DNA TEKNOLOJİSİNİN GELİŞİMİ

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "DNA TEKNOLOJİSİNİN GELİŞİMİ"

Transkript

1 İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap s 1957 Kornberg DNA polimeraz enziminin keşfi 1966 Nirenberg Genetik kodun keşfi 1967 Gellert DNA ligaz enziminin keşfi 1973 Boyer,Cohen & Berg DNA klonlana tekniğinin gelişmesi 1975 Southern Southern blot ve hibridizasyon 1976 Sanger & Barrell - Maxam & Gilbert DNA dizi analizi 1982 Palmiter & Brinster Transgenik farelerin üretilmesi 1985 Mullis Polimeraz zincir reaksiyonu : PCR 1990 İnsan Genom Projesinin başlat lmas 2001 İnsan genomunun taslağ tamamland 2003 İnsan genom projesi tamamland 1

2 GENOMDAKİ POLİMORFİK DİZİLER RFLP (Restriction Fragment Length Polymorphism) Diğer DNA Polimorfizmleri Minisatellitler ( baz çifti tekrarlar) VNTR (Variable Number of Tandem Repeats) Mikrosatellitler (CA tekrarlar ; 2-10 baz çifti tekrarlar) STR (Short Tandem Repeats) Tek nükleotid değişimleri SNP (Single Nucleotid Polymorphism) SNP Baz toplumlarda normal kişilerde genomik DNA n n tek baz çiftlik pozisyonunda farkl sekans alternatiflerinin (allel) bulunmas d r. Bu farkl allellerin s kl ğ %1 den daha fazla olmal d r. GTCACCATAGGATCCT CAGTGGTATCCTAGGA 1bp GTCACCATAGGCTCCT CAGTGGTATCCGAGGA 2

3 SNP İnsan genom varyasyonlar n n büyük çoğunluğu tüm toplumlarda müşterektir. SNP lerin sadece %15 kadar bir topluluğa özeldir. Bu say n n 11 milyona ç kacağ tahmin edilmektedir. Kompleks Hastal klar Oligogenik veya poligenik olabilir. Allelik heterojenite olabilir. Lokus heterojenitesi olabilir. Genler aras ndaki ilişki, additif, sinerjistik, epistatik olabilir. Patolojinin ortaya ç kmas için bir eşik düzeyin aş lmas gerekebilir. 3

4 Kompleks Hastal klar Vaka ve kontrolün seçildiği test toplumu homojen ve iyi karakterize edilmiş olmal d r. Bağlant ve assosiasyon çal şmas mümkünse birlikte yap lmal d r. Bir veya birkaç marker la saptanan negatif assosiasyon, riski ekarte etmek için yeterli olmamal d r. Bir seri pozitif assosiasyon da patojenik sekans lokalize etmek ve tan mlamak için yeterli olmayabilir real-time PCR 5700 Applied Biosystems icycler BioRad 7700 Applied Biosystems LightCycler Roche FluorTracker Stratagene FluorImager Molecular Dynamics 4

5 5

6 6

7 7

8 8

9 9

10 FRET (Fluorescence Resonance Energy Transfer) using adjacent hybridization probes Excitation FRET Emission P FITC Red 640 Phosphate P Amplicon 10

11 real-time LightCycler real-time real-time Operation RT PCR H zl, çok say da örnek, kontaminasyon oran n n düşük olmas, duyarl, bilgisa-yar destekli, maliyet Teknoloji 2 hedef ile s n rl, ilk yat r m pahal, yeni protol geliştirilmesi güç. 11

12 DNA DİZİ ANALİZİ DNA DİZİ ANALİZİ 12

13 DNA DİZİ ANALİZİ DNA DİZİ ANALİZİ 13

14 DNA DİZİ ANALİZİ DNA DİZİ ANALİZİ 14

15 DNA DİZİ ANALİZİ MUTANT NORMAL Mikroarray (DNA chip) -K sa oligonükleotid diziler Yüksek çözünürlüklü SNP analizleri için geliştirildiler -İstatistik programlar ile kopya say s ndaki kazan m ve kay plar hesaplamak olanakl hale geldi -10K, 100K, 500K SNP 6kb lik aral kta tarama -Anne-baba DNA taramas birlikte yap l rsa: uniparantel dizomi ve hücre kontaminasyonu gösterilebilir de novo mutasyon patolojik/normal? 15

16 DNA Genotyping RNA Eukaryotic Cell Gene Expression: Which genes? How much? Mikroarray Uygulamalar Ekspresyon düzeyi (cdna array); Genotipleme; DNA kopyasay s (CGH); Protein bağlanma bölgesinin belirlenmesi; Gen ürünlerinin hücre d ş nda lokalize edilmesi; 16

17 Mikroarray Uygulamalar Kanser araşt rmalar : Genomda (tümör dokusunda) moleküler yap n n ortaya konmas ile etkin tan ve tedavi. Immünoloji: Enfeksiyonlarda konağ n genomik cevab... Farmakoloji: Ekpresyon profiline göre tedavi yan t n n önceden belilenmesi

18 Chemistry (Wafer Prep) Photolithography Cartridge Assembly 18

19 Mikroarray (DNA chip) Probe array Hybridized array Tagged nucleic acid Detect Fluorescent Stain Mikroarray (DNA chip) 19

20 Mikroarray (DNA chip) Yöntem DNA Zaman Çözünürlük Prob Karyotipleme ++++ yavaş 5-10 Mb - FISH +++ yavaş 1-5 Mb + Array-CGH +++ orta 1 Mb - Mikroarray 10K, 100K, 500K + h zl kb - -DNA Chip - Protein Chip - Lab on a chip? 20

21 Bioinformatik Bioinformatik Heryerde - istatistik, dizayn ve analiz: Deney öncesi, önerme, buluş ve tan mlama, vb. - İç ve d ş veri tabanlar nda karş laşt rma. - Nukleotid ve protein sekans verileri, moleküler modelleme 21

22 - Biyoinformatik: biyoloji, bilişim teknolojisi ve bilgisayar bilimlerini bir araya getiren bir bilim dal d r. En önemli amac, genom düzeyinde saklanan ve gerektiğinde kullan lan yaşam şifresininin keşfedilmesidir. -Biyoinformatikçal şmalar n n da katk s yla, gelişimsel biyolojiden kanserin tan ve tedavisine kadar bir çok biyolojik olay n alt nda yatan mekanizmalar aç ğa ç kar labilir. 22

23 - Biyolojik bilgiler ile ilgili veri taban oluşturulup yönetilmesi, - genom ve dizi analizleri, -işlevsel genomik ve ilgili veri analizi, - birincil protein dizisinden protein yap tahmini (3D), - hücresel olaylar n modellenip in sliko gerçekleştirilmesi. 23

24 - Nükleotid veri tabanlar Bağ ms z olarak toplamakta iken, h zla artan dizi verilerini tekbir kaynakta toplamak için tüm nükelotid dizi verilerini toplayan uluslararas işbirliği gurubu (International Nucleotide Sequence Database Collaboration) başl ca DNA dizilerini içeren üç merkez olan Japon (DDBJ), Avrupa (EMBL)), ve Amerikan (GenBank, NCBI) taraf ndan kuruldu. 24

25 - Genom ve dizi analizleri Dizi eşleme yöntemlerine (sequence alignment) dayanan dizilerinde belli bir oran n üstünde benzerlik gösteren (homolog) genlerin araşt r lmas s kça veri tabanlar n n kullan lmas n gerektirmektedir. 25

26 - Bu verileri saklayacak, birleştirecek, erişimini ve çözümlenmesini sağlayacak araçlar n geliştirilmesi öncelikli gerekesinimlerden biridir. - Hücre içi fizyolojik olaylar n, proteinler aras ilişkiler sonucu oluşan sinyal ileti yollar n n biyoinformatik ile modellenmesi gerekmektedir. DNA RNA Protein Fenotip A. Biyolojinin ana dogmas Genetik Moleküler Kimyasal Fenotip bilgi yap işlev B. Biyoinformatiğin ana dogmas Şekil 6: A ve B Biyoloji ve biyoinformatikte bilginin kullanm ak ş 26

27 - Biyoinformatik ve Gelecek Önümüzdeki y l içerisinde biyoinformatik bilimindeki gelişmeler ile: - biyokimyasal işlev, -yap sal bilgi ve - evrimsel ipuçlar bulunarak, hastal klar n temellerinin ortaya konmas n sağlanacakt r. 27

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

BİYOTEKNOLOJİ KÖKENLİ FARMASÖTİK ÜRÜNLER VE FORMÜLASYON TASARIMLARI. Prof.Dr. Asuman BOZKIR Doç.Dr. Burcu DEVRİM

BİYOTEKNOLOJİ KÖKENLİ FARMASÖTİK ÜRÜNLER VE FORMÜLASYON TASARIMLARI. Prof.Dr. Asuman BOZKIR Doç.Dr. Burcu DEVRİM BİYOTEKNOLOJİ KÖKENLİ FARMASÖTİK ÜRÜNLER VE FORMÜLASYON TASARIMLARI Prof.Dr. Asuman BOZKIR Doç.Dr. Burcu DEVRİM Biyoteknoloji Hücre ve doku biyolojisi kültürü, moleküler biyoloji, mikrobiyoloji, genetik,

Detaylı

GENETİK TANI YÖNTEMLERİ. Prof.Dr.Mehmet Alikaşifoğlu

GENETİK TANI YÖNTEMLERİ. Prof.Dr.Mehmet Alikaşifoğlu GENETİK TANI YÖNTEMLERİ Prof.Dr.Mehmet Alikaşifoğlu S Genetik Tanı Yöntemleri S Sitogenetik Tanı Yöntemleri S Moleküler Sitogenetik Tanı Yöntemleri S Moleküler Genetik Tanı Yöntemleri Sitogenetik Tanı

Detaylı

T.H. Morgan ve A.H. Sturtevant 1911

T.H. Morgan ve A.H. Sturtevant 1911 GENETĐK 111-503 HAFTA III Bağlantı, Asosiyasyon, Haritalama Doç. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark: kiyazma 2. Görünüşteki

Detaylı

HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

Rekombinant DNA Teknolojisi-II

Rekombinant DNA Teknolojisi-II BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-II Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2

Detaylı

Bitki Moleküler Biyolojisi. Prof. Dr. Nermin Gözükırmızı

Bitki Moleküler Biyolojisi. Prof. Dr. Nermin Gözükırmızı Bitki Moleküler Biyolojisi Prof. Dr. Nermin Gözükırmızı Bitki Moleküler Biyolojisi moleküler tekniklere dayalı bir bilim dalıdır. Dizileme, PCR, cdna, transkriptomik, proteomik, transformasyon, high-resolution

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

MOLEKÜLER BİYOLOJİ LABORATUVARI

MOLEKÜLER BİYOLOJİ LABORATUVARI MOLEKÜLER 2014-2015 BİYOLOJİ LABORATUVARI GÜZ DÖNEMİ MOLEKÜLER BİYOLOJİ LABORATUVARI 7.HAFTA DERS NOTLARI GAZİ ÜNİVERSİTESİ FEN FAKÜLTESİ BİYOLOJİ BÖLÜMÜ Sayfa 1 / 6 1. RFLP (RESTRİKSİYON PARÇA UZUNLUK

Detaylı

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz Genom Sayısal ve Yapısal Mutasyonlar Prof. Dr. Fatma Savran Oğuz Organizmanın haploid hücredeki tüm gen ve gen dışı bölgelerinden oluşan kalıtsal maddenin tamamı Genom bir kişinin taşıdığı tüm genetik

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

BİYOİNFORMATİK GİZEM BAKKAL ZEYNEP TURAN ŞEYDA KARŞIYAKA ÜMMÜHAN YOZGAN GİZEM BOLAT

BİYOİNFORMATİK GİZEM BAKKAL ZEYNEP TURAN ŞEYDA KARŞIYAKA ÜMMÜHAN YOZGAN GİZEM BOLAT BİYOİNFORMATİK GİZEM BAKKAL ZEYNEP TURAN ŞEYDA KARŞIYAKA ÜMMÜHAN YOZGAN GİZEM BOLAT BİYOİNFORMATİK NEDİR? Biyoinformatik, kabaca söyleyecek olursak, biyolojik bilginin bilgisayar yardımı ile incelenmesi

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Dr. Muradiye Nacak Gaziantep Üniversitesi Tıp Fakültesi Farmakoloji Anabilim Dalı 4Kasım, 2009 Sunum Planı Farmakogenetik,

Detaylı

MĐKRODĐZĐN DENEYLERĐNĐN TASARIMI: Dikkat Edilmesi Gereken Noktalar

MĐKRODĐZĐN DENEYLERĐNĐN TASARIMI: Dikkat Edilmesi Gereken Noktalar Hafta VIII Genombilimde Mikrodizin Uygulamaları ve Biyoinformatik Analiz MĐKRODĐZĐN DENEYLERĐNĐN TASARIMI: Dikkat Edilmesi Gereken Noktalar Doç. Dr. Hilâl Özdağ Niçin Mikrodizin Deneyi? Genomik ölçekte

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

REKOMBİNANT DNA TEKNİKLERİ I DR. ONUR YILMAZ 2017

REKOMBİNANT DNA TEKNİKLERİ I DR. ONUR YILMAZ 2017 REKOMBİNANT DNA TEKNİKLERİ I DR. ONUR YILMAZ 2017 Rekombinasyon: Yenibileşim - yenidenoluşum. Bir molekülün-hücrenin, atasal wild type yada ilkin (orijinal) yapısından farklılık göstermesi durumudur. I

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

Comparative Genomic Hybridization (CGH)

Comparative Genomic Hybridization (CGH) CGH, ARRAY-CGH Comparative Genomic Hybridization (CGH) CGH sitogenetik tekniğini ilk defa, Kallioniemi ve ark. 1992 de Science da yayınlattıkları çalışmaları ile ortaya koydular. Kallioniemi A, Kollioniemi

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU DOKTORA DERS KATALOĞU ERCİYES ÜNİVERSİTESİ GDM 638 Lipid Kimyası Zorunlu DERS SAATİ: 3 Bahar Yrd. Doç. Dr. Hasan YALÇIN KREDİSİ :3 Tel:(352) 4374901 (32731), E-mail: hyalcin@erciyes.edu.tr, Web sayfası

Detaylı

BİYOİNFORMATİK CİHAN SUVARİ

BİYOİNFORMATİK CİHAN SUVARİ BİYOİNFORMATİK CİHAN SUVARİ 1.BİYOİNDORMATİK NEDİR? En kısa şekliyle biyolojik bilginin saklanacağı veri tabanlarının organize edilmesi ve bu bilginin bilgisayar yardımıyla incelenmesi ve işlenmesi olarak

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

FISH ve in situ melezleme

FISH ve in situ melezleme FISH ve in situ melezleme In situ melezleme belirli bir mrna nın doku içinde nerede bulunduğunu görmemize yarar. Bu metod inceleyenin ilgilendiği mrna nın normal yerini görmesine olanak sağlar. In situ

Detaylı

Agaroz jel elektroforezi

Agaroz jel elektroforezi MOLEKÜLER TEKNİKLER Dr. Naşit İĞCİ Nevşehir Hacı Bektaş Veli Üniversitesi Moleküler Biyoloji ve Genetik Bölümü 4. Sınıf (2017-2018 Bahar) 2. NOT Agaroz jel elektroforezi PAGE daha çok proteinlerin ve küçük

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

REKOMBİNANT DNA TEKNOLOJİSİ. Araş. Gör. Dr. Öğünç MERAL

REKOMBİNANT DNA TEKNOLOJİSİ. Araş. Gör. Dr. Öğünç MERAL Araş. Gör. Dr. Öğünç MERAL 1960 lardan bu yana genetik ve moleküler biyolojideki kavrayışımızın hızla artması, biyoteknolojide heyecan verici buluşlar ve uygulamalara yol açtı. DNA yapısı ve fonksiyonlarının

Detaylı

NEDEN BİYOİNFORMATİK?

NEDEN BİYOİNFORMATİK? 127 NEDEN BİYOİNFORMATİK? Rengün Çetin ATALAY* Recent progresses in molecular biology have revealed the large fractions of the genome sequences of several species during the last decades. Public sequence

Detaylı

Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2

Detaylı

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8 DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS BİYOİNFORMATİĞE GİRİŞ BTEC 513 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce

Detaylı

Genetik Kavramlar Sekizinci baskıdan çeviri Klug, Cummings, Spencer

Genetik Kavramlar Sekizinci baskıdan çeviri Klug, Cummings, Spencer Genetik Kavramlar Sekizinci baskıdan çeviri Klug, Cummings, Spencer 1 Genetiğe Giriş Copyright 2006 Pearson Prentice Hall, Inc. 1-Genetiğe giriş 1.1 100 yıldan daha kısa zamanda Mendel den DNA ya 1.2 İkili

Detaylı

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni.

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni. BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr Özgeçmişimim Postdoctoral

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine

Detaylı

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D.

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. DR. ONUR YILMAZ Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. Koç Katımı Çiftleşme mevsiminde kızgınlık gösteren koyunun koç ile birleştirilmesi olayına koç katımı

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ DNA Polimorfizminin tanımlanması Bireyler arasındaki genetik farklılıkların belirlenmesini sağlar. Polimorfizm

Detaylı

BİO 775 PROTEOMİK ve GENOMİK

BİO 775 PROTEOMİK ve GENOMİK 1 BİO 775 PROTEOMİK ve GENOMİK SEQUENCE TAGGED SITES (STSs) EXPRESSED SEQUENCE TAG (ESTs) S. Esin SELÇUK 2006 2 SEQUENCE TAGGED SITES (STSs) STS; genomda 200-300 baz uzunluğundaki kısa bir bölgedir ve

Detaylı

GÖĞÜS HASTALIKLARINDA GENETİK ARAŞTIRMA. Prof. Dr. Nejat Akar Ankara Üniversitesi

GÖĞÜS HASTALIKLARINDA GENETİK ARAŞTIRMA. Prof. Dr. Nejat Akar Ankara Üniversitesi GÖĞÜS HASTALIKLARINDA GENETİK ARAŞTIRMA Prof. Dr. Nejat Akar Ankara Üniversitesi DNA RNA Genomik Transkriptomik Gen Dizileri, SNPs RNA Protein Hücre Doku Organ Proteomik Diferansiyel Proteomik Fonksiyonel

Detaylı

Differential Display. Özgür Çakır

Differential Display. Özgür Çakır Differential Display Özgür Çakır Differential gen anlatımı Gelişmeye bağlı gen anlatımı değişiklikleri Ortam uyaranları ile gen anlatımı değişimleri Doku veya hücreye özel gen anlatımları Farklı anlatım

Detaylı

GENETİK DOKTORA PROGRAMI DERS TANITIM TABLOSU

GENETİK DOKTORA PROGRAMI DERS TANITIM TABLOSU GENETİK DOKTORA PROGRAMI DERS TANITIM TABLOSU Dersin Kodu ve Adı GEN 601 Genetik Danışma Prof. Dr. Koray Boduroğlu 501+502+503+506 1 yarıyıl (2 teorik, haftada toplam 2 saat) Aile ağacı, Mendel kalıtımı,

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

Rekombinant DNA, Klonlama ve kullanımı

Rekombinant DNA, Klonlama ve kullanımı Rekombinant DNA, Klonlama ve kullanımı Betül ÖZTAŞ Gamze ÇALIŞKAN Betül ERÇELİK ÖZET GİRİŞ Günümüzde gen klonlaması çalışmaları; gen izolasyonu, gen bankalarının oluşturulması, genlerin güvenlik altına

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

Sekansın Temelleri ve Sekans Bazlı Çalışma Doç. Dr. Fatih Özaltın Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Nefroloji Ünitesi Nefrogenetik Laboratuvarı TİGED-24 Nisan 2011 Dalaman Çekirdekte DNA kromatin

Detaylı

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği sirna Doç.Dr. Metiner Tosun EÜ Eczacılık Fakültesi Farmakoloji AD Trabzon Ekim 07 Geleneksel ilaç geliştirme fazları: Doğrusal süreç 1-5 yıl

Detaylı

BİLECİK ŞEYH EDEBALİ ÜNİVERSİTESİ FEN EDEBİYAT FAKÜLTESİ MOLEKÜLER BİYOLOJİ VE GENETİK BÖLÜMÜ EĞİTİM ÖĞRETİM YILI 1. SINIF (N.

BİLECİK ŞEYH EDEBALİ ÜNİVERSİTESİ FEN EDEBİYAT FAKÜLTESİ MOLEKÜLER BİYOLOJİ VE GENETİK BÖLÜMÜ EĞİTİM ÖĞRETİM YILI 1. SINIF (N. PAZARTESİ SALI ÇARŞAMBA PERŞEMBE 2017-2018 EĞİTİM ÖĞRETİM YILI 1. SINIF (N.Ö.) GÜZ DÖNEMİ DERS GÜN SAAT DERSİN ADI DERSLİK 09:00 10:00 11:00 İş Güvenliği T F105 İş Güvenliği T F105 08:00 09:00 10:00 Atatürk

Detaylı

DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel

Detaylı

Kromozom Anomalilerinin Tanısında Gelişmeler; Kromozomal Karyotipten Moleküler Karyotipe

Kromozom Anomalilerinin Tanısında Gelişmeler; Kromozomal Karyotipten Moleküler Karyotipe Kromozom Anomalilerinin Tanısında Gelişmeler; Kromozomal Karyotipten Moleküler Karyotipe Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD, 2012 Kromozom Anomalilerinin

Detaylı

1. Sınıf Güz Dönemi I. Hafta Pazartesi Salı Çarşamba Perşembe Cuma Ders Saati

1. Sınıf Güz Dönemi I. Hafta Pazartesi Salı Çarşamba Perşembe Cuma Ders Saati I. Hafta Ders Saati 15.09.2014 16.09.2014 17.09.2014 18.09.2014 19.09.2014 Atatürk İlkeleri ve İnkılap Tarihi I: Atatürk İlkeleri ve İnkılap Tarihi I: Makromoleküller (Yrd. Doç. Dr. Mehmet Ataş) Türk Dili

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

XXXVII. Türk Mikrobiyoloji Cemiyeti Kongresi, Antalya, Kasım 2016HIV- AIDS Bilgilendirme Eğitimi

XXXVII. Türk Mikrobiyoloji Cemiyeti Kongresi, Antalya, Kasım 2016HIV- AIDS Bilgilendirme Eğitimi XXXVII. Türk Mikrobiyoloji Cemiyeti Kongresi, Antalya, 17-20 Kasım 2016HIV- AIDS Bilgilendirme Eğitimi 1 Abakavir Aşırı Duyarlılık Riskinin Araştırılmasında HLA-B*57:01 Testini Nasıl Kullanıyoruz? Dr.

Detaylı

DNA dan Kromozomlara

DNA dan Kromozomlara DNA dan Kromozomlara Giriş DNA nın genetik bilgiyi barındırdığının anlaşılmasından sonra; DNA nın genler halinde nasıl organize olduğu ve Genetik işlevin kromozomlar halinde nasıl organize olduğu araştırılmaya

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI)

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Adli Biyolojik Incelemeler ve Molekuler Genetik Kursu DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Yrd. Doç. Dr. GÖNÜL FİLOĞLU İ.Ü. ADLİ TIP ENSTİTÜSÜ KRİMİNAL İDANTİFİKASYONDA DNA TİPLEMESİ Moleküler

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ Doç.Dr. Aynur KARADENİZLİ Kocaeli Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Francisella tularensis Küçük, aerobik, pleomorfik,

Detaylı

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi KRAS Mutasyon Tespit Kiti Teknik Şartnamesi 1. KRAS testi ile insan KRAS geninin kodon 12, kodon 13 ve kodon 61 deki mutasyonlarının kantitatif ölçümü 2. Yöntem dizi analizine dayalı pyrosequencing metodu

Detaylı

FUNGAL SALGINLARIN ARAŞTIRILMASI;

FUNGAL SALGINLARIN ARAŞTIRILMASI; FUNGAL SALGINLARIN ARAŞTIRILMASI; kullanılan yöntemler, RAPD ve rdna IS1 sekans analizi uygulamaları Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. Yatan hasta

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN Bünyamin ATMIŞ DANIŞMAN Yrd. Doç. Dr. Dilek TURGUT BALIK 1. PARMAKİZİ 2. DNA PARMAKİZİ 3.

Detaylı

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır.

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır. TIBBİ GENETİK I-DERS TANIMLARI 1-Tanım: DNA ve RNA yapısının öğretilmesi. b. Amaç: DNA nın genetik materyal olmasında moleküler yapısının önemi ve RNA yapısının proteine geçiş ve gen ekspresyonu kontrolündeki

Detaylı

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

DNA Mikroarrayler: SNP analizleri

DNA Mikroarrayler: SNP analizleri Hafta IX Genombilimde Mikrodizin Uygulamaları ve iyoinformatik Analiz DNA Mikroarrayler: SNP analizleri Doç. Dr. Hilâl Özdağ DNA Mikrodizin Genomik Dizi SNP 5 T / G 3 SNP prob = 25 baz Perfect Match Mismatch

Detaylı

PEDİATRİK MAKROTROMBOSİTOPENİLİ OLGULARDA MYH9 & TUBB1 GEN MUTASYONLARI

PEDİATRİK MAKROTROMBOSİTOPENİLİ OLGULARDA MYH9 & TUBB1 GEN MUTASYONLARI PEDİATRİK MAKROTROMBOSİTOPENİLİ OLGULARDA MYH9 & TUBB1 GEN MUTASYONLARI 1 Didem Torun Özkan, 2 Abdullah A. Waheed, 3 Yeşim Oymak, 3 Canan Vergin, 2 Ayten Kandilci, 4 Nejat Akar 1. Okan Üniversitesi, Sağlık

Detaylı

BİYOİNFORMATİK AYÇA İŞLEK OĞUZHAN DEMİROK HURİYE VERİM ADEM DUMAN

BİYOİNFORMATİK AYÇA İŞLEK OĞUZHAN DEMİROK HURİYE VERİM ADEM DUMAN BİYOİNFORMATİK AYÇA İŞLEK OĞUZHAN DEMİROK HURİYE VERİM ADEM DUMAN BİYOİNFORMATİKNEDİR? Biyoinformatik, biyomedikal araştırmaların, tıpta ve biyolojide elde edilen bilgilerin bilgisayar yardımı ile bu alandaki

Detaylı

KHDAK hastalarının Moleküler Patoloji raporunda neler olmalı?

KHDAK hastalarının Moleküler Patoloji raporunda neler olmalı? KHDAK hastalarının Moleküler Patoloji raporunda neler olmalı? Tibbi Onkoloji kongresi 19-23 Mart 2014 Dr Büge Öz İÜ, Cerrahpaşa Tıp Fakültesi Patoloji AD Hiçbir çıkar ilişkim yoktur. Recommended procedure

Detaylı

REKOMBİNANT DNA TEKNOLOJİSİ

REKOMBİNANT DNA TEKNOLOJİSİ REKOMBİNANT DNA TEKNOLOJİSİ Rekombinant-DNA teknolojisinin gelişimindeki önemli atlama taşları: 1860-1865 Gregor Mendel Bezelye çaprazlamaları ile döllere gen geçişini ilk kez ortaya çıkardı 1953 Watson

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

Risk Yönetimi. Gürcan Banger

Risk Yönetimi. Gürcan Banger Risk Yönetimi Gürcan Banger Risk Yönetimine giriş Bu sunumun amacı, sivil toplum alanında hizmet tedarik projelerinde, süreç boyunca ortaya çıkması muhtemel risk alanlarının tespiti ve takibi ile oluşabilecek

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

mirna Profilleri Hepatoselüler Kansere Gidişte Marker Olabilir mi?

mirna Profilleri Hepatoselüler Kansere Gidişte Marker Olabilir mi? mirna Profilleri Hepatoselüler Kansere Gidişte Marker Olabilir mi? RÜÇHAN YAZAN SERTÖZ EGE ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ MİKROBİYOLOJİ ANABİLİM DALI HSK 6. büyük malignite Kanserden 2.sıklıkta ölüm

Detaylı

NRAS Mutasyon Kiti Teknik Şartnamesi

NRAS Mutasyon Kiti Teknik Şartnamesi NRAS Mutasyon Kiti Teknik Şartnamesi 1- Sistem ile PCR ürünlerinden direkt olarak dizi analizi yapılabilmeli, ayrıca cycle sequencing işlemine gerek kalmamalıdır. 2- Sistemde dizinin sentezi ile deteksiyonu

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces YAPAY KROMOZOMLAR Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces cerevisiae. de kurulmuştur. Halkasal plazmid maya sentromerinden,replikasyon orijininden, seçici bir işaret geninden ve

Detaylı

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.

Detaylı

Tularemi: Tanı yöntemleri. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD

Tularemi: Tanı yöntemleri. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD Tularemi: Tanı yöntemleri Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD Dünyada Tularemi Francisella tularensis: Taksonomi Bacterium tularensis Tulare kasabası, Kaliforniya, Dr.

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Yrd. Doç. Dr. Neşe Direk Dokuz Eylül Üniversitesi Psikiyatri Anabilim Dalı Genetik Epidemiyoloji ve Psikiyatri Genome-Wide vs. Aday Gen Asosiyasyon

Detaylı

MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ FEN FAKÜLTESİ MOLEKÜLER BİYOLOJİ ve GENETİK BÖLÜMÜ LİSANS PROGRAMI DERS PLANI

MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ FEN FAKÜLTESİ MOLEKÜLER BİYOLOJİ ve GENETİK BÖLÜMÜ LİSANS PROGRAMI DERS PLANI MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ FEN FAKÜLTESİ MOLEKÜLER BİYOLOJİ ve GENETİK BÖLÜMÜ LİSANS PROGRAMI DERS PLANI Ders Kodu Ders Adı Sınıf Yarıyıl Kredi T U L K Z/S BİY 1801 Genel Biyoloji I 1 1 3 0 0 4 Z

Detaylı

DNA NEDİR? NASIL KEŞFEDİLDİ

DNA NEDİR? NASIL KEŞFEDİLDİ DNA NEDİR? NASIL KEŞFEDİLDİ DNA, Deoksiribonükleik asit in kısaltılmış halidir. DNA, canlılardaki biyolojik işlemlerin şifresini taşıyan genleri oluşturur. DNA Nedir? Vücudumuzdaki her hücrede, 23 çift

Detaylı

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ GENOM PROJELERĐ Doç. Dr. Hilâl Özdağ Genom Projeleri Dizileme Klon kütüphaneleri Stratejiler Genom Dizilemesi Tekrar eden DNA dizileri Biraraya getirme (Assembly) PHRAP, PHRED,CONSED Bitiş Boşlukların

Detaylı

POYRAZ TIBBİ CİHAZLAR EDVOTEK

POYRAZ TIBBİ CİHAZLAR EDVOTEK POYRAZ TIBBİ CİHAZLAR EDVOTEK EDVOTEK VİZYON Edvotek, bir çok disiplini bir araya getirerek karmaşık gibi görünen birçok bilimin temellerini anlatarak «Nasıl bilim adamı yetiştiririz?» sorusuna karşılık

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) 11:30 12:15 Tıbbi Biyoloji ve Genetik: DNA. Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma)

Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) 11:30 12:15 Tıbbi Biyoloji ve Genetik: DNA. Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) HÜCRE BİLİMLERİ DERS KURULU III KURUL SORUMLUSU: DOÇ. DR. A.YEŞİM GÖÇMEN KURUL SORUMLUSU YARDIMCISI: YRD. DOÇ. DR. TEKİN YILDIRIM TIP103 HÜCRE BİLİMLERİ DERS KURULU III I. HAFTA 06.02.2017 (Pazartesi)

Detaylı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı MIKROARRAY TEKNOLOJİSİ Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı 2602040083 vshancer@yahoo.com EŞ ANLAMLILAR Biochip DNA chip DNA microarray Gene array 2 Neden bu teknolojiye ihtiyaç

Detaylı

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.

Detaylı

İnformatik/Enformatik (Informatics): Bilgi ve bilgisayar bilgi sistemleri ile ilgilenir. Bilgi işlenmesi, bilgi sistemlerinin mühendisliği

İnformatik/Enformatik (Informatics): Bilgi ve bilgisayar bilgi sistemleri ile ilgilenir. Bilgi işlenmesi, bilgi sistemlerinin mühendisliği BİYOİNFORMATİK I DERSİ İÇİN BAZI NOTLAR Dr. Naşit İĞCİ Biyoloji İnformatik/Enformatik (Informatics): Bilgi ve bilgisayar bilgi sistemleri ile ilgilenir. Bilgi işlenmesi, bilgi sistemlerinin mühendisliği

Detaylı