİ BİYOLOJİ YE GİRİŞİŞ Prof. Dr. Turgut Ulutin HÜCRE BİLİMİB Hücre, yaşam için gerekli tüm biyolojik olayların yapıldığı canlının en küçük birimidir. Buna en iyi örnek, tek bir hücre olarak yaşamını

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:

Detaylı

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN Bünyamin ATMIŞ DANIŞMAN Yrd. Doç. Dr. Dilek TURGUT BALIK 1. PARMAKİZİ 2. DNA PARMAKİZİ 3.

Detaylı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 16S rrna Analizi Doç. Dr. Zeynep Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum içeriği Genel bilgi Uygulanışı Kullanım alanları Avantajları Dezavantajları Neden

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection)

SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) Geleneksel olarak bireylerin kendisini, atalarını ve varsa döllerinin bilgilerini içeren kriterlere göre seleksiyon yapılmaktadır. Elde edilen

Detaylı

NÜKLEİK ASİTLERİN ELEKTROFOREZİ

NÜKLEİK ASİTLERİN ELEKTROFOREZİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ NÜKLEİK ASİTLERİN ELEKTROFOREZİ Yüksek Lisans Semineri Hazırlayan: Venhar ÇELİK Danışman: Yrd.Doç.Dr. Dilek Turgut-BALIK NÜKLEİK ASİTLERİN

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

REKOMBİNANT DNA TELNOLOJİSİNİN TEMEL PRENSİPLERİ

REKOMBİNANT DNA TELNOLOJİSİNİN TEMEL PRENSİPLERİ REKOMBİNANT DNA TELNOLOJİSİNİN TEMEL PRENSİPLERİ Klonlama Birçok moleküler genetik tekniğinin kalbi gendir. Gen, genetik manipülasyonlarda kullanılmadan önce izole edilmeli ve iyi karakterize edilmelidir.

Detaylı

RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050

Detaylı

DNA Dizi Analiz Yöntemleri

DNA Dizi Analiz Yöntemleri DNA Dizi Analiz Yöntemleri DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

Ökaryotik Kromozomlar

Ökaryotik Kromozomlar Telomer Ökaryotik Kromozomlar Mitoz metafazında kromozomlar mikroskop altında görülebilir Kromozomların uçlarında telomer denilen yapılar vardır, bu yapıların görevi kromozomu korumaktır Ortaya yakın bir

Detaylı

HIZLI YÖNTEMLER (III)

HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ Yrd. Doç. Dr. Hakan GÜRKAN Trakya Üniversitesi Tıp Fakültesi Tıbbi Genetik Anabilim Dalı PGT NEDİR? Gebelik öncesi genetik tanı (PGT) adı verilen

Detaylı

ayxmaz/biyoloji Enzimler

ayxmaz/biyoloji Enzimler Enzimler 1. Bir enzim substrat ile karıştırılır. 1 dakika süren karıştırılmada,10 de saniyelik aralıklarla oluşan ürün miktarı belirlenir. Bu denemeden elde edilen veriler aşağıda gösterilmiştir: Zaman

Detaylı

Farmakogenetikte Kullanılan Temel Yöntemler

Farmakogenetikte Kullanılan Temel Yöntemler Farmakogenetikte Kullanılan Temel Yöntemler Dr. Melih Ö. Babaoğlu Hacettepe Üniversitesi Tıp Fakültesi Farmakoloji A.D. XIII. TFD Eğitim Sempozyumu Van 1 Hastalık derecesi Fizyolojik durum İlaç etkileşmeleri

Detaylı

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8)

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8) KONU-7. MOLEKÜLER BĠYOLOJĠDE TEMEL TEKNĠKLER BĠTKĠDEN GENOMĠK DNA ĠZOLASYONU Kullanılan Tamponlar: 1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol,

Detaylı

Yağ Asitlerinin β Oksidayonu. Prof. Dr. Fidancı

Yağ Asitlerinin β Oksidayonu. Prof. Dr. Fidancı Yağ Asitlerinin β Oksidayonu Prof. Dr. Fidancı Yağ Asitlerinin Beta Oksidasyonu Yağ asitlerinin enerji üretimi amacı ile yıkımında (yükseltgenme) en önemli yol β oksidasyon yoldudur. β oksidasyon yolu

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION

Detaylı

PROTEİN ANALİZ YÖNTEMLERİ

PROTEİN ANALİZ YÖNTEMLERİ PROTEİN ANALİZ YÖNTEMLERİ Protein analizleri, fen bilimleri araştırmaları ve farmosötik endüstrisinde önemli bir araç olarak karşımıza çıkar. Protein Analizinin Amaçları: Hastalıkların Kesin Tanısının

Detaylı

GENETİK LABORATUVARI

GENETİK LABORATUVARI GENETİK LABORATUVARI Laboratuvar sorumluları: Prof. Dr. Mehmet TOPAKTAŞ Prof. Dr. Hasan Basri İLA Temel Araştırma Alanımız: Genetik, Sitogenetik, Genotoksikoloji Genetik laboratuvarında günlük hayatta

Detaylı

İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya.

İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. Bakterilerin tanımlanması Bakterilerin tanımlanması Bakterilerin

Detaylı

TRANSLASYON VE TRANKRİPSİYON

TRANSLASYON VE TRANKRİPSİYON TRANSLASYON VE TRANKRİPSİYON GEN İFADESİ (GEN EKSPRESYONU) Gen ifadesinin düzenlenmesi çeşitli aşamalarda olur: 1) Primer transkriptlerin oluşumu 2) Primer mrna dan matür (olgun) mrna oluşumu 3) mrna nın

Detaylı

ORGANİK KİMYADA STEREOKİMYA KONUSUNUN PROGRAMLI ÖĞRETİMİ

ORGANİK KİMYADA STEREOKİMYA KONUSUNUN PROGRAMLI ÖĞRETİMİ ORGANİK KİMYADA STEREOKİMYA KONUSUNUN PROGRAMLI ÖĞRETİMİ N. İzzet KURBANOĞLU 1, Yavuz TAŞKESENLİGİL 2 1 Atatürk Üniversitesi, Ağrı Eğitim Fakültesi, İlköğretim Bölümü, AĞRI 2 Atatürk Üniversitesi, K.K.

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden

Detaylı

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT gulden.haspolat@gthb.gov.tr

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

IDC Savunma Sanayii. Antikor tabanlı tanımlama sistemleri birçok üstün özellikler sahiptir. Yüksek hassasiyette ve kısa sürede hızlı sonuç üretme.

IDC Savunma Sanayii. Antikor tabanlı tanımlama sistemleri birçok üstün özellikler sahiptir. Yüksek hassasiyette ve kısa sürede hızlı sonuç üretme. IDC Savunma Sanayii Biyolojik Tabanlı Tanımlama Sistemleri Antikor tabanlı tanımlama sistemleri, biyolojik madde ve mikroorganizmaların tespitinde sayısal ve ayırt edici sonuçlar ile ortamda bulunan biyolojik

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

Servisler. Real-Time PCR Kitleri Reverse-Line Blot Kitleri

Servisler. Real-Time PCR Kitleri Reverse-Line Blot Kitleri Kasım 2007 İontek Tarihçesi Ara. 1996 - Kuruluş May. 1997 - Türkiye de ilk oligonükleotid sentezi Şub. 1999 - DNA dizileme ve kapiler elektroforez ile STR analizi hizmeti Şub. 2002 - Araştırma amaçlı Real-time

Detaylı

REKOMBİNANT DNA TEKNOLOJİSİ

REKOMBİNANT DNA TEKNOLOJİSİ REKOMBİNANT DNA TEKNOLOJİSİ Rekombinant-DNA teknolojisinin gelişimindeki önemli atlama taşları: 1860-1865 Gregor Mendel Bezelye çaprazlamaları ile döllere gen geçişini ilk kez ortaya çıkardı 1953 Watson

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

Uygulama 6. Transkripsiyon yönü. Ekzonlar (kodlama bölgeleri) Transkripsiyon. Sonlandırıcı kodon başlangıcı

Uygulama 6. Transkripsiyon yönü. Ekzonlar (kodlama bölgeleri) Transkripsiyon. Sonlandırıcı kodon başlangıcı Uygulama 6 DNA Dizilerinde Bazı Đstatistiksel Analizler DNA molekülleri nükleotidlerin uzun birer dizileridir. Dizilenmiş bir DNA molekülüne A,C,G,T harflerinin oluşturduğu bir kelimelik uzun bir yazı

Detaylı

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β

Detaylı

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Replikasyon genetik materyelin tamamen kendi benzeri yeni bir molekül oluşturma işlemidir. DNA kendini eşleyebilen yegane biyomoleküldür

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

Nitrik Oksit Sentaz ve Nitrik Oksit Ölçüm Yöntemleri

Nitrik Oksit Sentaz ve Nitrik Oksit Ölçüm Yöntemleri Nitrik Oksit Sentaz ve Nitrik Oksit Ölçüm Yöntemleri Nitrik Oksit Sentaz ve Nitrik Oksit Ölçüm Yöntemlerine Giriş Doç. Dr. Bahar Tunçtan ME.Ü. Eczacılık Fakültesi Farmakoloji Ab.D. ME.Ü. Tıp Fakültesi

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA ET ÜRÜNLERİNDE TAĞŞİŞ Tağşiş; gıda maddesinin mevzuata veya izin verilen özelliklerine aykırı olarak üretilmesi hali olarak tanımlanmaktadır. Gıda ürünlerinde; tağşiş bir çok şekilde yapılabilmektedir.

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN: Dilek SADAK DANIŞMAN : Yrd. Doç. Dr. Dilek TURGUT-BALIK

Detaylı

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM

1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1 DNA (Deosiribo Nükleik Asit) Kalıtım maddesi hücre çekirdeğinde bulunur. Kalıtım maddesi iğ ipliği (Yumak) şeklinde bir görünümdedir. İğ ipliğindeki kalıtım maddesi

Detaylı

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi KRAS Mutasyon Tespit Kiti Teknik Şartnamesi 1. KRAS testi ile insan KRAS geninin kodon 12, kodon 13 ve kodon 61 deki mutasyonlarının kantitatif ölçümü 2. Yöntem dizi analizine dayalı pyrosequencing metodu

Detaylı

FARMAKOGENETİ K/GENOMİ KARAŞ TIRMALAR VE TIPTA UYGULAMALARI

FARMAKOGENETİ K/GENOMİ KARAŞ TIRMALAR VE TIPTA UYGULAMALARI FARMAKOGENETİ K/GENOMİ KARAŞ TIRMALAR VE TIPTA UYGULAMALARI Prof. Dr. A. Şükrü AYNACIOĞLU Gaziantep Üniversitesi Tıp Fakültesi Farmakoloji Anabilim Dalı, 27310 Gaziantep. Tel: (342) 3600753 E-mail: aynacioglu@gantep.edu.tr

Detaylı

2. Kanun- Enerji dönüşümü sırasında bir miktar kullanılabilir kullanılamayan enerji ısı olarak kaybolur.

2. Kanun- Enerji dönüşümü sırasında bir miktar kullanılabilir kullanılamayan enerji ısı olarak kaybolur. Enerji Dönüşümleri Enerji Enerji; bir maddeyi taşıma veya değiştirme kapasitesi anlamına gelir. Enerji : Enerji bir formdan diğerine dönüştürülebilir. Kimyasal enerji ;moleküllerinin kimyasal bağlarının

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

www.demiraylisesi.com

www.demiraylisesi.com YÖNETİCİ MOLEKÜLLER C, H, O, N, P atomlarından meydana gelir. Hücrenin en büyük yapılı molekülüdür. Yönetici moleküller hücreye ait genetik bilgiyi taşır, hayatsal faaliyetleri yönetir, genetik bilginin

Detaylı