Yrd.Doç.Dr. Yosun MATER

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Yrd.Doç.Dr. Yosun MATER"

Transkript

1 * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER

2 *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak ve büyük ölçüde hayvanlar ile yapılan karşılaştırmalı gen ve protein çalışmaları ile elde edilmiştir. *Son zamanlarda moleküler biyoloji yöntemleri bitkilerin evriminin çalışılmasında da kullanılmaya başlanmıştır. *Bu veriler ışığında bitkiler ve hayvanlar aleminin yaklaşık 1 milyar yıl önce ayrıldığı tahmin edilmektedir. *Bitkilerin evrim desenleri hayvanlardan çok farklıdır. Yrd.Doç.Dr. Yosun MATER

3 *Gerçekten de, bitkilerde yer alan organel organizasyonunda hayvanlardan farklıdır. *Çok daha büyük ve yapısal olarak daha değişken mitokondrilere ek olarak, nüklear genom, mitokondriyal genomdan farklı bir üçüncü bağımsız genom setine, kloroplast genom setine sahiptirler (Palmer 1985). *Bitki mitokondriyal genom yapısı, hayvan mitokondriyal genom yapısından oldukça farklıdır. *Burada yer alan genom, devamlı farklılaşan farklı bölgelerin eklenip silindiği bir yapıdadır (Palmer 1985). *Onun içinde boyu bp den 2,500,000 bp e kadar olabilir. Yrd.Doç.Dr. Yosun MATER

4 *Linear-doğrusal veya dairesel yapıda olabilir. *Alt genomik daireler (Subgenomic circles) yardımıyla genetik bilgi birbirinden ayrılabilir. *Türlere göre değişken özellikler gösterir (Tablo 4.15). *Kızılyaprak Marchantia polymorpha ait mitokondriyal genom bp uzunluğunda ve 30 protein tanımlayan - kodlayan geni (16 ribosomal protein, 7 tane NADH - ubiqinon oksiredüktaz alt birimi, 3 tane sitokrom c oksidaz alt birimi, 3 tane H + - ATP - sentaz altbirimi ve 1 tane sitokrom b alt birimi içerir), 3 rrna - belirleyici geni ve 29 trna -belirleyici geni ( 27 trna türü için) içerir. *Genom, ayrıca çeşitli pseudogenleri, yani yaklaşık 40 tanımlanamayan, okuma çerçevesi içeren (bazıları protein - kodlayan genler olabilir) bölgeyi içermektedir. *Ayrıca tip I ve tip II olmak üzere iki intron tespit edilmiştir (Oda ve ark. 1992).

5 Yrd.Doç.Dr. Yosun MATER

6 *Bazı yapısal genler, bitki mitokondriyal genomunda birden fazla kopya halinde görülebilir. *Ancak, bugüne kadar mevcut verilere göre, genom boyutunda görülen büyük değişkenliğe rağmen genlerde tesbit edilen değişimlerin sayısı ve çeşidi, oldukça sınırlı görülmektedir. *Örneğin, mitokondriyal genom uzunluğu, bir yeşil alg (Chlorophyte alg) olan Prothoteca wickerhammi de sadece 55,328 bp uzunluktadır. *Örneğin; bu büyüklük Marchantia mitokondriyal genom büyüklüğünün yaklaşık % 30 na karşılık gelir. *Esas olarak genler dizileri benzese de sayıları farklıdır (Wolfe ve ark. 1994). Yrd.Doç.Dr. Yosun MATER

7 *Bugüne kadar belirlenmiş en büyük mitokondriyal genomu; Arabidopsis thaliana aittir. *Uzunluğu 366,923 bp dan oluşur (Unseld et al. 1997). *Belirlenen ve tanımlanmayan protein kodlayan genlerin uzunluğu bu genomun yaklaşık %20 sini oluşturmaktadır. *Genomun kalan kısmını da ise intronlar, duplikasyonlar ve retrotransposonlar yaklaşık %20 lik bir yer alır. *Aynı zamanda içine entegre olmuş plazmit dizilerinin kalıntıları bir diğer %20 yi oluşturur. *Bu nedenle, Arabidopsis thaliana'nın mitokondriyal genomunun %60 hesaba katılmaz.

8 *Damarlı bitkilerde kloroplast genomu daireseldir ve boyutu çeşitlilik gösterir. *Bazı bitkilerde yaklaşık 70,000 bp iken, bazı fotosentetik olmayan bitkilerde boyu yaklaşık 220,000 bp olabilir. * Onun için ortalama, yaklaşık bp olarak kabul edilir (Palmer 1985). *Bitki mitokondriyal genomu boyutuna göre oldukça az çeşitlilik gösteren bir yapı sergiler. *En çok protein kodlayan genlerde, trna belirleyici genlerde, pseudogenlerde ve intronlarda varyasyonlar görülür (Tablo 4.15).

9 *Geçmişte yapılan birkaç gen sekanslama ve enzim kesim denemeleri ile yapılan haritalama çalışmaları; kloroplast genlerinin, nükleotid oranlarının, memeli nüklear genlerinin nükleotit oranlarından daha düşük olduğunu düşündürmektedir (Curtis ve Clegg 1984, Palmer 1985; Zurawski ve Clegg 1987). *Elbette bitki mitokondriyal DNA larında bu sık sık görülen yeniden düzenlemeler, nükleotid dizisi belirleme çalışmalarını yavaşlatmaktadır. Yrd.Doç.Dr. Yosun MATER

10 VİRÜSLERDE GÖRÜLEN DEĞİŞİMLER RNA Virüslerinde Görülen Değişimler *RNA virüsleri, DNA genomlu organizmalara göre son derece yüksek oranda değişimler geçirirler (Holland ve ark. 1982). *Bu değişim oranı ökaryotlara göre, yaklaşık 1 milyon kez daha hızlı olabilir. *Bunun sebebi viral RNA ların nükleotid sekanslarının değişimleri, kısa zaman periyotlarında olması ile ilişkilidir. *Viral genom arasında oluşan bu farklılıkla,r nispeten kısa zaman aralıkları ile izole edilen suşların incelenmesi ile kolaylıkla saptanabilir. *Bu özellik evrimsel oranlarını tahmin etmek daha farklı bir yaklaşım sağlar.

11 Tahmin Modelleri *RNA virüslerinde görülen değişim hızını tahmin etmek için literatürlerde çeşitli yöntemler önerilmiştir (Buonagurio ve ark. 1986, Saitou ve Nei 1986; Li ve ark. 1988). *Bütün modellerde; mutasyona bağlı değişimlerin büyük çoğunluğunun, virüsün izolasyonundan önce olduğu, ancak virüsün izolasyonundan sonra ortaya çıktığı kabul edilmektedir. *Bu değişikliklerin tespit edilmesinde en çok tercih edilen yöntemlerden biri Li ve arkadaşlarının tarif ettiği modeldir (Li ve ark.1988). Yrd.Doç.Dr. Yosun MATER

12 *İnsan Bağışıklık Sistemi Bozucu Virüsleri (Human Deficiency Viruses=HIV) *Edinilmiş bağışıklık eksikliği sendromu (AIDS), insan bağışıklık sistemi bozucu virüsler (HIV) adı verilen, retrovirüs kaynaklı bir hastalıktır. *HIV in HIV - 1 ve HIV-2 olmak üzere iki ana tipi bilinmektedir. *İlginç olan, HIV genomunda oluşan değişimlerin, virüsün patojenitesini ve antijenitesini büyük olasılıkla doğrudan etkilemesidir (Rabson ve Martin 1985 ; Gallo 1987). *Bir grup yazar (örneğin, Hahn ve ark. 1986; Yokoyama ve Gojobori 1987) HIV -1 de yer alan nükleotit değişiklik oranlarını incelemişlerdir. *Bu çalışmaların sonuçları; Li ve arkadaşları (1988) tarafından aşağıdaki gibi verilmiştir.

13 *Buna göre; HIV- 1 virüsünün üç suşu WMJ1, WMJ2 ve WMJ3, 3 Ekim 1984, 15 Ocak 1985 ve 3 Mayıs 1985 tarihinde iki yaşındaki bir çocuktan izole edilmiştir. *Çocuğun enfeksiyonun sadece tek bir HIV şusu (annesi tarafından hamilelik sırasında) aldığı düşünülmektedir. *WMJ1 ve WMJ2 dizileri, sırasıyla 1 ve 2 nin zamana bağlı değişim oranı t = 3.4 ayda (0.28 yılda) oluşmuştur. *Dış grup olarak bir dizi izolat kullanılmıştır. *Değişim oranı Li ve arkadaşlarının (1988) metodu kullanarak hesaplanmıştır. *WMJ suşlarında nükleotid değişim hızları; WMJ1 için ve WMJ2 için olarak belirlenmiştir.

14 *Tablo 4.17 de benzer olan-sinonim (Ks) ve sinonim olmayannonsinonim (K A ) gen oranları HIV -1 için farklı genlerde görülen değişiklikler hesaplanmıştır. *Sinonim genlerde, sinonim olmayan-nonsinonim genlerden daha fazla oranda benzerlik bulunmuştur. *Memeli nüklear genlerinde ortalama K A / Ks oranı yaklaşık 5 ve bazı yüksek korunmuş sıralarda bu oran 100 ü aşar (Tablo 4.1). *Bunun anlamı HIV in K A / Ks oranı ortalama 2'den azdır. *Hatta bu oran korunmuş iki gen gag ve pol için oranı 7 den daha azdır. *Böylece, HIV genlerinin saflığının çok zayıf olduğunu anlıyoruz.

15 *HIV genomunda benzer ve benzer olmayan gen oranlarının mutasyona uğrama oranı hesabı ile bunların memeli genlerinden 106 kat daha fazla değiştiği-mutasyona uğradığı belirlenmiştir. *Diğer RNA virüsleri için elde edilen sonuçlarda benzer oranda bulunmuştur (Holland ve ark. 1982, Gojobori ve Yokoyama 1985, Hayashida ve ark. 1985; Buonagurio ve ark. 1986; Saitou ve Nei 1986). *HIV de belirlenen bu yüksek değişme oranlarının RNA virüslerinde yer alan reverse-transkriptaz ile bağlantılı olduğu düşünülmüştür. Yrd.Doç.Dr. Yosun MATER

16 *Bu enzimin görevi RNA dan DNA sentezlenmesini sağlamaktır (Rabson ve Martin 1985, Hahn ve ark. 1986; Coffin 1986). *Bu sırada açığa çıkan RNA'dan ters transkripsiyon hatalarının sayısının fazlılığının esas olarak buna bağlı olduğu düşünülmüştür/önerilmiştir. *Birçok yazar tarafından işaret edildiği gibi yüksek değişim oranları doku tropizmi ve duyarlılığı gibi viral özelliklerin hızla değişimi ve antiviral ilaç tedavisi değişikliğe neden olabilecek diğer etkenler arasında yer alır. * Bu tür özellikler, çok sayıda farklı dizi içeren, kılıf genlerinin (env) aşırı değişimine, dolayısıyla virüsün son derece hızlı yeni antijenik özellikler kazanmasına yardımcı ve destek olabilir.

17 Yrd.Doç.Dr. Yosun MATER

18 Yrd.Doç.Dr. Yosun MATER

19 *KULLANILAN KAYNAKLAR * 1 Fundamentals of Molecular Evolution (2000) Dan Graur and Wen-Hsiung Li Sinauer Associates, Inc.,Publishers. Sunderland, MA, USA. Yrd.Doç.Dr. Yosun MATER

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Evrimsel açıdan genlerin çoğaltılmasının önemi ilk defa Haldane (1932) ve Muller (1935 ) tarafından önerildi ve tanımlandı. *Evrimsel açıdan bir genin

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN MİTOKONDRİ Doç.. Dr. Mehmet GÜVENG Hemen hemen bütün b ökaryotik hücrelerde ve ökaryotik mikroorganizmalarda bulunur. Eritrositlerde, bakterilerde ve yeşil alglerde mitokondri yoktur. Şekilleri (küremsi

Detaylı

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA (Ribonükleik Asit) Nükleik asitler, Friedrich Miescher tara2ndan 1869'da keşfedildi. İl=haplı bandajlardan izole edilen bu maddeye nüklein adını

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Domain Çoğalması ve Gen Uzaması *Ökaryotlarda modern genler üzerine yapılan bir araştırma gösteriyor ki, içsel duplikasyonlar evrim boyunca sık sık meydana

Detaylı

Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER

Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Virüslere Giriş Virüsler genellikle ökaryotlardan ve prokaryotlardan çok daha küçük moleküllerdir. Genellikle enfeksiyon yeteneği olan

Detaylı

ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER

ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER Virüsler Hücresel yapı da dahil olmak üzere canlıların ortak özelliklerini göstermeyen canlılardır. Prokaryotlardan daha küçüklerdir.

Detaylı

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler

Detaylı

Gen Organizasyonu ve Genomların Evrimi

Gen Organizasyonu ve Genomların Evrimi GENETĐK 111-503 Gen Organizasyonu ve Genomların Evrimi Doç. Dr. Hilâl Özdağ 1 RNA nın Kendi Kendini Kopyalayabiliyor Olmalıydı Đlkin zamanlardaki RNA dünyasında RNA moleküllerinin kopyalanması. RNA polimerazlar

Detaylı

KOMPERATİF GENOMİK Principles of Genome Analysis and Genomics S.B. Primrose and R.M. Twyman Bölüm 7 s. 113-132 Amacı; farklı organizmaların genom yapısındaki farklılık ve benzerliklerin ortaya çıkarılmasıdır.

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

03.05.2012. Acquired Immune Deficiency Syndrome(Edinilmiş bağışıklık eksikliği sendromu) AIDS(EBES)

03.05.2012. Acquired Immune Deficiency Syndrome(Edinilmiş bağışıklık eksikliği sendromu) AIDS(EBES) AIDS in tanımı,ne olduğu,ilk çıkışı ve genel bilgiler AIDS in evrimi ve modifikasyonu HIV ve insan bağışıklık sistemi DNA sarmalı üzerine modifikasyonun y etkisi Motoo Kimura Modifikasyon hesaplamalarına

Detaylı

DNA Tamiri ve Rekombinasyonu

DNA Tamiri ve Rekombinasyonu DNA Tamiri ve Rekombinasyonu Bitkilerdeki 3 genom UV ve radyosyonun diğer formları, kimyasallar, ve diğer streslerle (örneğin oksidatif, ısı vb.) devamlı hasar görür. Bazı proteinler onarımda ve rekombinasyonda

Detaylı

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz İnsan Mikrobiyom Projesi Prof. Dr. Tanıl Kocagöz Human Microbiome Project İnsan Mikrobiyom Projesi (İMP) 2007 yılında NIH tarafından başlatıldı 300 gönüllünün 5 vücut bölgesinden değişik zamanlarda, toplam

Detaylı

12. SINIF KONU ANLATIMI 2 DNA VE RNA

12. SINIF KONU ANLATIMI 2 DNA VE RNA 12. SINIF KONU ANLATIMI 2 DNA VE RNA DNA (DEOKSİRİBONÜKLEİK ASİT) Temel nükleik asittir. Prokaryot hücrelerin sitoplazmasında, ökaryot hücrelerde çekirdek, mitokondri ve kloroplast organelinde bulunur.

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE YAZILIYA HAZIRLIK SORULARI 12. Sınıf 1 GENDEN PROTEİNE Protein sentezini tüm canlılar gerçekleştirir. Bir mrna molekülünde en fazla 64 çeşit kodon bulunur. DOĞRU YANLIŞ SORULARI Canlıların heterotrof beslenenleri

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin.

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin. GENOMUN YAPISI Gen ve un tanımı Büyüklükleri Dizi Tipleri Doç. Dr. Metin Aytekin www.metinaytekin.com Erciyes Üniversitesi Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı 11 Kasım 2014 Nedir? Bir organizmanın

Detaylı

cdna Kitaplık Hazırlanışı

cdna Kitaplık Hazırlanışı cdna Kitaplık Hazırlanışı Uzm.Bio.Veysel Sabri HANÇER İstanbul Üniversitesi Moleküler Biyoloji ve Genetik Doktora Programı 2602043040 Genetik Bilginin İki Kaynağı Vardır; Genomik DNA mrna Ökaryotlardaki

Detaylı

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik hücreler, transkripsiyondan sonra RNA yı değişikliğe uğratırlar

Detaylı

VEKTÖRLER Halime Nebioğlu

VEKTÖRLER Halime Nebioğlu VEKTÖRLER Halime Nebioğlu İstanbul Üniversitesi Gen klonlamasında kullanılan aracı moleküllere vektör denir. Vektörler konakçı organizmada, konakçı organizmadan bağımsız olarak replikasyon (çoğalma) gösterirler.

Detaylı

LYS ANAHTAR SORULAR #4. Nükleik Asitler ve Protein Sentezi

LYS ANAHTAR SORULAR #4. Nükleik Asitler ve Protein Sentezi LYS ANAHTAR SORULAR #4 Nükleik Asitler ve Protein Sentezi 1) İncelenen bir nükleotidin DNA ya mı yoksa RNA ya mı ait olduğu; I. Bağ çeşidi II. Pürin bazı çeşidi III. Pirimidin bazı çeşidi IV. Şeker çeşidi

Detaylı

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI Moleküler biyolojiye giriş Doç.Dr.Pınar AKSOY SAĞIRLI Molecular biology terimi ilk kez Warren Weaver tarafından 1938 de kullanıldı. Hayatın fiziksel ve kimyasal olarak açıklanması olarak tanımlandı. 1977

Detaylı

VİROLOJİ VİRUS GENETİĞİ

VİROLOJİ VİRUS GENETİĞİ VİROLOJİ VİRUS GENETİĞİ Giriş İnsan vüruslarının üretilmesi ve incelenmesi doğal konağında zor, hatta imkansızdır. Bu nedenle viruslerin daha ekonomik ve pratik olan laboratuvar hayvanlarında yada hücre

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 SANTRAL DOGMA Hücredeki bilgi aktarım mekanizmasının tamamına SANTRAL DOGMA denir. Santral dogma tek yönlü bilgi aktarımıdır. Geri dönüşümü

Detaylı

Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki

Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki başarılı girişimlerini belgeler. İstenen ve istenmeyen

Detaylı

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri mrna trna - rrna Taşıyıcı (transfer) RNA (trna) Nispeten küçük moleküllerdir. Bir öncu molekülün nükleusta işlenmesiyle oluşurlar. trna molekülleri, mrna

Detaylı

BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER

BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER www.benimdershanem.esy.es Bilgi paylaştıkça çoğalır. BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER NÜKLEİK ASİTLER Nükleik asitler, bütün canlı hücrelerde ve virüslerde bulunan, nükleotid birimlerden

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ 1 Genetik mühendisliği canlıların kalıtsal özelliklerinin değiştirilerek onlara yeni işlevler kazandırılmasına yönelik araştırmalar yapan bilim dalıdır. Genetik mühendisleri

Detaylı

CANLILARIN ORTAK ÖZELLİKLERİ

CANLILARIN ORTAK ÖZELLİKLERİ 1 CANLILARIN ORTAK ÖZELLİKLERİ 1.Hücresel yapıdan oluşur 2.Beslenir 3.Solunum yapar 4.Boşaltım yapar 5.Canlılar hareket eder 6.Çevresel uyarılara tepki gösterir 7.Büyür ve gelişir (Organizasyon) 8.Üreme

Detaylı

GENETİK ŞİFRE. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK ŞİFRE. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK ŞİFRE Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genetik Bilgi Akışı Genetik kodun özellikleri 1. Genetik şifre, harfler halinde gösterilen mrna moleküllerini oluşturan ribonükleotid bazları kullanılarak,

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

Hücre zarının yapısındaki yağlardan eriyerek hücre zarından geçerler.fazlalıkları karaciğerde depo edilir.

Hücre zarının yapısındaki yağlardan eriyerek hücre zarından geçerler.fazlalıkları karaciğerde depo edilir. DERS: BİYOLOJİ KONU: C.T.B(Vitaminler e Nükleik Asitler) VİTAMİNLER Bitkiler ihtiyaç duydukları bütün vitaminleri üretip, insanlar ise bir kısmını hazır alır. Özellikleri: Yapıcı, onarıcı, düzenleyicidirler.

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

YGS YE HAZIRLIK DENEMESi #18

YGS YE HAZIRLIK DENEMESi #18 YGS YE HAZIRLIK DENEMESi #18 1) Bakterilerin gerçekleştirdiği, I. Kimyasal enerji sayesinde besin sentezleme II. Işık enerjisini kimyasal bağ enerjisine dönüştürme III. Kimyasal bağ enerjisini ATP enerjisine

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

Mustafa EMREM

Mustafa EMREM Mustafa EMREM 162161022 Bakterilerdeki transformasyonun ilk kanıtları İngiliz bilim adamı Frederick Griffith tarafından elde edilmiştir. Genetik materyal aktarımı Dikey Gen Transferi ebeveyn ile yavru

Detaylı

Mikobakteriyolojide yeni nesil dizileme ile analiz

Mikobakteriyolojide yeni nesil dizileme ile analiz Mikobakteriyolojide yeni nesil dizileme ile analiz Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, İzmir Mikobakteriyolojide kullanım alanları Moleküller epidemiyoloji

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

VİRAL TANI KİTLERİ (GFJ-480)

VİRAL TANI KİTLERİ (GFJ-480) VİRAL TANI KİTLERİ (GFJ-480) CMV PCR Tanı Kiti Cytomegalovirus un Konvensiyonel PCR yöntemiyle tanınması. HHV-5 olarak da bilinen Sitomegalovirüs, herpes virus ailesinin bir üyesidir. Oldukça sık görülen

Detaylı

YGS YE HAZIRLIK DENEMESi #12

YGS YE HAZIRLIK DENEMESi #12 YGS YE HAZIRLIK DENEMESi #12 1) İnsanda döllenme sırasında, I. Spermdeki çekirdek, sentrozomun yumurtaya geçmesi II. Spermdeki akrozomun patlayarak zona pellusidayı eritmesi III. Yumurtadaki salgı maddelerinin

Detaylı

8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için

8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için 8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için koruyucu kalkan görevi görmektedir. Protein kendi kendine

Detaylı

ADIM ADIM YGS-LYS 37. ADIM HÜCRE 14- ÇEKİRDEK

ADIM ADIM YGS-LYS 37. ADIM HÜCRE 14- ÇEKİRDEK ADIM ADIM YGS-LYS 37. ADIM HÜCRE 14- ÇEKİRDEK 3) Çekirdek Ökaryot yapılı hücrelerde genetik maddeyi taşıyan hücre kısmıdır. Prokaryot hücreli canlılarda bulunmaz. GÖREVLERİ: 1) Genetik maddeyi taşıdığından

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

J Popul Ther Clin Pharmacol 8:e257-e260;2011

J Popul Ther Clin Pharmacol 8:e257-e260;2011 SİTOMEGALOVİRUS (CMV) Prof. Dr. Seyyâl ROTA Gazi Ü.Tıp Fakültesi LOW SYSTEMIC GANCICLOVIR EXPOSURE AND PREEMPTIVE TREATMENT FAILURE OF CYTOMEGALOVIRUS REACTIVATION IN A TRANSPLANTED CHILD J Popul Ther

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 12 Prokaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır.

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır. BİYOLOJİYE GİRİŞ Canlılığın bilimsel olarak araştırılmasıdır. Biyolojik Organizasyon; Her düzeydeki biyolojik organizasyon belirgin özelliklere sahiptir. Her türlü maddenin kimyasal yapıtaşları olan ve

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

RİBOZOM YAPI, FONKSİYON BİYOSENTEZİ

RİBOZOM YAPI, FONKSİYON BİYOSENTEZİ RİBOZOM YAPI, FONKSİYON VE BİYOSENTEZİ Ribozom Palade adlı araştırıcı tarafından elektron mikroskop ile tanımlanmıştır. Viruslar hariç tüm canlılarda bulunan bir membranla çevrili olmayan organellerdir.

Detaylı

Transkripsiyon (RNA Sentezi) Dr. Mahmut Çerkez Ergören

Transkripsiyon (RNA Sentezi) Dr. Mahmut Çerkez Ergören Transkripsiyon (RNA Sentezi) Dr. Mahmut Çerkez Ergören Transkripsiyon Transkripsiyon DNA molekülündeki bilginin RNA nükleotid dizisi haline çevrilmesi işlemidir. (DNA dan RNA sentezlenmesi) Hücre içi genetik

Detaylı

BAKTERİLERİN GENETİK KARAKTERLERİ

BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür

Detaylı

YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024

YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024 YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024 YAŞLANMA Hücre yapısını ve organelleri oluşturan moleküler yapılarından başlayıp hücre organelleri,hücre,doku,organ ve organ sistemlerine

Detaylı

VİROLOJİYE GİRİŞ. Dr. Sibel AK

VİROLOJİYE GİRİŞ. Dr. Sibel AK VİROLOJİYE GİRİŞ Dr. Sibel AK Bugün; Virüs nedir? Virüslerin sınıflandırılması Virüsler nasıl çoğalır? Solunum yoluyla bulaşan viral enfeksiyonlar Gıda ve su kaynaklı viral enfeksiyonlar Cinsel temas yoluyla

Detaylı

YGS YE HAZIRLIK DENEMESi #7

YGS YE HAZIRLIK DENEMESi #7 YGS YE HAZIRLIK DENEMESi #7 1) 48 saat karanlıkta bekletilen bir saksı bitkisinden bu sürenin sonunda bir yaprak kopartılmış (1. yaprak) ve bitki aydınlık ortamda 12 saat bekletilmiştir. Bu sürenin sonunda

Detaylı

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

A. DNA NIN KEŞFİ VE ÖNEMİ

A. DNA NIN KEŞFİ VE ÖNEMİ DNA nın Yapısı ve Replikasyonu Biyoloji Ders Notları A. DNA NIN KEŞFİ VE ÖNEMİ İlk olarak Friedrich Miescher (1869) akyuvar hücreleri ve balık sperminde yönetici molekülleri tespit etmiştir. Çekirdekte

Detaylı

Mendel Dışı kalıtım. Giriş

Mendel Dışı kalıtım. Giriş Mendel Dışı kalıtım DR. UMUT FAHRİOĞLU, PHD MSC Giriş Bir organizmanın fenotipinin genotipin bakarak tahmin edilebilmesi için birçok farklı faktörün çok iyi anlaşılabilmesi lazım. Mendel kalıtım modellerindeki

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

13 HÜCRESEL SOLUNUM LAKTİK ASİT FERMANTASYONU

13 HÜCRESEL SOLUNUM LAKTİK ASİT FERMANTASYONU 13 HÜCRESEL SOLUNUM LAKTİK ASİT FERMANTASYONU Laktik Asit Fermantasyonu Glikozdan oksijen yokluğunda laktik asit üretilmesine LAKTİK ASİT FERMANTASYONU denir. Bütün canlılarda sitoplazmada gerçekleşir.

Detaylı

Model Organizmalar. Yusuf DOĞAN

Model Organizmalar. Yusuf DOĞAN Model Organizmalar Yusuf DOĞAN Model Organizma Nedir? Model organizmalar çeşitli biyolojik olayların anlaşılması için üzerinde çalışılan bir türdür. Bu organizmaları laboratuvar ortamında üretmek ve üretimlerini

Detaylı

İvesi Koyunlarında Mitokondriyal 16S rrna Gen Bölgesi Polimorfizmlerinin PCR-RFLP Yöntemiyle İncelenmesi

İvesi Koyunlarında Mitokondriyal 16S rrna Gen Bölgesi Polimorfizmlerinin PCR-RFLP Yöntemiyle İncelenmesi TÜRK TARIM ve DOĞA BİLİMLERİ DERGİSİ < www.turkjans.com TURKISH JOURNAL of AGRICULTURAL and NATURAL SCIENCES İvesi Koyunlarında Mitokondriyal 16S rrna Gen Bölgesi Polimorfizmlerinin PCR-RFLP Yöntemiyle

Detaylı

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI 12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların genlerine

Detaylı

11/18/2015. Mitokondrial DNA. Umut Fahrioglu, PhD MSc. Mitokondri

11/18/2015. Mitokondrial DNA. Umut Fahrioglu, PhD MSc. Mitokondri Mitokondrial DNA Umut Fahrioglu, PhD MSc Mitokondri 1 Mitokondri Şekerlerden, yağlardan ve diğer yakıtlardan oksijen yardımı ile ATP üretme işlemi olan hücresel solunumun merkezidir. İki zarla çevrilmiştir

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

ÜNİTE 4:VİRÜS VE BAKTERİ GENETİĞİ

ÜNİTE 4:VİRÜS VE BAKTERİ GENETİĞİ ÜNİTE 4:VİRÜS VE BAKTERİ GENETİĞİ En küçük virüsler yaklaşık 20nm çapında dırlar ve bir ribozom dan daha küçüktürler. Virüsler bir hücre yapısı olarak kabul edilmezler çünkü normal hücreler kristalize

Detaylı

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces YAPAY KROMOZOMLAR Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces cerevisiae. de kurulmuştur. Halkasal plazmid maya sentromerinden,replikasyon orijininden, seçici bir işaret geninden ve

Detaylı

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER Plazmid ve Epizomlar Bakterilerin kendi kromozomlarının yanı sıra, kromozom dışı bazı genetik parçacıklar bulunmaktadır Bakteri kromozomundan daha küçük yapıda

Detaylı

Yrd.Doç.Dr.Yosun MATER

Yrd.Doç.Dr.Yosun MATER * *1.GİRİŞ 1 *Londra Linne Topluluğunun 1 Temmuz 1858 de toplantısında, Charles Darwin doğal seçilim ile anlattığı evrim teorisini sundu. *Türlerin Kökeni basılalı bir yıl olmuştu. Darwin in teorisi sadece

Detaylı

ÖĞLE ARASI ÖĞLE ARASI

ÖĞLE ARASI ÖĞLE ARASI 1. HAFTA 7 Kasım 2016 Pazartesi 8 Kasım 2016 Salı 9 Kasım 2016 Çarşamba 10 Kasım 2016 Perşembe 11 Kasım 2016 Cuma Diş Anatomisi ve Morfolojisi 08.30-09.15 09.30-10.15 Dr. Gökçe Soğancı Mandibular santral,

Detaylı

Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın

Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın Hücre Nükleusu, Nükleus Membranı, Nükleus Porları Doç. Dr. Ahmet Özaydın Nükleus (çekirdek) ökaryotlar ile prokaryotları ayıran temel özelliktir. Çekirdek hem genetik bilginin deposu hem de kontrol merkezidir.

Detaylı

GEN EKSPRESYONU: GENDEN PROTEİNE

GEN EKSPRESYONU: GENDEN PROTEİNE GENLER ve İŞLEVLERİ GEN EKSPRESYONU: GENDEN PROTEİNE Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Genlerin Doğası Şimdiye kadar öğrendiklerimiz bize canlıya ait bilgilerin DNA da yer aldığını

Detaylı

Mitokondri ve Mitokondri genomu

Mitokondri ve Mitokondri genomu Mitokondri ve Mitokondri genomu Hücrede kalıtsal materyalin aktarılması sadece nukleusa özgü bir olay mı? Hücre de kalıtımda rol oynayan başka organel var mı? 2 Mitokondri, oksijenin işlenmesi ve tüketilen

Detaylı

TÜBİTAK MAM GEN MÜHENDM HENDİSLİĞİ VE BİYOTEKNOLOJB YOTEKNOLOJİ ENSTİTÜSÜ (GMBE) TANITIMI IKEV Türkiye için Biyoteknoloji Toplantısı 8 Kasım m 2007 1 GMBE Personeli Araştırmacı 50 Toplam Personel 65 Teknisyen

Detaylı

YGS YE HAZIRLIK DENEMESi #2

YGS YE HAZIRLIK DENEMESi #2 YGS YE HAZIRLIK DENEMESi #2 1) Aşağıdaki grafikte, ph derecesi ile X, Y ve Z enzimlerin tepkime hızı arasındaki ilişki gösterilmiştir. 2) Aşağıdaki şemada kloroplast ile mitokondri arasındaki madde alış

Detaylı

KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI

KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI MBG 111 BİYOLOJİ I Hazırlayan: Yrd.Doç.Dr. Yosun MATER GİRİŞ Mendel kalıtımında eğer genler bağımsız ise kalıtıldıklarında kabaca belli oranlarda ve sıklıkla

Detaylı

1 Canlı Bilimine Giriş 2. 2 Yaşamın Kimyası 18

1 Canlı Bilimine Giriş 2. 2 Yaşamın Kimyası 18 1 Canlı Bilimine Giriş 2 1.1 Tüm yaşayan organizmaların belirli özellikleri ortaktır 2 1.2 Yaşam bir çok seviyede incelenebilir 4 1.3 Bilim insanları doğal dünyayı araştırmak için iyi yapılandırılmış yöntemler

Detaylı

Mikroskobun Yapımı ve Hücrenin Keşfi Mikroskop: Robert Hooke görmüş ve bu odacıklara hücre demiştir.

Mikroskobun Yapımı ve Hücrenin Keşfi Mikroskop:  Robert Hooke görmüş ve bu odacıklara hücre demiştir. Mikroskobun Yapımı ve Hücrenin Keşfi Mikroskop: Gözümüzle göremediğimiz çok küçük birimleri (canlıları, nesneleri vs ) incelememize yarayan alete mikroskop denir. Mikroskobu ilk olarak bir kumaş satıcısı

Detaylı

FİLOGENİ ve HAYAT AĞACI

FİLOGENİ ve HAYAT AĞACI FİLOGENİ ve HAYAT AĞACI Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER Giriş Filogenetik veriler ile canlılar arasında oluşturulan akrabalık ilişkileri, canlılığın gelişimine dair bize akrabalık ağaçlarını

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

GENETİK ŞİFRE PROF. DR. SERKAN YILMAZ

GENETİK ŞİFRE PROF. DR. SERKAN YILMAZ GENETİK ŞİFRE PROF. DR. SERKAN YILMAZ Genetik Şifre (Kod) Organizmalardaki proteinlerin birincil yapılarının (amino asit dizilerinin), DNA molekülündeki genlerin nükleotid dizisi tarafından tayin edilmesi

Detaylı

www.demiraylisesi.com

www.demiraylisesi.com YÖNETİCİ MOLEKÜLLER C, H, O, N, P atomlarından meydana gelir. Hücrenin en büyük yapılı molekülüdür. Yönetici moleküller hücreye ait genetik bilgiyi taşır, hayatsal faaliyetleri yönetir, genetik bilginin

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

-...sentezlenemezse; - ortamda... birikir. - ortamda... oluşmadığından

-...sentezlenemezse; - ortamda... birikir. - ortamda... oluşmadığından 2014 2015 MEV KOLEJİ ÖZEL ANKARA OKULLARI 9. SINIF BİYOLOJİ DERSİ YAZ TATİLİ EV ÇALIŞMASI Ödevin Veriliş Tarihi:12.06.2015 Ödevin Teslim Tarihi: 21.09.2015 1.Aşağıda verilen özelliklerden hangisi canlılarda

Detaylı

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ Seçici gen ifadesi embriyonun gelişmesini sağlayan 4 temel işlevi denetler: 1. Hücre çoğalması 2. Hücre farklılaşması 3. Hücre etkileşimleri 4. Hücre hareketi HÜCRE

Detaylı

Prokaryotlar ve Arkealar. Yrd.Doç.Dr.Yosun MATER

Prokaryotlar ve Arkealar. Yrd.Doç.Dr.Yosun MATER Prokaryotlar ve Arkealar Yrd.Doç.Dr.Yosun MATER Prokaryotlar ve Arkealar (Archealar) 1.İlk Hücreler Mikrofosiller, ilk hücrelerin olasılıkla prokaryot olduğunu işaret eder. En eski mikrofosiller 3,5 milyar

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

Tıbbi Biyoloji ve Genetik

Tıbbi Biyoloji ve Genetik TIP FAKÜLTESİ Tıbbi Biyoloji ve Genetik Yüksek Lisans Programı Tıbbi Biyoloji ve Tıbbi Genetik Anabilim Dalları Yüksek Lisans Programı Ders Sorumluları, nedimeserakinci@gmail.com Prof. Dr. Osman Hayran,

Detaylı

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması

Detaylı

Bitki Türevli Aşılar. Cüneyt Uçarlı. Moleküler Biyoloji ve Genetik Anabilim Dalı Fen Bilimleri Enstitüsü İstanbul Üniversitesi 2010

Bitki Türevli Aşılar. Cüneyt Uçarlı. Moleküler Biyoloji ve Genetik Anabilim Dalı Fen Bilimleri Enstitüsü İstanbul Üniversitesi 2010 Bitki Türevli Aşılar Cüneyt Uçarlı Moleküler Biyoloji ve Genetik Anabilim Dalı Fen Bilimleri Enstitüsü İstanbul Üniversitesi 2010 Bitki Yapımı Aşılar Dünyada her yıl yaklaşık olarak 57 milyon kişi ölmekte

Detaylı