Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 2015-Bursa

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 2015-Bursa"

Transkript

1 Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 2015-Bursa

2 İnvazif Fungal Enfeksiyonlar Aspergillus türleri Candida türleri Candida dışı maya mantarları Aspergillus dışı küf mantarları Cryptococcus neoformans Trichosporon türleri Malassezia türleri Geotrichum candidum Magnusiomyces capitatus Saprochaete clavata Mucorales takımı Fusarium türleri Pseudallesheria/Scedosporium

3 Antifungal Tedavi Başarısızlığı Pek çok nedenleri var Antifungal Direnç Intrensek (primer) direnç Kazanılmış (sekonder) direnç Mikrobiyolojik direnç Klinik direnç

4 In Vitro Antifungal Duyarlılık Testleri Referans yöntemler CLSI yöntemleri CLSI M27-A3 CLSI M38-A2 CLSI M44-A2 CLSI M51-A Suplementler (M27-S4; M44-S3; M51-S1) EUCAST yöntemleri EUCAST E. Dis 7.2 EUCAST E. Dis suseptibility testing afst/rational documents for antifungals Alman referans yöntemi DIN Onaylı ve valide ticari sistemler Sensititre Yeast One (TREK Diagnostic Systems, Inc., Cleveland, OH) Agar Gradiyent Yöntemi Etest (AB Biodisk, Solna, Sweden) Etest (biomerieux, Inc., Marcy l Etoile, France) Liofilchem MIC Test Strips (Via Scozia, Zona Industriale Italy) Vitek 2 (biomerieux, Inc., Marcy l Etoile, France)

5 Antifungal Direnç Mikrobiyolojik Direnç Klinik Direnç Mikrobiyolojik direnç Wild-type: Direnç gelişimi olmamış suş Non-wild type: Direnç gelişimi olan suş Epidemiyolojik eşik değerlerle belirlenir. o İdeal olanı 1000 suşluk veri olmasıdır o Modal dağılıma bakılır ve modal MİK den iki dilüsyon yüksek MİK değeri o Suşların %95-99 unu kapsayan MİK değeri Klinik direnç Bir suşun, antifungal ajanın güvenilir kullanım dozunda ulaştığı serum ve doku düzeyinden daha yüksek MİK değerine sahip olması

6 Flukonazol: 2mg/L; S >4 mg/l;r

7 Sistemik Etkili Antifungal Ajanlar Skualen epoksidaz 14-α-demetilaz Β-1,3 glukan sentaz

8 Primer Antifungal Direnç Amfotericin B Aspergillus terreus Pseudoallescheria boydii, Scedosporium apiospermum, S. prolificans Trichosporon asahii, T. mucoides Candida lusitaniae, C. krusei, C. glabrata? Flukonazol Çoğu küf mantarları C. krusei C. glabrata Vorikonazole Mucorales takımı Ekinokandinler Aspergillus dışı çoğu küf mantarları Candida dışı çoğu mayalar

9 Kazanılmış Direnç 1. İlaçların hücre içine penetrasyonunun azalması 2. Hedef enzimdeki değişimler a. Hedef enzim genlerinin aşırı ekspresyonu b. Hedef enzim genlerinde nokta mutasyonlar 3. Effluks pompası genlerinin aşırı ekspresyonu

10 Amfoterisin B Kazanılmış Direnç Çok uzun yıllar (50 yıldan fazla) monoterapide olarak kullanılmasına rağmen direnç gelişimi çok az Özellikle küflerde Hücre zarında ergestrol miktarının azalması ve diğer sterollerin birikmesi Maya mantarlarında Erg2, Erg3, Erg11, Erg24 AmB ye direnç geliştiren suşların virülansı düşük Benjamin Matteson Vincent etal. PLOS BIOLOGY 2013

11 Ekinokandin Direnci

12 Mantar Hücre Duvarı Yaşam için kesinlikle gerekli Katmanlardan oluşmuş Dış kısmı: Glikoprotein İç kısmı: Polisakkarit moleküleri (glukan ve kitin) Hücre duvarı sentezi dinamik bir süreç (Konfigürasyonu değişmekte) Maya-hif formu Stres cevabı

13 Kazanılmış Direnç 1. İlaçların hücre içine penetrasyonunun azalması 2. Hedef enzimdeki değişimler a. Hedef enzim genlerinin aşırı ekspresyonu b. Hedef enzim genlerinde nokta mutasyonlar 3. Effluks pompası genlerinin aşırı ekspresyonu Hücre duvar konfigürasyonunun değişimi Eagle etkisi Paradoksal etki

14 1,3-β-D Glukan Sentaz Enzim Kompleksi En az iki alt kısım Fks proteini Rho1 proteini Fks proteini FKS1 FKS2 FKS3 UDP-glikoz molekülünden glukozun (1,3)-β-D glikozil iskeletine eklenmesine

15 FKS1 ve FKS2 geninde nokta mutasyonu C. albicans, C. parapsilosis, C. dubliniensis, C. krusei, C. guilliermondii, Aspergillus türleri FKS1 geninde nokta mutasyonu iki farklı bölgede (hotspot=hs) olabilmekte FKS1 HS1: aa FKS1 HS2: aa Ser 645 Phe veya Thy veya Pro ile değişimi C. glabrata da hem FKS1 hem de FKS2 genindeki mutasyon önemli FKS1: D632E, D632G, D632Y FKS2: F659V, F659S, F659del

16 Kitin Konsantrasyonunun Artması ile Gelişen Direnç Hücre duvarı sinyal ağının aktivasyonu kitin sentezini aktive ediyor PKC HOG Ca ++ /calcineurin

17

18 Azol Direnci

19 Azollerin Etki Mekanizması

20 Candida Türleri-Azol Direnci ERG11 geninde nokta mutasyonu ERG11 geninin aşırı ekspresyonu Dışa atım genlerinin aşırı çalışması MDR genleri CDR genleri C. albicans (MDR1, CDR1, CDR2), C. glabrata (CgCDR1, CgCDR2) ve C. dubliniensis (CdMDR1, CdCDR1) By-pass yollar (ERG3 genleri ile ilişkili)

21 MacCallum DM, Coste A, Ischer F, et al. Genetic dissection of azole resistance mechanisms in Candida albicans and their validation in a mouse model of disseminated infection. Antimicrob Agents Chemother. 2010;54:

22 Aspergillus fumigatus da Azol Direnci İlacın Hedef Bölgesindeki Değişimler 14-α-demetilaz enzimini kodlayan gen cyp51 Cyp51A Cyp51B %63 homolog

23 Aspergillus fumigatus da Kazanılmış Direnç 1997 yıllında ilk kez itrakonazol direnci ile karşılaşılıyor Denning DW, Venkateswarlu K, Oakley KL, et al. Antimicrob Agents Chemother 1997; 41: Denning DW, Radford SA, Oakley KL, Hall L, Johnson EM, Warnock DW. J Antimicrob Chemother 1997; 40: Oakley KL, Morrissey G, Denning DW. Antimicrob Agents Chemother 1997; 41:

24 Cyp51A Nokta Mutasyonu Değişen kodonlar Minimal İnhibitör Konsantrasyon (µg/ml) İtrakonazol Vorikonazol Pasokonazol G54E >8 0,25-0,5 0,25-1 G54R >8 0,12-0,5 1 G54V >8 0,25-1 Belirlenmedi G54W >8 0,12-0,5 >8 G138C >8 4->8 1->8 P216L >8 1 1 M220I >8 1 0,5 M220K > >8 M220R >8 2 2 M220T >8 0,5-1 0,25-0,5 M220V > ,5-1 Y431C >8 4 1 G432S >8 0,5 0,25 G434C >8 4 1 G448S >8 >8 0,5-1 Nokta mutasyonlar Azol grubu ilaçlarla uzun süre devam eden tedavi veya proflaksi Hasta kökenli gelişmekte

25 A. fumigatus /Multi-Azol Hollanda da multiazol dirençli (MAR) izolatlar 12/13 hasta cyp51a geninde TR34/L98H >2002 Direnci Hem daha önce azol kullanmayan; kullanan hastalar Tek bir kolondan kaynaklanmadığı Verweij P E et al. Multiple-triazole-resistant aspergillosis. N Engl J Med.2007; 356:

26 A. fumigatus A. / Voriconazole Hollanda da özellikle vorikonazole dirençli izolatlar TR46/Y121F/T289A Direnci >2009 sonra görüldüğü Linden JWM, et al. Aspergillosis due to Voriconazole Highly Resistant Aspergillus fumigatus and Recovery of Genetically Related Resistant Isolates From Domiciles. Clinical Infectious Diseases 2013;57(4):513 20

27 Cyp51A Geninin Promotor Bölgesi Tandem Repeat (TR) WT CAGAGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAAAGTTGCCTAATTA TR34 CAGAGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAAT GAATCACGCGGTCCGGATGTGTGCTGAGCCGAAT GAAAGTTGCCTAATTA TR46 CAGAGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAAAGTTG TCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAAAGTTG CCTAATTA TR46 CAGAGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAA AGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAA AGTTGCCTAATTA TR53 CAGAGTTGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAAAGTTGCCTAA TGTCTAGAATCACGCGGTCCGGATGTGTGCTGAGCCGAATGAAAGTTGCCTAATTA TR34/L98H TR46/Y121F/T289A

28 Kazanılmış Direnç Çevresel maruziyet Demetilaz inhibitörleri (DMI) azol grubu fungisitlerin kullanılmasına Multiazol direnç oranı %5-12,5

29 Snelders E, Veld HRA, Rijs AJ, Kema GH, Melchers WJ, Verweij PE. Possible environmental origin of resistance of Aspergillus fumigatus to medical triazoles. Appl Environ Microbiol 2009; 75:

30 Zirai fungisitler Medikal antifungal ajanlar Ergesterol sentez inhibitörleri Mantar Hücresi Mitokondri üzerinden etkili Glukan sentezini inhibe edenler Ekinokandinler Ergestrol ile etkileşenler Amfoterisin B Çekirdek üzerinden etkili Cyt P450; cyp51 Azoller Cyt P450; cyp51 Azoller

31 Ziraat-Antifungal Ajanlar Mantarlar esas olarak fitopatojendir Ürünün %10-30 kadarının mantar enfeksiyonu nedeniyle kaybedilmesi sıktır Özellikle nemli ve ılık/sıcak mevsimlerde etkileri çok artar Tarım / Bahçecilik /Çiçekçilik sektöründe antifungal çok kullanılır

32 Stensvold CR, et al. Curr Fungal Infect Rep 2012; 6:178-91

33 Ziraat-Azol İlk azol 1973 Triademefon İmazalil 1980 den sonra kullanımı hızla artmış Propikonazol Bromukonazol Epoksikonazol Difenokonazole Tebukonazole

34 Stensvold CR, et al. Curr Fungal Infect Rep 2012; 6:178-91

35

36 Ülkemizde Azol Direnci

37 Kullanılan Suşlar Uludağ Üniversitesi Tıp Fakültesi Mikrobiyoloji Laboratuvarı stoklarında bulunan ( ) «Aspergillus fumigatus kompleks» suşları

38 Çalışma Aşamaları Canlandırma İki kez Saborauds dekstroz agara (SDA) pasajlanarak canlanmaları sağlandı (37 o C da saat) DİZİ ANALİZİ SDAx2 50 C ETÜV «A. fumigatus Kompleksindeki» Diğer Suşlardan Ayırım «A. fumigatus kompleksindeki» A. fumigatus dışındaki türleri ayırmak için, dirençli olan suşların tamamı 50 o C da inkübe edildi. Bu derecede üreyen suşlar A. fumigatus olarak değerlendirildi PCR 4µ/ml İTZ SDA Direnç Tarama Canlandırılan ve saflığından emin olunan suşlar 4 µg/ml itrakonazol içeren SDA a pasajlandı ve 48 saat inkübe edildi. Bu ortamda üreyen suşlar dirençli kabul edilerek ayrıldı DUYARLILIK TEST Kontrol Suşlar Kontrol olarak Dr Paul Verweij den temin edilen bir dirençli ve bir duyarlı suş her tarama grubuna eklendi Değerlendirme Dirençli suşlara CLSI M38-A2 dökümanına göre in-vitro antifungal duyarlılık testleri çalışıldı

39 Dirençli Suşlardan DNA Analizi DNA ekstraksiyonu spin kolon prensibiyle çalışan ticari bir kitle (Gene Matrix Plant&Fungi; EURx Ltd, Gdansk/Polonya) yapıldı

40 Primerler GAGAGACTTTGACACAGTCCGCGACAGAGGCCTCCCCCCTATAAGTCGAGTGCAGGACTG GCTGATCAAACTATGCTCATGCACTGTCTTCTCCTACATAACAGAATACTGGGCAGCGGG CTGGAGATACTATGGCTTTCATATGTTGCTCAGCGGCAGCATTCTGAAACACGTGCGTAG CAAGGGAGAAGGAAAGAAGCACTCTGAATAATTTACACTGTTCTCCTCTAGAAAAAACTC ATGAGTGAATAATCGCAGCACCACTCCAGAGTTGTCTAGAATCACGCGGTCCGGATGTGT GCTGAGCCGAATGAAAGTTGCCTAATTACTAAGGTGTAGTTCCAGCATACCATACACCCT AACTCATACTACGGTAGGTAGATCTACTTACCTATGAACCTATATTGGTAGGTAGGTGAA TATAAAATACAGCATGGAACATGTTTTTCATTAGCTGGTCTCTCATTCGTCCTTGTCCTA GGCCTTAAGGAATCCAGTATATGAAATAATCCCTCTTATCCATTTTCCTCTTATTCTTTT TCATTTCCCTCATCACTGCAACTCTAATCCTCGGGCTCACCCTCCCTGTGTCTCCTCGAA ATGGTGCCGATGCTATGGCTTACGGCCTACATGGCCGTTGCGGTGCTGACGGCAATCTTG CTCAATGTTGTTTATCAATTATTCTTTCGGCTTTGGAACCGAACAGAACCGCCAATGGTC TTTCATTGGGTCCCATATCTGGGTAGTACCATCAGTTACGGGATTGATCCCTACAAGTTC TTCTTTGCGTGCAGAGAAAAGGCAAGTTTCAAGATTGTAGTTTGACATTCATTCCTGGGC GCATTGCTGAGTATTGCTTTCTTAACTGGCAGTATGGCGATATCTTCACTTTTATACTGT TGGGTCAAAAAACCACAGTCTACCTGGGCGTTCAGGGAAACGAGTTTATTCTCAACGGCA AGCTCAAGGATGTCAATGCGGAAGAGGTCTATAGTCCATTGACGACCCCCGTTTTCGGAT CGGACGTGGTGTATGATTGTCCCAATTCCAAGCTGATGGAGCAGAAAAAGTTCATCAAGT ACGGCTTGACTCAGTCTGCGTTAGAGTCTCATGTGCCACTTATTGAGAAGGAGGTTTTGG ACTATCTGCGCGATTCACCGAACTTTCAAGGCTCGTCCGGCCGGGTGGACATCTCTGCGG CAATGGCTGAGATTACCATTTTTACCGCTGCTCGAGCCCTCCAAGGCCAGGAAGTTCGTT CCAAACTCACGGCTGAGTTCGCTGACCTCTATCATGACCTGGACAAGGGCTTTACTCCCA TCAATTTTATGCTACCGTGGGCCCCATTGCCGCATAACAAGAAGCGAGATGCTGCTCATG CGCGCATGAGGTCAATCTACGTTGACATCATCACTCAGCGCCGTCTTGACGGTGAGAAGG ACTCTCAGAAATCAGACATGATATGGAACCTGATGAACTGCACATACAAAAACGGCCAGC AAGTGCCTGATAAAGAGATTGCGCACATGATGATAACCCTGTTGATGGCTGGTCAGCATT CGTCTTCGTCCATCAGCGCCTGGATTATGCTGAGACTGGCCTCACAGCCAAAAGTCCTCG AAGAGCTGTATCAGGAACAGCTGGCCAATCTTGGCCCCGCCGGGCCAGACGGCAGTCTTC CTCCGCTCCAGTACAAGGATCTTGACAAACTTCCCTTCCATCAACATGTTATTCGTGAAA CCTTGCGGATTCACTCCTCTATTCACTCTATCATGCGCAAGGTGAAAAGCCCCTTGCCCG TTCCCGGGACCCCTTACATGATTCCTCCCGGTCGCGTGCTCCTTGCTTCACCTGGAGTGA CAGCCCTCAGCGACGAACACTTCCCCAATGCTGGGTGCTGGGATCCCCATCGCTGGGAGA ACCAGGCTACTAAGGAGCAGGAGAACGACAAGGTTGTCGACTACGGTTACGGCGCCGTCT CCAAGGGCACGTCAAGTCCCTATCTTCCGTTTGGTGCTGGCCGACACCGCTGCATCGGCG AGAAATTCGCTTATGTCAACCTTGGTGTGATTCTGGCGACCATTGTGCGCCACCTGCGAC TTTTCAACGTGGATGGAAAGAAAGGAGTCCCTGAAACTGACTATTCATCCCTCTTTTCGG GCCCCATGAAGCCAAGCATCATCGGCTGGGAGAAGCGGTCGAAAAACACATCCAAGTGAG ACTGTTGTAACCATCGAGGACTTCAAAGGATTTGGTGTGATCGGAATAGGTGTATTATAC (ekzon 1548, intron 71 base-pair [bp]) Accession number: AFUA_4G06890

41 PCR ve Dizi Analizi Klasik PCR protokolü Ethidyum-bromid jel elektroforez Heterodubleks analizi (HDA) (yalnız promotor bölge için) PCR ürünlerinin saflaştırılması (CP: Omega Bio- Tek, Norcross GA/ABD) DNA dizi analizi (Beckman Coulter CEQ8000XL) Dizilerdeki mutasyonları saptamak için web tabanlı bir program ile (Bioedit Sequence alignment editor) ClustalW Analiz yapıldı

42 yılları 746 suş tarandı (419 hastaya ait) 76 suşta (%10,2) ITZ dirençli 62 hastada (%14,8) direnç

43 Hasta sayısı Suş sayısı Dirençli hasta yüzdesi Dirençli suş yüzdesi

44 MİK (µg/ml) aralığı MİK 50 (µg/ml) MİK 90 (µg/ml) İtrakonazol >16 >16 >16 Vorikonazol Posokonazol 0, Amfoterisin B 0,5-2 0,5 1

45 Promotor Bölge Elektroforezi

46 Promotor Bölge ClusterW Analizi

47 TR34/L98H mutasyonu Azol dirençli suşlarımızın %86,8 inde (66/76) tarımda kullanılan azol fungisitlerin neden olduğu TR34/L98H mutasyonu tespit edildi.

48 Tebukonazol (Ziraai Fungisit) TR34/L98H mutasyonu olan 66 suşun tebukonozol MİK değerleri biri hariç >16 µg/ml olarak bulundu. Bir suşun MİK değeri ise yine yüksek olup, 4µg/ml olarak saptandı

49 SONUÇ TR34/L98H mutasyonu bölgemizde (ülkemizde) bulunmakta 2000 yılından sonra görülme olasılığı yüksek

50 First Determination of Azol Resistance in Aspergillus fumigatus Strains Carrying the TR 34 /L98H Mutations in Turkey Ece Özmerdiven 1, Seçil Ak 2, Beyza Ener 1, Harun Ağca 1, Burcu Dalyan Cilo 1, Berrin Tunca 2, Halis Akalın 3 Uludağ University, Faculty of Medicine Department of Medical Microbiology 1, Department of Medical Biology 2, Department of Clinical Microbiology and Infectious Diseases 3 ICCAC 2014 On-line Abstract (POM008) Journal of Infection and Chemotherapy 2015 (Basıma kabul edildi)

51 SONUÇ Amfoterisin B de kazanılmış direnç çok az Ekinokandinler FKS1 ve FKS2 genlerinde nokta mutasyonu Eagle etkisi Azoller Candida türleri ERG11 geninde nokta mutasyonu MDR (Flukonazol) ve CDR (multi-azol) genlerinin aşırı ekspresyonu Azoller Aspergillus fumigatus CYP51A geninde nokta mutasyonu TR34/L98H

Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 2016 İstanbul

Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 2016 İstanbul Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 016 İstanbul İnvazif Fungal Enfeksiyonlar Candida türleri Aspergillus türleri Pneumocystis jirovecii Cryptococcus neoformans Candida dışı maya mantarları

Detaylı

ANTİFUNGAL DİRENÇ MEKANİZMALARI ve DUYARLILIK TESTLERİ. Nilgün ÇERİKÇİOĞLU 2014 MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD

ANTİFUNGAL DİRENÇ MEKANİZMALARI ve DUYARLILIK TESTLERİ. Nilgün ÇERİKÇİOĞLU 2014 MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD ANTİFUNGAL DİRENÇ MEKANİZMALARI ve DUYARLILIK TESTLERİ Nilgün ÇERİKÇİOĞLU 2014 MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD İn Vitro Duyarlılık Test Sonuçları Duyarlı (MİK) Doza bağımlı duyarlı

Detaylı

ANTİFUNGAL DİRENÇ ve ANTİFUNGAL DUYARLILIK TESTLERİ

ANTİFUNGAL DİRENÇ ve ANTİFUNGAL DUYARLILIK TESTLERİ ANTİFUNGAL DİRENÇ ve ANTİFUNGAL DUYARLILIK TESTLERİ STANDART DUYARLILIK YÖNTEMLERİ ve ANTİFUNGAL DUYARLILIK TESTLERİNDE NEYİ, NASIL ve NE ZAMAN UYGULAMALIYIZ? Mine Doluca Dereli Dokuz Eylül Üniversitesi

Detaylı

ANTİFUNGAL DUYARLILIK TESTİ NE ZAMAN VE NASIL YAPILMALI? Prof. Dr. Nilgün Çerikçioğlu MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ A.

ANTİFUNGAL DUYARLILIK TESTİ NE ZAMAN VE NASIL YAPILMALI? Prof. Dr. Nilgün Çerikçioğlu MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ A. ANTİFUNGAL DUYARLILIK TESTİ NE ZAMAN VE NASIL YAPILMALI? Prof. Dr. Nilgün Çerikçioğlu MARMARA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ A.D 2012 ANTİFUNGAL DUYARLILIK TESTLERİ (AFDT) İÇİN GEREKÇELER

Detaylı

Mine Doluca Dereli Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim

Mine Doluca Dereli Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim CANDIDA TÜRLERİNDE DİRENÇ EPİDEMİYOLOJİSİ Mine Doluca Dereli Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı İYİ Kİ DOĞDUNUZ MİNE HOCA GİRİŞ İnvaziv fungal infeksiyonların ve antifungal

Detaylı

Antifungal Duyarlılık Testleri

Antifungal Duyarlılık Testleri 6. Türkiye EKMUD Kongresi 11-15 Mayıs 2016, Antalya KURS 3: SİSTEMİK FUNGAL ENFEKSİYONLARDA TANI ve TEDAVİ Antifungal Duyarlılık Testleri Prof. Dr. Sevtap ARIKAN AKDAĞLI Hacettepe Üniversitesi Tıp Fak.

Detaylı

Antifungal duyarlılık testleri

Antifungal duyarlılık testleri KLİNİK ÖRNEKTEN SONUÇ RAPORUNA MANTAR ENFEKSİYONLARINA LABORATUVAR YAKLAŞIMI Antifungal duyarlılık testleri Dr.Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı,Ankara DİRENÇ

Detaylı

Antifungal Tedavide Direnç. Dr. Atahan Çağatay İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı

Antifungal Tedavide Direnç. Dr. Atahan Çağatay İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Antifungal Tedavide Direnç Dr. Atahan Çağatay İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Antifungal Tedavide Direnç İnvazif Fungal İnfeksiyonlarda Sıklık Tanımlama

Detaylı

Febril Nötropenik Hastada Antimikrobiyal Direnç Sorunu: Klinik yansımalar. Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi

Febril Nötropenik Hastada Antimikrobiyal Direnç Sorunu: Klinik yansımalar. Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi Febril Nötropenik Hastada Antimikrobiyal Direnç Sorunu: Klinik yansımalar Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi OLGU 55 yaşında bayan hasta 2003 yıllında diffüz büyük B hücreli NHL tanısı 4 kez

Detaylı

NİLGÜN ÇERİKÇİOĞLU MARMARA ÜNİV. TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ A.D. KLİMUD 2013 ANTALYA

NİLGÜN ÇERİKÇİOĞLU MARMARA ÜNİV. TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ A.D. KLİMUD 2013 ANTALYA NİLGÜN ÇERİKÇİOĞLU MARMARA ÜNİV. TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ A.D. KLİMUD 2013 ANTALYA İnvazif Fungal Enfeksiyon ( İFE ) Epidemiyolojisi Candida Azol proflaksisi Aspergillus Kötü prognoz Erken tanı

Detaylı

Kandida Enfeksiyonlarında Direnç Sorunu. Dr.Buket Ertürk Şengel Marmara Üniversitesi Tıp Fakültesi Pendik Eğitim vearaştırma Hastanesi

Kandida Enfeksiyonlarında Direnç Sorunu. Dr.Buket Ertürk Şengel Marmara Üniversitesi Tıp Fakültesi Pendik Eğitim vearaştırma Hastanesi Kandida Enfeksiyonlarında Direnç Sorunu Dr.Buket Ertürk Şengel Marmara Üniversitesi Tıp Fakültesi Pendik Eğitim vearaştırma Hastanesi İnvaziv Fungal Enfeksiyonların Literatürde Rapor Edilen Oranları (%)

Detaylı

ANTİFUNGAL DUYARLILIK TESTLERİNDE YENİ NELER VAR? EUCAST YÖNTEMİ VE YENİ ÖNERİLER

ANTİFUNGAL DUYARLILIK TESTLERİNDE YENİ NELER VAR? EUCAST YÖNTEMİ VE YENİ ÖNERİLER ANTİFUNGAL DUYARLILIK TESTLERİNDE YENİ NELER VAR? EUCAST YÖNTEMİ VE YENİ ÖNERİLER Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara EUCAST The European Committee

Detaylı

CLSI Yöntemi ve Yeni Öneriler. Prof. Dr. Sevtap Arıkan Akdağlı Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

CLSI Yöntemi ve Yeni Öneriler. Prof. Dr. Sevtap Arıkan Akdağlı Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı CLSI Yöntemi ve Yeni Öneriler Prof. Dr. Sevtap Arıkan Akdağlı Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı SUNUM PLANI Antifungal duyarlılık testleri (AFDT) ile ilgili temel bilgiler

Detaylı

Antifungal Direnç Sorunu

Antifungal Direnç Sorunu KLIMIK Antimikrobiyal Yönetim Sempozyumu 6-8 Ekim 2016 Istanbul Antifungal Direnç Sorunu Prof. Dr. Sevtap Arıkan Akdağlı Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum Planı

Detaylı

Referans Dışı Yöntemlerdeki Gelişmeler Neler Sunuyor? Dilek Yeşim METİN Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova-İZMİR

Referans Dışı Yöntemlerdeki Gelişmeler Neler Sunuyor? Dilek Yeşim METİN Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova-İZMİR Referans Dışı Yöntemlerdeki Gelişmeler Neler Sunuyor? Dilek Yeşim METİN Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova-İZMİR Antifungal Duyarlılık testleri Antifungal tedavinin doğru yönlendirilebilmesi

Detaylı

Özgün Çalışma/Original Article. Mikrobiyol Bul 2009; 43: Banu SANCAK 1, Şehnaz ALP 1, Gülşen HASÇELİK 1, Sevtap ARIKAN 1 ÖZET

Özgün Çalışma/Original Article. Mikrobiyol Bul 2009; 43: Banu SANCAK 1, Şehnaz ALP 1, Gülşen HASÇELİK 1, Sevtap ARIKAN 1 ÖZET Özgün Çalışma/Original Article Mikrobiyol Bul 2009; 43: 269-276 FLUKONAZOL, İTRAKONAZOL VE VORİKONAZOLÜN KLİNİK BLASTOSCHIZOMYCES CAPITATUS (GEOTRICHUM CAPITATUM) İZOLATLARINA KARŞI İN VİTRO AKTİVİTESİNİN

Detaylı

Hematolog Gözüyle Fungal İnfeksiyonlara Yaklaşım. Dr Mehmet Ali Özcan Dokuz Eylül Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı İzmir-2012

Hematolog Gözüyle Fungal İnfeksiyonlara Yaklaşım. Dr Mehmet Ali Özcan Dokuz Eylül Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı İzmir-2012 Hematolog Gözüyle Fungal İnfeksiyonlara Yaklaşım Dr Mehmet Ali Özcan Dokuz Eylül Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı İzmir-2012 Nötropenik hastalarda fungal infeksiyonlar Nötropeni invaziv

Detaylı

Antifungal Duyarlılık Testleri:

Antifungal Duyarlılık Testleri: 2. Ulusal Klinik Mikrobiyoloji Kongresi 9-13 Kasım 2013 Belek-Antalya Antifungal Duyarlılık Testleri: Ne zaman? Hangi Yöntemler? Prof. Dr. Sevtap ARIKAN AKDAĞLI Hacettepe Üniversitesi Tıp Fak. Tıbbi Mikrobiyoloji

Detaylı

Candida Epidemiyolojisi. Dr. Nur Yapar Aralık 2009 Çeşme İzmir

Candida Epidemiyolojisi. Dr. Nur Yapar Aralık 2009 Çeşme İzmir Candida Epidemiyolojisi Dr. Nur Yapar 12-13 Aralık 2009 Çeşme İzmir Sunum Planı İnvazif Fungal İnfeksiyon (İFİ) etkenleri Candida infeksiyonlarının sıklığı Etken dağılımındaki değişiklikler Direnç durumu

Detaylı

Antifungal duyarlılık testlerinde Etest. Dr.M.Ali SARAÇLI

Antifungal duyarlılık testlerinde Etest. Dr.M.Ali SARAÇLI Antifungal duyarlılık testlerinde Etest Dr.M.Ali SARAÇLI GĠRĠġ Antifungal duyarlılık test çalıģmalarında artıģ var. Ġdeal yöntem nedir? EĢik değerleri tanımlanmıģ 2/42 UYGULANMAKTA OLAN YÖNTEMLER Sıvı

Detaylı

Candida Türlerinin İdentifikasyonunda Fermentasyon-Asimilasyon Testleri ve Otomatize Sistemler. Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi

Candida Türlerinin İdentifikasyonunda Fermentasyon-Asimilasyon Testleri ve Otomatize Sistemler. Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi Candida Türlerinin İdentifikasyonunda Fermentasyon-Asimilasyon Testleri ve Otomatize Sistemler Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi Maya ve Maya Benzeri Mantarlar Ascomycota Hemiascomycetes

Detaylı

OLGU SUNUMLARI. Dr. A. Nedret KOÇ. Erciyes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kayseri

OLGU SUNUMLARI. Dr. A. Nedret KOÇ. Erciyes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kayseri OLGU SUNUMLARI Dr. A. Nedret KOÇ Erciyes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kayseri OLGU SUNUMLARI- 1 Olgu-1 Yaş: 26 Cinsiyet: Erkek Tanı:Üç yıldır bifenotipik lösemi Şikayetleri:

Detaylı

Antifungal ilaçlar. Öner Süzer www.onersuzer.com osuzer@istanbul.edu.tr. Son güncelleme: 13.04.2011 1/33 2/33

Antifungal ilaçlar. Öner Süzer www.onersuzer.com osuzer@istanbul.edu.tr. Son güncelleme: 13.04.2011 1/33 2/33 Antifungal ilaçlar Öner Süzer www.onersuzer.com osuzer@istanbul.edu.tr Son güncelleme: 13.04.2011 1/33 2/33 1 Mikozlar (Fungal Enfeksiyonlar) Yüzeysel: Dermatomikozlar (dermatofitler tarafından oluşturulan,

Detaylı

Yoğun Bakım Ünitelerinde Mikroorganizma Profilindeki Değişim. Yoğun Bakım Ünitelerinde Mantar Etkenleri Profilindeki Değişim

Yoğun Bakım Ünitelerinde Mikroorganizma Profilindeki Değişim. Yoğun Bakım Ünitelerinde Mantar Etkenleri Profilindeki Değişim Yoğun Bakım Ünitelerinde Mikroorganizma Profilindeki Değişim Yoğun Bakım Ünitelerinde Mantar Etkenleri Profilindeki Değişim Ahmet KALKAN* * Fırat Üniversitesi Tıp Fakültesi, Klinik Mikrobiyoloji ve İnfeksiyon

Detaylı

Çeşitli Klinik Örneklerden İzole Edilen Kandida Türlerinin Dağılımı ve Antifungal Duyarlılıkları

Çeşitli Klinik Örneklerden İzole Edilen Kandida Türlerinin Dağılımı ve Antifungal Duyarlılıkları Okmeydanı Tıp Dergisi ():-7, 5 doi:.5/otd.5. Araştırma Çeşitli Klinik Örneklerden İzole Edilen Kandida Türlerinin Dağılımı ve Antifungal Duyarlılıkları Hakan Temiz *, Sevim Temiz **, Şafak Kaya *** * S.B.

Detaylı

Gebelikte vulvavagina kandidozu:

Gebelikte vulvavagina kandidozu: Gebelikte vulvavagina kandidozu: Borik asit ile 13 farklı antifungal ilacın CLSI M27-A3 protokolüne göre duyarlılık sonuçları ve dört virulans faktörünün incelenmesi Ayşe Kalkancı 1, Ahmet Barış Güzel

Detaylı

AKILCI ANTİFUNGAL KULLANIMI. Dr Alpay AZAP Ankara Üniversitesi Tıp Fakültesi İnfeksiyon Hst ve Klinik Mikr AD

AKILCI ANTİFUNGAL KULLANIMI. Dr Alpay AZAP Ankara Üniversitesi Tıp Fakültesi İnfeksiyon Hst ve Klinik Mikr AD AKILCI ANTİFUNGAL KULLANIMI Dr Alpay AZAP Ankara Üniversitesi Tıp Fakültesi İnfeksiyon Hst ve Klinik Mikr AD AKILCI ANTİFUNGAL KULLANIMI: Curr Opin Infect Dis 2012, 25:107 115 Hastaların daha iyi tedavi

Detaylı

Mikolojik Tanı. Dr Dilek Yeşim Metin Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Bornova-İzmir

Mikolojik Tanı. Dr Dilek Yeşim Metin Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Bornova-İzmir Mikolojik Tanı Dr Dilek Yeşim Metin Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Bornova-İzmir Candida infeksiyonları Yüzeyel (mukoza ve deri) infeksiyon Fırsatçı, sistemik infeksiyon

Detaylı

Febril Nötropenik Hastada Antifungal Profilaksi

Febril Nötropenik Hastada Antifungal Profilaksi Febril Nötropenik Hastada Antifungal Profilaksi Prof. Dr. Rabin SABA Akdeniz ÜTF - MSG Nötropenik Hastada Antifungal Profilaksi Prof. Dr. Rabin SABA Akdeniz ÜTF - MSG Profilaksi TEDAVİ İHTİYACI OLMAYAN

Detaylı

İnvazif Kandida İnfeksiyonları Tedavi. Prof. Dr. Nur YAPAR DEÜTF İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D.

İnvazif Kandida İnfeksiyonları Tedavi. Prof. Dr. Nur YAPAR DEÜTF İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D. İnvazif Kandida İnfeksiyonları Tedavi Prof. Dr. Nur YAPAR DEÜTF İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji A.D. Sunum Planı Düşman: Birinin kötülüğünü isteyen, ondan nefret eden, ona zarar vermeye

Detaylı

COMPARISON OF BROTH MICRODILUTION AND E-TEST METHODS FOR THE ANTIFUNGAL SUSCEPTIBILITY TESTING OF CANDIDA SPP. STRAINS ISOLATED FROM BLOOD CULTURES

COMPARISON OF BROTH MICRODILUTION AND E-TEST METHODS FOR THE ANTIFUNGAL SUSCEPTIBILITY TESTING OF CANDIDA SPP. STRAINS ISOLATED FROM BLOOD CULTURES Özgün Çalışma/Original Article Mikrobiyol Bul 2010; 44: 263-271 KAN KÜLTÜRLERİNDEN İZOLE EDİLEN CANDIDA SPP. SUŞLARININ ANTİFUNGAL İLAÇLARA KARŞI DUYARLILIKLARININ BELİRLENMESİNDE BUYYON MİKRODİLÜSYON

Detaylı

Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı

Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi. Tıbbi Mikrobiyoloji Anabilim Dalı Emrah Salman, Zeynep Ceren Karahan Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Antibiyotik kullanımına bağlı ishal etkeni olan Clostridium difficile, nozokomiyal diyarenin en sık

Detaylı

Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test. Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul

Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test. Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul Sorunlu Mikroorganizmalar, Sorunlu Antibiyotikler ve E Test Prof.Dr.Güner Söyletir Marmara Üniversitesi, İstanbul Sorunlu Mikroorganizmalar Nonfermentatif bakteriler Acinetobacter sp. Stenotrophomonas

Detaylı

EKĠNOKANDĠNLER. Dr. Tuba TURUNÇ. Başkent Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı

EKĠNOKANDĠNLER. Dr. Tuba TURUNÇ. Başkent Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı EKĠNOKANDĠNLER Dr. Tuba TURUNÇ Başkent Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı BAMÇAĞ 16-18 Aralık 2011 Sunum Planı Etki Mekanizmaları Farmakolojik Özellikleri

Detaylı

KLİNİK ASPERGILLUS İZOLATLARI: TÜR DAĞILIMI VE ANTİFUNGAL DUYARLILIK SONUÇLARININ DEĞERLENDİRİLMESİ

KLİNİK ASPERGILLUS İZOLATLARI: TÜR DAĞILIMI VE ANTİFUNGAL DUYARLILIK SONUÇLARININ DEĞERLENDİRİLMESİ Araştırma ANKEM Derg ;():9 doi:./ankem..9 KLİNİK ASPERGILLUS İZOLATLARI: TÜR DAĞILIMI VE ANTİFUNGAL DUYARLILIK SONUÇLARININ DEĞERLENDİRİLMESİ Yasemin ÖZ, Filiz AKŞİT, Müge ASLAN, Nilgün KAŞİFOĞLU, Nuri

Detaylı

* Bu çalışma Hacettepe Üniversitesi Bilimsel Araştırmalar Birimi tarafından (Proje no: 05 D ) desteklenmiştir.

* Bu çalışma Hacettepe Üniversitesi Bilimsel Araştırmalar Birimi tarafından (Proje no: 05 D ) desteklenmiştir. MİKROBİYOL MİKROBİYOLOJİ BÜL 2008; 42: BÜLTENİ 293-300 293 ÖZGÜN ÇALIŞMA CANDIDA TÜRLERİNİN AMFOTERİSİN B YE DUYARLILIĞININ E-TEST VE İKİ FARKLI BESİYERİ İLE ÖNERİLMİŞ OLAN DİRENÇ SINIR DEĞERLERİNE GÖRE

Detaylı

Geliş Tarihi (Received): Kabul Ediliş Tarihi (Accepted):

Geliş Tarihi (Received): Kabul Ediliş Tarihi (Accepted): Kısa Bildiri/Short Communication Mikrobiyol Bul 2015; 49(4): 609-618 Atılım Pompalarını Fazla Eksprese Eden Flukonazole Dirençli Candida albicans Suşlarında Bu Genlerin Transkripsiyon Faktörlerindeki Mutasyonların

Detaylı

Çeşitli Klinik Örneklerden Soyutlanan Kandidaların Tür Dağılımı ve Antifungal Direnci*

Çeşitli Klinik Örneklerden Soyutlanan Kandidaların Tür Dağılımı ve Antifungal Direnci* Çeşitli Klinik Örneklerden Soyutlanan Kandidaların Tür Dağılımı ve Antifungal Direnci* Aytekin Çıkman *, Mehmet Parlak **, Mehmet Reşat Ceylan ***, Hüseyin Güdücüoğlu ****, Mustafa Berktaş **** Özet Amaç:

Detaylı

Dokuz Eylül Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, İzmir.

Dokuz Eylül Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, İzmir. MİKROBİYOL MİKROBİYOLOJİ BÜLT 2007; 41: BÜLTENİ 285-290 285 KISA BİLDİRİ: ASPERGILLUS TÜRLERİNİN KASPOFUNGİNE KARŞI İN VİTRO DUYARLILIĞININ SAPTANMASINDA MİNİMUM İNHİBİTÖR VE MİNİMUM ETKİLİ KONSANTRASYON

Detaylı

Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri

Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Yoğun Bakım Ünitesinde Gelişen Kandida Enfeksiyonları ve Mortaliteyi Etkileyen Risk Faktörleri Emel AZAK, Esra Ulukaya, Ayşe WILLKE Kocaeli Üniversitesi Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik

Detaylı

KISA BİLDİRİ: CANDIDA ALBICANS İZOLATLARINA KARŞI AMFOTERİSİN B İLE FLUKONAZOL VE VORİKONAZOL KOMBİNASYONLARININ İN VİTRO ETKİNLİĞİ*

KISA BİLDİRİ: CANDIDA ALBICANS İZOLATLARINA KARŞI AMFOTERİSİN B İLE FLUKONAZOL VE VORİKONAZOL KOMBİNASYONLARININ İN VİTRO ETKİNLİĞİ* MİKROBİYOL MİKROBİYOLOJİ BÜL 2008; 42: BÜLTENİ 149-155 149 KISA BİLDİRİ: CANDIDA ALBICANS İZOLATLARINA KARŞI AMFOTERİSİN B İLE FLUKONAZOL VE VORİKONAZOL KOMBİNASYONLARININ İN VİTRO ETKİNLİĞİ* SHORT COMMUNICATION:

Detaylı

KANDİDÜRİ Olgu Sunumları

KANDİDÜRİ Olgu Sunumları KANDİDÜRİ Olgu Sunumları Dr Vildan AVKAN-OĞUZ Dokuz Eylül üniversitesi Tıp Fakültesi Ġnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. ÇeĢme / Aralık 2009 Olgu - 1 56 yaģında, erkek hasta ġikayeti yok

Detaylı

Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları. Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna

Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları. Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları Dilara Öğünç Gülçin Bayramoğlu Onur Karatuna Olgularla Klinik Bakteriyoloji: Antibiyotik Duyarlılık Testleri Yorumları Dr Dilara

Detaylı

HEMATOLOJİK MALİGNİTELİ OLGUDA KLEBSİELLA PNEUMONİAE İLE GELİŞEN BAKTEREMİ OLGUSU VE TEDAVİ SEÇENEKLERİ

HEMATOLOJİK MALİGNİTELİ OLGUDA KLEBSİELLA PNEUMONİAE İLE GELİŞEN BAKTEREMİ OLGUSU VE TEDAVİ SEÇENEKLERİ HEMATOLOJİK MALİGNİTELİ OLGUDA KLEBSİELLA PNEUMONİAE İLE GELİŞEN BAKTEREMİ OLGUSU VE TEDAVİ SEÇENEKLERİ Dr. Seyit Ali BÜYÜKTUNA CUMHURİYET ÜNİVERSİTESİ OLGU SUNUMU K, 67 yaşında Özgeçmiş: AML (2013 yılında

Detaylı

Çeşitli Candida Türlerinin İki Farklı Triazole Duyarlılıklarının Mikrodilüsyon Yöntemi İle Araştırılması

Çeşitli Candida Türlerinin İki Farklı Triazole Duyarlılıklarının Mikrodilüsyon Yöntemi İle Araştırılması Araştırma Yazısı Çeşitli Candida Türlerinin İki Farklı Triazole Duyarlılıklarının Mikrodilüsyon Yöntemi İle Araştırılması The Investigation of the Susceptibility of Various Candida Species to Two Different

Detaylı

STANDARDİZASYON KURUMLARI VE TÜRKİYE

STANDARDİZASYON KURUMLARI VE TÜRKİYE STANDARDİZASYON KURUMLARI VE TÜRKİYE (yalnızca CLSI mı?) Dr.ELViN DiNÇ OKMEYDANI E.A.H ENFEKSİYON HASTALIKLARI VE KLİNİK MİKROBİYOLOJİ KLİNİĞİ Antibiyotik tedavisi gerektiren bir enfeksiyonda rolü olan

Detaylı

Candida Enfeksiyonları. Beyza Ener Uludağ Üniversitesi Tıp Fakültesi

Candida Enfeksiyonları. Beyza Ener Uludağ Üniversitesi Tıp Fakültesi Candida Enfeksiyonları Beyza Ener Uludağ Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıklarında Neden Epidemiyoloji? Enfeksiyonun sıklığı ve yaygınlığı hakkında bilgi edinme Enfeksiyona sebep olan riskler

Detaylı

EKİNOKANDİN GRUBU ANTİFUNGALLER

EKİNOKANDİN GRUBU ANTİFUNGALLER EKİNOKANDİN GRUBU ANTİFUNGALLER Yrd.Doç.Dr. Onur KAYA Süleyman Demirel Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları Anabilim Dalı Sepsisli olgu sayısı Gram-negatif bakteriler Gram-pozitif bakteriler

Detaylı

Antimikrobiyal tedavide yeni yaklaşım: Doripenem. İn vitro Veriler. Prof.Dr.Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul

Antimikrobiyal tedavide yeni yaklaşım: Doripenem. İn vitro Veriler. Prof.Dr.Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul Antimikrobiyal tedavide yeni yaklaşım: Doripenem İn vitro Veriler Prof.Dr.Güner Söyletir Marmara Üniversitesi Tıp Fakültesi, İstanbul Karbapenemler GRUP 1 Ertapenem GRUP 2 Imipenem Meropenem Biapenem Panipenem

Detaylı

Fungal Etkenler. Toplantı sunumları Dr.AyşeKalkancı. Santral Sinir Sistemi Enfeksiyonlarında Tanı. Ege Mikrobiyoloji Günleri-3

Fungal Etkenler. Toplantı sunumları Dr.AyşeKalkancı. Santral Sinir Sistemi Enfeksiyonlarında Tanı. Ege Mikrobiyoloji Günleri-3 Toplantı sunumları Dr.AyşeKalkancı Santral Sinir Sistemi Enfeksiyonlarında Tanı Fungal Etkenler Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı SSS enfeksiyonları Mortalite

Detaylı

Kan Kültürlerinden İzole Edilen Maya Türlerinin Vıtek 2 Sistemi ile Tanımlanması ve Antifungal Duyarlılıkları

Kan Kültürlerinden İzole Edilen Maya Türlerinin Vıtek 2 Sistemi ile Tanımlanması ve Antifungal Duyarlılıkları Araştırma Makalesi Kan Kültürlerinden İzole Edilen Maya Türlerinin Vıtek 2 Sistemi ile Tanımlanması ve Antifungal Duyarlılıkları Distribution and Antifungal Susceptibilities with VITEK 2 system of Yeast

Detaylı

Yatan hasta örneklerinden izole edilen Candida izolatlarının tür dağılımlarının ve antifungal duyarlılık profillerinin değerlendirilmesi

Yatan hasta örneklerinden izole edilen Candida izolatlarının tür dağılımlarının ve antifungal duyarlılık profillerinin değerlendirilmesi Araştırma Makalesi/Original Article Makale Dili Türkçe /Article Language Turkish Türk Hijyen ve Deneysel Biyoloji Dergisi Yatan hasta örneklerinden izole edilen Candida izolatlarının tür dağılımlarının

Detaylı

Yatan Hastalardan İzole Edilen Candida Türlerinin ve Antifungal Duyarlılıklarının Belirlenmesi

Yatan Hastalardan İzole Edilen Candida Türlerinin ve Antifungal Duyarlılıklarının Belirlenmesi Araştırmalar / Researches DOI: 10.5350/SEMB.20151118061252 Yatan Hastalardan İzole Edilen Candida Türlerinin ve Antifungal Duyarlılıklarının Belirlenmesi Alper Togay 1, Banu Bayraktar 1, Dilek Yıldız Sevgi

Detaylı

İNVAZİF ASPERGİLLOZ TANILI HASTALARDAN İZOLE EDİLEN ASPERGILLUS TÜRLERİNİN ANTİFUNGAL DUYARLILIKLARI*

İNVAZİF ASPERGİLLOZ TANILI HASTALARDAN İZOLE EDİLEN ASPERGILLUS TÜRLERİNİN ANTİFUNGAL DUYARLILIKLARI* Araştırma ANKEM Derg 2014;28(4):129133 doi:10.5222/ankem.2014.129 İNVAZİF ASPERGİLLOZ TANILI HASTALARDAN İZOLE EDİLEN ASPERGILLUS TÜRLERİNİN ANTİFUNGAL DUYARLILIKLARI* Mustafa Altay ATALAY 1, Ayşe Nedret

Detaylı

AZOL GRUBU ANTİFUNGALLER. Dr. Selda Sayın Kutlu Pamukkale Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

AZOL GRUBU ANTİFUNGALLER. Dr. Selda Sayın Kutlu Pamukkale Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD AZOL GRUBU ANTİFUNGALLER Dr. Selda Sayın Kutlu Pamukkale Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD ANTİFUNGALLER Eski antifungaller Amfoterisin B Birinci jenarasyon

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

Aspergilloziste Erken Tanı ve Serodiagnoz. Dr Zekaver Odabaşı Marmara Üniversitesi Tıp Fakültesi

Aspergilloziste Erken Tanı ve Serodiagnoz. Dr Zekaver Odabaşı Marmara Üniversitesi Tıp Fakültesi Aspergilloziste Erken Tanı ve Serodiagnoz Dr Zekaver Odabaşı Marmara Üniversitesi Tıp Fakültesi Aspergilloziste Mortalite Düzeyleri Type/site of aspergillosis Pulmonary Aspergillosis Number of cases %

Detaylı

İFİ TEDAVİSİNDE CEVAPLANMAYAN SORULAR. Dr. Murat Akova

İFİ TEDAVİSİNDE CEVAPLANMAYAN SORULAR. Dr. Murat Akova İFİ TEDAVİSİNDE CEVAPLANMAYAN SORULAR Dr. Rabin Saba Dr. Murat Akova Dr. Zekaver Odabaşı Invaziv Fungal Enfeksiyonlarda yeni risk grupları var mı? İNVAZİV ASPERGİLLOZ Risk Faktörleri ve Direnç Prof Dr

Detaylı

Dünden Bugüne Kandida

Dünden Bugüne Kandida Dünden Bugüne Kandida Dr. Murat Akova Hacettepe Üniversitesi Tıp Fakültesi İç Hastalıkları Anabilim Dalı, İnfeksiyon Hastalıkları Ünitesi Kandidaya İlişkin İyi Bilinenler En sık rastlanan fungal infeksiyon

Detaylı

Ruti Ru n ti d n e Man tar Man Enfeksi yon feksi yon ar l ı ar n ı a Laboratu atu ar ar Y akl aşı akl aşı Serolojik ve ve ol M eküler Yönt

Ruti Ru n ti d n e Man tar Man Enfeksi yon feksi yon ar l ı ar n ı a Laboratu atu ar ar Y akl aşı akl aşı Serolojik ve ve ol M eküler Yönt Rutinde Mantar Enfeksiyonlarına Laboratuvar Yaklaşımı; Serolojik ve Moleküler Yöntemler Dr. M. Ali SARAÇLI KASIM 2012 Serolojik tanı Moleküler tanı Annelerin hayali 2/28 MİKOLOJİDE SEROLOJİ Kültür tanımlamasının

Detaylı

İlaç direnci saptanmasında yeni yöntemler. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR

İlaç direnci saptanmasında yeni yöntemler. Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR İlaç direnci saptanmasında yeni yöntemler Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD, Bornova, İZMİR 2050 TB Eliminasyon Hedefi (WHO; Global Tuberculosis Report 2012)

Detaylı

Doç. Dr. Bilgin ARDA Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

Doç. Dr. Bilgin ARDA Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Doç. Dr. Bilgin ARDA Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD OLGU 1 53 yaşında kadın hasta Multiple Miyelom VAD 5 kür Kemoterapiye yanıt yok (%70 plazma hücreleri)

Detaylı

Yatan hastaların idrar kültürlerinden izole edilen Candida türleri ve antifungal duyarlılıkları

Yatan hastaların idrar kültürlerinden izole edilen Candida türleri ve antifungal duyarlılıkları Araştırma Makalesi/Original Article Türk Hijyen ve Deneysel Biyoloji Dergisi Yatan hastaların idrar kültürlerinden izole edilen Candida türleri ve antifungal duyarlılıkları Candida species isolated from

Detaylı

MANTARLAR VE BİYOFİLM. Dr. Ş. Barçın ÖZTÜRK Adnan Menderes Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

MANTARLAR VE BİYOFİLM. Dr. Ş. Barçın ÖZTÜRK Adnan Menderes Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD MANTARLAR VE BİYOFİLM Dr. Ş. Barçın ÖZTÜRK Adnan Menderes Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Sürpriiiizz!!! BİYOFİLM 11.12.2015 Mantar Simpozyumu IV-Sorunlar

Detaylı

YBÜ de Fungal İnfeksiyonlar: Epidemiyoloji ve Risk faktörleri

YBÜ de Fungal İnfeksiyonlar: Epidemiyoloji ve Risk faktörleri YBÜ de Fungal İnfeksiyonlar: Epidemiyoloji ve Risk faktörleri Prof. Dr. Ata Nevzat YALÇIN Akdeniz Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikr. AD (5.Haziran.2015-Afyon) İnvaziv Fungal

Detaylı

Febril Nötropenide Fungal İnfeksiyonlara Klinik Yaklaşım

Febril Nötropenide Fungal İnfeksiyonlara Klinik Yaklaşım Febril Nötropenide Fungal İnfeksiyonlara Klinik Yaklaşım Dr. Murat Akova Hacettepe Üniversitesi Tıp Fakültesi İç Hastalıkları Anabilim Dalı, İnfeksiyon Hastalıkları Ünitesi, Ankara İnvaziv Fungal İnfeksiyonların

Detaylı

İFİ TEDAVİSİNde Cevaplanmayan Sorular. Dr. Murat Akova

İFİ TEDAVİSİNde Cevaplanmayan Sorular. Dr. Murat Akova İFİ TEDAVİSİNde Cevaplanmayan Sorular Dr. Rabin Saba Dr. Murat Akova Dr. Zekaver Odabaşı Invaziv Fungal Enfeksiyonlarda yeni risk grupları var mı? İNVAZİV ASPERGİLLOZ Risk Faktörleri ve Direnç Prof Dr

Detaylı

Dr. Aysun YALÇI Gülhane Eğitim Araştırma Hastanesi , ANKARA

Dr. Aysun YALÇI Gülhane Eğitim Araştırma Hastanesi , ANKARA Dr. Aysun YALÇI Gülhane Eğitim Araştırma Hastanesi 29.03.2017, ANKARA Sunum Planı Giriş Antimikrobiyal direnci önleme Direncin önlenmesinde WHO, İDSA,CDC önerileri El hijyeni Temas izolasyonu önlemleri

Detaylı

KANDİDA REHBERLERİ. Dr. Hüsnü PULLUKÇU Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

KANDİDA REHBERLERİ. Dr. Hüsnü PULLUKÇU Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD KANDİDA REHBERLERİ Dr. Hüsnü PULLUKÇU Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD KANDİDALAR Lycaste candida Clematis candida KANDİDALAR KANDİDALAR Bunun için tedavide

Detaylı

YOĞUN BAKIMDA FUNGAL ENFEKSİYONLAR. Dr. Murat Sungur Erciyes Üniversitesi Tıp Fakültesi Yoğun Bakım Bilim Dalı msungur@erciyes.edu.

YOĞUN BAKIMDA FUNGAL ENFEKSİYONLAR. Dr. Murat Sungur Erciyes Üniversitesi Tıp Fakültesi Yoğun Bakım Bilim Dalı msungur@erciyes.edu. YOĞUN BAKIMDA FUNGAL ENFEKSİYONLAR Dr. Murat Sungur Erciyes Üniversitesi Tıp Fakültesi Yoğun Bakım Bilim Dalı msungur@erciyes.edu.tr FUNGAL ENFEKSİYON Artmış mortalite Artmış morbidite YB kalış süresinde

Detaylı

Doripenem: Klinik Uygulamadaki Yeri

Doripenem: Klinik Uygulamadaki Yeri Doripenem: Klinik Uygulamadaki Yeri Prof. Dr. Haluk ERAKSOY İstanbul Üniversitesi İstanbul Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Yeni Antimikrobik Sayısı Azalmaktadır

Detaylı

Propolisin Mikobakterilere Karşı in-vitro Etkinliğinin Araştırılması

Propolisin Mikobakterilere Karşı in-vitro Etkinliğinin Araştırılması Propolisin Mikobakterilere Karşı in-vitro Etkinliğinin Araştırılması Melek İnci 1, Ayşe Nedret Koç 2, Mustafa Altay Atalay 2, Sibel Silici 3, Hafize Sav 2, Fatma Mutlu Sarıgüzel 4, Aslıhan Gültekin Çökük

Detaylı

AZOLLER. Doç. Dr. Ç.Banu ÇETİN Celal Bayar Üniversitesi Tıp Fakültesi

AZOLLER. Doç. Dr. Ç.Banu ÇETİN Celal Bayar Üniversitesi Tıp Fakültesi AZOLLER Doç. Dr. Ç.Banu ÇETİN Celal Bayar Üniversitesi Tıp Fakültesi Kandidemi Mortalite Etken % % Mortalite KNS 31.9 21 S aureus 15.7 25 Enterococci 11.1 32 Candida spp. 7.6 38 E. coli 5.7 24 Klebsiella

Detaylı

Bağışıklık sistemi baskılanmış hastalarda invaziv

Bağışıklık sistemi baskılanmış hastalarda invaziv Antifungal Tedavide Kombine Kullanım Esin ŞENOL* * Gazi Üniversitesi Tıp Fakültesi, Klinik Bakteriyoloji ve İnfeksiyon Hastalıkları Anabilim Dalı, ANKARA Bağışıklık sistemi baskılanmış hastalarda invaziv

Detaylı

Sema KEÇEL ÖZCAN*, Handan A IRBAfiLI**, fieyda ÇALIfiKAN*, Ayfle WILLKE***

Sema KEÇEL ÖZCAN*, Handan A IRBAfiLI**, fieyda ÇALIfiKAN*, Ayfle WILLKE*** ANKEM Derg 7;():-7 HEMATOLOJ K MAL GN TEL HASTALARDAN ZOLE ED LEN NON-ALBICANS CANDIDA VE CANDIDA DIfiI MAYA TÜRLER N N VOR KONAZOL VE FLUKONAZOLE N-V TRO DUYARLILIKLARI* Sema KEÇEL ÖZCAN*, Handan A IRBAfiLI**,

Detaylı

Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı?

Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı? Makrolid dirençli Staphylococcus aureus ile kolonize kistik fibrozis hastalarında MLS B direnç genlerinde yıllar içerisinde değişim var mı? Muharrem ÇİÇEK, Banu SANCAK, Burçin ŞENER Hacettepe Üniversitesi

Detaylı

Mikrobiyoloji ve Klinik Mikrobiyoloji AD ETKENLERİNİ TANIYALIM...

Mikrobiyoloji ve Klinik Mikrobiyoloji AD ETKENLERİNİ TANIYALIM... Prof. Dr. Sevtap Arıkan Hacettepe Üniv.. Tıp T p Fak. Mikrobiyoloji ve Klinik Mikrobiyoloji AD FIRSATÇI I MİKOZ M ETKENLERİNİ TANIYALIM... 1 Fırsatçı mikozlar, immün sistemi baskılanmış olgularda önemli

Detaylı

Mycobacterium tuberculosis te Dışa Atım Pompaları

Mycobacterium tuberculosis te Dışa Atım Pompaları Mycobacterium tuberculosis te Dışa Atım Pompaları 1 Dışa atım (efflux)..transporter Geniş substrat özgüllüğü (polispesifik) Doğal fonksiyonları 2 3 ABC (ATP-binding cassette) Sekonder MFS (major facilitator

Detaylı

ANTİFUNGAL TEDAVİ YAKLAŞIMLARINDA GÜNCEL DURUM

ANTİFUNGAL TEDAVİ YAKLAŞIMLARINDA GÜNCEL DURUM ANTİFUNGAL TEDAVİ YAKLAŞIMLARINDA GÜNCEL DURUM Dr.Rabin SABA Medstar Hastanesi Antalya EKMUD İZMİR 18.02.2016 EPİDEMİYOLOJİ Hematolojik malignite ve KH nakillerinde en önemli mortalite ve morbidite nedeni

Detaylı

TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM)

TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM) TÜBERKÜLOZ DIŞI MİKOBAKTERİLER (TDM) Ne zaman etkendir? Duyarlılık testleri ne zaman ve nasıl yapılmalıdır? Nasıl tedavi edilmelidir? TDM NE ZAMAN ETKENDİR? Şebeke suyundan, topraktan, doğal sulardan,

Detaylı

İnvazif Mantar Enfeksiyonlarında Diğer Tanı Yaklaşımları. Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 17.03.2015

İnvazif Mantar Enfeksiyonlarında Diğer Tanı Yaklaşımları. Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 17.03.2015 İnvazif Mantar Enfeksiyonlarında Diğer Tanı Yaklaşımları Dr Beyza Ener Uludağ Üniversitesi Tıp Fakültesi 17.03.2015 Mantar Enfeksiyonunun Etiyolojik Tanı Mikroskobik inceleme ile etkeni gösterme Besiyerlerinde

Detaylı

MOKSİFLOKSASİN VE AMFOTERİSİN B KOMBİNASYONUNUN CANDIDA TÜRLERİ ÜZERİNE İN VİTRO SİNERJİSTİK ETKİSİ*

MOKSİFLOKSASİN VE AMFOTERİSİN B KOMBİNASYONUNUN CANDIDA TÜRLERİ ÜZERİNE İN VİTRO SİNERJİSTİK ETKİSİ* Özgün Çalışma/Original Article Mikrobiyol Bul 2010; 44: 65-70 MOKSİFLOKSASİN VE AMFOTERİSİN B KOMBİNASYONUNUN CANDIDA TÜRLERİ ÜZERİNE İN VİTRO SİNERJİSTİK ETKİSİ* IN VITRO SYNERGISTIC EFFECT OF MOXIFLOXACIN

Detaylı

Cerrahpaşa Tıp Fakültesi Hastanesinde Febril Nötropenik Hasta Antifungal Tedavi Uygulama Prosedürü

Cerrahpaşa Tıp Fakültesi Hastanesinde Febril Nötropenik Hasta Antifungal Tedavi Uygulama Prosedürü Cerrahpaşa Tıp Fakültesi Hastanesinde Febril Nötropenik Hasta Antifungal Tedavi Uygulama Prosedürü Prof. Dr. Neşe Saltoğlu İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi, Enfeksiyon Hastalıkları ve Klinik

Detaylı

KAN DOLAŞIMI İNFEKSİYONLARI. Dr. Selda SAYIN KUTLU Pamukkale Üniversitesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

KAN DOLAŞIMI İNFEKSİYONLARI. Dr. Selda SAYIN KUTLU Pamukkale Üniversitesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD KAN DOLAŞIMI İNFEKSİYONLARI Dr. Selda SAYIN KUTLU Pamukkale Üniversitesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Mantar ve yabancı cisim infeksiyonları Mantar biyomateryaller Yabancı cisim infeksiyonları

Detaylı

CANDİDA İLE UYARILMIŞ VAJİNAL VE BUKKAL EPİTEL HÜCRELERİNİN SİTOKİN ÜRETİMİ

CANDİDA İLE UYARILMIŞ VAJİNAL VE BUKKAL EPİTEL HÜCRELERİNİN SİTOKİN ÜRETİMİ CANDİDA İLE UYARILMIŞ VAJİNAL VE BUKKAL EPİTEL HÜCRELERİNİN SİTOKİN ÜRETİMİ Emine Yeşilyurt, Sevgi Özyeğen Aslan, Ayşe Kalkancı, Işıl Fidan, Semra Kuştimur Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji

Detaylı

Daptomisin: Laboratuvar Yaklaşım. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul

Daptomisin: Laboratuvar Yaklaşım. Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul Daptomisin: Laboratuvar Yaklaşım Prof. Dr. Güner Söyletir Marmara Üniversitesi Tıp Fakültesi İstanbul Daptomisin: Mikrobiyolojik Yaklaşım İn vitro çalışma sonuçları İn vitro testler Direnç gelişimi DAPTOMİSİN

Detaylı

ERCİYES ÜNİVERSİTESİ DENEYİMİ

ERCİYES ÜNİVERSİTESİ DENEYİMİ ERCİYES ÜNİVERSİTESİ DENEYİMİ Doç. Dr. Orhan YILDIZ Erciyes Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD. KAYSERi Erciyes Üniversitesi Hastaneleri 1300 yatak / 10 milyon

Detaylı

Olgularla antifungal direnç ve klinik yansımaları. Dr. A. Nedret KOÇ Erciyes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Kayseri

Olgularla antifungal direnç ve klinik yansımaları. Dr. A. Nedret KOÇ Erciyes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Kayseri Olgularla antifungal direnç ve klinik yansımaları Dr. A. Nedret KOÇ Erciyes Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Kayseri OLGU SUNUMLARI-1 Olgu-1 Yaş:27, inşaat işçisi Cins: Erkek

Detaylı

Candida Epidemiyolojisindeki Değişikliklerin Araştırılması*

Candida Epidemiyolojisindeki Değişikliklerin Araştırılması* Özgün Çalışma/Original Article Mikrobiyol Bul 2015; 49(3): 423-431 Candida Epidemiyolojisindeki Değişikliklerin Araştırılması* Investigation of the Changes in Candida Epidemiology Barış ÇİÇEK 1, Hava YILMAZ

Detaylı

Alınan örnekten hangi tetkikler istenmeli?

Alınan örnekten hangi tetkikler istenmeli? OLGU 1. M SORU -1 Alınan örnekten hangi tetkikler istenmeli? MİKROBİYOLOJİK TANI: KONVANSİYONEL YÖNTEMLER Direk mikroskopik inceleme Kültür DİĞER YÖNTEMLER Moleküler yöntemler?? OLGU 1. M SORU -2 YAYMA

Detaylı

Invazif Fungal Enfeksiyonlarda Serodiagnoz Prof Dr Zekaver Odabaşı

Invazif Fungal Enfeksiyonlarda Serodiagnoz Prof Dr Zekaver Odabaşı Invazif Fungal Enfeksiyonlarda Serodiagnoz Prof Dr Zekaver Odabaşı Marmara Üniversitesi Tıp Fakültesi İFİ Diagnostik Yöntemler Chandrasekar P, Eur J Hematol, 2010 GALAKTOMANNAN TESTİ Double sandwich -

Detaylı

Antimikrobiyal Duyarlılık Testleri (AMD) Hangi Durumlarda Yapılmalı? Genel kavramlar

Antimikrobiyal Duyarlılık Testleri (AMD) Hangi Durumlarda Yapılmalı? Genel kavramlar ULUSAL MİKROBİYOLOJİ STANDARTLARI (UMS) Antimikrobiyal Duyarlılık Testleri Hangi Durumlarda Yapılmalı? Genel kavramlar Hazırlayan Birim Klinik Bakteriyoloji Tanı Standartları Çalışma Grubu- 11 Onaylayan

Detaylı

YOĞUN BAKIM ÜNİTESİNDE MANTAR İNFEKSİYONLARINDA TEDAVİ. Dr.İbrahim ERAYMAN NEÜ Meram Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik. Mik. AD.

YOĞUN BAKIM ÜNİTESİNDE MANTAR İNFEKSİYONLARINDA TEDAVİ. Dr.İbrahim ERAYMAN NEÜ Meram Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik. Mik. AD. YOĞUN BAKIM ÜNİTESİNDE MANTAR İNFEKSİYONLARINDA TEDAVİ Dr.İbrahim ERAYMAN NEÜ Meram Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik. Mik. AD. İNVAZİV FUNGAL İNFEKSİYONLAR Artan farkındalık ve tanısal gelişmeler

Detaylı

Antifungal profilaksi. Dr. Bilgin ARDA Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD

Antifungal profilaksi. Dr. Bilgin ARDA Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Antifungal profilaksi Dr. Bilgin ARDA Ege Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları ve Klinik Mikrobiyoloji AD Tedavi Stratejileri Tedavi Profilaksi Ampirik Pre-emptif Etkene yönelik 4 40 1 39

Detaylı

Klinik Mikrobiyoloji'de Bu Yıl Makaleler -2- Klinik mikoloji. Dr.Çağrı Ergin Pamukkale Üniversitesi / Denizli

Klinik Mikrobiyoloji'de Bu Yıl Makaleler -2- Klinik mikoloji. Dr.Çağrı Ergin Pamukkale Üniversitesi / Denizli Klinik Mikrobiyoloji'de Bu Yıl Makaleler -2- Klinik mikoloji Dr.Çağrı Ergin Pamukkale Üniversitesi / Denizli Patoloji Fungal lökonişi Onikomikozun beyaz değişimleri Süperfisiyal beyaz onikomikoz Nadir,

Detaylı

PNÖMOKOKLARDA DİRENÇ VE GELİŞMELER DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD

PNÖMOKOKLARDA DİRENÇ VE GELİŞMELER DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD PNÖMOKOKLARDA DİRENÇ VE GELİŞMELER DR. BURÇİN ŞENER HACETTEPE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ AD XXXIV. Türk Mikrobiyoloji Kongresi - 2010 İÇERİK Pnömokokal enfeksiyonların epidemiyolojisi

Detaylı

Yoğun Bakım Ünitesinde İnvaziv Kandida Enfeksiyonlarının Tedavisi. Dr. Mustafa NAMIDURU GÜTF-Enf. Hst ve Kl. Mik. AD.

Yoğun Bakım Ünitesinde İnvaziv Kandida Enfeksiyonlarının Tedavisi. Dr. Mustafa NAMIDURU GÜTF-Enf. Hst ve Kl. Mik. AD. Yoğun Bakım Ünitesinde İnvaziv Kandida Enfeksiyonlarının Tedavisi Dr. Mustafa NAMIDURU GÜTF-Enf. Hst ve Kl. Mik. AD. 1 Gaziantep Klasiği 2 Temel Sorunlar: 1. Mortalite ve Morbitidesi Yüksek 2. Her Geçen

Detaylı

EUCAST TANIMLAYICI DÖKÜMANI EDef 9.2

EUCAST TANIMLAYICI DÖKÜMANI EDef 9.2 EUCAST TANIMLAYICI DÖKÜMANI EDef 9.2 Konidia Oluşturan Küfler için Antifungal İlaçların Sıvı Dilüsyonla Minimum İnhibitor Konsantrasyonlarını Belirleme Yöntemi Yayın Tarihi: Temmuz 2014 Çeviri Tarihi:

Detaylı

İNVAZİF ASPERGİLLOZLU OLGULARDAN İZOLE EDİLEN ASPERGILLUS SPP. SUŞLARININ ANTİFUNGAL DUYARLILIKLARI

İNVAZİF ASPERGİLLOZLU OLGULARDAN İZOLE EDİLEN ASPERGILLUS SPP. SUŞLARININ ANTİFUNGAL DUYARLILIKLARI Özgün Çalışma/Original Article Mikrobiyol Bul 2010; 44: 273-278 İNVAZİF ASPERGİLLOZLU OLGULARDAN İZOLE EDİLEN ASPERGILLUS SPP. SUŞLARININ ANTİFUNGAL DUYARLILIKLARI ANTIFUNGAL SUSCEPTIBILITIES OF ASPERGILLUS

Detaylı

TERB NAF N LE FLUKONAZOL KOMB NASYONUNUN CANDIDA ALBICANS KÖKENLER NE KARfiI IN VITRO ETK S

TERB NAF N LE FLUKONAZOL KOMB NASYONUNUN CANDIDA ALBICANS KÖKENLER NE KARfiI IN VITRO ETK S nfeksiyon Dergisi (Turkish Journal of Infection) 2003; 17 (1): 71-75 TERB NAF N LE FLUKONAZOL KOMB NASYONUNUN CANDIDA ALBICANS KÖKENLER NE KARfiI IN VITRO ETK S IN VITRO ACTIVITY OF TERBINAFINE IN COMBINATION

Detaylı