Ders 10 - Diğer küçük kodlamayan RNA lar

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Ders 10 - Diğer küçük kodlamayan RNA lar"

Transkript

1 Ders 10 - Diğer küçük kodlamayan RNA lar

2 ü Yüksek organizmalar ait proteomlar nispeten durağandır. ü Bir bireyde diğer insanlara göre her haploid genomun ~ dizisinin farklı olmasına rağmen, bu yalnızca ~ (%0.3) protein kodlayan dizide yer alır ve bunların çoğu da sessiz (3. baz) değişimidir. ü Bu nedenle, her bireye ait ve türler arasındaki fenoipik çeşitlilik büyük oranda protein-kodlamayan dizilerdeki farklılıklardan ileri geliyor olabilir. ü Varyasyonların bir kısmı cis-acing promotorlar ve enchancerlarda olsa da bu cevabın sadece küçük bir kısmıdır.

3 ü Genomun %5-10 u transkribe edilmektedir. ü Kodlamayan RNA ların pek çok görevinin yanında kromain mimarisinin düzenlenmesinde de yer aldıklarına dair kanıtlar bulunmaktadır (Örneğin, XIST geninin ürünü). ü Kodlamayan RNA genlerinin geneik hastalıklarla da ilişkili olduğu bilinmektedir. - CarIlage-hair hypoplasia (CHH), kısa kollu cücelik hastalığının 267 nükleoidlik RMRP ncrna genindeki mutasyonları ile ilişkili olduğu belirlenmişir. - Otozomal-dominant diskratosis congenita hastalarının ise telomeraz RNA larında mutasyon taşıdığı ve bununda gen bankasında yer alan aday bir gen olduğu bilinmektedir.

4 ü İnsan, fare ve diğer memeli genomları karşılaşarıldığında, bu genomların protein-kodlayan bölgeler dışındaki dizi homoloji derecesinin de oldukça yüksek olduğu gösterilmişir. ü Yüksek organizmaların biyolojisinin anlaşılmasının doğru şekilde gerçekleşirilebilmesi için, yalnızca proteomların anlaşılması yeterli olmayacakar. ü Bunun yanında, kodlamayan RNA ların tanımlanması, bunların ekspresyon paternlerinin, işlenmelerinin ve sinyallenme yollarının da tanımlanması gereklidir.

5 ~ 21,000

6

7

8 ü Kodlamayan ilk RNA 1965 senesinde mayada alanin trna sının keşfiyle bulunmuştur (Holley et al, Science, 1965). ü 1974 senesinde de sekonder yapısı (yonca yaprağı) X-ray Kristallografi analizleri sonucunda keşfedilmişir.

9 ü Büyüklüklerine göre; nükleoigen büyük olan kodlanmayan RNA lar uzun kodlanmayan RNA (long non-coding RNA) olarak isimlendirilir nükleoigen daha kısa olanlara ise küçük kodlanmayan RNA (small non-coding RNA) olarak isimlendirilir.

10 ü İşlevlerine göre; - Housekeeping Kodlanmayan RNA lar (ncrna) - Düzenleyici Kodlanmayan RNA lar (ncrna)

11

12

13

14

15

16 mikrorna lar

17 ü RNA İnterferans (RNAi) - RNA interferans çii iplikçikli RNA nın hücreye girdiği zaman homolog mrna zincirinin degradasyonuna yol açması ile sonuçlanan transkripsiyon sonrası gen susturma mekanizmasıdır (post-transcripional gene silencing) - Bu susturma mekanizması ilk olarak daha koyu renkte petunya çiçeği elde etmek istenirken beyaz-mor alacalı ve beyaz renkte çiçeklerin elde edilmesiyle fark edilmişir.

18 ü Petunya bitkisine Agrobacterium tumefaciens adlı vektör ile Petunyada pigmentasyonu katalizleyen enzimlerin genleri eklenerek daha koyu renkte petunyalar elde edilmek istenmişir ancak ya tamamen renksiz ya da normal renkten daha açık renkte petunyalar elde edilmişir.

19

20 ü sirna Kodlamayan RNA lar - İlk kez 1999 yılında keşfedilen sirna ların öncüsu bc lik dsrna lardır. - dsrna lar endonükleaz enzimlerinden RNAaz III ailesinin üyesi olan Dicer enzimi taramndan 3 uçlarında 2nt lik çıkına kalacak biçimde bc lik sirna ları meydana geirirler.

21 ü Bir sirna homolog gen ifadesini iki yolla susturur; - İlki mrna nın yıkılmasını teikleyerek, - Diğeri de promotör bölgesinde genin sessizleşirici kromain değişimlerini teikleyerek susturur.

22

23 ü mirna ile sirna arasındaki farklılıklar; - sirna lar, dsrna orijinlidir. - sirna lar büyük ölçüde yabancı RNA ya etki gösterir ve tamamen mrna ya bağlanarak parçalar ve gen ifadesini susturur. - mirna lar saç tokası şeklinde ssrna orijinli olup, endojen kaynaklıdır. - mirna lar, posgranskripsiyonel gen ekspresyonunu düzenler; hedef mrna ya tamamen bağlanarak parçalar ve gen ifadesini susturur veya tam komplementerlik sağlayamayarak mrna yı parçalayamaz.

24 ü İnsan genom dizisinin tamamlanması ve protein kodlayıcı genlerin tanımlanmasına karşın, ncrna genlerinin etkileri tam olarak aydınlaalamamışar. ü Son yıllarda pek çok sistemaik tarama ile yeni ncrna genleri tanımlanmışar. Yeni ncrna genlerinin keşfedilmesinde ve apta kullanım alanlarının genişleilmesi için; - Bilgisayar bazlı karşılaşarmalı genom analizleri güçlu bir yaklaşım olarak kabul edilmektedir. - cdna cloning stratejilerinin ncrna çoğalalması için özel olarak tasarlanması sonucunda verilerin artacağı kabul edilmektedir. - Prensipte mümkün olabilen, yeni transkriptlerin ( hem ncrna hem de protein kodlayan RNA) saptanması için yüksek kapasiteli oligonükleoid mikroarraylerin kullanılması verileri araracakar.

Non-coding RNA Molekülleri

Non-coding RNA Molekülleri Non-coding RNA Molekülleri Dersin Sorumlusu: Dr. Hatice MERGEN Dersin adı: Proteomik ve Genomik Hazırlayan: Çiğdem KAPLAN 2004 2005 GÜZ Non-Coding RNAs (Kodlama Yapmayan RNA lar) Genom projesinin ilk hedefi,

Detaylı

Kodlanmayan Rna ların İşlevi ve Tıpda Kullanım Alanları

Kodlanmayan Rna ların İşlevi ve Tıpda Kullanım Alanları Kodlanmayan Rna ların İşlevi ve Tıpda Kullanım Alanları Yüksek Lisans Öğr. Figen GÜZELGÜL* Prof. Dr. Kıymet AKSOY* 1. KODLANMAYAN RNA LAR Yüksek organizmalı canlılarda genetik materyal DNA olup, DNA daki

Detaylı

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA (Ribonükleik Asit) Nükleik asitler, Friedrich Miescher tara2ndan 1869'da keşfedildi. İl=haplı bandajlardan izole edilen bu maddeye nüklein adını

Detaylı

GENETĐK EPĐGENETĐK. Doç. Dr. Hilâl Özdağ EPĐGENETĐK

GENETĐK EPĐGENETĐK. Doç. Dr. Hilâl Özdağ EPĐGENETĐK GENETĐK 111-503 EPĐGENETĐK Doç. Dr. Hilâl Özdağ EPĐGENETĐK Epigenetik gen işlevinde çekirdek DNA sının diziliminde bir değişiklik olmaksızın gerçekleşen tersine çevrilebilir kalıtlanabilir değişiklikleri

Detaylı

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır.

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır. TIBBİ GENETİK I-DERS TANIMLARI 1-Tanım: DNA ve RNA yapısının öğretilmesi. b. Amaç: DNA nın genetik materyal olmasında moleküler yapısının önemi ve RNA yapısının proteine geçiş ve gen ekspresyonu kontrolündeki

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

Ders 11 - Protein kodlamayan RNA ların insan hastalıklarındaki rolu

Ders 11 - Protein kodlamayan RNA ların insan hastalıklarındaki rolu Ders 11 - Protein kodlamayan RNA ların insan hastalıklarındaki rolu Kodlamayan RNA lar ü Kodlamayan genomun hem normal gelişim için gerekli olduğu ortaya konulmuş hem de birçok hastalıkla ilişkilendirilmiş8r.

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ. Betül Çavuşoğlu. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi

DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ. Betül Çavuşoğlu. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ Betül Çavuşoğlu İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ Betül Çavuşoğlu, İstanbul Üniversitesi, Cerrahpaşa Tıp Fakültesi,

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği

RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği sirna Doç.Dr. Metiner Tosun EÜ Eczacılık Fakültesi Farmakoloji AD Trabzon Ekim 07 Geleneksel ilaç geliştirme fazları: Doğrusal süreç 1-5 yıl

Detaylı

Transkripsiyon (RNA Sentezi) Dr. Mahmut Çerkez Ergören

Transkripsiyon (RNA Sentezi) Dr. Mahmut Çerkez Ergören Transkripsiyon (RNA Sentezi) Dr. Mahmut Çerkez Ergören Transkripsiyon Transkripsiyon DNA molekülündeki bilginin RNA nükleotid dizisi haline çevrilmesi işlemidir. (DNA dan RNA sentezlenmesi) Hücre içi genetik

Detaylı

Antimikrobiyaller için Yeni Hedefler. Prof. Dr. Tanıl Kocagöz Tıp Fakültesi, Tıbbi Mikrobiyoloji A.D.

Antimikrobiyaller için Yeni Hedefler. Prof. Dr. Tanıl Kocagöz Tıp Fakültesi, Tıbbi Mikrobiyoloji A.D. Antimikrobiyaller için Yeni Hedefler Prof. Dr. Tanıl Kocagöz Tıp Fakültesi, Tıbbi Mikrobiyoloji A.D. Fleming 1929 Antimikrobiyaller Penicillium kolonisi Bakteri üreyemiyor Bakteri Davies J, and Davies

Detaylı

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını

Detaylı

Yard. Doç. Dr. Ercan ARICAN. İ.Ü. FEN FAKÜLTESİ, Moleküler Biyoloji ve Genetik Bölümü

Yard. Doç. Dr. Ercan ARICAN. İ.Ü. FEN FAKÜLTESİ, Moleküler Biyoloji ve Genetik Bölümü KANSER OLUŞUMUNDA ROL OYNAYAN EPİGENETİK MEKANİZMALAR Yard. Doç. Dr. Ercan ARICAN İ.Ü. FEN FAKÜLTESİ, Moleküler Biyoloji ve Genetik Bölümü Epigenetik Nedir? Gen ekspresyonuna dayanan kalıtsal bilgi epigenetik

Detaylı

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri mrna trna - rrna Taşıyıcı (transfer) RNA (trna) Nispeten küçük moleküllerdir. Bir öncu molekülün nükleusta işlenmesiyle oluşurlar. trna molekülleri, mrna

Detaylı

GEN EKSPRESYONUNUN KONTROLÜ

GEN EKSPRESYONUNUN KONTROLÜ GEN EKSPRESYONUNUN KONTROLÜ Hazırlayan: Yrd.Doç.Dr. Yosun MATER Gen Ekspresyonun Kontrolü Kontrol genellikle transkripsiyon başlangıç düzeyinde gerçekleşir. Transkripsiyonda düzenleyici proteinler tarafından

Detaylı

Gen Organizasyonu ve Genomların Evrimi

Gen Organizasyonu ve Genomların Evrimi GENETĐK 111-503 Gen Organizasyonu ve Genomların Evrimi Doç. Dr. Hilâl Özdağ 1 RNA nın Kendi Kendini Kopyalayabiliyor Olmalıydı Đlkin zamanlardaki RNA dünyasında RNA moleküllerinin kopyalanması. RNA polimerazlar

Detaylı

Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON

Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON Biyoteknoloji ve Genetik II Hafta 8 TRANSLASYON Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com TRANSLASYON Translasyon a. mrna ribozoma

Detaylı

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin.

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin. GENOMUN YAPISI Gen ve un tanımı Büyüklükleri Dizi Tipleri Doç. Dr. Metin Aytekin www.metinaytekin.com Erciyes Üniversitesi Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı 11 Kasım 2014 Nedir? Bir organizmanın

Detaylı

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013])

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) BİYOLOJİ PROJE SUNUMU GRUP SUSTURUCU PROJE ADI Bazı Bitki Türlerindeki mirna

Detaylı

RNA nın Yapısı. Dr. Mahmut Çerkez Ergören

RNA nın Yapısı. Dr. Mahmut Çerkez Ergören RNA nın Yapısı Dr. Mahmut Çerkez Ergören RNA (Ribonükleik Asit ) Ribonükleotidlerin fosfodiester bağı ile bağlanmasından oluşan polinükleotid zinciridir. Tek zincirden oluşur (trna nın bazı bölgeleri hariç).

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

ÖĞLE ARASI ÖĞLE ARASI

ÖĞLE ARASI ÖĞLE ARASI 1. HAFTA 7 Kasım 2016 Pazartesi 8 Kasım 2016 Salı 9 Kasım 2016 Çarşamba 10 Kasım 2016 Perşembe 11 Kasım 2016 Cuma Diş Anatomisi ve Morfolojisi 08.30-09.15 09.30-10.15 Dr. Gökçe Soğancı Mandibular santral,

Detaylı

Bir enzim olarak RNA ve Riboşalterler

Bir enzim olarak RNA ve Riboşalterler Bir enzim olarak RNA ve Riboşalterler RNA Doğada mevcut en az 8 çeşit RNA enzim vardır. Bu RNA enzimlerinin RNA Dünyasında var olan bir yaşam formunun kalınaları oldukları düşünülmektedir. RNA RNA nın

Detaylı

VEKTÖRLER Halime Nebioğlu

VEKTÖRLER Halime Nebioğlu VEKTÖRLER Halime Nebioğlu İstanbul Üniversitesi Gen klonlamasında kullanılan aracı moleküllere vektör denir. Vektörler konakçı organizmada, konakçı organizmadan bağımsız olarak replikasyon (çoğalma) gösterirler.

Detaylı

Genetik Şifre ve Transkripsiyon

Genetik Şifre ve Transkripsiyon Genetik Şifre ve Transkripsiyon Prof. Dr. Sacide PEHLİVAN 12 Aralık 2016 RNA (Ribonükleik Asit): Ribonükleotid Polimeri Tek zincirli bir moleküldür. İçerdiği şeker ünitesi riboz dur. DNA dan baz içeriği

Detaylı

Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I -

Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I - Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I - Pre-mRNA (hnrna) cap mrna AAAAAAAAAAAAA REPLİKASYON DNA nın kendini eşlemesi TRANSKİPSİYON DNA dan RNA ya gene

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler)

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) PROKARYOTLARDA GEN EKSPRESYONU ve REGÜLASYONU (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) Nihal EYVAZ (050559015) Şerife OKAY (050559025) Prof. Dr. Figen ERKOÇ Gazi Eğitim Fakültesi Gen

Detaylı

TRANSLASYON VE DÜZENLENMESİ

TRANSLASYON VE DÜZENLENMESİ TRANSLASYON VE DÜZENLENMESİ TRANSLASYON Translasyonda nükleik asit kullanılır fakat son ürün bir nükleik asit değil proteindir. Translasyon mekanizması 4 ana bileşenden oluşmaktadır: 1. mrnalar 2. trnalar

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

Transkripsiyon ve Transkripsiyonun Düzenlenmesi

Transkripsiyon ve Transkripsiyonun Düzenlenmesi MBG 505 BAKTERİ GENETİĞİ Transkripsiyon ve Transkripsiyonun Düzenlenmesi Emrah ÖZÇELİK Ribonükleik asit (RNA) 3 tip RNA Mesajcı RNA (mrna) (genetik seviyede) Transfer RNA (trna) Ribozomal RNA (rrna) (fonksiyonel

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

Ökaryotlarda transkripsiyon. Dr. İSMAİL BEZIRGANOĞLU

Ökaryotlarda transkripsiyon. Dr. İSMAİL BEZIRGANOĞLU Ökaryotlarda transkripsiyon Dr. İSMAİL BEZIRGANOĞLU Transkripsiyonal Düzenlemeye Genel Bakış Ökaryotlarda mrna ve protein sentezi iki farklı hücresel organelde gerçekleşir. Transkripsiyon nukleusta translasyon

Detaylı

GEN EKSPRESYONUNUN KONTROLÜ VE DÜZENLENMESİ GEN İFADESİ

GEN EKSPRESYONUNUN KONTROLÜ VE DÜZENLENMESİ GEN İFADESİ GEN EKSPRESYONUNUN KONTROLÜ VE DÜZENLENMESİ GEN İFADESİ Bir organizmanın genetik yapısını DNA da bulunan dntp dizileri belirler ve bu bilginin ifade edilmesi ise (Protein sentezi) RNA lar ile sağlanır.

Detaylı

Tanımlamalar PROTEİN SENTEZİ; TRANSLASYON. Protein sentezi ;translasyon. mrna ; Genetik şifre 1/30/2012. Prof Dr.Dildar Konukoğlu

Tanımlamalar PROTEİN SENTEZİ; TRANSLASYON. Protein sentezi ;translasyon. mrna ; Genetik şifre 1/30/2012. Prof Dr.Dildar Konukoğlu PROTEİN SENTEZİ; TRANSLASYON Prof Dr.Dildar Konukoğlu DNA SENTEZİ DNA DNA RNA sentezi DNA mrna Protein sentezi mrna Protein Tanımlamalar Replikasyon Replikasyon Transkripsiyon Transkripsiyon Translasyon

Detaylı

Uygulama 6. Transkripsiyon yönü. Ekzonlar (kodlama bölgeleri) Transkripsiyon. Sonlandırıcı kodon başlangıcı

Uygulama 6. Transkripsiyon yönü. Ekzonlar (kodlama bölgeleri) Transkripsiyon. Sonlandırıcı kodon başlangıcı Uygulama 6 DNA Dizilerinde Bazı Đstatistiksel Analizler DNA molekülleri nükleotidlerin uzun birer dizileridir. Dizilenmiş bir DNA molekülüne A,C,G,T harflerinin oluşturduğu bir kelimelik uzun bir yazı

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

Bakteriyofaj ve Mikro-RNA Kullanımı

Bakteriyofaj ve Mikro-RNA Kullanımı İnfeksiyonlara Antibiyotik Dıșı Tedavi Yaklașımları: Bakteriyofaj ve Mikro-RNA Kullanımı Doç. Dr. Kenan MİDİLLİ İ.Ü. Cerrahpașa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Faj Açmazlar Panresistan

Detaylı

Mustafa EMREM

Mustafa EMREM Mustafa EMREM 162161022 Bakterilerdeki transformasyonun ilk kanıtları İngiliz bilim adamı Frederick Griffith tarafından elde edilmiştir. Genetik materyal aktarımı Dikey Gen Transferi ebeveyn ile yavru

Detaylı

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN MİTOKONDRİ Doç.. Dr. Mehmet GÜVENG Hemen hemen bütün b ökaryotik hücrelerde ve ökaryotik mikroorganizmalarda bulunur. Eritrositlerde, bakterilerde ve yeşil alglerde mitokondri yoktur. Şekilleri (küremsi

Detaylı

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ Değişik canlı gruplarında kalıtsal molekülün çeşidi, sayısı, biçimi ve organizasyonu bakımından farklılıklar bulunur. Ortak özellik: nükleik

Detaylı

Doç.Dr.Erdal BALCAN 1

Doç.Dr.Erdal BALCAN 1 www2.bayar.edu.tr/biyoloji/erdal.balcan E.Coli gibi bakteriler kısa yaşam süreleri içinde çeşitli çevresel koşullarla karşılaşırlar (ortam ile etkileşimleri fazla). Bakteriler ve diğer prokaryotlar evrimsel

Detaylı

Tarifname. ENDOJEN MAGP1 EKSPRESYONU ARTIM NĠTELĠĞĠ SERGĠLEYEN LĠPOLĠTĠK BĠLEġENLER ĠÇEREN BĠR KOMPOZĠSYON

Tarifname. ENDOJEN MAGP1 EKSPRESYONU ARTIM NĠTELĠĞĠ SERGĠLEYEN LĠPOLĠTĠK BĠLEġENLER ĠÇEREN BĠR KOMPOZĠSYON 1 Tarifname ENDOJEN MAGP1 EKSPRESYONU ARTIM NĠTELĠĞĠ SERGĠLEYEN LĠPOLĠTĠK BĠLEġENLER ĠÇEREN BĠR KOMPOZĠSYON Teknik Alan Buluş, endojen magp1 ekspresyonu artıma yönelik oluşturulmuş, lipolitik bileşenler

Detaylı

Heperan Sülfat Proteoglikan (HSPG) Miktarının Kanserli Hücrelerdeki Değişimi. Kemal SÖNMEZ

Heperan Sülfat Proteoglikan (HSPG) Miktarının Kanserli Hücrelerdeki Değişimi. Kemal SÖNMEZ Heperan Sülfat Proteoglikan (HSPG) Miktarının Kanserli Hücrelerdeki Değişimi Kemal SÖNMEZ 122204012 ÖZET Heperan Sülfat Proteoglikanlar (HSPG) bir glikoprotein ailesi üyesidir. Tüm HSPG ların ortak özelliği

Detaylı

MikroRNA'lar ve Anksiyete Bozuklukları İlişkisi

MikroRNA'lar ve Anksiyete Bozuklukları İlişkisi MikroRNA'lar ve Anksiyete Bozuklukları İlişkisi Dr. Fikret Poyraz ÇÖKMÜŞ Nazilli Devlet Hastanesi 21. TPD Yıllık Toplantısı ve KES, Antalya 1 Sunum Akışı Tarihçe Epigenetik Düzenlenme Nedir? Kodlanmayan

Detaylı

Gen Klonlama ve Uygulamaları. Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı

Gen Klonlama ve Uygulamaları. Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı Gen Klonlama ve Uygulamaları Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı Klonlama Gen klonlaması : DNA segmentleri veya bir genin kopyalarının Reproduktif klonlama : Bir canlının

Detaylı

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD Genomiks Temeli DNA nın dizilenmesi ve elde edilen dizilerin biyoinformatiksel metotlar kullanılarak

Detaylı

PROTEİN SENTEZİNİN DÜZENLENMESİ VE AŞAMALARI

PROTEİN SENTEZİNİN DÜZENLENMESİ VE AŞAMALARI PROTEİN SENTEZİNİN DÜZENLENMESİ VE AŞAMALARI Protein Sentezinin Düzenlenmesi Edward TATUM 1940 yılında bir gen bir enzim hipotezini ileri sürmüştür. Bu hipotez daha sonra bir gen bir protein haline gelmiştir.

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

TRANSLASYON VE TRANKRİPSİYON

TRANSLASYON VE TRANKRİPSİYON TRANSLASYON VE TRANKRİPSİYON GEN İFADESİ (GEN EKSPRESYONU) Gen ifadesinin düzenlenmesi çeşitli aşamalarda olur: 1) Primer transkriptlerin oluşumu 2) Primer mrna dan matür (olgun) mrna oluşumu 3) mrna nın

Detaylı

1. GİRİŞ. Şekil 1: Metafaz kromozomunun şematik organizasyonu (http://onlinehumanbody.blogspot.com/2010/09/structure-of-chromosome.

1. GİRİŞ. Şekil 1: Metafaz kromozomunun şematik organizasyonu (http://onlinehumanbody.blogspot.com/2010/09/structure-of-chromosome. 1 1. GİRİŞ İnterfaz sırasında, DNA ve onunla birleşmiş proteinler (histonlar) kromatin yapıda sıkıca paketlenmiştir. DNA nın tümünün paketlenme oranı, yaklaşık 1000-10000 kez katlanma şeklindedir. Bu,

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

Antisens Teknolojisi

Antisens Teknolojisi Orlab On-Line Mikrobiyoloji Dergisi Yıl: 2007 Cilt: 05 Sayı: 2 Sayfa: 14-37 www.mikrobiyoloji.org/pdf/702070203.pdf Antisens Teknolojisi İsmail Karaboz 1, Caner Çolak 2 Giriş Antisens teknolojisi insan,

Detaylı

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik hücreler, transkripsiyondan sonra RNA yı değişikliğe uğratırlar

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler

Detaylı

YGS YE HAZIRLIK DENEMESi #13

YGS YE HAZIRLIK DENEMESi #13 YGS YE HAZIRLIK DENEMESi #13 1) Canlılarda özelliklerin genlerle kontrol edildiği ve her genin en az bir özellikten sorumlu olduğu bilindiğine göre, I. Diploid canlılarda her özellik için iki gen bulunması

Detaylı

RNA İNTERFERANS (RNAi) RNA INTERFERENCE (RNAi)

RNA İNTERFERANS (RNAi) RNA INTERFERENCE (RNAi) Erciyes Üniversitesi Fen Bilimleri Enstitüsü Dergisi 25 (1-2) 34 47 (2009) http://fbe.erciyes.edu.tr/ ISSN 1012-2354 RNA İNTERFERANS (RNAi) Ramazan GÜNDOĞDU 1, Venhar ÇELİK 1,* 1 Fırat Üniversitesi, Fen-Edebiyat

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde

Detaylı

KOMPERATİF GENOMİK Principles of Genome Analysis and Genomics S.B. Primrose and R.M. Twyman Bölüm 7 s. 113-132 Amacı; farklı organizmaların genom yapısındaki farklılık ve benzerliklerin ortaya çıkarılmasıdır.

Detaylı

2. Histon olmayan kromozomal proteinler

2. Histon olmayan kromozomal proteinler 12. Hafta: Nükleik Asitler: Nükleik asitlerin yapısal üniteleri, nükleozitler, nükleotidler, inorganik fosfat, nükleotidlerin fonksiyonları, nükleik asitler, polinükleotidler, DNA nın primer ve sekonder

Detaylı

GEN MUTASYONLARI. Yrd. Doç. Dr. DERYA DEVECİ

GEN MUTASYONLARI. Yrd. Doç. Dr. DERYA DEVECİ GEN MUTASYONLARI Yrd. Doç. Dr. DERYA DEVECİ Gen mutasyonları 2 temel mekanizma ile gerçekleşir. A. İnsersiyon; Bir veya daha fazla nükleotidin araya girmesiyle B. Delesyon; Bir veya daha fazla nükleotidin

Detaylı

cdna Kitaplık Hazırlanışı

cdna Kitaplık Hazırlanışı cdna Kitaplık Hazırlanışı Uzm.Bio.Veysel Sabri HANÇER İstanbul Üniversitesi Moleküler Biyoloji ve Genetik Doktora Programı 2602043040 Genetik Bilginin İki Kaynağı Vardır; Genomik DNA mrna Ökaryotlardaki

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II. RNA Çalışmaları Transkriptom

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II. RNA Çalışmaları Transkriptom MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II RNA Çalışmaları Transkriptom RNA Bakteri hücresinin %6 sı Memeli hücresinin %1.1 i Total 10-15µg RNA nın RNA dır %80-85 i rrna %15-20 si trna ve nukleusa ait

Detaylı

10. Ulusal Pediatrik Hematoloji Kongresi 3 6 Haziran 2015, Ankara [ALİ BAY] BEYANI

10. Ulusal Pediatrik Hematoloji Kongresi 3 6 Haziran 2015, Ankara [ALİ BAY] BEYANI Araştırma Destekleri/ Baş Araştırıcı 10. Ulusal Pediatrik Hematoloji Kongresi 3 6 Haziran 2015, Ankara [ALİ BAY] BEYANI Sunumum ile ilgili çıkar çatışmam yoktur. Çalıştığı Firma (lar) Danışman Olduğu Firma

Detaylı

Gen Klonlanması. & DNA kütüphanelerinin oluşturulması. Mikrobiyoloji Anabilim Dalı

Gen Klonlanması. & DNA kütüphanelerinin oluşturulması. Mikrobiyoloji Anabilim Dalı 8. Ha&a Gen Klonlanması & DNA kütüphanelerinin oluşturulması Mikrobiyoloji Anabilim Dalı Gen Klonlanması Klonlama ne demektir? Gen klonlaması nedir? Bütün bir organizmayı klonlamadan farkı nedir? Gen klonlaması

Detaylı

Antisens Teknolojisi

Antisens Teknolojisi Orlab On-Line Mikrobiyoloji Dergisi Yıl: 2007 Cilt: 05 Sayı: 2 Sayfa: 14-31 www.mikrobiyoloji.org/pdf/702070203.pdf Giriş Antisens Teknolojisi İsmail Karaboz 1, Caner Çolak 2 Antisens teknolojisi insan,

Detaylı

Tarifname P53 AKTİVASYONU VESİLESİ İLE ANTİ-KARSİNOJENİK ETKİ GÖSTEREN BİR FORMÜLASYON

Tarifname P53 AKTİVASYONU VESİLESİ İLE ANTİ-KARSİNOJENİK ETKİ GÖSTEREN BİR FORMÜLASYON 1 Tarifname P3 AKTİVASYONU VESİLESİ İLE ANTİ-KARSİNOJENİK ETKİ GÖSTEREN BİR Teknik Alan FORMÜLASYON Buluş, p3 aktivasyonu vesilesi ile anti-karsinojenik etki göstermeye yönelik oluşturulmuş bir formülasyon

Detaylı

YAZILI SINAV CEVAP ANAHTARI BİYOLOJİ

YAZILI SINAV CEVAP ANAHTARI BİYOLOJİ YAZILI SINAV CEVAP ANAHTARI BİYOLOJİ CEVAP 1: (TOPLAM 9 PUAN) 1.1: Eğer terleme ve su emilimi arasındaki ilişkide ortam sıcaklığının etkisini öğrenmek istiyorsa; deneyi aynı sayıda yaprağa sahip aynı tür

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA GEN İFADESİNİN DÜZENLENMESİ DNA Düzeyinde Gen Ekspresyonu Düzenlemesi Transkripsiyonel Düzeyde Gen Ekspresyonu Düzenlenmesi Post-transkripsiyonel Düzeyde Gen Ekspresyonu

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

Kromozom Biyolojisi. Tarihçe

Kromozom Biyolojisi. Tarihçe Kromozom Biyolojisi Tarihçe Kromozom Biyolojisi ve Sitogenetik -Son 300 yıldır önemli araştırma alanlarından -Moleküler biyolojideki gelişmeler de kromozomlar üzerindeki araştırmaları etkiledi -Kromozomlar

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

MikroRNA Biyogenezi. MicroRNA Biogenesis

MikroRNA Biyogenezi. MicroRNA Biogenesis Atatürk Üniversitesi Vet. Bil. Derg. 2015; 10(3): 211-218 Derleme/Review DOI:10.17094/avbd.35776 MikroRNA Biyogenezi Mustafa HİTİT 1, Ercan KURAR 2, Aydın GÜZELOĞLU 1 1. Selçuk Üniversitesi, Veteriner

Detaylı

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D 1. DNA replikasyonu.. için gereklidir A) sadece mitoz B) sadece mayoz C) mitoz ve mayoz D) sadece gamet oluşumu E) sadece protein sentezi 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

Beşinci Baskıya Önsöz, xv Dördüncü Baskıya Önsöz, xvi Üçüncü Baskıya Önsöz, xvii İkinci Baskıya Önsöz, xviii Birinci Baskıya Önsöz, xx

Beşinci Baskıya Önsöz, xv Dördüncü Baskıya Önsöz, xvi Üçüncü Baskıya Önsöz, xvii İkinci Baskıya Önsöz, xviii Birinci Baskıya Önsöz, xx Beşinci Baskıya Önsöz, xv Dördüncü Baskıya Önsöz, xvi Üçüncü Baskıya Önsöz, xvii İkinci Baskıya Önsöz, xviii Birinci Baskıya Önsöz, xx Kısım 1: Gen Klonlama ve DNA Analizinin Temel İlkeleri, 1 1 Gen Klonlama

Detaylı

Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki

Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki başarılı girişimlerini belgeler. İstenen ve istenmeyen

Detaylı

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE YAZILIYA HAZIRLIK SORULARI 12. Sınıf 1 GENDEN PROTEİNE Protein sentezini tüm canlılar gerçekleştirir. Bir mrna molekülünde en fazla 64 çeşit kodon bulunur. DOĞRU YANLIŞ SORULARI Canlıların heterotrof beslenenleri

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

Farmakolojide Yeni Hedefler: Tanı ve Tedavide mikrorna'ların Potansiyel Değeri ve Araştırma Yöntemleri

Farmakolojide Yeni Hedefler: Tanı ve Tedavide mikrorna'ların Potansiyel Değeri ve Araştırma Yöntemleri Türk Farmakoloji Derneği XXI. Eğitim Sempozyumu Ege Üniversitesi Eczacılık Fakültesi Farmakoloji Anabilim Dalı işbirliğiyle Farmakolojide Yeni Hedefler: Tanı ve Tedavide mikrorna'ların Potansiyel Değeri

Detaylı

SAHTE İSMİNİ HAKETMEYEN GENLER; PSÖDOGENLER

SAHTE İSMİNİ HAKETMEYEN GENLER; PSÖDOGENLER Doi: 10.17944/mkutfd.62254 DERLEME/ REVİEW SAHTE İSMİNİ HAKETMEYEN GENLER; PSÖDOGENLER Mustafa Kemal Üniv Tıp Derg 2016; 7(25): 50-55 Not Deserve the Pseudo Name; Pseudogenes Dilara Sönmez 1, Bülent Göğebakan

Detaylı

XXVII. ULUSAL BİYOKİMYA KONGRESİ

XXVII. ULUSAL BİYOKİMYA KONGRESİ XXVII. ULUSAL BİYOKİMYA KONGRESİ TİP2 DİYABETİK RATLARDA Vitis vinifera L. EKSTRAKTININ PIK3R1 (phosphatidylinositol 3-kinase regulatory subunit 1) GEN İFADESİ ÜZERİNE ETKİSİ 1 Emine Gülsün CAN 1 Emine

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

Kök Hücre ve Farklılaşma

Kök Hücre ve Farklılaşma Kök Hücre ve Farklılaşma Kök Hücre Erişkin ve embriyonik kök hücreler farklılaşarak soma7k hücreleri oluştururlar. Kök hücre Progenitör hücre Farklılaşmış hücre Neden Farklılaşmaya İh7yaç Duyulur Tek hücreli

Detaylı

HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin

HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Hücrenin biyosentez mekanizmalarındaki hatalar toplamıdır Hücresel metabolizmanın yavaşlaması sonucu geri dönüşü olmayan olaylar toplamıdır Yaşlılık

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

BİTKİLERE GEN TRANSFERİNDE KULLANILAN VEKTÖRLER

BİTKİLERE GEN TRANSFERİNDE KULLANILAN VEKTÖRLER BİTKİLERE GEN TRANSFERİNDE KULLANILAN VEKTÖRLER Feyza Tufan Yüksek Lisans Öğrencisi Moleküler Biyoloji ve Genetik Anabilim Dalı Fen Bilimleri Enstitüsü İstanbul Üniversitesi İÇERİK Vektörler Aktarılan

Detaylı

Agrobacterium rhizogenes

Agrobacterium rhizogenes Agrobacterium rhizogenes Agrobacterium toprakta yaşayan gram negatif bir bakteri, Rhizobieceae fam., doğal genetik mühendisi, A. rhizogenes- saçak kök ( hairy root ) hastalığı A. tumefaciens- dikotillerde

Detaylı

SİSTEM BİYOLOJİSİ NEDİR?

SİSTEM BİYOLOJİSİ NEDİR? SİSTEM BİYOLOJİSİ SİSTEM BİYOLOJİSİ NEDİR? Sistem biyolojisi, canlıların genler, proteinler ve biyokimyasal tepkimelerin etkileşen ve bütünleşmiş bir ağ yapısı olarak algılanarak incelenmesini amaçlayan

Detaylı

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER Plazmid ve Epizomlar Bakterilerin kendi kromozomlarının yanı sıra, kromozom dışı bazı genetik parçacıklar bulunmaktadır Bakteri kromozomundan daha küçük yapıda

Detaylı

TRANSLASYON ve PROTEİNLER

TRANSLASYON ve PROTEİNLER TRANSLASYON ve PROTEİNLER Prof. Dr. Sacide PEHLİVAN 13 Aralık 2016 mrna daki baz sırasının kullanılarak amino asitlerin doğru sıra ile proteini oluşturmasını kapsayan olayların tümüne Translasyon veya

Detaylı

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE VE GDO UYGULAMALARI GÜVENLİK VE GDO UYGULAMALARI Neslihan ATLIHAN Neslihan ATLIHAN Gıda Yüksek Mühendisi Gıda Yüksek Mühendisi Gıda ve Yem Kontrol

Detaylı

Ökaryotik Kromozomlar

Ökaryotik Kromozomlar Telomer Ökaryotik Kromozomlar Mitoz metafazında kromozomlar mikroskop altında görülebilir Kromozomların uçlarında telomer denilen yapılar vardır, bu yapıların görevi kromozomu korumaktır Ortaya yakın bir

Detaylı