Moleküler Dizileme Teknolojileri

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Moleküler Dizileme Teknolojileri"

Transkript

1 Moleküler Dizileme Teknolojileri Dr. Güven Toksoy, PhD İstanbul Üniversitesi İstanbul Tıp Fakültesi Tıbbi Genetik AD :44 1

2 Klasik dizileme Sanger dizileme Maxim Gilbert dizileme tekniği Yeni nesil dizileme teknolojileri 2. Nesil dizileme Illumina (Reversible Dye Terminator) Ion Torrent (native dntp proton detection) Roche (Pyrosequencing) (çekildi, teknoloji değişikliği?) Solid ABI (Ligation based) (çekildi) 3. Nesil dizileme (henüz rutinde yok 2-3 yıl) PacBio Real time sequencing (amplifikasyon gerekmiyor) Helicos (Reversible Dye Terminator) (amplifikasyon gerekmiyor) Oxford Nanopore (porotic ion detection) (amplifikasyon gerekmiyor) :44 2

3 Karşılaştırma SANGER DİZİLEME Sınırlı büyüklük YENİ NESİL DİZİLEME (2. nesil) Tüm genoma kadar bp bp Tüm dizi tek çıktı Mozaiklik için yetersiz Dizi başına ~5 USD (baz başına 5/1000USD) Motiften bağımsız yüksek özgünlük Altyapı göreceli ucuz Run maliyeti ucuz* Her bir hedef için çok kopya Mozaiklik için uygun Exom ~500 USD (500/30x10 3 USD) Motife göre değişen özgünlük Altyapı pahalı Run maliyeti pahalı* :44 3

4 SANGER Dizileme PCR + + Dizilenecek PCR ürünü Dizilenecek hedef bölgeye uygun primer İşaretli dntp ve ddntp karışımı + (NH4) 2 SO (NH4) 4 2 SO 4 MgCL 2 MgCL MgCL 2 KCl 2 MgCL KCl (NH4) 2 2 SO KCl 4 + Polimeraz enzimi :44 4

5 Elektroforez* 3 G A C T A G A T A C G A G C G T G A 5 Template DNA 5 C T G A T C T A T G C T C G C A C T 3 Primer dizisi A G T C z a m a n CTGATCTATGCTCGCACT CTGATCTATGCTCGCAC CTGATCTATGCTCGCA CTGATCTATGCTCGC CTGATCTATGCTCG CTGATCTATGCTC CTGATCTATGCT CTGATCTATGC CTGATCTATG CTGATCTAT CTGATCTA CTGATCT CTGATC O K U M A Y Ö N Ü T C A C G C T C G T A T C *işaretli nükleotid ile sonlanmış binlerce kopya içeren fragmanlar :44 5

6 Yeni Nesil Dizileme Next generation sequencing (Yeni nesil dizileme) Deep sequencing (Derin dizileme) Massivelly parallel sequencing (Masif paralel dizileme) High-throughput sequencing (Yüksek kapasiteli dizileme) Second generation sequencing Illumina (Reversible Dye Terminator) Roche (Pyrosequencing) (??) Solid ABI (Ligation based) (çekildi) Ion Torrent (native dntp proton detection) Third generation sequencing PacBio Real time sequencing (amplifikasyon gerekmiyor) Helicos (Reversible Dye Terminator) (amplifikasyon gerekmiyor) Oxford Nanopore (porotic ion detection) (amplifikasyon gerekmiyor) :44 6

7 İş akışı Kütüphane hazırlanması (Library preparation) DNA örnekleri fragmante edilir (ya da hedef fragmanlar elde edilir), fragmanların ucuna platforma özgün adaptörler takılır PCR ile amplifiye edilir (platforma spesifik ortamda) Dizileme (Sequencing) Yeni nesil dizilemede DNA sentezi ve okuma işlemi aynı anda gerçekleşir ve eşzamanlı olarak bir çok dizileme yapılır (Massively parallel sequencing) (kısa okuma ve hatalı okumanın ana nedeni de bu işlem sırasındaki desenkronizasyondur) Veri analizi (Data analysis) RAW data analizi, dizilerin filtrelenmesi, assambling, varyasyon analizi, biyoinformatik analiz :44 7

8 Terimler De novo sequencing Resequencing Targeted sequencing Shotgun Targeted sequencing VERİ BÜYÜKLÜĞÜ Whole genome sequencing Exom sequencing Targeted sequencing Sanger sequencing normal Polimorfizm Gri bölge Patolojik/ olası patolojik :44 8

9 Yeni nesil dizileme ile tanı Lab iş gücü İşlem sonrası Elde edilen bilgi Normal diziler Nadir/de novo varyasyonlar ya da etkisi bilinmeyen mutasyonlar Polimorfizm Fenotip ilişkili mutasyon Biyoinformatikçi Sonuç :44 9

10 Yeni nesil dizileme ve cfdna çalışmaları :44 10

11 cfdna ile anöplodi taraması FİRMA-MARKA PLATFORM ANALİZ TEKNİĞİ ve ALGORİTMA BGI:NIFTY Illumina Hiseq& İon proton MPSS SEQUENOIM: Materni T21Plus Illumina Illumina Hiseq t-mpss Verinata Health: Verifi Prenatal test Illumina Hiseq S-MPSS Integrated Genetics: Ariosa: Harmony Illumina Hiseq DANSR + FORTE (t-mpss) Natera:Panorama Illumina Hiseq Non kantatif - SNP tabanlı targeted dizileme ~ SNP Premaitha healt: Iona test (2015 ocak) İon proton S-MPSS + Fetal fraksiyon düzeltmesi MPSS:Massively parallel signature sequencing FORTE:Fetal-fraction Optimized Risk of Trisomy Evaluation NIFTY, Natera ve Sequanom Digeorge ve diğer mikro del/dup sendromları için sonuç veriyor :44 11

12 Sayılar - 10 milyon adet bp uzunlukta dizi elde edildiinde total genomun yaklaşık %4 ü dizilenmiş oluyor. Bunlardan %50 si unique dizi. Chr13 için ~ , chr ve chr21 için dizi haritalanabiliyor. (H. Christina Fan, PNAS, October 2008) - Trizomi21 li fetus taşıyan gebelikte örnekten okuma elde edililirken sadece bu okunan dizilerden 21. kromozoma ait tanesi (%0,3) anöploidi hesaplamasında kullanılabiliyor (Chiu RW, Proc Natl Acad Sci USA 2008) - Fetal plasental DNA fraksiyonu kromozomal dozun hesaplanmasında çok önemli ve spesifiteyi arttırıyor.21. Kromozoma ait %4 oranında DNA taşıyorsa bunun trizomi durumunda %2 artış beklenmelidir. Yüksek güvenilirlik için yaklaşık adet 21. kromozoma ait dizinin elde edilmesi gerekir. Bu da 21. kromozom DNA yükü total genomun % 1,5 olduğu için toplam okunabilir dizi sayısının minimum 6.3 milyon, ortalama MPSS verimi %25 olduğundan yaklaşık örnek başına toplam okuma yapmak gerekmektedir. (Andrew B. Sparks, P APRIL American Journal of Obstetrics & Gynecology, 2012) - Targeted SNP çalışmalarında yaklaşık yüksek polimorfizm gösteren SNP bölgesi taranıyor :44 12

13 cfdna Plazmada serbest DNA fragmanları 300bp Köken: Plasenta sitotrofoblast ve sinsisyotrofoblast hücreleri apoptosis ve yıkımı Perferik kan Plazma Plasenta kökenli DNA <%10 Maternal DNA %90 Lenfositler Eritrositler - İnsan genomu ~3 milyar baz uzunluğunda - Rastgele kırılmış halde milyonlarca küçük fragman - chr13 %3,7; chr18 %2,5 chr21 %1.5 ini oluşturuyor - Plasental DNA parçacıkları total havuzda fraksiyon %10 ise chr13 % 0,37; chr18 %0,25; chr21 %0, :44 13

14 cfdna nın yeni nesil dizilemede kullanımı Kalitatif: Plasental DNA dan elde edilen baba kökenli dizide anneden farklı baz değişiminin gösterilmesi Kantitatif: Amplifikasyon sonrası karşılaştırmalı ürün artışının saptanması Plasental DNA Maternal lokus Plasental DNA Paternal lokus Maternal DNA Plasental DNA Mat Plasental DNA Pat :44 C G A C T A G A A G C G T G T C G T C A T T G C A T C G A Maternal DNA Plasental DNA amplifikasyon fark 14

15 cfdna da plasental DNA nın saptanması Y kökenli dizilerin total DNA havuzuna oranı SNP farklılılarının saptanması SNP : Genomda bulunan ve fenotipi etkilemeyen kısa baz değişiklikleridir. Toplumda değişik sıklıklarda saptanan SNP ler vardır. Genomda şimdilik bilinen SNP sayısı > ATGCTAGGAGGTGATTTCGCCAATGCGGCAGATACAGTAG ATGCTAGGAGGTGATTTCACCAATGCGGCAGATACAGTAG GTGATTTCGCCAATGCGGCAGATACAGTAG CTAGGAGGTGATTTCGCCAATGCGGCAGAT GGAGGTGATTTCGCCAATGCGGCAGATACAGTAG GCTAGGAGGTGATTTCGCCAATGCGGCAGATACAG ATGCTAGGAGGTGATTTCGCCAATGCGGCAGATACAGTAG TAGGAGGTGATTTCGCCAATGCGG GGTGATTTCGCCAATGCGGCAGATACAGTAG AGGAGGTGATTTCGCCAATGCGGCAGATA GGAGGTGATTTCGCCAATGCGGCAGATACAGTAG ATGCTAGGAGGTGATTTCGCCAATGCGGC TTTCGCCAATGCGGCAGATACAGTAG AGGAGGTGATTTCGCCAAT... ATGCTAGGAGGTGATTTCGCCAATGCG ATGCTAGGAGGTGATTTCACCAATGCGGCA ATGCTAGGAGGTGATTTCACCAATGCGGC.. ATGCTAGGAGGTGATTTCACCAATGCGGCAGAT %92!!! Aynı yöntem nokta mutasyonları ve Rh analizlerinde de kullanılmaktadır :44 15 %8

16 SNP tabanlı targeted dizileme (PANORAMA) ANNE SNP PROFİLİ T T/A C/C cfdna SNP PROFİLİ T G A C T A G A A G C G T G T A G T G A T T G C A T C G A G A C T A G A A G C G T G T A G T G A T T G C A T C G A T G G A C T A G A A G C G T G G A G T C A T T G C A T C G A G A C T A G A A G C G T G G A G T C A T T G C A T C G A G A C T A G A A G C G T G G A G T C A T T G C A T C G A G A C T A G A A G C G T G G A G T C A T T G C A T C G A :44 16 T/G G/C

17 Örnek alımı Maternal periferik kan ~10 ml standard EDTA içeren tüp (~8 saat) Özel CF DNA örnekleme tüpü (14 gün oda ısısı) (Streck Cellfree DNA BCT CE) :44 17

18 Genel Protokol Library preparation Cluster generation / Clonal amplification Massively parallel sequencing Mapping reads (Alignment) Quantifying reads Interpreting data Reporting :44 18

19 Library preparation Adaptör ve barkod eklenmesi - Adaptör DNA nın tutunmasını sağlar ve amplifikasyon sırasında primer görevi yapar. - Barkod aynı çalışmada çalışılan örneklerin birbirinden ayrılmasını sağlar :44 19

20 Cluster generation / Clonal amplification İllumina İon torrent DNA polimeraz PCR reaksiyonu :44 20

21 Massively parallel sequencing Illumina Ion torrent :44 21

22 Kantitatif Yöntem; Fetus NORMAL Anne 46 kromozom + fetus 46 kromozom Başlangıçtaki DNA Havuzu Kromozom Amplifikasyon sonrası DNA Havuzu Kromozom Anne ye ait DNA fragmanları Yeni nesil dizileme ile amplifikasyon 1 : 1 : 1 Fetusa ait DNA fragmanları tüm AMPLİKONLARIN oranı eşit

23 Kantitatif Yöntem Amplifikasyon öncesi DNA Havuzu Chr 21 fragmanları Amplifikasyon sonrası DNA Havuzu Chr 21 fragmanları maternal fetal Aynı kromozomun fragmanlarında farklı oranlarda artış?

24 DNA baz dizilimi ve CG zenginliğine göre amplifikasyon veriminin değişimi Mavi pikler CG zenginliği göz önüne alınmadan elde edilen sonuç Kırmızı pikler CG zenginliği dikkate alınarak normalizasyon yapılmış durum!!! Problem : Lokasyon (CNV varlığı) ve motife (CG/AT oranı) dayalı amplifikasyon farklılıkları dozun değişmesine yol açar!! Çözüm: CG zenginliği paralel dizilerin kullanılarak normalizasyon yapılması ve stabil bölgelerin analize alınması H. Christina Fan, :44 24

25 Kantitatif Yöntem; Fetus NORMAL Anne 46 kromozom + fetus 46 kromozom Başlangıçtaki DNA Havuzu Kromozom Amplifikasyon sonrası DNA Havuzu Kromozom Anne ye ait DNA fragmanları Yeni nesil dizileme ile amplifikasyon 1 : 1 : 1 Fetusa ait DNA fragmanları tüm AMPLİKONLARIN oranı eşit

26 Kantitatif Yöntem; Fetus TRİZOMİK Anne 46 kromozom + fetus 47 kromozom (47,+21) Başlangıçtaki DNA Havuzu Kromozom Amplifikasyon sonrası DNA Havuzu Kromozom Anne ye ait DNA fragmanları Yeni nesil dizileme ile amplifikasyon 9:1 ; 9/1 : 9/1,5 Fetusa ait DNA fragmanları 21. Kromozom AMPLİKONLARINDA artış

27 Kalitatif yyöntem :Targeted sequencing Önceden belirlenmiş hedef bölgeler için tasarlanmış oligolar DNA havuzundan istenen bölgelerin ayıklanması Veri analizi Amplifikasyon atgagcatg atgagcatg cgttcgaa cgttcgaa ggcctgca ggcctgca hedef bölgeler için Havuzdaki miktarla orantılı elde edilen oligolar :44 27

28 Targeted sequencing/ SNP sequencing/ MPSS/s-MPSS Dizilenen bölge sayısı MPSS SNP sequencing Targeted sequencing Yüksek sayıda dizi elde edilir Sınırlı sayıda okuma elde edilir Sınırlı sayıda okuma elde edilir Tekrar sayısı Yüksek Yüksek Yüksek Akraba evliliğinde hassasiyet Yumurta donasyonunda Hassasiyet* Değişmez Değişmez Değişmez *Fetal plasental DNA nın fraksiyonunun hesaplanmasında ve SNP tabanlı çalışmalarda analiz optimizasyonu gerektirir. Çalışan firmalar var (Harmony, Materni21), çalışmayan (Panorama) :44 28

29 Gelecekteki beklentiler Mikrodelesyon ve mikroduplikasyonların yüksek hassasiyetle ve güvenilirlikle yapılması Tek gen hastalıklarının topluca taranabilmesi Tüm genom dizileme Daha uzun dizilerin amplifikasyon olmadan okunabilmesi, Maliyetlerin düşmesi Teşekkürler :44 29

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Non-İnvaziv Prenatal Tarama (NİPT) Uluslararası kalite güvenceniz

Non-İnvaziv Prenatal Tarama (NİPT) Uluslararası kalite güvenceniz Non-İnvaziv Prenatal Tarama (NİPT) Uluslararası kalite güvenceniz NIPT Testi Nedir? Non-İnvaziv Prenatal Tarama (NIPT) trizomi taraması için geliştirilmiş daha güvenilir ve daha hassas ileri düzey bir

Detaylı

Non-invaziv Prenatal Test: Fetal Trizomilerin Saptanmasında Yeni Bir Dönem

Non-invaziv Prenatal Test: Fetal Trizomilerin Saptanmasında Yeni Bir Dönem Non-invaziv Prenatal Test: Fetal Trizomilerin Saptanmasında Yeni Bir Dönem Trizomi Değerlendirmesinin Evrimi 100% 80% Down Sendromu için Tanı Oranı FPR=5.0% FPR=

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

Maternal kanda serbest fetal DNA. Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji

Maternal kanda serbest fetal DNA. Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji Maternal kanda serbest fetal DNA Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji Serum/plazmada serbest DNA- RNA 1948-Mandel P, Metais P Serumda nükleik asit 1951- Ayala W Romatoid

Detaylı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil

Detaylı

Yeni Nesil Dizileme Prensipleri

Yeni Nesil Dizileme Prensipleri 1 2 3 7 8 9 4 5 6 Yeni Nesil Dizileme Prensipleri Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD NGS Yeni Nesil Dizi Analizi Next Generation Sequencing Massively Parallel Sequencing

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

Sık görülen Anöploidilerin Noninvaziv Prenatal Taramasında. Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD

Sık görülen Anöploidilerin Noninvaziv Prenatal Taramasında. Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD Sık görülen Anöploidilerin Noninvaziv Prenatal Taramasında cf-dna Analizi Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD Prenatal Tanı? Fetustaki, genetik veya

Detaylı

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine

Detaylı

Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji nabilimdalı 5. Yeni Nesil Dizileme Kongresi Yeni Nesil Dizileme Pazarı 2018 de tahmin edilen pazar payı4 milyar

Detaylı

MATERNAL PLAZMADAN SERBEST FETAL DNA ANALİZLERİ İLE ANÖPLOİDİLERİN PRENATAL TANISI

MATERNAL PLAZMADAN SERBEST FETAL DNA ANALİZLERİ İLE ANÖPLOİDİLERİN PRENATAL TANISI MATERNAL PLAZMADAN SERBEST FETAL DNA ANALİZLERİ İLE ANÖPLOİDİLERİN PRENATAL TANISI Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD Trizomi 21 Live born infants

Detaylı

İşlevsel Genomik Nedir?

İşlevsel Genomik Nedir? İşlevsel Genomik Nedir? İşlevsel Genomik, yapısal genomik tarafından sağlanan bileşenlerin ve bilginin kullanımı ile gen işlevinin değerlendirilmesinde, deneysel yaklaşımların (genom veya sistem boyunca)

Detaylı

Sık görülen Anöploidilerin Noninvaziv Prenatal Taramasında. Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD

Sık görülen Anöploidilerin Noninvaziv Prenatal Taramasında. Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD Sık görülen Anöploidilerin Noninvaziv Prenatal Taramasında cf-dna Analizi Prof. Dr. Seher Başaran İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD Prenatal Tanı? Fetustaki, genetik veya

Detaylı

Nifty Test Teknolojileri Transferi ve Türkiye Uygulamaları

Nifty Test Teknolojileri Transferi ve Türkiye Uygulamaları Genetik Hastalıklar Tanı Merkezi Nifty Test Teknolojileri Transferi ve Türkiye Uygulamaları Dr.Ayşe Şaylı 2016 Genoks Kimdir? 1 Genoks Genetik Hastalıklar Tanı Merkezi 3 uzman hekim,10 uzman biyolog,moleküler

Detaylı

Uzm. Bio. NUR YILDIRIM

Uzm. Bio. NUR YILDIRIM Uzm. Bio. NUR YILDIRIM Genlerin çok büyük ve çok sayıda ekzondan oluştuğu göz önüne alındığında, bu genleri Sanger sekanslama ve genom boyu SNP genotiplemesi gibi klasik genetik metodlarla taramak hem

Detaylı

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

Maternal kanda cf DNA: Klinik pratik. Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji

Maternal kanda cf DNA: Klinik pratik. Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji Maternal kanda cf DNA: Klinik pratik Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji Maternal kanda fetal DNA Trafik iki yönlü fetal kanda maternal DNA (%0,9) maternal kanda fetal DNA

Detaylı

Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD

Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD Prenatal tanıda amaç Fetustaki olası, genetik veya nongenetik nedenlerin yol açtığı, tedavisi olanaksız ciddi hastalık ve malformasyonların;

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β

Detaylı

Türkiye Maternal Fetal Tıp ve Perinatoloji Derneği VIII.Kongresi 11-14 Ekim 2012, İstanbul

Türkiye Maternal Fetal Tıp ve Perinatoloji Derneği VIII.Kongresi 11-14 Ekim 2012, İstanbul İstanbul Üniversitesi Fetal Nükleik Asit Araştırma Grubu Sonuçları Türkiye Maternal Fetal Tıp ve Perinatoloji Derneği VIII.Kongresi 11-14 Ekim 2012, İstanbul sfetal DNA Lo ve ark. 1997 yılında anne plazma

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Dönem V Tıbbi Genetik Staj Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Baran GENCER Oğuz GÜÇLÜ Erkam KÖMÜRCÜ Staj Eğitim Sorumlusu: Genel

Detaylı

Non-İnvaziv Prenatal Tanı: Rutine girdi mi? Klinikte nasıl önerilmeli? Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji

Non-İnvaziv Prenatal Tanı: Rutine girdi mi? Klinikte nasıl önerilmeli? Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji Non-İnvaziv Prenatal Tanı: Rutine girdi mi? Klinikte nasıl önerilmeli? Prof. Dr. Recep Has İstanbul Tıp Fakültesi Kadın Doğum/Perinatoloji Maternal kanda fetal DNA Trafik iki yönlü fetal kanda maternal

Detaylı

HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:

Detaylı

Maternal kanda fetal DNA tabanlı testler cfdna ile tarama: Kime? Nasıl? Doç. Dr. Ahmet Gül. MFTP-D, Perinatal Tıp Toplantısı İzmir, Nisan 2017

Maternal kanda fetal DNA tabanlı testler cfdna ile tarama: Kime? Nasıl? Doç. Dr. Ahmet Gül. MFTP-D, Perinatal Tıp Toplantısı İzmir, Nisan 2017 Maternal kanda fetal DNA tabanlı testler cfdna ile tarama: Kime? Nasıl? Doç. Dr. Ahmet Gül MFTP-D, Perinatal Tıp Toplantısı İzmir, 28-29 Nisan 2017 cfdna ile tarama: Kime? Nasıl? cfdna yöntemleri cfdna

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

Sekansın Temelleri ve Sekans Bazlı Çalışma Doç. Dr. Fatih Özaltın Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Nefroloji Ünitesi Nefrogenetik Laboratuvarı TİGED-24 Nisan 2011 Dalaman Çekirdekte DNA kromatin

Detaylı

Prenatal Tanıda Yeni Ufuklar Non İnvaziv Prenatal Test. Dr İsrael Aruh, Kent hastanesi IVF Ünitesi Direktörü

Prenatal Tanıda Yeni Ufuklar Non İnvaziv Prenatal Test. Dr İsrael Aruh, Kent hastanesi IVF Ünitesi Direktörü Prenatal Tanıda Yeni Ufuklar Non İnvaziv Prenatal Test Dr İsrael Aruh, Kent hastanesi IVF Ünitesi Direktörü PRENATAL TEST: NIPT TEKNOLOJİSİNE BAKIŞ Kromozom Anomalilerinin Prenatal Görülme Sıklığı Percent

Detaylı

AİLESEL AKDENİZ ATEŞİ (AAA-FMF)

AİLESEL AKDENİZ ATEŞİ (AAA-FMF) AİLESEL AKDENİZ ATEŞİ (AAA-FMF) MOLEKÜLER YAKLAŞIMLAR DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD AİLESEL AKDENİZ ATEŞİ Otozomal resesif kalıtım Akdeniz ve Ortadoğu kökenli populasyonlarda

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

Tüm Genom Analizi ve Klinik Mikrobiyoloji. Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD.

Tüm Genom Analizi ve Klinik Mikrobiyoloji. Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD. Tüm Genom Analizi ve Klinik Mikrobiyoloji Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD. Tüm Genom Analizi ve Klinik Mikrobiyoloji DNA dizileme yöntemleri Tüm genom analizi Mikrobiyolojide kullanım

Detaylı

1. HP PCR Template Preparation DNA isolation Kit özellikler

1. HP PCR Template Preparation DNA isolation Kit özellikler Genel Şartlar: 1. Teklif edilen kitler, orjinal ambalajında olmalıdır. Kitlerin ve kutuların içindeki reaktiflerin/sarf malzemelerin üzerinde üretici firma adı, testin adı, test sayısı, son kullanma tarihi

Detaylı

Mozaisizm- Kimerizm. Dr. Serdar Ceylaner Tıbbi Genetik Uzmanı

Mozaisizm- Kimerizm. Dr. Serdar Ceylaner Tıbbi Genetik Uzmanı Mozaisizm- Kimerizm Dr. Serdar Ceylaner Tıbbi Genetik Uzmanı Chimera Chimera Sphenks Kimerizm İki ayrı canlının dokularını içeren canlı Yapay ve doğal olmak üzere iki türü tanımlanabilir. Organ nakli

Detaylı

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden

Detaylı

Çoğul Gebelikler. Aneuploidi Taraması. Prof Dr. İskender Başer GATA Kadın Dogum AD (E)

Çoğul Gebelikler. Aneuploidi Taraması. Prof Dr. İskender Başer GATA Kadın Dogum AD (E) Çoğul Gebelikler Aneuploidi Taraması Prof Dr. İskender Başer GATA Kadın Dogum AD (E) Prof Dr Hayri Ermiş İkiz Gebelikler Dizigotik (Fraternal) Monozigotik (İdentik) 70-75 25-30 Farklı Genom Özdeş Genom

Detaylı

Prenatal Tanıda Yeni Bir Dönem: Kromozomal Anöploidlerin Tanısı İçin Maternal Dolaşımda Hücresiz Fetal DNA Kullanımı

Prenatal Tanıda Yeni Bir Dönem: Kromozomal Anöploidlerin Tanısı İçin Maternal Dolaşımda Hücresiz Fetal DNA Kullanımı Prenatal Tanıda Yeni Bir Dönem: Kromozomal Anöploidlerin Tanısı İçin Maternal Dolaşımda Hücresiz Fetal DNA Kullanımı Kromozomal anöploidler için doğum öncesi tarama çoğu ülkede rutin obstetrik bakımın

Detaylı

Mikobakteriyolojide yeni nesil dizileme ile analiz

Mikobakteriyolojide yeni nesil dizileme ile analiz Mikobakteriyolojide yeni nesil dizileme ile analiz Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, İzmir Mikobakteriyolojide kullanım alanları Moleküller epidemiyoloji

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

Epigenetik modifikasyonlarla çalışma yöntemleri.

Epigenetik modifikasyonlarla çalışma yöntemleri. Epigenetik modifikasyonlarla çalışma yöntemleri www.plantcell.org/cgi/doi/10.1105/tpc.110.tt0110b Epigenetik modifikasyonlarla çalışma yöntemleri DNA metilasyonu bisülfit dizileme TTCGCCGACTAA TTCGCCGAuTAA

Detaylı

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL PRENATAL VE POSTNATAL MOLEKÜLER TANI TESTLERİ Dr.Belgin Eroğlu Kesim *1800 lerde Mendel ile başlayan serüven, *1900 lerde kalıtım biriminin gen

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

J Popul Ther Clin Pharmacol 8:e257-e260;2011

J Popul Ther Clin Pharmacol 8:e257-e260;2011 SİTOMEGALOVİRUS (CMV) Prof. Dr. Seyyâl ROTA Gazi Ü.Tıp Fakültesi LOW SYSTEMIC GANCICLOVIR EXPOSURE AND PREEMPTIVE TREATMENT FAILURE OF CYTOMEGALOVIRUS REACTIVATION IN A TRANSPLANTED CHILD J Popul Ther

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Mendel Dışı kalıtım. Giriş

Mendel Dışı kalıtım. Giriş Mendel Dışı kalıtım DR. UMUT FAHRİOĞLU, PHD MSC Giriş Bir organizmanın fenotipinin genotipin bakarak tahmin edilebilmesi için birçok farklı faktörün çok iyi anlaşılabilmesi lazım. Mendel kalıtım modellerindeki

Detaylı

DNA Mikroarrayler: SNP analizleri

DNA Mikroarrayler: SNP analizleri Hafta IX Genombilimde Mikrodizin Uygulamaları ve iyoinformatik Analiz DNA Mikroarrayler: SNP analizleri Doç. Dr. Hilâl Özdağ DNA Mikrodizin Genomik Dizi SNP 5 T / G 3 SNP prob = 25 baz Perfect Match Mismatch

Detaylı

BRCA 1/2 DNA Analiz Paneli

BRCA 1/2 DNA Analiz Paneli FAST-BRCA Sequencing Kit BRCA 1/2 DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR... 3 5

Detaylı

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

GENETİK HASTALIKLAR. Dr.Taner DURAK. Tıbbi Genetik Uzmanı. Bursa Orman Bölge Müdürlüğü Fikir Bahçesi Konferansı 06.03.2014

GENETİK HASTALIKLAR. Dr.Taner DURAK. Tıbbi Genetik Uzmanı. Bursa Orman Bölge Müdürlüğü Fikir Bahçesi Konferansı 06.03.2014 GENETİK HASTALIKLAR Dr.Taner DURAK Tıbbi Genetik Uzmanı Bursa Orman Bölge Müdürlüğü Fikir Bahçesi Konferansı 06.03.2014 Dr. Taner DURAK özgeçmişi 1966 Artvin Şavşat doğumlu 1983-1989, Bursa, Uludağ Üniv,Tıp

Detaylı

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL

Detaylı

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi KRAS Mutasyon Tespit Kiti Teknik Şartnamesi 1. KRAS testi ile insan KRAS geninin kodon 12, kodon 13 ve kodon 61 deki mutasyonlarının kantitatif ölçümü 2. Yöntem dizi analizine dayalı pyrosequencing metodu

Detaylı

Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı

Akreditasyon Sertifikası Eki (Sayfa 1/6) Akreditasyon Kapsamı Akreditasyon Sertifikası Eki (Sayfa 1/6) Tıbbi Laboratuar Akreditasyon No: Adresi :Cemal Sahir Sok. No:14 Mecidiyeköy 34387 İSTANBUL / TÜRKİYE Tel : 0 212 272 48 00 Faks : 0 212 272 48 04 E-Posta : kalite@duzen.com.tr

Detaylı

attomol apo B-100 quicktype

attomol apo B-100 quicktype attomol apo B-100 quicktype İnsan apolipoprotein B-100 (apo B-3500 mutasyonu) gen inde 10708G>A geçiş tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1015

Detaylı

Performans Özellikleri

Performans Özellikleri Performans Özellikleri QIAamp DSP DNA FFPE Tissue Kiti, Sürüm 1 60404 Sürüm yönetimi Bu belge, QIAamp DSP DNA FFPE Tissue Kiti Performans Özellikleri, Sürüm 1, R3 belgesidir. Testi gerçekleştirmeden önce

Detaylı

Servisler. Real-Time PCR Kitleri Reverse-Line Blot Kitleri

Servisler. Real-Time PCR Kitleri Reverse-Line Blot Kitleri Kasım 2007 İontek Tarihçesi Ara. 1996 - Kuruluş May. 1997 - Türkiye de ilk oligonükleotid sentezi Şub. 1999 - DNA dizileme ve kapiler elektroforez ile STR analizi hizmeti Şub. 2002 - Araştırma amaçlı Real-time

Detaylı

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını

Detaylı

UÜ-SK BÜTÇE PLAN SATINALMA TEKNİK ŞARTNAME ÖRNEĞİ

UÜ-SK BÜTÇE PLAN SATINALMA TEKNİK ŞARTNAME ÖRNEĞİ 1 / 86 Malzeme Kodu : JENL45 FMF MUTASYON BELIRLEME TESTI (TEST/KUTU) SATINALMA BİLGİSİ (ŞARTNAME) (*) 40591 Düzenleme Tarihi : 24/10/2014 1. FMF Kiti bölümün isteği doğrultusunda MEVF genininin 10 ekzonuna

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın Mitokondri, ökaryotik organizmanın farklı bir organeli Şekilleri küremsi veya uzun silindirik Çapları 0.5-1 μm uzunlukları 2-6 μm Sayıları

Detaylı

Dizilim Analizi ile HLA Tiplendirimi (Sequence Based Typing, SBT)

Dizilim Analizi ile HLA Tiplendirimi (Sequence Based Typing, SBT) Dizilim Analizi ile HLA Tiplendirimi (Sequence Based Typing, SBT) Dr Klara Dalva AÜTF Hematoloji BD DTL Laboratuvarı Yüksek Çözünürlükte HLA Tiplendirimi Akraba olmayan vericiden Kök Hücre nakillerinde

Detaylı

Amniyosentezden önce bir şansınız daha var!

Amniyosentezden önce bir şansınız daha var! Hassasiyeti YÜKSEK ve GÜVENİLİR Bir Tarama Testi Fetal trizomilerin taranması ve Y kromozomunun değerlendirilmesinde kullanılan son derece gelişmiş bir kan testi Amniyosentezden önce bir şansınız daha

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

QIAsymphony DSP Dolaşan DNA Kiti

QIAsymphony DSP Dolaşan DNA Kiti QIAsymphony DSP Dolaşan DNA Kiti Şubat 2017 Performans Özellikleri 937556 Sample to Insight İçindekiler Performans Özellikleri... 4 Temel performans... 4 Çalışma kesinliği... 5 2 ml ve 4 ml protokollerinin

Detaylı

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi

Detaylı

PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

Xp21.2 Bilinen en büyük genlerden bp X kromozomunun % 1,5 i Gen/ekzon oranı %0,6 (13956 bp) BİLİNEN EN AZ 8 DOKU SPESİFİK PROMOTER BÖLGESİ,

Xp21.2 Bilinen en büyük genlerden bp X kromozomunun % 1,5 i Gen/ekzon oranı %0,6 (13956 bp) BİLİNEN EN AZ 8 DOKU SPESİFİK PROMOTER BÖLGESİ, Duchenne/Becker Müsküler Distrofi sinden etkilenmiş olgularda DMD gen mutasyonlarının MLPA ve yeni nesil dizileme teknolojisi ile araşbrılması Güven Toksoy, PhD İÜ, İTF, Tıbbi Gene9k AD Xp21.2 Bilinen en

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

4th COURSE in INTEGRATION of CYTOGENETICS, MICROARRAYS and MASSIVE SEQUENCING in BIOMEDICAL and CLINICAL RESEARCH

4th COURSE in INTEGRATION of CYTOGENETICS, MICROARRAYS and MASSIVE SEQUENCING in BIOMEDICAL and CLINICAL RESEARCH EUROPEAN SCHOOL of GENETIC MEDICINE ve İSTANBUL ÜNİVERSİTESİ işbirliği ile 4th COURSE in INTEGRATION of CYTOGENETICS, MICROARRAYS and MASSIVE SEQUENCING in BIOMEDICAL and CLINICAL RESEARCH Hibrid Kursu

Detaylı

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT gulden.haspolat@gthb.gov.tr

Detaylı

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ Yrd. Doç. Dr. Hakan GÜRKAN Trakya Üniversitesi Tıp Fakültesi Tıbbi Genetik Anabilim Dalı PGT NEDİR? Gebelik öncesi genetik tanı (PGT) adı verilen

Detaylı

Mitokondrial DNA Analiz Paneli

Mitokondrial DNA Analiz Paneli FAST-mtDNA Sequencing Kit Mitokondrial DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ SELÇUK KILIÇ, BEKİR ÇELEBİ, MEHMET GENÇ, CANAN KETRE, MUSTAFA KOLUKIRIK 1, Ankara 2 Bioeksen Ar-Ge Teknolojileri

Detaylı

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak BİYOFİZİK 2015 1 Amaç Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak 2 Hedefler Bu pratiğin sonunda öğrenciler, polimeraz zincir

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

GMO ve Transgenik Gıdalar ve Analiz Yöntemleri (Yurt dışı Eğitim) 27 Mart 2013

GMO ve Transgenik Gıdalar ve Analiz Yöntemleri (Yurt dışı Eğitim) 27 Mart 2013 GMO ve Transgenik Gıdalar ve Analiz Yöntemleri (Yurt dışı Eğitim) 27 Mart 2013 ALMANYA/Bavyera Sağlık ve Gıda Güvenliği Kurumu 28 Aralık 2012-28 Ocak 2013 Dr. Ayşegül Ersayın Yaşınok Ulusal Gıda Referans

Detaylı

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara 24-25 Şubat 2011, İzmir Sunum Planı Teorik

Detaylı

* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde

* Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde GENETİK HASTALIKLAR TANI MERKEZİ TEST LİSTESİ * Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. * Listede yeralan tüm testler merkezimizde yapılmakta olup

Detaylı

DÖNEM I 3. DERS KURULU 9 Şubat 3 Nisan 2015. Prof.Dr. Mustafa SARSILMAZ

DÖNEM I 3. DERS KURULU 9 Şubat 3 Nisan 2015. Prof.Dr. Mustafa SARSILMAZ DÖNEM I. DERS KURULU 9 Şubat Nisan 0 Dekan : Prof.Dr. Mustafa SARSILMAZ Dönem I Koordinatörü : Ders Kurulu Başkanı : Doç.Dr. Doç.Dr. KURUL DERSLERİ TEORİK PRATİK TOPLAM AKTS DERS VEREN ÖĞRETİM ÜYELERİ

Detaylı

α1-antitrypsin quicktype

α1-antitrypsin quicktype attomol α1-antitrypsin quicktype İnsan α-1 antitripsin gen inde M-, Z- and S-alellerin tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! Z-mutasyonun tespiti için 10 sipariş numarası:

Detaylı

Dr. Nilay HAKAN Muğla Sıtkı Koçman Üniv. Tıp Fak. Neonatoloji Bilim Dalı Perinatal Medicine Nisan 2017, İZMİR

Dr. Nilay HAKAN Muğla Sıtkı Koçman Üniv. Tıp Fak. Neonatoloji Bilim Dalı Perinatal Medicine Nisan 2017, İZMİR Nedeni Açıklanamayan Patolojik ve Uzamış Sarılığı Olan Yenidoğanlarda UDP- Glukuroniltransferaz 1 (UGT1A1), Hepatik Organik Anyon Taşıyıcısı (SLCO1B) ve Glutatyon S-transferaz (GST) Polimorfizmlerinin

Detaylı

İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik AD ve Perinatoloji BD Sunan: Prof. Dr. Atıl YÜKSEL

İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik AD ve Perinatoloji BD Sunan: Prof. Dr. Atıl YÜKSEL İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik AD ve Perinatoloji BD Sunan: Prof. Dr. Atıl YÜKSEL Metafaz Prometafaz(HRBT) 450 500 600 700 bant/haploid set ~ 500 bant çözünürlükte ~ 1 bant

Detaylı

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır.

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır. Allel: Bir genin seçenekli biçimi Wild Tip: Normal allel. Bireylerin çoğunda bulunan Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın Dominant / resesif tanımları Otozomal ve gonozomal kalıtım nedir? İnkomplet dominant/ kodominant ne ifade eder? Pedigri nedir, Neden yapılır?

Detaylı

attomol lactose intolerance C>T quicktype

attomol lactose intolerance C>T quicktype attomol lactose intolerance -13910C>T quicktype İnsan laktase-genine karşı -13910C>T geçiş tespitine yönelik mutasyon testi Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1045

Detaylı

Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim

Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim Polimeraz Zincir Reaksiyonu (PCR: Polymerase Chain Reaction) Ayten AŞKIN KILINÇ Veteriner Hekim PCR nedir? DNA Polimeraz enzimi kullanılarak DNA nın spesifik bir parçasının in vitro (bir tüp içerisinde)

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

Prenatal Tanı: Güncel Yaklaşım. Prof. Dr. Recep Has İ.Ü.İstanbul Tıp Fakültesi

Prenatal Tanı: Güncel Yaklaşım. Prof. Dr. Recep Has İ.Ü.İstanbul Tıp Fakültesi Prenatal Tanı: Güncel Yaklaşım Prof. Dr. Recep Has İ.Ü.İstanbul Tıp Fakültesi Gebelik takibi John Whitridge Williams 1866 1931 Fetal anomalilerin tanısı ANENCEPHALY: EARLY ULTRASONIC DIAGNOSIS AND ACTIVE

Detaylı

KRONİK BÖBREK HASTALIĞI (YETMEZLİĞİ) OLAN TÜRK HASTALARINDA TÜMÖR NEKROZ FAKTÖR ALFA ve İNTERLÖKİN-6 PROMOTER POLİMORFİZMLERİNİN ETKİSİ

KRONİK BÖBREK HASTALIĞI (YETMEZLİĞİ) OLAN TÜRK HASTALARINDA TÜMÖR NEKROZ FAKTÖR ALFA ve İNTERLÖKİN-6 PROMOTER POLİMORFİZMLERİNİN ETKİSİ KRONİK BÖBREK HASTALIĞI (YETMEZLİĞİ) OLAN TÜRK HASTALARINDA TÜMÖR NEKROZ FAKTÖR ALFA ve İNTERLÖKİN-6 PROMOTER POLİMORFİZMLERİNİN ETKİSİ Hazırlayan: Meral YILMAZ Cumhuriyet Üniversitesi KRONİK BÖBREK HASTALIĞI

Detaylı

Tanı konulmamış hastalarda yeni nesil dizileme ile tanı projeleri

Tanı konulmamış hastalarda yeni nesil dizileme ile tanı projeleri Moleküler Biyoloji ve Genetik Bölümü Tanı konulmamış hastalarda yeni nesil dizileme ile tanı projeleri Onur Emre Onat emre@fen.bilkent.edu.tr 13. Ulusal Sinirbilim Kongresi 30 Nisan-3 Mayis 2015, Konya

Detaylı

İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD ve Perinatoloji BD Sunan: Prof. Dr. Atıl YÜKSEL

İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD ve Perinatoloji BD Sunan: Prof. Dr. Atıl YÜKSEL İstanbul Üniversitesi, İstanbul Tıp Fakültesi, Tıbbi Genetik ABD ve Perinatoloji BD Sunan: Prof. Dr. Atıl YÜKSEL Metafaz Prometafaz(HRBT) 450 500 600 700 bant/haploid set ~ 500 bant çözünürlükte ~ 1 bant

Detaylı