DNA TEKNOLOJİSİNİN GELİŞİMİ

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "DNA TEKNOLOJİSİNİN GELİŞİMİ"

Transkript

1 İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap s 1957 Kornberg DNA polimeraz enziminin keşfi 1966 Nirenberg Genetik kodun keşfi 1967 Gellert DNA ligaz enziminin keşfi 1973 Boyer,Cohen & Berg DNA klonlana tekniğinin gelişmesi 1975 Southern Southern blot ve hibridizasyon 1976 Sanger & Barrell - Maxam & Gilbert DNA dizi analizi 1982 Palmiter & Brinster Transgenik farelerin üretilmesi 1985 Mullis Polimeraz zincir reaksiyonu : PCR 1990 İnsan Genom Projesinin başlat lmas 2001 İnsan genomunun taslağ tamamland 2003 İnsan genom projesi tamamland 1

2 GENOMDAKİ POLİMORFİK DİZİLER RFLP (Restriction Fragment Length Polymorphism) Diğer DNA Polimorfizmleri Minisatellitler ( baz çifti tekrarlar) VNTR (Variable Number of Tandem Repeats) Mikrosatellitler (CA tekrarlar ; 2-10 baz çifti tekrarlar) STR (Short Tandem Repeats) Tek nükleotid değişimleri SNP (Single Nucleotid Polymorphism) SNP Baz toplumlarda normal kişilerde genomik DNA n n tek baz çiftlik pozisyonunda farkl sekans alternatiflerinin (allel) bulunmas d r. Bu farkl allellerin s kl ğ %1 den daha fazla olmal d r. GTCACCATAGGATCCT CAGTGGTATCCTAGGA 1bp GTCACCATAGGCTCCT CAGTGGTATCCGAGGA 2

3 SNP İnsan genom varyasyonlar n n büyük çoğunluğu tüm toplumlarda müşterektir. SNP lerin sadece %15 kadar bir topluluğa özeldir. Bu say n n 11 milyona ç kacağ tahmin edilmektedir. Kompleks Hastal klar Oligogenik veya poligenik olabilir. Allelik heterojenite olabilir. Lokus heterojenitesi olabilir. Genler aras ndaki ilişki, additif, sinerjistik, epistatik olabilir. Patolojinin ortaya ç kmas için bir eşik düzeyin aş lmas gerekebilir. 3

4 Kompleks Hastal klar Vaka ve kontrolün seçildiği test toplumu homojen ve iyi karakterize edilmiş olmal d r. Bağlant ve assosiasyon çal şmas mümkünse birlikte yap lmal d r. Bir veya birkaç marker la saptanan negatif assosiasyon, riski ekarte etmek için yeterli olmamal d r. Bir seri pozitif assosiasyon da patojenik sekans lokalize etmek ve tan mlamak için yeterli olmayabilir real-time PCR 5700 Applied Biosystems icycler BioRad 7700 Applied Biosystems LightCycler Roche FluorTracker Stratagene FluorImager Molecular Dynamics 4

5 5

6 6

7 7

8 8

9 9

10 FRET (Fluorescence Resonance Energy Transfer) using adjacent hybridization probes Excitation FRET Emission P FITC Red 640 Phosphate P Amplicon 10

11 real-time LightCycler real-time real-time Operation RT PCR H zl, çok say da örnek, kontaminasyon oran n n düşük olmas, duyarl, bilgisa-yar destekli, maliyet Teknoloji 2 hedef ile s n rl, ilk yat r m pahal, yeni protol geliştirilmesi güç. 11

12 DNA DİZİ ANALİZİ DNA DİZİ ANALİZİ 12

13 DNA DİZİ ANALİZİ DNA DİZİ ANALİZİ 13

14 DNA DİZİ ANALİZİ DNA DİZİ ANALİZİ 14

15 DNA DİZİ ANALİZİ MUTANT NORMAL Mikroarray (DNA chip) -K sa oligonükleotid diziler Yüksek çözünürlüklü SNP analizleri için geliştirildiler -İstatistik programlar ile kopya say s ndaki kazan m ve kay plar hesaplamak olanakl hale geldi -10K, 100K, 500K SNP 6kb lik aral kta tarama -Anne-baba DNA taramas birlikte yap l rsa: uniparantel dizomi ve hücre kontaminasyonu gösterilebilir de novo mutasyon patolojik/normal? 15

16 DNA Genotyping RNA Eukaryotic Cell Gene Expression: Which genes? How much? Mikroarray Uygulamalar Ekspresyon düzeyi (cdna array); Genotipleme; DNA kopyasay s (CGH); Protein bağlanma bölgesinin belirlenmesi; Gen ürünlerinin hücre d ş nda lokalize edilmesi; 16

17 Mikroarray Uygulamalar Kanser araşt rmalar : Genomda (tümör dokusunda) moleküler yap n n ortaya konmas ile etkin tan ve tedavi. Immünoloji: Enfeksiyonlarda konağ n genomik cevab... Farmakoloji: Ekpresyon profiline göre tedavi yan t n n önceden belilenmesi

18 Chemistry (Wafer Prep) Photolithography Cartridge Assembly 18

19 Mikroarray (DNA chip) Probe array Hybridized array Tagged nucleic acid Detect Fluorescent Stain Mikroarray (DNA chip) 19

20 Mikroarray (DNA chip) Yöntem DNA Zaman Çözünürlük Prob Karyotipleme ++++ yavaş 5-10 Mb - FISH +++ yavaş 1-5 Mb + Array-CGH +++ orta 1 Mb - Mikroarray 10K, 100K, 500K + h zl kb - -DNA Chip - Protein Chip - Lab on a chip? 20

21 Bioinformatik Bioinformatik Heryerde - istatistik, dizayn ve analiz: Deney öncesi, önerme, buluş ve tan mlama, vb. - İç ve d ş veri tabanlar nda karş laşt rma. - Nukleotid ve protein sekans verileri, moleküler modelleme 21

22 - Biyoinformatik: biyoloji, bilişim teknolojisi ve bilgisayar bilimlerini bir araya getiren bir bilim dal d r. En önemli amac, genom düzeyinde saklanan ve gerektiğinde kullan lan yaşam şifresininin keşfedilmesidir. -Biyoinformatikçal şmalar n n da katk s yla, gelişimsel biyolojiden kanserin tan ve tedavisine kadar bir çok biyolojik olay n alt nda yatan mekanizmalar aç ğa ç kar labilir. 22

23 - Biyolojik bilgiler ile ilgili veri taban oluşturulup yönetilmesi, - genom ve dizi analizleri, -işlevsel genomik ve ilgili veri analizi, - birincil protein dizisinden protein yap tahmini (3D), - hücresel olaylar n modellenip in sliko gerçekleştirilmesi. 23

24 - Nükleotid veri tabanlar Bağ ms z olarak toplamakta iken, h zla artan dizi verilerini tekbir kaynakta toplamak için tüm nükelotid dizi verilerini toplayan uluslararas işbirliği gurubu (International Nucleotide Sequence Database Collaboration) başl ca DNA dizilerini içeren üç merkez olan Japon (DDBJ), Avrupa (EMBL)), ve Amerikan (GenBank, NCBI) taraf ndan kuruldu. 24

25 - Genom ve dizi analizleri Dizi eşleme yöntemlerine (sequence alignment) dayanan dizilerinde belli bir oran n üstünde benzerlik gösteren (homolog) genlerin araşt r lmas s kça veri tabanlar n n kullan lmas n gerektirmektedir. 25

26 - Bu verileri saklayacak, birleştirecek, erişimini ve çözümlenmesini sağlayacak araçlar n geliştirilmesi öncelikli gerekesinimlerden biridir. - Hücre içi fizyolojik olaylar n, proteinler aras ilişkiler sonucu oluşan sinyal ileti yollar n n biyoinformatik ile modellenmesi gerekmektedir. DNA RNA Protein Fenotip A. Biyolojinin ana dogmas Genetik Moleküler Kimyasal Fenotip bilgi yap işlev B. Biyoinformatiğin ana dogmas Şekil 6: A ve B Biyoloji ve biyoinformatikte bilginin kullanm ak ş 26

27 - Biyoinformatik ve Gelecek Önümüzdeki y l içerisinde biyoinformatik bilimindeki gelişmeler ile: - biyokimyasal işlev, -yap sal bilgi ve - evrimsel ipuçlar bulunarak, hastal klar n temellerinin ortaya konmas n sağlanacakt r. 27

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

Bitki Moleküler Biyolojisi. Prof. Dr. Nermin Gözükırmızı

Bitki Moleküler Biyolojisi. Prof. Dr. Nermin Gözükırmızı Bitki Moleküler Biyolojisi Prof. Dr. Nermin Gözükırmızı Bitki Moleküler Biyolojisi moleküler tekniklere dayalı bir bilim dalıdır. Dizileme, PCR, cdna, transkriptomik, proteomik, transformasyon, high-resolution

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz Genom Sayısal ve Yapısal Mutasyonlar Prof. Dr. Fatma Savran Oğuz Organizmanın haploid hücredeki tüm gen ve gen dışı bölgelerinden oluşan kalıtsal maddenin tamamı Genom bir kişinin taşıdığı tüm genetik

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Dr. Muradiye Nacak Gaziantep Üniversitesi Tıp Fakültesi Farmakoloji Anabilim Dalı 4Kasım, 2009 Sunum Planı Farmakogenetik,

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

Comparative Genomic Hybridization (CGH)

Comparative Genomic Hybridization (CGH) CGH, ARRAY-CGH Comparative Genomic Hybridization (CGH) CGH sitogenetik tekniğini ilk defa, Kallioniemi ve ark. 1992 de Science da yayınlattıkları çalışmaları ile ortaya koydular. Kallioniemi A, Kollioniemi

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU DOKTORA DERS KATALOĞU ERCİYES ÜNİVERSİTESİ GDM 638 Lipid Kimyası Zorunlu DERS SAATİ: 3 Bahar Yrd. Doç. Dr. Hasan YALÇIN KREDİSİ :3 Tel:(352) 4374901 (32731), E-mail: hyalcin@erciyes.edu.tr, Web sayfası

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

FISH ve in situ melezleme

FISH ve in situ melezleme FISH ve in situ melezleme In situ melezleme belirli bir mrna nın doku içinde nerede bulunduğunu görmemize yarar. Bu metod inceleyenin ilgilendiği mrna nın normal yerini görmesine olanak sağlar. In situ

Detaylı

NEDEN BİYOİNFORMATİK?

NEDEN BİYOİNFORMATİK? 127 NEDEN BİYOİNFORMATİK? Rengün Çetin ATALAY* Recent progresses in molecular biology have revealed the large fractions of the genome sequences of several species during the last decades. Public sequence

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8 DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS BİYOİNFORMATİĞE GİRİŞ BTEC 513 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce

Detaylı

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni.

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni. BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr Özgeçmişimim Postdoctoral

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine

Detaylı

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D.

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. DR. ONUR YILMAZ Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. Koç Katımı Çiftleşme mevsiminde kızgınlık gösteren koyunun koç ile birleştirilmesi olayına koç katımı

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ DNA Polimorfizminin tanımlanması Bireyler arasındaki genetik farklılıkların belirlenmesini sağlar. Polimorfizm

Detaylı

BİO 775 PROTEOMİK ve GENOMİK

BİO 775 PROTEOMİK ve GENOMİK 1 BİO 775 PROTEOMİK ve GENOMİK SEQUENCE TAGGED SITES (STSs) EXPRESSED SEQUENCE TAG (ESTs) S. Esin SELÇUK 2006 2 SEQUENCE TAGGED SITES (STSs) STS; genomda 200-300 baz uzunluğundaki kısa bir bölgedir ve

Detaylı

GENETİK DOKTORA PROGRAMI DERS TANITIM TABLOSU

GENETİK DOKTORA PROGRAMI DERS TANITIM TABLOSU GENETİK DOKTORA PROGRAMI DERS TANITIM TABLOSU Dersin Kodu ve Adı GEN 601 Genetik Danışma Prof. Dr. Koray Boduroğlu 501+502+503+506 1 yarıyıl (2 teorik, haftada toplam 2 saat) Aile ağacı, Mendel kalıtımı,

Detaylı

Differential Display. Özgür Çakır

Differential Display. Özgür Çakır Differential Display Özgür Çakır Differential gen anlatımı Gelişmeye bağlı gen anlatımı değişiklikleri Ortam uyaranları ile gen anlatımı değişimleri Doku veya hücreye özel gen anlatımları Farklı anlatım

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Sekansın Temelleri ve Sekans Bazlı Çalışma Doç. Dr. Fatih Özaltın Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Nefroloji Ünitesi Nefrogenetik Laboratuvarı TİGED-24 Nisan 2011 Dalaman Çekirdekte DNA kromatin

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği sirna Doç.Dr. Metiner Tosun EÜ Eczacılık Fakültesi Farmakoloji AD Trabzon Ekim 07 Geleneksel ilaç geliştirme fazları: Doğrusal süreç 1-5 yıl

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ Doç.Dr. Aynur KARADENİZLİ Kocaeli Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Francisella tularensis Küçük, aerobik, pleomorfik,

Detaylı

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI)

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Adli Biyolojik Incelemeler ve Molekuler Genetik Kursu DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Yrd. Doç. Dr. GÖNÜL FİLOĞLU İ.Ü. ADLİ TIP ENSTİTÜSÜ KRİMİNAL İDANTİFİKASYONDA DNA TİPLEMESİ Moleküler

Detaylı

Kromozom Anomalilerinin Tanısında Gelişmeler; Kromozomal Karyotipten Moleküler Karyotipe

Kromozom Anomalilerinin Tanısında Gelişmeler; Kromozomal Karyotipten Moleküler Karyotipe Kromozom Anomalilerinin Tanısında Gelişmeler; Kromozomal Karyotipten Moleküler Karyotipe Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD, 2012 Kromozom Anomalilerinin

Detaylı

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi KRAS Mutasyon Tespit Kiti Teknik Şartnamesi 1. KRAS testi ile insan KRAS geninin kodon 12, kodon 13 ve kodon 61 deki mutasyonlarının kantitatif ölçümü 2. Yöntem dizi analizine dayalı pyrosequencing metodu

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN Bünyamin ATMIŞ DANIŞMAN Yrd. Doç. Dr. Dilek TURGUT BALIK 1. PARMAKİZİ 2. DNA PARMAKİZİ 3.

Detaylı

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır.

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır. TIBBİ GENETİK I-DERS TANIMLARI 1-Tanım: DNA ve RNA yapısının öğretilmesi. b. Amaç: DNA nın genetik materyal olmasında moleküler yapısının önemi ve RNA yapısının proteine geçiş ve gen ekspresyonu kontrolündeki

Detaylı

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

DNA Mikroarrayler: SNP analizleri

DNA Mikroarrayler: SNP analizleri Hafta IX Genombilimde Mikrodizin Uygulamaları ve iyoinformatik Analiz DNA Mikroarrayler: SNP analizleri Doç. Dr. Hilâl Özdağ DNA Mikrodizin Genomik Dizi SNP 5 T / G 3 SNP prob = 25 baz Perfect Match Mismatch

Detaylı

REKOMBİNANT DNA TEKNOLOJİSİ

REKOMBİNANT DNA TEKNOLOJİSİ REKOMBİNANT DNA TEKNOLOJİSİ Rekombinant-DNA teknolojisinin gelişimindeki önemli atlama taşları: 1860-1865 Gregor Mendel Bezelye çaprazlamaları ile döllere gen geçişini ilk kez ortaya çıkardı 1953 Watson

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

Risk Yönetimi. Gürcan Banger

Risk Yönetimi. Gürcan Banger Risk Yönetimi Gürcan Banger Risk Yönetimine giriş Bu sunumun amacı, sivil toplum alanında hizmet tedarik projelerinde, süreç boyunca ortaya çıkması muhtemel risk alanlarının tespiti ve takibi ile oluşabilecek

Detaylı

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.

Detaylı

NRAS Mutasyon Kiti Teknik Şartnamesi

NRAS Mutasyon Kiti Teknik Şartnamesi NRAS Mutasyon Kiti Teknik Şartnamesi 1- Sistem ile PCR ürünlerinden direkt olarak dizi analizi yapılabilmeli, ayrıca cycle sequencing işlemine gerek kalmamalıdır. 2- Sistemde dizinin sentezi ile deteksiyonu

Detaylı

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces YAPAY KROMOZOMLAR Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces cerevisiae. de kurulmuştur. Halkasal plazmid maya sentromerinden,replikasyon orijininden, seçici bir işaret geninden ve

Detaylı

Tularemi: Tanı yöntemleri. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD

Tularemi: Tanı yöntemleri. Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD Tularemi: Tanı yöntemleri Doç.Dr. Aynur Karadenizli Kocaeli Üniversitesi Tıbbi Mikrobiyoloji AD Dünyada Tularemi Francisella tularensis: Taksonomi Bacterium tularensis Tulare kasabası, Kaliforniya, Dr.

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Yrd. Doç. Dr. Neşe Direk Dokuz Eylül Üniversitesi Psikiyatri Anabilim Dalı Genetik Epidemiyoloji ve Psikiyatri Genome-Wide vs. Aday Gen Asosiyasyon

Detaylı

DNA NEDİR? NASIL KEŞFEDİLDİ

DNA NEDİR? NASIL KEŞFEDİLDİ DNA NEDİR? NASIL KEŞFEDİLDİ DNA, Deoksiribonükleik asit in kısaltılmış halidir. DNA, canlılardaki biyolojik işlemlerin şifresini taşıyan genleri oluşturur. DNA Nedir? Vücudumuzdaki her hücrede, 23 çift

Detaylı

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ GENOM PROJELERĐ Doç. Dr. Hilâl Özdağ Genom Projeleri Dizileme Klon kütüphaneleri Stratejiler Genom Dizilemesi Tekrar eden DNA dizileri Biraraya getirme (Assembly) PHRAP, PHRED,CONSED Bitiş Boşlukların

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı MIKROARRAY TEKNOLOJİSİ Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı 2602040083 vshancer@yahoo.com EŞ ANLAMLILAR Biochip DNA chip DNA microarray Gene array 2 Neden bu teknolojiye ihtiyaç

Detaylı

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.

Detaylı

Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) 11:30 12:15 Tıbbi Biyoloji ve Genetik: DNA. Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma)

Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) 11:30 12:15 Tıbbi Biyoloji ve Genetik: DNA. Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) HÜCRE BİLİMLERİ DERS KURULU III KURUL SORUMLUSU: DOÇ. DR. A.YEŞİM GÖÇMEN KURUL SORUMLUSU YARDIMCISI: YRD. DOÇ. DR. TEKİN YILDIRIM TIP103 HÜCRE BİLİMLERİ DERS KURULU III I. HAFTA 06.02.2017 (Pazartesi)

Detaylı

LABORATUARDA SEKANSLARIN TOPLANMASI VE DEPOLANMASI. Ayhan YILMAZ

LABORATUARDA SEKANSLARIN TOPLANMASI VE DEPOLANMASI. Ayhan YILMAZ BİYOİNFORMATİK: LABORATUARDA SEKANSLARIN TOPLANMASI VE DEPOLANMASI Ayhan YILMAZ Sunum Taslağı DNA NIN NIN SEKANSLANMASI Genomik Sekanslama Shotgun Sekanslama Eksprese Olan Genlerin cdna Kütüphanelerini

Detaylı

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ Yrd. Doç. Dr. Hakan GÜRKAN Trakya Üniversitesi Tıp Fakültesi Tıbbi Genetik Anabilim Dalı PGT NEDİR? Gebelik öncesi genetik tanı (PGT) adı verilen

Detaylı

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden

Detaylı

Biyobankalar. Prof.Dr.Meral Özgüç

Biyobankalar. Prof.Dr.Meral Özgüç Biyobankalar Prof.Dr.Meral Özgüç Hacettepe Üniversitesi, Tıp Fakültesi, Tıbbi Biyoloji Anabilim Dalı 14.05.2014 Genetik Genombilim Yüksek ölçekli teknolojiler Örnek kalite sayı Biyobankalar & Çerçeve Kuralları

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

Genetikten Genombilime Geçişte Transkriptom Analizleri

Genetikten Genombilime Geçişte Transkriptom Analizleri Genetikten Genombilime Geçişte Transkriptom Analizleri Doç.Dr. Hilâl Özdağ AÜ iyoteknoloji Enstitüsü Mammals Other chordates Other eukaryotes Homo sapiens [NCI 35] Vega Gallus gallus [WASHUC1] Drosophila

Detaylı

Light Cycler Real Time PCR Teknolojisi ile Faktör V Geninde Yeni Mutasyon Taranması

Light Cycler Real Time PCR Teknolojisi ile Faktör V Geninde Yeni Mutasyon Taranması T.C. ANKARA ÜNĐVERSĐTESĐ BĐYOTEKNOLOJĐ ENSTĐTÜSÜ YÜKSEK LĐSANS TEZĐ Light Cycler Real Time PCR Teknolojisi ile Faktör V Geninde Yeni Mutasyon Taranması Biyolog S. Duygu SANLIDĐLEK Danışman Öğretim Üyesi

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil

Detaylı

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI 12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların genlerine

Detaylı

DNA ARAÇLARI ve BİYOTEKNOLOJİ

DNA ARAÇLARI ve BİYOTEKNOLOJİ DNA ARAÇLARI ve BİYOTEKNOLOJİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER DNA Düzenlenmesi İnsan DNA sı ile yapılan ilk çalışmalar için yani çalışma yöntemi geliştirilmesi için yaklaşık 1 milyon dolar

Detaylı

AFYON KOCATEPE ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ MOLEKÜLER BİYOLOJİ VE GENETİK ANABİLİM DALI BAŞKANLIĞI YÜKSEK LİSANS PROGRAMI

AFYON KOCATEPE ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ MOLEKÜLER BİYOLOJİ VE GENETİK ANABİLİM DALI BAŞKANLIĞI YÜKSEK LİSANS PROGRAMI YÜKSEK LİSANS PROGRAMI BİRİNCİ YIL BİRİNCİ YARIYIL ADI KREDİSİ* MBG-5501 UZMANLIK ALAN DERSİ Z 8 0 8 0 9 MBG-5601 TEZ HAZIRLIK ÇALIŞMASI Z 0 1 1 0 1 20 1 21 12 30 İKİNCİ YARIYIL ADI KREDİSİ* MBG-5502 UZMANLIK

Detaylı

yapılabilmelidir. 2- Yöntem dizi analizine dayalı olmalıdır ve bilinmeyen mutasyonları da tespit etmeye olanak

yapılabilmelidir. 2- Yöntem dizi analizine dayalı olmalıdır ve bilinmeyen mutasyonları da tespit etmeye olanak Glivec Direnci Mutasyon Analizi Testi Teknik Özellikleri 1- Glivec Direnci pyrosequencing testi ile BCR-ABL genindeki Y253H, Y253F, E255K, E255V,V299L, T315A, T3 l 5I, F3 l 7L, F3 l 7V, F359V, F359C mutasyonlarının

Detaylı

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β

Detaylı

Doç. Dr. Tijen Talas-Oğraş. TÜBĐTAK - Marmara Araştırma Merkezi Gen Mühendisliği ve Biyoteknoloji Enstitüsü

Doç. Dr. Tijen Talas-Oğraş. TÜBĐTAK - Marmara Araştırma Merkezi Gen Mühendisliği ve Biyoteknoloji Enstitüsü Bitki Biyoteknolojisi ve Açılımları YIBO-2009 Doç. Dr. Tijen Talas-Oğraş TÜBĐTAK - Marmara Araştırma Merkezi Gen Mühendisliği ve Biyoteknoloji Enstitüsü BĐYOTEKNOLOJĐ Biyoteknoloji; ürün oluşumu için biyolojik

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN: Dilek SADAK DANIŞMAN : Yrd. Doç. Dr. Dilek TURGUT-BALIK

Detaylı

CROSSMATCH (ÇAPRAZ KARŞILAŞTIRMA TESTİ)

CROSSMATCH (ÇAPRAZ KARŞILAŞTIRMA TESTİ) CROSSMATCH (ÇAPRAZ KARŞILAŞTIRMA TESTİ) Dr. İhsan Karadoğan V. Ulusal Kan Merkezleri ve Transfüzyon Tıbbı Kongresi 18-22 Kasım 2012 Antalya 1111 1111 1111 1111 UYGULAMA BASİT YORUM SON DERECE KARMAŞIK

Detaylı

ÖĞLE ARASI ÖĞLE ARASI

ÖĞLE ARASI ÖĞLE ARASI 1. HAFTA 7 Kasım 2016 Pazartesi 8 Kasım 2016 Salı 9 Kasım 2016 Çarşamba 10 Kasım 2016 Perşembe 11 Kasım 2016 Cuma Diş Anatomisi ve Morfolojisi 08.30-09.15 09.30-10.15 Dr. Gökçe Soğancı Mandibular santral,

Detaylı

ÇEVRE KORUMA TEMEL ALAN KODU: 85

ÇEVRE KORUMA TEMEL ALAN KODU: 85 TÜRKİYE YÜKSEKÖĞRETİM YETERLİLİKLER ÇERÇEVESİ () TEMEL ALAN YETERLİLİKLERİ ÇEVRE KORUMA TEMEL ALAN KODU: 85 ANKARA 13 OCAK 2011 İÇİNDEKİLER 1.BÖLÜM: ÖĞRENİM ALANLARI VE ÇALIŞMA YÖNTEMİ...3 1.1.ISCED 97

Detaylı

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD Genomiks Temeli DNA nın dizilenmesi ve elde edilen dizilerin biyoinformatiksel metotlar kullanılarak

Detaylı

Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD

Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD Prenatal tanıda amaç Fetustaki olası, genetik veya nongenetik nedenlerin yol açtığı, tedavisi olanaksız ciddi hastalık ve malformasyonların;

Detaylı

Ders 10 - Diğer küçük kodlamayan RNA lar

Ders 10 - Diğer küçük kodlamayan RNA lar Ders 10 - Diğer küçük kodlamayan RNA lar ü Yüksek organizmalar ait proteomlar nispeten durağandır. ü Bir bireyde diğer insanlara göre her haploid genomun ~3.000.000 dizisinin farklı olmasına rağmen, bu

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Kanser Biyolojisi ve Genetiği Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan

Detaylı

TÜBERKÜLOZ TANISINDA PCR

TÜBERKÜLOZ TANISINDA PCR 21. Yüzyılda Tüberküloz Sempozyumu ve II. Tüberküloz Laboratuvar Tanı Yöntemleri Kursu, Samsun TÜBERKÜLOZ TANISINDA PCR Doç. Dr. Cafer EROĞLU Ondokuz Mayıs Üniversitesi Tıp Fakültesi Klinik Mikrobiyoloji

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı