HEMOGLOBİNOPATİLER GENETİK HETEROJENİTE MOLEKÜLER TANI. Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "HEMOGLOBİNOPATİLER GENETİK HETEROJENİTE MOLEKÜLER TANI. Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı"

Transkript

1 HEMOGLOBİNOPATİLER GENETİK HETEROJENİTE MOLEKÜLER TANI Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı

2 Hemoglobin A Molekülü

3 A Molekülü ve S taşıyıcılığı A (2α2β) 97 A2 (2α2 )3 AS (2αβAβS) SS (2α2βS) S; Beta globin zinciri 6. Glu>Val

4

5 Beta talasemi taşıyıcısı A (2α2β) A2 (2α2 ) A2 <3.7 MCV<78

6 Alfa talasemi taşıyıcısı A (2α2β) A2 (2α2 ) A2 <3.5 H (β4)

7 Türkiyede Hemoglobinopatilerin Dağılımı Altay Ç:Turkish J Hematol 2002;19(2),309

8 Evlilik öncesi tarama yapılan 33 il

9 Normal insan hemoglobinleri Embriyonik Hemoglobinler Fetal Hemoglobin Erişkin Hemoglobinleri Gower 1 (ζ 2 ε 2 ) F (α 2 γ 2 ) A (α 2 β 2 ) Gower 2 (α 2 ε 2 ) A 2 (α 2 δ 2 ) Portland (ζ 2 γ 2 )

10 Globin zincirlerinin sentezi

11 Alfa ve beta globin gen kümeleri 11 16

12 molekülünde alfa ve beta globin zincir oranı

13 HEMOGLOBİNOPATİLER Hemoglobin Varyantları Anormal Hemoglobinler Talasemiler Akdeniz Anemisi α varyantları Adana β varyantları S, İstanbul α-talasemiler β-talasemiler Orak Hücre Anemisi CVS

14 Hemoglobinopati çeşitleri Hemoglobinopati Türü Dünya (n) Türkiye (n) Hemoglobin Varyantları 1000< 52 Alfa Talasemiler 100< 10 Beta Talasemiler 200< 43 Toplam Sayı 1300< 105

15 Sık görülen Hemoglobin Varyantları S 6 Glu Val GAG GTG C 6 Glu Lys GAG AAG E 26 Glu Lys GAG AAG D-Puncap 121 Glu Gln GAA CAA O-Arab 121 Glu Lys GAA AAA H 4 Barts 4

16 S ve D Taşıyıcılarına Ait Hematolojik Veriler Cins/ Yaş RBC /L g/dl Hct MCV fl MCH Pg MCHC g/dl Tipi β-globin Genotipi E AS AS E AS AS E AS AS K AS AS K AS AS E AD AD K AD AD E AD AD K AD AD E AD AD K AD AD

17 E ve C Taşıyıcılarına Ait Hematolojik Veriler Cins/ Yaş RBC /L g/dl Hct MCV fl MCH Pg MCHC g/dl Elektr. Beta Globin Genotipi K AE AE K AE AE E AE AE E AE AE K AE AE K AC AC E AC AC K AC AC E AC AC E AC AC

18 Ülkemizde görülen Hemoglobin varyantları Hemoglobin Mutation Hemoglobin Mutation 1 O-Podova α30 Glu Lys 27 Siirt β27 Ala Gly 2 Hasharon α47aspu His 28 Hakkari β31 Leu Arg 3 Monthgomery α48leu Arg 29 G-Copenhagen β47 Asp Asn 4 Adana α59 Gly Asp 30 Summer Hill β52 Asp His 5 J-Anatolia 61 Lys Thr 31 Hamadan β56 Gly Arg 6 Ube-2 α68 Asn Asp 32 J-Antakya β65 Lys Met 7 Q-Iran α75 Asp His 33 City of Hope β69 Gly Ser 8 Moabit α86 Leu Arg 34 J-Iran β77 His Asp 9 M-Iwate α87 His Tyr 35 Yaizu β79 Asp Asn 10 Çapa α94 Asp Gly 36 G-Szuhu β80 Asn Lys 11 Setif α94 Asp Tyr 37 Pyrgos β83 Gly Asp 12 G-Georgia α 95 Pro Leu 38 Istanbul β92 His Gln 13 Bronovo α103 His Leu 39 N-Baltimore β95 Lys Glu 14 Strumica α112 His Arg 40 Köln β98 Val Met 15 J-Meerut α120 Ala Glu 41 D-Punjab β121 Glu Gln 16 Tyne β5 Pro Ser 42 O-Arab β121 Glu Lys 17 S β6 Glu Val 43 Beograd β121 Glu Val 18 C β6 Glu Lys 44 Tunis β124pro Ser 19 Ankara β10 Ala Asp 45 Sarrebourg β131 Gln Arg 20 D-Ouled Rabah β19 Asn Lys 46 Brocton β138 Ala Pro 21 E-Saskatoon β22 Glu Lys 47 A2Yialousa D82 Ala Ser 22 G-Cousatta β22 Glu Ala 48 Baskent γ128 Ala Thr 23 D-Iran β22 Glu Gln 49 Lepore-Boston Hybrid 24 E β26 Glu Lys 50 P-Nilotic Hybrid 25 Knosos β27 Ala Ser 51 Costant Spring Elonged chain 26 Volga β27 Ala Asp 52 Antalya Deletion&Insertion

19 Ülkemizde sık görülen beta talasemi mutasyonları Mutasyon Mutasyon Türü IVSI (G A) 40.8 IVSI-6 + (T C) 10.3 IVSII-1 0 (G A) 8.0 IVSII (C G) 6.2 IVSI-1 0 (G A) 5.7 Fsc 8 0 (-AA) (T A) 4.2 Cd 39 0 (C T) 2.9 Fsc 8/9 0 (+G) 2.6 Cd 44 0 ( C) 1.8 Fsc 5 0 (-CT) 1.2

20 β-talasemi Taşıyıcılarına ait Hematolojik Veriler Cins/ Yaş RBC /L g/dl Hct MCV fl MCH Pg MCHC g/dl Tipi A 2 Beta Globin Genotipi K AA 4.8 IVSI-110 (G>A) E AA 4.8 IVSI-1 (G>A) E AA 4.7 Cod 39 (C>T) K AA 4.1 IVSI-6 (C>T) K AA 5.8 Fsc 8 (AA) K AA (T>A) K AA 6.1 IVS2-1 (G>A) K AA 5.7 IVS2-745 (C>G) K AA 4.0 Fsc5 (-CT) K AA 4.0 Fsc 44 (-C) E AA 4.2 Fsc 74/75 (-C) E AA 3.6 IVSI-5 (G>C) E AA 4.3 Fsc 8/9 (+G)

21 Ülkemizde görülen beta talasemi mutasyonları Position Mutation Position Mutations C T 22 IVS-I-110 G A 2-88 C T 23 IVS-I-116 T G 3-87 C G 24 IVS-I-130 G A 4-30 T A 25 IVS-I-130 G C 5-28 A C 26 FSC-36/37 -T 6 5 -UTR +22 G A 27 Cd 37 G A 7 FSC-5 -CT 28 FSC bp 8 FSC-6 -A 29 Cd 39 C T 9 FSC-8 -AA 30 FSC-44 -C 10 FSC-8/9 +G 31 FSC-74/75 -C 11 Cd 15 G A 32 FSC-82/83 -G 12 FSC AAGTTGG 33 IVS-II-1 G A 13 Cd 30 G C 34 IVS-II-654 C T 14 IVS-I-1 G A 35 IVS-II-745 C G 15 IVS-I-1 G C 36 IVS-II-848 C A 16 IVS-I-1 G T 37 IVS-II-849 A G 17 IVS-I-2 T A 38 3'-UTR -13 bp 18 IVS-I-5 G A 39 Poly A AATAAA AATGAA 19 IVS-I-5 G C 40 Poly A AATAAA AATAAG 20 IVS-I-5 G T 41 Poly A AATAAA AACAAA 21 IVS-I-6 T C bp Deletion

22 BETA TALASEMİ GENOTİPLERİ Allel durumu Fenotip Sağlam / Normal Sessiz taşıyıcı + / -Thal heterozigot Homozigot + / + -Thal homozigot Beta talasemi intermedia IVS1-6/IVS1-6 Ağır Taşıyıcı 0 / -Thal heterozigot Homozigot 0 / 0 -Thal homozigot BetaTalasemi Major IVS2-1/IVS2-1 Kombine Heterozigot + / 0 -Thal çift heterozigot Beta talasemi intermedia IVS1-6/IVS2-1 Beta talasemi Major IVS1-1/IVS2-1

23 Alfa globin gen delesyonları

24 Alfa talasemi genotipleri

25 Alfa globin gen mutasyonları DELESYONEL ALFA TALASEMİ MUTASYONLARI NONDELESYONEL ALFA TALASEMİ MUTASYONLARI 3.7 Kb α Kb α Kb Med I α Kb α Kb Med II α 0 PA1 * AATAAA AATAAG α + PA2 ** AATAAA AATGAA α + 5NT DEL α + ADANA α + KOYA DORA α + * Arabian Population ** Turkish and Cyprus population

26 Delesyonel ve nondelesyonel alfa talasemi taşıyıcıların hematolojik verileri Cins/Yaş RBC /L g/dl Hct MCV fl MCH pg MCHC g/dl Tipi A 2 Alfa talasemi Genotipi Erkek n: AA 2.5 αα/αα Kadın n: AA 2.5 αα/αα E AA α(3.7)/αα K AA α(4.2)/αα K AA (17.4)/αα E AA (20.5)/ αα K AA (26.5)/ αα E AA 1.4 αα/α 5nt α E AA 2.5 αα/ α PA1 α K AA 1.9 αα/α PA2 α E: Erkek, K: Kadın, *MED I, **MED II, 5nt: 5 nüleotid delesyonu (-TGAGG), PA1: AATAAA AATAAG, PA2: AATAAA AATGAA

27 ALFA TALASEMİ GENOTİPLERİ Gen sayısı Fenotip Sağlam / Normal Sessiz taşıyıcı ( + ) - / -thal-2 heterozigot Homozigot - /- -thal-2 homozigot Ağır Taşıyıcı ( 0 ) - -/ -thal-1 heterozigot Bart s --/-- -thal-1 homozigot H - -/- -thal-1/ -thal-2 Nondelesyonel -talasemi * / Nondelesyonel -thal H * / * Nondel -thal homozigot H - -/ * -thal-1/non del -thal H - -/ * -thal-1/non del -thal * Nokta mutasyonu

28 H Genotipleri ve hematolojik verileri Cins/Yaş RBC /L g/dl Hct MCV fl MCH pg MCHC g/dl Tip A 2 H Genotipi E AH (MED I)/-α(3.7) K AH (20.5)/-α(3.7) K AH (20.5)/-α(4.2) E AH (MEDII)/-α(3.7) E AH (MED I)/α 5nt α K AH (MED I)/α PA1 α E AH (20.5)/αα CD59 K AH (MED II)/α 5nt α E AH 0.8 α PA1 α/α PA1 α

29 GLOBİN GEN KOMBİNASYONLARI Abnormal Hemoglobins S, E, D, C -Thalassemia Mutations Alpha 3.7 kb del Alpha 17.4 kb del Alpha 20.5 kb del Alpha 26.5 kb del Alpha 4.2 kb del -Thalassemia Mutations IVSI-110 IVSI-1 IVSI-6 IVSI-5-30

30 Cins/Yaş SS ve S-β-Talasemili hastaların Hematolojik Verileri RBC /L g/dl Hct MCV fl MCH Pg MCHC g/dl Tipi F Beta Globin Genotipi K SS 0.3 SS E SS(F) 9.5 SS E SS 1.1 SS E SS 1.1 SS K SS(F) 14.5 SS E SD 0.9 SD E SE 2.2 SE K SS(F) 3.4 S/IVSI-1 K SS 0.9 S/Fsc5 K SF 15.8 S/IVSI-5 E SS 1.7 S/IVSI-6 E SS 2.0 S/IVSI-110 E SF 10.0 S/Cd39

31 DD, D-β-Talasemi ve E-β- Talasemili Hastaların Hematolojik Değerleri Cins /Yaş RBC /L g/dl Hct MCV fl MCH Pg MCHC g/dl Tipi F Beta Globin Genotipi E DD 0.4 DD K DD 1.7 DD K DD 1.4 D/IVSI-1 E DD 2.3 D/Fsc5 K DD 1.1 D/IVSI-110 K DD 1.7 D/IVSI-110 E EE 1.2 E/IVSI-6 E EF 10.0 E/IVSI-110

32 S ile Delesyonel veya Nondelesyonel Alfa Talasemi Kombinasyonları Cins/Yaş RBC /L g/dl Hct MCV fl MCH pg MCHC g/dl Tipi A 2 Alfa talasemi Genotipi K AS 3.1 αα/αα E AS 3.5 αα/αα K AS α(3.7)/αα K AS α(4.2)/αα E AS (17.4)/αα K AS (20.5)/αα E AS (26.5)/αα E AS 3.3 αα/α PA2 α K AS (17.4)/-α(3.7) E AS (26.5)/α PA2 α

33 HPLC ile belirlenen A, A2 ve X

34 Hemoglobin X Cins Yaş RBC /L g/dl Hct MCV fl MCH Pg Fe μg/dl Ferritin ng/ml -X K/ K/ E/ E/

35 Pedigree of the family with Sarrebourg

36 DNA Dizi analizi ile Sarrebourg (β131 CAG CGG)

37 Baba Anne

38 Kız kardeş Erkek kardeş

39 Hemoglobin AX Adı Soyadı Cins Yaş RBC /L g/dl Hct MCV fl MCH Pg MCHC g/dl X G.S. K/ C.S. E/ Y.S. K/ M.O.S E/

40 E-Saskatoon ve G-Coushatta Hematolojik Veriler Adı Soyadı RBC /L g/dl Hct MCV fl MCH Pg MCHC g/dl HPLC Elktr. Mutasyon A. S AE AD S.A EE DD T. B AS AE Z. B AS AE AE- Saskatoon EE- Saskatoon AG- Coushatta AG- Coushatta

41 Taşıyıcıların belirlenmesi Kan örneği alınır EDTA*Na2 tüplere konur Bu kan örneğinden sayım yapılır Hemoglobin varyant analizi yapılır Anormal, beta veya alfa talasemi tanısı alır Bu kandaki lökositlereden DNA izole edilir PCR ile mutasyon taraması yapılır Doğum öncesi tanıda CVS de bu mutasyonlar aranır

42 Taşıyıcıların belirlenmesi Yüksek Basınçlı Sıvı Kromatografisi (HPLC) kullanılmaktadır Anormal Hemolobinler tanımlanmakta ve miktarları ölçülmektedir. A2 miktarı ölçülerek talasemi taşıyıcıları belirlenmektedir. Kan sayımı yapılarak eritrosit indeksleri ile talasemi taşıyıcılığına kesin tanı konur. Beta talasemi taşıyıcılarında A2>3.7 ve MCV<79 fl

43

44 GAG T g a

45 CVS Alınması

46

47 PCR YÖNTEMLERİ RFLP ARMS sonuçları Anne Baba CVS CVS KONTROL Anne Baba CVS CVS (+) (-) Kontrol Mutant Normal Normal Normal AS AS SS SS AA AS SS Kontrol Mutanat

48 PolyA mutasyonu taşıyan bir aile Cins RBC MCV MCH MCHC A 2 F Yıl g/dl /L fl pg g/dl Anne Baba

49 1 GGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCC GGTCAACTTCAAGgt gagcggcgggccgggagcgat ct gggt cgaggggcgagat ggcgcct t cct cgcagggca t gaggat cacgcgggt t gcgggaggt gt agcgcaggcggcggct gcgggcct gggccct cggccccact gaccct c *******----g t t c t c t gc a c a gctcctaagccactgcctgctggtgaccctggccgcccacctccccgccgagttcacccctgcg GTGCA CGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAgc t gga gc c t cggt ggccat gct t ct t gcccct t gggcct ccccccagcccct cct cccct t cct gcacccgt acccccgt ggt a---g-t-c--c-----ga aa-g-a *c--tt-c ct t t gaat aaagt ct gagt gggcggcagcct gt gt gt gcct gagt t t t t t ccct c*agaaacgt gccagc*at gg g---c-c--tg--cc-g--t------a-a----

50 Poly A mutasyonu GTGCA CGCCTCCCTGGACAAGTT CCTGGC TTCTGTAG ACACCGTGCTGACCT CCAAATA CCGTTAAgctggagcctcgg tggccatgcttcttgcccctt gggcctccccccagcccctcctccccttcc tgcacccgtaccccc PolyA gtggtctttaataaagtctgagtgggcggcagccgttgtgtg g g cctgagtttttt ctgtcccggaatgtgccaacaatgg

51 Normal N Anne M Baba F CVS CVS Kontrol C

52 A C G T A C G T A C G T MOTHER FATHER G G G T G A G T C T G A G A A T A A G T T T C T G G T C C T cvs Anne Baba CVS

53 Alfa ve beta talasemi mutasyonunun birlikte olduğu bir ailenin hematolojik değerleri Family RBC /L g/dl Hct MCV fl MCH Pg Elect A 2 Genotype Mother Z.K.26 Father M.K AA 4.8 IVS1-110 /N AA / 20.5 kb Boy K.K.6 Girl D.K AA 4.2 IVS1-110/ 20.5 kb AA 4.3 IVS1-110 /N Anne β-thal (IVS1-110) ve Baba -Thal-1 (20.5kb del)

54

55

56

57

58 Prenatal Tanı (Üç ayrı aile) Orak hücre anemili anne ve taşıyıcı baba Family RBC Hct MCV MCH F Genotype /L g/dl fl pg Elect Mother 27 Father 23 CVS Mother 28 Father 30 CVS Mother 23 Father 30 CVS SF 9.0 SS AS 1.4 AS SS SF 9.0 SS AS 1.0 AS SS SS 1.6 SS AS 0.9 AS SS

59 Prenatal Tanı Orak hücre anemili anne ve taşıyıcı baba Family RBC Hct MCV MCH F Genotype /L g/dl fl pg Elect Mother 21 Father 26 CVS Mother 22 Father 27 CVS Mother 24 Father 29 CVS SF 13.0 SS AS 2.2 AS SS SF 11.9 SS AS 1.4 AS SS SF 15.0 SS AS 2.0 AS AS

60 Prenatal Tanı Orak hücre anemili anne ve taşıyıcı baba Family RBC Hct MCV MCH F Genotype /L g/dl fl Pg Elect Mother 23 Father 25 CVS Mother 25 Father 27 CVS SS 3.9 SS AS 1.8 AS SS SS 5.5 SS AS 1.3 AS AS

61 Prenatal Tanı Orak hücre anemili anne ve taşıyıcı baba (AE) Family RBC Hct MCV MCH F Genotype /L g/dl fl Pg Elect Mother 27 Father 28 CVS SF 14.2 SS AE 1.2 AE ES

62 Prenatal Tanı EE anne ve taşıyıcı baba AS Family RBC Hct MCV MCH F Genotype /L g/dl fl pg Elect Mother 24 Father 27 CVS EE 1.5 E-Saskatoon/ E-Saskatoon AS 1.2 AS A/ E-Saskatoon

63 Prenatal Tanı DD anne ve taşıyıcı baba AC Family RBC Hct MCV MCH F Genotype /L g/dl fl pg Elect Mother 26 Father 34 CVS Mother 28 Father 36 CVS DD 1.8 D/ D AC 1.9 AC CD DD 1.8 D/ D AC 1.9 AC AD

64 Prenatal Tanı S- -Thal anne ve taşıyıcı baba Family RBC /L g/dl Hct MCV fl MCH pg Elect A 2 F Genotype Mother 26 Father 27 CVS SS S/IVSI AA A/IVSI-1 S/IVSI-1 Mother 23 Father 28 CVS SS S/IVSI AS AS A/IVSI-5

65 Prenatal Tanı S- -Thal anne ve Normal baba Family RBC /L g/dl Hct MCV fl MCH pg Elect A 2 F Genotype Mother U26 Father U26 CVS SF S/IVSI AA Normal A/IVSI-110

66 Prenatal Tanı -Thal intermedia anne ve taşıyıcı baba Family RBC /L g/dl Hct MCV fl MCH pg Elect A 2 F Genotype Mother T24 Father T30 CVS AF / AA 6.2 A/-30 A/-30

67

68 Yeni Mutasyon Türleri Mutasyon Türü ve yeri Yayınlanan Dergi ve yılı Adana 1 geni Am J Hematol 1993 IVS geni Br J Hematol 1993 Poly A 2 geni Br J Hematol 1992 IVS2-850 geni Hemoglobin 1995

69 İlginize teşekkür ederim

NONDELESYONEL ALFA TALASEMİLER

NONDELESYONEL ALFA TALASEMİLER Augusta GA, USA NONDELESYONEL ALFA TALASEMİLER Prof. Dr. Mehmet Akif ÇÜRÜK Çukurova Üniversitesi Tıp Fakültesi Tıbbi Biyokimya Anabilim Dalı Kırmızı kan hücreleri Hemoglobin Molekülü Beta talasemi taşıyıcılığı

Detaylı

ÇUKUROVA DA HEMOGLOBİNOPATİLERİN MOLEKÜLER TANISI

ÇUKUROVA DA HEMOGLOBİNOPATİLERİN MOLEKÜLER TANISI ÇUKUROVA DA HEMOGLOBİNOPATİLERİN MOLEKÜLER TANISI Ahmet GENÇ Çukurova Üniversitesi Tıp Fakültesi Biyokimya Anabilim Dalı Doktora Öğrencisi ahmetgenc_@hotmail.com Bu tez çalışması, Çukurova Üniversitesi

Detaylı

HEMOGLOB NOPAT LERDE SORUNLU VAKALARIN ANAL Z

HEMOGLOB NOPAT LERDE SORUNLU VAKALARIN ANAL Z 5. Uluslararası Talasemi Yazokulu 5th International Thalassemia Summerschool 93 HEMOGLOB NOPAT LERDE SORUNLU VAKALARIN ANAL Z Ahmet Genç, Filiz Zeren, Mehmet Akif Çürük Çukurova Üniversitesi, Tıp Fakültesi

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

Antalya İlindeki Beta-Talasemi Gen Mutasyonları, Tek Merkez Sonuçları

Antalya İlindeki Beta-Talasemi Gen Mutasyonları, Tek Merkez Sonuçları Antalya İlindeki Beta-Talasemi Gen Mutasyonları, Tek Merkez Sonuçları Ayşegül UĞUR KURTOĞLU, Volkan KARAKUŞ, Özgür ERKAL, Erdal KURTOĞLU Antalya Eğitim ve Araştırma Hastanesi Biyokimya Kliniği,Genetik

Detaylı

TALASEMİ VE HEMOGLOBİNOPATİLERDE GENOTİP-FENOTİP İLİŞKİSİ

TALASEMİ VE HEMOGLOBİNOPATİLERDE GENOTİP-FENOTİP İLİŞKİSİ TALASEMİ VE HEMOGLOBİNOPATİLER TALASEMİ VE HEMOGLOBİNOPATİLERDE GENOTİP-FENOTİP İLİŞKİSİ Dr. Erol BAYSAL FRCP (London) Consultant Molecular Geneticist Head of Molecular Genetics Unit Senior Lecturer Dubai

Detaylı

β-talasemiler Prof.Dr. Abdullah ARPACI 7-9 KASIM KAHRAMAN MARAŞ

β-talasemiler Prof.Dr. Abdullah ARPACI 7-9 KASIM KAHRAMAN MARAŞ β-talasemiler Prof.Dr. Abdullah ARPACI 7-9 KASIM KAHRAMAN MARAŞ İÇERİK HEMOGLOBİN YAPISI β-talasemi GENEL BİLGİ MOLEKÜLER YAPISI KLİNİK SINFLANDIRMA LABORATUVAR ÖNLEM HPLC Hücre 2DNA nın İşlevi Nedir?

Detaylı

ALFA TALASEMİ MUTASYONLARININ DNA DİZİ ANALİZİ İLE BELİRLENMESİ

ALFA TALASEMİ MUTASYONLARININ DNA DİZİ ANALİZİ İLE BELİRLENMESİ T.C. ÇUKUROVA ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOKİMYA ANABİLİMDALI ALFA TALASEMİ MUTASYONLARININ DNA DİZİ ANALİZİ İLE BELİRLENMESİ Figen GÜZELGÜL YÜKSEK LİSANS TEZİ DANIŞMANI Prof. Dr.

Detaylı

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β

Detaylı

Hemoglobinopatilere Laboratuvar Yaklaşımı

Hemoglobinopatilere Laboratuvar Yaklaşımı Hemoglobinopatilere Laboratuvar Yaklaşımı Dr. Çağatay Kundak DÜZEN LABORATUVARLAR GRUBU 1949 yılında Orak Hücre Anemisi olan hastalarda elektroforetik olarak farklı bir hemoglobin tipi tanımlanmıştır.

Detaylı

ÇUKUROVA ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ

ÇUKUROVA ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ ÇUKUROVA ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ YÜKSEK LİSANS TEZİ Volkan Vural TAŞ TÜRKİYE DE HEMOGLOBİN VARYANTLARI VE TALASEMİ MUTASYONLARI BİLGİ SİSTEMİ BİYOTEKNOLOJİ ANABİLİM DALI ADANA, 2008 ÇUKUROVA

Detaylı

β - TALASEMİ DE MOLEKÜLER TANI VE YÖNTEMLERİ

β - TALASEMİ DE MOLEKÜLER TANI VE YÖNTEMLERİ TALASEMİ VE HEMOGLOBİNOPATİLER Boğaziçi Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü, İstanbul basak@boun.edu.tr β - TALASEMİ DE MOLEKÜLER TANI VE YÖNTEMLERİ Prof. Dr. A.Nazlı BAŞAK GİRİŞ Son onbeş

Detaylı

Hemoglobin Elektroforezi. Doç. Dr. Şule Ünal Hacettepe Üniversitesi, Pediatrik Hematoloji Ünitesi

Hemoglobin Elektroforezi. Doç. Dr. Şule Ünal Hacettepe Üniversitesi, Pediatrik Hematoloji Ünitesi Hemoglobin Elektroforezi Doç. Dr. Şule Ünal Hacettepe Üniversitesi, Pediatrik Hematoloji Ünitesi GLOBIN BOZUKLUKLARI 1 Yetersiz normal Hb sentezi (Niceliksel hemoglobinopatiler) >>TALASEMİLER 2 Anormal

Detaylı

Perifer hastanelerinde talasemi tanısı ve izlemi. Dr. Şule Ünal Antakya Devlet Hastanesi

Perifer hastanelerinde talasemi tanısı ve izlemi. Dr. Şule Ünal Antakya Devlet Hastanesi Perifer hastanelerinde talasemi tanısı ve izlemi Dr. Şule Ünal Antakya Devlet Hastanesi DÜNYADA (WHO) Taşıyıcılık oranı..% 5.1 Taşıyıcı sayısı > 266 000 000 Her yıl doğan yeni taşıyıcı sayısı.1 000 000

Detaylı

Kahramanmaraş Talasemi. Sempozyumu I

Kahramanmaraş Talasemi. Sempozyumu I Kahramanmaraş Talasemi Sempozyumu I 7-9 Nisan 2016 Kahramanmaraş Talasemi Sempozyumu I 7-9 Nisan 2016 Ramada Otel, Kahramanmaraş BİLİMSEL PROGRAM Saat 7 Nisan 2016, Perşembe 09:00 16:00 KURS 16:30-18:00

Detaylı

Dr. Duran Canatan. Anahtar Sözcükler. Epidemiyoloji, Hemoglobinopati, Talasemi, Türkiye TÜRKİYE DE HEMOGLOBİNOPATİLERİN EPİDEMİYOLOJİSİ

Dr. Duran Canatan. Anahtar Sözcükler. Epidemiyoloji, Hemoglobinopati, Talasemi, Türkiye TÜRKİYE DE HEMOGLOBİNOPATİLERİN EPİDEMİYOLOJİSİ TÜRK HEMATOLOJİ DERNEĞİ 2014: 4 1 Dr. Duran Canatan Ulusal Hemoglobinopati Konseyi ve Talasemi Federasyonu Kurucu Başkanı Akdeniz Kan Hastalıkları Vakfı - Hemoglobinopati Tanı Merkezi Başkanı e-posta:

Detaylı

HEMOGLOBİN VARYANTLARININ DNA DİZİ ANALİZİ İLE BELİRLENMESİ

HEMOGLOBİN VARYANTLARININ DNA DİZİ ANALİZİ İLE BELİRLENMESİ T.C. ÇUKUROVA ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ BİYOKİMYA ANABİLİM DALI HEMOGLOBİN VARYANTLARININ DNA DİZİ ANALİZİ İLE BELİRLENMESİ Ahmet GENÇ YÜKSEK LİSANS TEZİ DANIŞMANI Doç. Dr. M. Akif ÇÜRÜK

Detaylı

The investigation of distribution of hereditary alpha-thalassemia mutations in Isparta reservoir

The investigation of distribution of hereditary alpha-thalassemia mutations in Isparta reservoir Original Article / Özgün Araştırma The investigation of distribution of hereditary alpha-thalassemia mutations in Isparta reservoir Isparta ve Çevresinde Alfa-Talasemi Kalıtsal Mutasyonlarının Dağılımının

Detaylı

Hemoglobin G-Coushatta ile b (IVSI-110) veya S Bileşik Heterozigot Riskli Fetus İçin Prenatal Genetik Danışmanlık

Hemoglobin G-Coushatta ile b (IVSI-110) veya S Bileşik Heterozigot Riskli Fetus İçin Prenatal Genetik Danışmanlık Hemoglobin G-Coushatta ile b (IVSI-110) veya S Bileşik Heterozigot Riskli Fetus İçin Prenatal Genetik Danışmanlık Haluk AKIN *, Aslıhan YILMAZ EKMEKÇİ **, Asude ALPMAN DURMAZ **, Burak DURMAZ ***, Hüseyin

Detaylı

β- TALASEMİ MOLEKÜLER TANISINDA KLASİK YÖNTEMLERLE MİKROARRAY YÖNTEMİNİN KARŞILAŞTIRILMASI

β- TALASEMİ MOLEKÜLER TANISINDA KLASİK YÖNTEMLERLE MİKROARRAY YÖNTEMİNİN KARŞILAŞTIRILMASI T.C. ÇUKUROVA ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ BİYOKİMYA ANABİLİM DALI β- TALASEMİ MOLEKÜLER TANISINDA KLASİK YÖNTEMLERLE MİKROARRAY YÖNTEMİNİN KARŞILAŞTIRILMASI Elçin ÖZKARALI YÜKSEK LİSANS TEZİ

Detaylı

ÖZET SUMMARY BETA TALASEMİ MUTASYON TİPLERİNİN MOLEKÜLER ANALİZİ MOLECULAR GENETIC ANALYSES OF BETA-THALASSEMIA PATIENTS

ÖZET SUMMARY BETA TALASEMİ MUTASYON TİPLERİNİN MOLEKÜLER ANALİZİ MOLECULAR GENETIC ANALYSES OF BETA-THALASSEMIA PATIENTS Ege Tıp Dergisi 39 (3): 153-157, 2000 BETA TALASEMİ MUTASYON TİPLERİNİN MOLEKÜLER ANALİZİ MOLECULAR GENETIC ANALYSES OF BETA-THALASSEMIA PATIENTS Berna YILMAZ 1 Zuhal BALIM 1. Ferda ÖZKINAY 2 Cumhur GÜNDÜZ

Detaylı

Okmeydanı Eğitim ve Araştırma Hastanesi Tıbbi Biyokimya Laboratuvarında HPLC Yöntemi ile Saptanan Anormal Hemoglobin Varyantları

Okmeydanı Eğitim ve Araştırma Hastanesi Tıbbi Biyokimya Laboratuvarında HPLC Yöntemi ile Saptanan Anormal Hemoglobin Varyantları doi:.5222/otd.26.65 Araştırma Okmeydanı Eğitim ve Araştırma Hastanesi Tıbbi Biyokimya Laboratuvarında HPLC Yöntemi ile Saptanan Anormal Hemoglobin Varyantları Okan Dikker*, Müberra Vardar*, Rıza Sandıkçı*,

Detaylı

ANORMAL HEMOGLOB NLER

ANORMAL HEMOGLOB NLER 5. Uluslararası Talasemi Yazokulu 5th International Thalassemia Summerschool ANORMAL HEMOGLOB NLER Doç. Dr. Canan Vergin Dr.Behçet Uz Çocuk Hastalıkları E itim Ara tırma Hastanesi, ZM R e-mail: cvergin@gmail.com

Detaylı

Anemili Çocuk Prof. Dr. Yeşim Aydınok

Anemili Çocuk Prof. Dr. Yeşim Aydınok Anemili Çocuk Prof. Dr. Yeşim Aydınok yesim.aydinok@ege.edu.tr Anemi nedir? 1) Solukluk, halsizlik, çabuk yorulma 2) 1+ kan hemoglobinde (Hb) azalma 3) Kan Hb düzeyinde azalma 4) Kan Hb düzeyi azalması

Detaylı

Dr. Zeynep Karakaş. Anahtar Sözcükler. Alfa talasemi, Genetik, Klinik, Anahtar Sessiz alfa Sözcükler talasemi taşıyıcı, Ağır alfa talasemi

Dr. Zeynep Karakaş. Anahtar Sözcükler. Alfa talasemi, Genetik, Klinik, Anahtar Sessiz alfa Sözcükler talasemi taşıyıcı, Ağır alfa talasemi TÜRK HEMATOLOJİ DERNEĞİ HematoLog 2014: 4 1 Dr. Zeynep Karakaş İstanbul Üniversitesi Dr. Şule İstanbul ÜnalTıp Fakültesi, Çocuk Hematoloji Onkoloji Bilim Dalı, İstanbul, Türkiye Hacettepe Üniversitesi

Detaylı

Talasemi ve Orak Hücreli Anemide Hematolojik Tanı. Dr. Zümrüt Uysal

Talasemi ve Orak Hücreli Anemide Hematolojik Tanı. Dr. Zümrüt Uysal Talasemi ve Orak Hücreli Anemide Hematolojik Tanı Dr. Zümrüt Uysal 19 Kasım 2011 Anemik Çocuğa Yaklaşım Öykü Fizik muayene Laboratuar LABORATUVAR 1.Tam Kan Sayımı Hb,Hkt, KK, OEV, OEH, OEHK, BK, Trombosit

Detaylı

Talasemi taramasında ve tanısında yaşanan sorunlar

Talasemi taramasında ve tanısında yaşanan sorunlar Talasemi taramasında ve tanısında yaşanan sorunlar PROF.DR. DURAN CANATAN Çocuk Sağlığı ve Hastalıkları / Kan / Genetik Uzmanı Akdeniz Kan Hastalıkları Vakfı Başkanı Antalya Genetik Hastalıklar Merkezi

Detaylı

TALASEM MERKEZLER NDE TANIYA YÖNEL K KULLANILAN YÖNTEMLER

TALASEM MERKEZLER NDE TANIYA YÖNEL K KULLANILAN YÖNTEMLER 5. Uluslararası Talasemi Yazokulu 5th International Thalassemia Summerschool TALASEM MERKEZLER NDE TANIYA YÖNEL K KULLANILAN YÖNTEMLER Prof. Dr. Ye im Aydınok Ege Üniversitesi Tıp Fakültesi, Pediatrik

Detaylı

Dr. Zeynep Karakaş. İstanbul Üniversitesi Dr. Ülker İstanbul Koçak Tıp Fakültesi, Çocuk Hematoloji Onkoloji Bilim Dalı, İstanbul, Türkiye

Dr. Zeynep Karakaş. İstanbul Üniversitesi Dr. Ülker İstanbul Koçak Tıp Fakültesi, Çocuk Hematoloji Onkoloji Bilim Dalı, İstanbul, Türkiye TÜRK HEMATOLOJİ DERNEĞİ 2014: 4 1 Dr. Zeynep Karakaş İstanbul Üniversitesi Dr. Ülker İstanbul Koçak Tıp Fakültesi, Çocuk Hematoloji Onkoloji Bilim Dalı, İstanbul, Türkiye Gazi Üniversitesi Tıp e-posta:

Detaylı

ANORMAL HEMOGLOBİNLERİN TANISINDA MLPA TASARIMI

ANORMAL HEMOGLOBİNLERİN TANISINDA MLPA TASARIMI ANORMAL HEMOGLOBİNLERİN TANISINDA MLPA TASARIMI Çağıl COŞKUN Temmuz 2010 DENİZLİ ANORMAL HEMOGLOBİNLERİN TANISINDA MLPA TASARIMI Pamukkale Üniversitesi Sağlık Bilimleri Enstitüsü Yüksek Lisans Tezi Biyofizik

Detaylı

HEMOGLOBİNOPATİ KONTROL PROGRAMI

HEMOGLOBİNOPATİ KONTROL PROGRAMI TALASEMİ VE HEMOGLOBİNOPATİLER T.C. Sağlık Bakanlığı AÇSAP Genel Müdürlüğü HEMOGLOBİNOPATİ KONTROL PROGRAMI Toplumların geleceği o toplumu oluşturan bireylerin nitelikleri ile doğrudan ilişkilidir. Toplumu

Detaylı

KONYA BÖLGESİNİN ANORMAL HEMOGLOBİN VE TALASEMİ MUTASYON TİPLERİNİN BELİRLENMESİ

KONYA BÖLGESİNİN ANORMAL HEMOGLOBİN VE TALASEMİ MUTASYON TİPLERİNİN BELİRLENMESİ T.C. ÇUKURAVA ÜNĠVERSĠTESĠ SAĞLIK BĠLĠMLERĠ ENSĠTĠTÜSÜ BĠYOKĠMYA ANABĠLĠM DALI KONYA BÖLGESİNİN ANORMAL HEMOGLOBİN VE TALASEMİ MUTASYON TİPLERİNİN BELİRLENMESİ Sedefgül YÜZBAġIOĞLU ARIYÜREK DOKTORA TEZĠ

Detaylı

Hemoglobinopati Verilerimiz

Hemoglobinopati Verilerimiz Hemoglobinopati Verilerimiz Hemoglobinopatiler çalışma grubu www.hemoglobinopatiler.org Hemoglobinopatiler Çalışma Grubu Koordinatörü: Yeşim Aydınok Koordinatör yardımcısı: TPHD Eritrosit Hastalıkları

Detaylı

HATAY-SAMANDAĞ YÖRESİNDEKİ LİSELERDE HEMOGLOBİNOPATİ TİPLENDİRİLMESİ VE BİLGİLENDİRİLMESİ ÇALIŞMASI

HATAY-SAMANDAĞ YÖRESİNDEKİ LİSELERDE HEMOGLOBİNOPATİ TİPLENDİRİLMESİ VE BİLGİLENDİRİLMESİ ÇALIŞMASI T.C. ÇUKUROVA ÜNİVERSİTESİ TIP FAKÜLTESİ TIBBİ BİYOKİMYA ANABİLİM DALI HATAY-SAMANDAĞ YÖRESİNDEKİ LİSELERDE HEMOGLOBİNOPATİ TİPLENDİRİLMESİ VE BİLGİLENDİRİLMESİ ÇALIŞMASI DR. MURAT TAHİROĞLU UZMANLIK TEZİ

Detaylı

Dr. Zeynep Karakaş. Anahtar Sözcükler

Dr. Zeynep Karakaş. Anahtar Sözcükler TÜRK HEMATOLOJİ DERNEĞİ 2014: 4 1 Dr. Zeynep Karakaş İstanbul Üniversitesi İstanbul Tıp Fakültesi, Çocuk Sağlığı ve Hastalıkları Anabilim Dalı, Çocuk Hematoloji Onkoloji Bilim Dalı, İstanbul, Türkiye e-posta:

Detaylı

Beta-Talasemi Taşıyıcılarında Beta-Globin Gen Mutasyon Tipi ve Hematolojik Fenotip Arasındaki İlişki

Beta-Talasemi Taşıyıcılarında Beta-Globin Gen Mutasyon Tipi ve Hematolojik Fenotip Arasındaki İlişki Beta-Talasemi Taşıyıcılarında Beta-Globin Gen Mutasyon Tipi ve Hematolojik Fenotip Arasındaki İlişki Sevilay ÖNEY *, Zeynep ÖZTÜRK **, Alphan KÜPESİZ ***, İbrahim KESER ****, M. Akif YEŞİLİPEK ***** Beta-Talasemi

Detaylı

Dr. Canan Vergin. Anahtar Sözcükler. Epidemiyoloji, Hemoglobinopati, Talasemi DÜNYADA HEMOGLOBİNOPATİLERİN EPİDEMİYOLOJİSİ

Dr. Canan Vergin. Anahtar Sözcükler. Epidemiyoloji, Hemoglobinopati, Talasemi DÜNYADA HEMOGLOBİNOPATİLERİN EPİDEMİYOLOJİSİ TÜRK HEMATOLOJİ DERNEĞİ 2014: 4 1 Dr. Canan Vergin Dr. Behçet Uz Çocuk Hastalıkları ve Cerrahisi Eğitim ve Araştırma Hastanesi, Hematoloji-Onkoloji Kliniği, İzmir, Türkiye e-posta: cvergin@gmail.com Anahtar

Detaylı

Dr. Zeynep Karakaş Dr. Ferda Özkınay. İstanbul Üniversitesi İstanbul Tıp Fakültesi,

Dr. Zeynep Karakaş Dr. Ferda Özkınay. İstanbul Üniversitesi İstanbul Tıp Fakültesi, TÜRK HEMATOLOJİ DERNEĞİ 2014: 4 1 Dr. Zeynep Karakaş Dr. Ferda Özkınay İstanbul Üniversitesi İstanbul Tıp Fakültesi, Ege Çocuk Üniversitesi Hematoloji Tıp Onkoloji Fakültesi, Bilim Tıbbi Dalı, Genetik

Detaylı

Servisler. Real-Time PCR Kitleri Reverse-Line Blot Kitleri

Servisler. Real-Time PCR Kitleri Reverse-Line Blot Kitleri Kasım 2007 İontek Tarihçesi Ara. 1996 - Kuruluş May. 1997 - Türkiye de ilk oligonükleotid sentezi Şub. 1999 - DNA dizileme ve kapiler elektroforez ile STR analizi hizmeti Şub. 2002 - Araştırma amaçlı Real-time

Detaylı

TALASEMI: AKDENIZ ANEMISI ORAK HÜCRELİ ANEMİ

TALASEMI: AKDENIZ ANEMISI ORAK HÜCRELİ ANEMİ TALASEMI: AKDENIZ ANEMISI ORAK HÜCRELİ ANEMİ HAZIRLAYANLAR PROF.DR. DURAN CANATAN PROF. DR.YESIM AYDINOK PROF.DR. ZEYNEP KARAKAS DOC. DR. ILGEN SASMAZ KAN YAŞAM IRMAĞIDIR Kan, vücudun organ ve dokularını

Detaylı

GENETİK HASTALIKLARDA TOPLUM TARAMALARI

GENETİK HASTALIKLARDA TOPLUM TARAMALARI GENETİK HASTALIKLARDA TOPLUM TARAMALARI Bir genetik hastalığa neden olan veya bir genetik hastalığa yatkınlığa neden olan belirli genleri taşıyan kişilerin tespit edilmesi için yapılan toplum temelli çalışmalardır.

Detaylı

TÜRKİYE DE HEMOGLOBİN VARYANTLARI VE TALASEMİ MUTASYONLARI BİLGİ SİSTEMİ *

TÜRKİYE DE HEMOGLOBİN VARYANTLARI VE TALASEMİ MUTASYONLARI BİLGİ SİSTEMİ * TÜRKİYE DE HEMOGLOBİN VARYANTLARI VE TALASEMİ MUTASYONLARI BİLGİ SİSTEMİ * An Information System on Hemoglobin Variants and Thalassemia Mutations in Turkey Volkan Vural TAŞ Biyoteknoloji Anabilim Dalı

Detaylı

REKOMBİNANT MOLEKÜLLERLE İNSAN HEMOGLOBİNLERİNİN TANIMLANMASI ÜZERİNE ÇALIŞMALAR

REKOMBİNANT MOLEKÜLLERLE İNSAN HEMOGLOBİNLERİNİN TANIMLANMASI ÜZERİNE ÇALIŞMALAR REKOMBİNANT MOLEKÜLLERLE İNSAN HEMOGLOBİNLERİNİN TANIMLANMASI ÜZERİNE ÇALIŞMALAR Aylin KÖSELER Kasım 2009 DENİZLİ REKOMBİNANT MOLEKÜLLERLE İNSAN HEMOGLOBİNLERİNİN TANIMLANMASI ÜZERİNE ÇALIŞMALAR Pamukkale

Detaylı

Ülkemizde Çukurova, Akdeniz kıyı şeridi, Ege ve Marmara bölgelerinde talasemi taşıyıcılığı sık olarak görülmektedir

Ülkemizde Çukurova, Akdeniz kıyı şeridi, Ege ve Marmara bölgelerinde talasemi taşıyıcılığı sık olarak görülmektedir ÖNSÖZ Bilindiği üzere Anayasamız ve Umumi Hıfzısıhha Kanunu ülkenin sağlık şartlarının düzeltilmesi, sağlığa zarar veren tüm unsurlarla mücadele edilmesi ve gelecek neslin sağlıklı yetiştirilmesi hususunda

Detaylı

K İŞİSEL BİLGİLER. : ahmetgenc_@hotmail.com & agenc@adiyaman.edu.tr

K İŞİSEL BİLGİLER. : ahmetgenc_@hotmail.com & agenc@adiyaman.edu.tr K İŞİSEL BİLGİLER Ad Soyadı : Ahmet GENÇ Doğum Yeri/Tarihi : Hatay / 10.12.1979 Adres : Adıyaman Üniversitesi, Sağlık Hizmetleri MYO, Altınşehir, 02040 ADIYAMAN T : 04162233800/1671 Fax : (0 416) 223 2071

Detaylı

Dr. Ferdane Kutlar. Medical College of Georgia/Georgia Regents University, Department of Medicine, GA, USA e-posta: fkutlar@gru.edu.

Dr. Ferdane Kutlar. Medical College of Georgia/Georgia Regents University, Department of Medicine, GA, USA e-posta: fkutlar@gru.edu. TÜRK HEMATOLOJİ DERNEĞİ 2014: 4 1 Dr. Ferdane Kutlar Medical College of Georgia/Georgia Regents University, Department of Medicine, GA, USA e-posta: fkutlar@gru.edu Anahtar Sözcükler Hemoglobin, Hemoglobinopati,

Detaylı

Evlilik öncesi hemoglobinopati taraması: Kadirli, Türkiye beta-talasemi açısından riskli bir bölge mi?

Evlilik öncesi hemoglobinopati taraması: Kadirli, Türkiye beta-talasemi açısından riskli bir bölge mi? Türk Biyokimya Dergisi [Turkish Journal of Biochemistry Turk J Biochem] 2014; 39(3):357 361 doi: 10.5505/tjb.2014.90217 Araştırma Makalesi [Research Article] Yayın tarihi 12 Kasım 2014 TurkJBiochem.com

Detaylı

Son onbeş yılda, talasemi ve anormal

Son onbeş yılda, talasemi ve anormal Talasemi Moleküler Genetiği Dr. A. Nazlı BAŞAK Boğaziçi Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü, İstanbul Son onbeş yılda, talasemi ve anormal hemoglobinlerin genetik tanısına yönelik çok çeşitli

Detaylı

SPR YÖNTEMİ İLE Hb D-LOS ANGELES IN GEN DÜZEYİNDE TANISI

SPR YÖNTEMİ İLE Hb D-LOS ANGELES IN GEN DÜZEYİNDE TANISI 1 SPR YÖNTEMİ İLE Hb D-LOS ANGELES IN GEN DÜZEYİNDE TANISI Ceylan AYADA Aralık 2006 DENİZLİ 2 3 SPR YÖNTEMİ İLE Hb D-LOS ANGELES IN GEN DÜZEYİNDE TANISI Pamukkale Üniversitesi Sağlık Bilimleri Enstitüsü

Detaylı

AİLESEL AKDENİZ ATEŞİ (AAA-FMF)

AİLESEL AKDENİZ ATEŞİ (AAA-FMF) AİLESEL AKDENİZ ATEŞİ (AAA-FMF) MOLEKÜLER YAKLAŞIMLAR DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD AİLESEL AKDENİZ ATEŞİ Otozomal resesif kalıtım Akdeniz ve Ortadoğu kökenli populasyonlarda

Detaylı

T.C. ADIYAMAN ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ YÜKSEK LİSANS TEZİ

T.C. ADIYAMAN ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ YÜKSEK LİSANS TEZİ T.C. ADIYAMAN ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ YÜKSEK LİSANS TEZİ DELESYONEL VE NONDELESYONEL FETAL HEMOGLOBİNİN KALITSAL KALICILIĞINA (HPFH) NEDEN OLAN GENOTİPLERİN BELİRLENMESİ AYŞE DALYAN BİYOLOJİ

Detaylı

DENİZLİ YÖRESİNDE GÖZLENEN Hb D-LOS ANGELES MUTASYONUNUN BETA GLOBİN GEN AİLESİ HAPLOTİP ANALİZİ

DENİZLİ YÖRESİNDE GÖZLENEN Hb D-LOS ANGELES MUTASYONUNUN BETA GLOBİN GEN AİLESİ HAPLOTİP ANALİZİ DENİZLİ YÖRESİNDE GÖZLENEN Hb D-LOS ANGELES MUTASYONUNUN BETA GLOBİN GEN AİLESİ HAPLOTİP ANALİZİ Onur ÖZTÜRK Mart 2007 DENİZLİ 1 DENİZLİ YÖRESİNDE GÖZLENEN Hb D-LOS ANGELES MUTASYONUNUN BETA GLOBİN GEN

Detaylı

Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör;

Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör; TALASEMİ Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör; Talasemi kırmızı kan hücrelerinin üretimini bozan genetik hastalıklardır. Ülkemizde çok sık görülmektedir. Hastaların kırmızı

Detaylı

ANEMİLİ HASTAYA GENEL YAKLAŞIM. Dr Mustafa ÇETİN Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı

ANEMİLİ HASTAYA GENEL YAKLAŞIM. Dr Mustafa ÇETİN Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı ANEMİLİ HASTAYA GENEL YAKLAŞIM Dr Mustafa ÇETİN Erciyes Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı Dersin içeriği Aneminin tanımlanması. Anemi tanısında fizik muayene, öykü Semptom ve Bulgular Anemili

Detaylı

TALASEM MERKEZLER NDE TOPLUM E T M PROGRAMLARI

TALASEM MERKEZLER NDE TOPLUM E T M PROGRAMLARI 5. Uluslararası Talasemi Yazokulu 5th International Thalassemia Summerschool TALASEM MERKEZLER NDE TOPLUM E T M PROGRAMLARI Dr. smail Hakkı T MUR Mu la l Sa lık Müdürlü ü Halk Sa lı ı Uzmanı HEMOGLOB NOPAT

Detaylı

Beta Talasemi Tanı ve Tedavi Klavuzu

Beta Talasemi Tanı ve Tedavi Klavuzu Beta Talasemi Tanı ve Tedavi Klavuzu Talasemiler, otozomal resesif geçiş gösteren, hemoglobin (Hb) zincirlerinden birinin veya birkaçının hasarlı sentezi sonucu gelişen hipokrom mikrositer anemi ile karakterize

Detaylı

1. EKSİK BASKINLIK 2. EŞ BASKINLIK 3. ÇOK ALLELLİLİK 4. KONTROL ÇAPRAZLAMASI

1. EKSİK BASKINLIK 2. EŞ BASKINLIK 3. ÇOK ALLELLİLİK 4. KONTROL ÇAPRAZLAMASI 1. EKSİK BASKINLIK 2. EŞ BASKINLIK 3. ÇOK ALLELLİLİK 4. KONTROL ÇAPRAZLAMASI Eksik baskınlık (ekivalentlik): Bazı karakterlerde allel genler, birbirine tam baskınlık göstermezler. Bireyler, bu karakterler

Detaylı

GENETİK HASTALIKLAR TANI MERKEZİ

GENETİK HASTALIKLAR TANI MERKEZİ GENETİKS GENETİK HASTALIKLAR TANI MERKEZİ NADİR GENETİK HASTALIKLAR 2014 * Merkezimiz hafta içi ve cumartesi günleri saat 8. 30-19. 00 saatleri arasında hizmet vermektedir. 5-Alfa-Redüktaz Tip 2 Yetmezliği

Detaylı

TALASEMİ HASTALARINDA DMT1 POLİMORFİZMİNİN KAN KURŞUN VE DEMİR DÜZEYLERİ İLE İLİŞKİSİNİN ARAŞTIRILMASI

TALASEMİ HASTALARINDA DMT1 POLİMORFİZMİNİN KAN KURŞUN VE DEMİR DÜZEYLERİ İLE İLİŞKİSİNİN ARAŞTIRILMASI TÜRKİYE CUMHURİYETİ ANKARA ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TALASEMİ HASTALARINDA DMT1 POLİMORFİZMİNİN KAN KURŞUN VE DEMİR DÜZEYLERİ İLE İLİŞKİSİNİN ARAŞTIRILMASI Derya SÖYLEMEZ DİSİPLİNLERARASI

Detaylı

Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N

Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Hacettepe Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı Çocuk Nefrolojisi Bilim Dalı Ankara Giriş Sistinozis (OMIM 219800),

Detaylı

TALASEMİ Akdeniz Anemisi. Dr. Gönül Aydoğan

TALASEMİ Akdeniz Anemisi. Dr. Gönül Aydoğan TALASEMİ Akdeniz Anemisi Dr. Gönül Aydoğan Hemoglobin Hemoglobin, kanda solunum organından dokulara oksijen dokulardan solunum organına ise karbondioksit taşıyan bir protein. Hb : Hem+ Globin Hem : 4 Pirol

Detaylı

Kan ve Ürünlerinin Transfüzyonu. Uz.Dr. Müge Gökçe Prof.Dr. Mualla Çetin

Kan ve Ürünlerinin Transfüzyonu. Uz.Dr. Müge Gökçe Prof.Dr. Mualla Çetin Kan ve Ürünlerinin Transfüzyonu Uz.Dr. Müge Gökçe Prof.Dr. Mualla Çetin Olgu-şikayet 2 yaş, erkek hasta, Kahramanmaraş Tekrarlayan akciğer ve cilt enfeksiyonları, ağızda aftlar ve solukluk. Olgu-Öykü Anne

Detaylı

T.C. SAĞLIK BAKANLIĞI İSTANBUL BAKIRKÖY KADIN DOĞUM VE ÇOCUK HASTALIKLARI EĞİTİM VE ARAŞTIRMA HASTANESİ

T.C. SAĞLIK BAKANLIĞI İSTANBUL BAKIRKÖY KADIN DOĞUM VE ÇOCUK HASTALIKLARI EĞİTİM VE ARAŞTIRMA HASTANESİ T.C. SAĞLIK BAKANLIĞI İSTANBUL BAKIRKÖY KADIN DOĞUM VE ÇOCUK HASTALIKLARI EĞİTİM VE ARAŞTIRMA HASTANESİ TALASEMİ MAJOR UN P DİSPERSİYONU ÜZERİNE ETKİSİ UZMANLIK TEZİ Dr. Muhammed KARABULUT DANIŞMAN Klinik

Detaylı

Aytemiz Gürgey* *Bilim Akademisi Üyesi e-posta: aytemizgurgey@yahoo.com. Anahtar Sözcükler. Anormal hemoglobinler, Hemoglobinopati, Talasemi

Aytemiz Gürgey* *Bilim Akademisi Üyesi e-posta: aytemizgurgey@yahoo.com. Anahtar Sözcükler. Anormal hemoglobinler, Hemoglobinopati, Talasemi TÜRK HEMATOLOJİ DERNEĞİ HematoLog 2014: 4 1 Aytemiz Gürgey* *Bilim Akademisi Üyesi e-posta: aytemizgurgey@yahoo.com Anahtar Sözcükler Anormal hemoglobinler, Hemoglobinopati, Talasemi ANORMAL HEMOGLOBİNLER

Detaylı

VIII. BÖLÜM BETA TALASEMİ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011

VIII. BÖLÜM BETA TALASEMİ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011 ULUSAL TEDAVİ KILAVUZU 2011 BETA TALASEMİ VIII. BÖLÜM TANI VE TEDAVİ KILAVUZU BETA TALASEMİ TANI VE TEDAVİ KILAVUZU BETA TALASEMİ TANI VE TEDAVİ KILAVUZU GİRİŞ Talasemiler, otozomal resesif geçiş gösteren,

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Dönem V Tıbbi Genetik Staj Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Baran GENCER Oğuz GÜÇLÜ Erkam KÖMÜRCÜ Staj Eğitim Sorumlusu: Genel

Detaylı

TALASEMİ MAJORLU HASTALARDA KEMİK MİNERAL YOĞUNLUĞU İLE HİPOGONADİZM ARASINDAKİ İLİŞKİ

TALASEMİ MAJORLU HASTALARDA KEMİK MİNERAL YOĞUNLUĞU İLE HİPOGONADİZM ARASINDAKİ İLİŞKİ T.C. SAĞLIK BAKANLIĞI İSTANBUL OKMEYDANI EĞİTİM VE ARAŞTIRMA HASTANESİ ÇOCUK SAĞLIĞI VE HASTALIKLARI TALASEMİ MAJORLU HASTALARDA KEMİK MİNERAL YOĞUNLUĞU İLE HİPOGONADİZM ARASINDAKİ İLİŞKİ Dr. Salih GÜLER

Detaylı

HEMOGLOBİNOPATİLER ÇALIŞMA GRUBU Prof. Dr. Yeşim Aydınok

HEMOGLOBİNOPATİLER ÇALIŞMA GRUBU Prof. Dr. Yeşim Aydınok HEMOGLOBİNOPATİLER ÇALIŞMA GRUBU Prof. Dr. Yeşim Aydınok Ülkemizde hemoglobinopatiler 1950 li yıllarda tanınmaya başlanmış (1) ve otozomal resesif kalıtılan bu hastalığın taşıyıcı sıklığının önemli bölgesel

Detaylı

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL PRENATAL VE POSTNATAL MOLEKÜLER TANI TESTLERİ Dr.Belgin Eroğlu Kesim *1800 lerde Mendel ile başlayan serüven, *1900 lerde kalıtım biriminin gen

Detaylı

DEMİR EKSİKLİĞİ ANEMİSİ İLE BETA TALASEMİ MİNÖRÜN AYIRICI TANISINDA ERİTROSİT İNDEKSLERİNİN ROLÜ

DEMİR EKSİKLİĞİ ANEMİSİ İLE BETA TALASEMİ MİNÖRÜN AYIRICI TANISINDA ERİTROSİT İNDEKSLERİNİN ROLÜ T.C. PAMUKKALE ÜNİVERSİTESİ TIP FAKÜLTESİ İÇ HASTALIKLARI ANA BİLİM DALI DEMİR EKSİKLİĞİ ANEMİSİ İLE BETA TALASEMİ MİNÖRÜN AYIRICI TANISINDA ERİTROSİT İNDEKSLERİNİN ROLÜ UZMANLIK TEZİ DR. İKBAL YILMAZ

Detaylı

D YARBAKIR BÖLGES NDE BETA-TALASEM TARAMASINDA BEL RLENEMEYEN MUTASYON T PLER N N D Z ANAL Z YÖNTEM YLE ARA TIRILMASI

D YARBAKIR BÖLGES NDE BETA-TALASEM TARAMASINDA BEL RLENEMEYEN MUTASYON T PLER N N D Z ANAL Z YÖNTEM YLE ARA TIRILMASI SA T.C. D CLE ÜN VERS TES LIK B L MLER ENST TÜSÜ D YARBAKIR BÖLGES NDE BETA-TALASEM TARAMASINDA BEL RLENEMEYEN MUTASYON T PLER N N D Z ANAL Z YÖNTEM YLE ARA TIRILMASI YÜKSEK L SANS TEZ MURAT YURT DANI

Detaylı

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ Yrd. Doç. Dr. Hakan GÜRKAN Trakya Üniversitesi Tıp Fakültesi Tıbbi Genetik Anabilim Dalı PGT NEDİR? Gebelik öncesi genetik tanı (PGT) adı verilen

Detaylı

Ü ç ş ç ç Ğ ş Ü Ş Ü «ç Ğ Ç ğ Ö ş ş ç ç Ğ Ğ ş ç Ö Ç«Ğ ğ Ü Ğ Ğ Ç ğ ç ç Ğ Ö ç Ö Ğ Ç ş ç ğ ş Ğ Ş ç ç Ö Ü ş Ş Ü Ü ş ğ ğ ç ç ç ğ ğ ş ş ğ ş Ğ ğ Ğ Ü ğ ğ ğ ğ Ü ş ğ ğ ş ş ç ğ Ğ ğ ç ğ Ğ ş ş ç ş ğ ş Ü ç Ğ ş ğ ğ

Detaylı

Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı İle Tanı ve Tedavi Merkezleri Yönetmeliği

Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı İle Tanı ve Tedavi Merkezleri Yönetmeliği Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı İle Tanı ve Tedavi Merkezleri Yönetmeliği Resmi Gazete: Tarihi:24.10.2002 Sayısı:24916 BİRİNCİ BÖLÜM Amaç, Kapsam, Dayanak, Tanımlar Amaç

Detaylı

Canan Albayrak, Davut Albayrak Ondokuz Mayıs Üniversitesi Tıp Fakültesi, Çocuk Hematoloji Bölümü, Samsun

Canan Albayrak, Davut Albayrak Ondokuz Mayıs Üniversitesi Tıp Fakültesi, Çocuk Hematoloji Bölümü, Samsun Canan Albayrak, Davut Albayrak Ondokuz Mayıs Üniversitesi Tıp Fakültesi, Çocuk Hematoloji Bölümü, Samsun Talasemi takip ve tedavisi daha çok transfüzyon ve şelasyona yoğunlaşmıştır. Talasemilerde hemoliz,

Detaylı

Burdur da ilköğretim 8. sınıflarda β - talasemi taşıyıcılık sıklığı

Burdur da ilköğretim 8. sınıflarda β - talasemi taşıyıcılık sıklığı Orijinal araştırma-original research http://dx.doi.org/10.7197/1305-0028.1827 Burdur da ilköğretim 8. sınıflarda β - talasemi taşıyıcılık sıklığı Prevalence of β thalassemia trait among the 8th grade primary

Detaylı

IX. BÖLÜM KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011

IX. BÖLÜM KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011 ULUSAL TEDAVİ KILAVUZU 2011 KRONİK HASTALIK ANEMİSİ IX. BÖLÜM TANI VE TEDAVİ KILAVUZU KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU KRONİK HASTALIK ANEMİSİ TANI VE TEDAVİ KILAVUZU GİRİŞ VE TANIM Kronik

Detaylı

TALASEM DE PRENATAL TANIDA KAR ILA ILAN GÜÇLÜKLER VE PRENATAL TANI YÖNTEMLER NDE GEL MELER

TALASEM DE PRENATAL TANIDA KAR ILA ILAN GÜÇLÜKLER VE PRENATAL TANI YÖNTEMLER NDE GEL MELER 5. Uluslararası Talasemi Yazokulu 5th International Thalassemia Summerschool TALASEM DE PRENATAL TANIDA KAR ILA ILAN GÜÇLÜKLER VE PRENATAL TANI YÖNTEMLER NDE GEL MELER Hacettepe University Department of

Detaylı

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi

Detaylı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 16S rrna Analizi Doç. Dr. Zeynep Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum içeriği Genel bilgi Uygulanışı Kullanım alanları Avantajları Dezavantajları Neden

Detaylı

PEDİATRİK HEMATOLOJİ- ONKOLOJİ OKULU 26 ARALIK 2015

PEDİATRİK HEMATOLOJİ- ONKOLOJİ OKULU 26 ARALIK 2015 PEDİATRİK HEMATOLOJİ- ONKOLOJİ OKULU 26 ARALIK 2015 Dr. Ebru Yılmaz Keskin Samsun EAH Pediatrik Hematoloji 1 OLGU SUNUMLARI A Ailesi: * A1 * A2 * A3 B Ailesi * B1 * B2 C Ailesi * C1 2 Olgu Sunumu A1 7⁷

Detaylı

PROTEİNLERİN 3 BOYUTLU YAPISI

PROTEİNLERİN 3 BOYUTLU YAPISI PROTEİNLERİN 3 BOYUTLU YAPISI PROTEİNLERİN 3 BOYUTLU YAPISI PROTEİNLERİN 3 BOYUTLU YAPISI 1-Primer Yapı (1 o ) 2-Sekonder Yapı (2 o ) -Alfa heliks -Beta kırmalı tabaka -Beta bendler (kıvrım, dirsek) -Tesadüfi

Detaylı

TARAMA PROGRAMLARI VE YÖNTEMLERİ

TARAMA PROGRAMLARI VE YÖNTEMLERİ TALASEMİ VE HEMOGLOBİNOPATİLER TARAMA PROGRAMLARI VE YÖNTEMLERİ 1-Prof. Dr. Bahattin Tunç 2-Uz.Dr.İsmail Hakkı Timur 1-Sağlık Bakanlığı Dışkapı Eğitim-Araştırma Hastanesi Çocuk Hastanesi Başhekimi, Ankara

Detaylı

DNA dan Protein lere

DNA dan Protein lere DNA dan Protein lere Proteinler, çok sayıda amino asit (50-3000 tane) biriminden oluşmaktadır. Amino asitlerde, amino grubu (- NH 2 ), asit grubu (- OOH karboksil grubu) ve zincir rezidüsü (kalan) denen

Detaylı

BETA TALASEMİ MUTASYONLARI VE BETA GLOBİN GEN AİLESİ HAPLOTİP İLİŞKİLERİ

BETA TALASEMİ MUTASYONLARI VE BETA GLOBİN GEN AİLESİ HAPLOTİP İLİŞKİLERİ BETA TALASEMİ MUTASYONLARI VE BETA GLOBİN GEN AİLESİ HAPLOTİP İLİŞKİLERİ Anzel BAHADIR Kasım 29 DENİZLİ BETA TALASEMİ MUTASYONLARI VE BETA GLOBİN GEN AİLESİ HAPLOTİP İLİŞKİLERİ Pamukkale Üniversitesi

Detaylı

Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı İle Tanı ve Tedavi Merkezleri Yönetmeliği

Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı İle Tanı ve Tedavi Merkezleri Yönetmeliği Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı İle Tanı ve Tedavi Merkezleri Yönetmeliği Tarihi:24.10.2002 Sayısı:24916 Sağlık Bakanlığından: Kalıtsal Kan Hastalıklarından Hemoglobinopati

Detaylı

Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı ile Tanı ve Tedavi Merkezleri Yönetmeliği. Tarih: 24.10.

Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı ile Tanı ve Tedavi Merkezleri Yönetmeliği. Tarih: 24.10. Kalıtsal Kan Hastalıklarından Hemoglobinopati Kontrol Programı ile Tanı ve Tedavi Merkezleri Yönetmeliği Tarih: 24.10.2002 Sayı: 24916 BİRİNCİ BÖLÜM Amaç, Kapsam, Dayanak, Tanımlar Amaç Madde 1 Bu Yönetmeliğin

Detaylı

TALASEMİ MAJOR HASTALARINDA APOLİPOPROTEİN E POLİMORFİZMİNİN SOL VENTRİKÜL DİYASTOLİK DİSFONKSİYONU ÜZERİNE OLAN ETKİSİ

TALASEMİ MAJOR HASTALARINDA APOLİPOPROTEİN E POLİMORFİZMİNİN SOL VENTRİKÜL DİYASTOLİK DİSFONKSİYONU ÜZERİNE OLAN ETKİSİ T.C. PAMUKKALE ÜNİVERSİTESİ TIP FAKÜLTESİ BİYOKİMYA ANABİLİM DALI TALASEMİ MAJOR HASTALARINDA APOLİPOPROTEİN E POLİMORFİZMİNİN SOL VENTRİKÜL DİYASTOLİK DİSFONKSİYONU ÜZERİNE OLAN ETKİSİ UZMANLIK TEZİ DR.

Detaylı

Anne ve baba akrabaysa çocukta genetik (genetic) sorun olma olasılığı artar mı?

Anne ve baba akrabaysa çocukta genetik (genetic) sorun olma olasılığı artar mı? This information (16) on Marrying a Relative is in Turkish Akraba evliliği (İngilizce si Marrying a relative) Anne ve baba akrabaysa çocukta genetik (genetic) sorun olma olasılığı artar mı? Bu sorunun

Detaylı

Kocaeli Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı. Hematoloji BD Olgu Sunumu 12 Eylül 2017 Salı

Kocaeli Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı. Hematoloji BD Olgu Sunumu 12 Eylül 2017 Salı Kocaeli Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı Hematoloji BD Olgu Sunumu 12 Eylül 2017 Salı Araş. Gör. Dr. Akbar Akbarov KOCAELİ ÜNIVERSİTESİ TIP FAKÜLTESİ ÇOCUK SAĞLIĞI

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör;

Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör; TALASEMİ Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör; Talasemi kırmızı kan hücrelerinin üretimini bozan genetik hastalıklardır. Ülkemizde çok sık görülmektedir. Hastaların kırmızı

Detaylı

V. BÖLÜM HEREDİTER SFEROSİTOZ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011

V. BÖLÜM HEREDİTER SFEROSİTOZ TANI VE TEDAVİ KILAVUZU ULUSAL TEDAVİ KILAVUZU 2011 ULUSAL TEDAVİ KILAVUZU 2011 HEREDİTER SFEROSİTOZ V. BÖLÜM TANI VE TEDAVİ KILAVUZU HEREDİTER SFEROSİTOZ TANI VE TEDAVİ KILAVUZU HEREDİTER SFEROSİTOZ TANI VE TEDAVİ KILAVUZU GİRİŞ Herediter sferositoz (HS);

Detaylı

Hipokrom Mikrositer Anemide Demir Eksikliği Anemisi ve Talasemi Taşıyıcılığı Oranları

Hipokrom Mikrositer Anemide Demir Eksikliği Anemisi ve Talasemi Taşıyıcılığı Oranları Hipokrom Mikrositer Anemide Demir Eksikliği Anemisi ve Talasemi Taşıyıcılığı Oranları Fatma OĞUZ *, Tuğçe AKSU UZUNHAN **, Fatih Köksal BİNNETOĞLU ***, Hayriye ERTEM VEHİD **** Hipokrom Mikrositer Anemide

Detaylı

DÜNYADA VE TÜRKİYE DE DEMİR EKSİKLİĞİ ANEMİSİ. Prof. Dr. Özcan Bör Eskişehir Osmangazi Üniversitesi Çocuk Hematolojisi ve Onkolojisi Bilim Dalı

DÜNYADA VE TÜRKİYE DE DEMİR EKSİKLİĞİ ANEMİSİ. Prof. Dr. Özcan Bör Eskişehir Osmangazi Üniversitesi Çocuk Hematolojisi ve Onkolojisi Bilim Dalı DÜNYADA VE TÜRKİYE DE DEMİR EKSİKLİĞİ ANEMİSİ Prof. Dr. Özcan Bör Eskişehir Osmangazi Üniversitesi Çocuk Hematolojisi ve Onkolojisi Bilim Dalı Demir Yerkabuğunda en çok bulunan minerallerden biri Demir

Detaylı

KALITIM- FATIH GIZLIGIDER SORULARI. 4. Rabia renkkörlüğü yönünden bir ailenin soy ağacını şekilde verilen

KALITIM- FATIH GIZLIGIDER SORULARI. 4. Rabia renkkörlüğü yönünden bir ailenin soy ağacını şekilde verilen KALITIM- FATIH GIZLIGIDER SORULARI 1. Fatma, melez sarı bezelyeleri birbiri ile çaprazladığında oluşabilecek ihtimalleri pasta grafik ile gösteriyor. Fatma nın çizmiş olduğu grafik aşağıdakilerden hangisi

Detaylı

HEMOGLOBİN VARYANTLARININ ÖLÇÜMÜNDE INTERLAB-G26 ELEKTROFOREZİ VE PRİMUS ULTRA 2 HPLC YÖNTEMLERİNİN KARŞILAŞTIRILMASI

HEMOGLOBİN VARYANTLARININ ÖLÇÜMÜNDE INTERLAB-G26 ELEKTROFOREZİ VE PRİMUS ULTRA 2 HPLC YÖNTEMLERİNİN KARŞILAŞTIRILMASI Doi: 10.17944/mkutfd.46647 ÖZGÜN MAKALE/ORIGINAL ARTICLE Mustafa Kemal Üniv Tıp Derg 2016; 7(26): 39-45 HEMOGLOBİN VARYANTLARININ ÖLÇÜMÜNDE INTERLAB-G26 ELEKTROFOREZİ VE PRİMUS ULTRA 2 HPLC YÖNTEMLERİNİN

Detaylı

Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör;

Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör; TALASEMİ Akdeniz Anemisi; Cooley s Anemisi; Talasemi Majör; Talasemi Minör; Talasemi kırmızı kan hücrelerinin üretimini bozan genetik hastalıklardır. Ülkemizde çok sık görülmektedir. Hastaların kırmızı

Detaylı

α1-antitrypsin quicktype

α1-antitrypsin quicktype attomol α1-antitrypsin quicktype İnsan α-1 antitripsin gen inde M-, Z- and S-alellerin tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! Z-mutasyonun tespiti için 10 sipariş numarası:

Detaylı

Amino Asitler. Amino asitler, yapılarında hem amino grubu ( NH 2 ) hem de karboksil grubu ( COOH) içeren bileşiklerdir.

Amino Asitler. Amino asitler, yapılarında hem amino grubu ( NH 2 ) hem de karboksil grubu ( COOH) içeren bileşiklerdir. Amino Asitler Amino asitler, yapılarında hem amino grubu ( NH 2 ) hem de karboksil grubu ( COOH) içeren bileşiklerdir. 1 Fizyolojik ph da, amino asitlerin amino grubu proton taşır ve pozitif yüklüdür;

Detaylı