Save this PDF as:

Ebat: px
Şu sayfadan göstermeyi başlat:





3 This journal is indexed and abstracted by Thomson Reuters Services beginning with Volume 3 () 27 in the followings: Science Citation Index Expanded (also known as SciSearch ) Journal Citation Reports/Science Edition This journal is also indexed and abstracted in: CAB Abstracts TÜRKİYE ATIF DİZİNİ ULAKBİM-TÜBİTAK EBSCO YAZIŞMA ADRESİ (Address for Correspondence) Kafkas Üniversitesi Veteriner Fakültesi Dergisi Editörlüğü Kars / Türkİye Phone: /244 Fax: ELEKTRONİK BASKI (Electronic Edition) ISSN: ONLINE MAKALE GÖNDERME (Online Submission)

4 Bu dergi Kafkas Üniversitesi Veteriner Fakültesi tarafından iki ayda bir yayımlanır. This journal is published bi-monthly, by the Faculty of Veterinary Medicine, University of Kafkas. Kafkas Üniversitesi Veteriner Fakültesi Adına Sahibi (Owner) Prof.Dr. Hidayet Metin ERDOĞAN Dekan (Dean) EDİTÖR (Editor-in-Chief) Prof.Dr. İsa ÖZAYDIN YABANCI DİL EDİTÖRLERİ (English Editors) Doç.Dr. Ahmet ÜNVER Doç.Dr. Şükrü Metin PANCARCI İSTATİSTİK EDİTÖRÜ (Statıstıcs Editor) Prof.Dr. Gül ERGÜN EDİTÖR YARDIMCILARI (Associate Editors) Prof.Dr. Mehmet ÇİTİL Doç.Dr. Özgür AKSOY Yrd.Doç.Dr. Oktay ÖZKAN Yrd.Doç.Dr. Duygu KAYA SEKRETER (Secretary) Fahri ALTUN BASKI (Print) ESER OFSET MATBAACILIK Tel: ERZURUM DANIŞMA KURULU (Advisory Board) Prof.Dr. Kemal AK İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Belma ALABAY Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Mustafa ALİŞARLI Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Prof.Dr. Feray ALKAN Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Çiğdem ALTINSAAT Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Kemal ALTUNATMAZ İstanbul Üniversitesi Veteriner Fakültesi Prof.Dr. Mustafa ARICAN Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Sırrı AVKİ Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Prof.Dr. Metin BAYRAKTAR Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Burhan ÇETİNKAYA Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Nazir DUMANLI Fırat Üniversitesi Veteriner Fakültesi Prof.Dr. Hüdaverdi ERER Selçuk Üniversitesi Veteriner Fakültesi Prof.Dr. Ayhan FİLAZİ Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Ekrem GÜREL Abant İzzet Baysal Üniversitesi Fen Edebiyat Fakültesi Prof.Dr. Tolga GÜVENÇ Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Prof.Dr. Ali İŞMEN Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Prof.Dr. Hakkı İZGÜR Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Zafer KARAER Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Arif KURTDEDE Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Erdoğan KÜÇÜKÖNER Süleyman Demirel Üniversitesi Mühendislik Mimarlık Fakültesi Prof.Dr. Kamil ÖCAL Adnan Menderes Üniversitesi Veteriner Fakültesi Prof.Dr. Metin PETEK Uludağ Üniversitesi Veteriner Fakültesi Prof.Dr. Sevim ROLLAS Marmara Üniversitesi Eczacılık Fakültesi Prof.Dr. Berrin SALMANOĞLU Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Nesrin SULU Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Ayşe TOPAL Uludağ Üniversitesi Veteriner Fakültesi Prof.Dr. Ş. Doğan TUNCER Ankara Üniversitesi Veteriner Fakültesi Prof.Dr. Cevdet UĞUZ Afyon Kocatepe Üniversitesi Veteriner Fakültesi Prof.Dr. Cengiz YALÇIN Dicle Üniversitesi Veteriner Fakültesi Prof.Dr. Halis YERLİKAYA Fırat Üniversitesi Veteriner Fakültesi

5 Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) AKBAŞ Yavuz Ege Üniversitesi Ziraat Fakültesi Zootekni Bölümü AKSOY Alirıza Kafkas Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı AKSOY Melih Adnan Menderes Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı AKTAŞ Abit İstanbul Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı AKYÜZ Bilal Erciyes Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı ALKAN Sezai Akdeniz Üniversitesi Ziraat Fakültesi Zootekni Bölümü ALP Müjdat İstanbul Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı ARAL Yılmaz Ankara Üniversitesi Veteriner Fakültesi Hayvan Sağlığı Ekonomisi ve İşletmeciliği Anabilim Dalı ASLAN Şahin Kafkas Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı AYAŞAN Tugay Çukurova Tarımsal Araştırma Enstitüsü Müdürlüğü BİRLER Sema İstanbul Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı CERİT Harun İstanbul Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı CEYHAN Vedat Ondokuz Mayıs Üniversitesi Ziraat Fakültesi Tarım Ekonomisi Bölümü ÇETİNKAYA Nurcan Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı ÇİLİNGİROĞLU Nesrin Hacettepe Üniversitesi Tıp Fakültesi Halk Sağlığı AnaBilim Dalı ÇİTİL Mehmet Kafkas Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı DOĞRUER Yusuf Selçuk Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dal ELMA Ertuğrul Kırıkkale Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı ERDOĞAN Zeynep Mustafa Kemal Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı EYDURAN Ecevit Iğdır Üniversitesi Ziraat Fakültesi Zootekni Bölümü GÜLÜ Murat Çukurova Üniversitesi Ziraat Fakültesi Zootekni Bölümü GÜLER Leyla Konya Veteriner Kontrol ve Araştırma Enstitüsü Moleküler Mikrobiyoloji Laboratuarı GÜNER Ahmet Selçuk Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı GÜNGÖR Örsan Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı GÜNLÜ Aytekin Selçuk Üniversitesi Veteriner Fakültesi Hayvan Sağlığı Ekonomisi ve İşletmeciliği Anabilim Dalı HECER Canan Uludağ Üniversitesi Karacabey Meslek Yüksekokulu Gıda Teknolojisi Programı İNCİ Abdullah Erciyes Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı KARA Murat Kafkas Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı KARABAĞ Kemal Rize Üniversitesi Pazar Meslek Yüksekokulu KARAOĞLU Taner Ankara Üniversitesi Veteriner Fakültesi Viroloji Anabilim Dalı KARATEPE Bilge Niğde Üniversitesi Bor Meslek Yüksekokulu KAYAARDI Semra Celal Bayar Üniversitesi Mühendislik Fakültesi Gıda Mühendisliği Bölümü KAYGISIZ Ferhan Öztürk İstanbul Üniversitesi Veteriner Fakültesi Hayvan Sağlığı Ekonomisi ve İşletmecliği Anabilim Dalı KOCAMIŞ Hakan Kafkas Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı KOÇAK Ömür İstanbul Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı KOYUNCU Mehmet Uludağ Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı KÜPLÜLÜ Özlem Ankara Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı LAÇİN Ekrem Atatürk Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı MOL TOKAY Sühendan İstanbul Üniversitesi Su Ürünleri Fakültesi Avlama ve İşleme Teknolojisi Bölümü NALBANTOĞLU Serpil Ankara Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı ONBAŞILAR Esin Ebru Ankara Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı ÖZDEN Osman Ege Üniversitesi Su Ürünleri Fakültesi Su Ürünleri Yetiştiriciliği Bölümü ÖZKAN Emel Namık Kemal Üniversitesi Ziraat Fakültesi Zootekni Bölümü PANCARCI Şükrü Metin Kafkas Üniversitesi Veteriner Fakültesi Doğum ve Jinekoloji Anabilim Dalı SABUNCUOĞLU Ç. Nilüfer Atatürk Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı SAÇAKLI Pınar Ankara Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı SARIERLER Murat Adnan Menderes Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı SARIÖZKAN Savaş Erciyes Üniversitesi Veteriner Fakültesi Hayvan Sağlığı Ekonomisi ve İşletmeciliği Anabilim Dalı SERBEST Ayşe Uludağ Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı SEYREK İNTAŞ Deniz Uludağ Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı SONAL Songül Uludağ Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı ŞAHİN Tekin Harran Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı ŞAROĞLU Murat İstanbul Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı ŞİMŞEK Gülcihan Fırat Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı TEL Yaşar Harran Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı TEPELİ Cafer Selçuk Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı TİLKİ Muammer Kafkas Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı TOKŞEN Erol Ege Üniversitesi Su Ürünleri Fakültesi Su Ürünleri Yetiştiriciliği Bölümü ULUTAŞ Zafer Gaziosmanpaşa Üniversitesi Ziraat Fakültesi Zootekni Bölümü UYSAL Ongun Ankara Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı ÜNAL Yücel Ağrı İbrahim Çeçen Üniversitesi Fen Edebiyat Fakültesi VATANSEVER Leyla Kafkas Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı YILDIRIM Yakup Kafkas Üniversitesi Veteriner Fakültesi Viroloji Anabilim Dalı YILDIZ Gültekin Ankara Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı YILDIZ Hüseyin Uludağ Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı YUCEL Banu Ege Üniversitesi Ziraat Fakültesi Zootekni Bölümü

6 İÇİNDEKİLER (CONTENTS) ARAŞTIRMA MAKALELERİ (Research Articles) Comparision of Principal Component Regression with the Least Square Method in Prediction of Internal Egg Quality Characteristics in Japanese Quails CICEK RATHERT T, UCKARDES F, NARINC D, AKSOY T... Merada Otlatma ve Meraya İlave Konsantre Yem Verilmesinin Kuzularda Performans ve Rumen Parametrelerine Etkisi KAYA I, SAHIN T, AKSU ELMALI D, UNAL Y... General Structure and Economic Analysis of Fish Farms in Ordu Province - Turkey DAGTEKIN M, YILMAZ E, GUREL M... Dairy Firms Characteristics and Practices Intended for Economic Sustainability and Food Safety in Aydın Region of Turkey COBANOGLU F, KARAMAN AD, TUNALIOGLU R, OVA G... Effects of Short-Acting Anaesthetics on Haemodynamic Function as Determined by Doppler Ultrasonography in Rabbits KAYA M, PEKCAN Z, SEN Y, BOZTOK B, ŞENEL OO, BUMIN A... Etilen Glikol ile Direkt Transfer Metoduna Göre Dondurulan in vivo Sığır Embriyolarının Transferi KIZIL SH, AKYOL N, KARASAHIN T, SATILMIS M... Determination of BMP-5, BMPR-B and GDF-9 Gene Mutations of the Indigenous Sheep Breeds in Turkey GURSEL FE, AKIS I, DURAK H, MENGI A, OZTABAK K... Estimation of Partial Gas Production Times of Some Feedstuffs Used in Ruminant Nutrition SAHIN M, UKARDES F, CANBOLAT O, KAMALAK A, ATALAY AI... Alabalık (Oncorhynchus mykiss) Filetosundan Kroket Yapımı ve Kalite Niteliklerinin Belirlenmesi BERIK N, CANKIRILIGIL C, KAHRAMAN D... Evaluation of Manure Management in Dairy Cattle Farms: The Case of İzmir - Tire (Turkey) Region OZTURK I, UNAL HB... Identification of Economic Incentives Directed Toward Food Safety Practices: The Case of Turkish Meat Processing Firms COBANOGLU F, KARAMAN AD, TUNALIOGLU R, OVA G... Koyunculuk Açısından Batı Anadolu İllerinin Sınıflandırılması GEVREKCI Y, ATAC FE, TAKMA C, AKBAS Y, TASKIN T... The Effects of Dietary Flaxseed Oil Supplementations on Fatty Acids Composition of The Yolks in Quail (Coturnix Coturnix Japonica) Eggs CITIL OB, YILDIRIM I, PARLAT SS... Seroprevalence of Antibodies Against Neospora caninum in Cows in Van Province ALAN M, CETIN Y, SENDAG S, AKKAN HA, KARACA M... Farklı Tünek Sistemlerinin Etlik Piliçlerde Tibia ve Femur Kemiklerinin Morfolojik ve Kimyasal Özelliklerine Etkileri BIRGUL OB, MUTAF S, ALKAN S... Pişmiş Döner Kebaplarda Mikrobiyolojik Kalite ve Mikrobiyel Gelişim Üzerine Bir Araştırma BOSTAN K, YILMAZ F, MURATOGLU K, AYDIN A... Chewing lice (Phthiraptera) Found on Wild Birds in Turkey DIK B, ERDOGDU YAMAC E, USLU U... Localization of Estrogen Receptor Alpha and Progesterone Receptor B in the Bovine Ovary During the Follicular and Luteal Phase of the Sexual Cycle AKBALIK ME, SAGSOZ H, GUNEY SARUHAN B... Sayfa (Page)

7 Sayfa (Page) Serological and Epidemiological Investigation of Bluetongue, Maedi-Visna and Caprine Arthritis- Encephalitis Viruses in Small Ruminant in Kirikkale District in Turkey AZKUR AK, GAZYAGCI S, ASLAN ME... Kars Yöresinde Atık Yapan İneklerin Çeşitli Örneklerinden Brucella Etkenlerinin Kültürel ve Moleküler Yöntemlerle Araştırılması ve Olguların Epidemiyolojik Analizi BUYUK F, SAHIN M... Effects of Age and Sex on Meat Quality of Turkish Native Geese Raised Under A Free-Range System KIRMIZIBAYRAK T, ONK K, EKIZ B, YALCINTAN H, YILMAZ A, YAZICI K, ALTINEL A... Fluoride Levels of Drinking Water in Bitlis Province (Turkey) KAHRAMAN T, ALEMDAR S, ALISARLI M, AGAOGLU S... Yerli Türk Kazlarında Çıkım Ayı ve Cinsiyetin Kesim ve Karkas Özelliklerine Etkisi TILKI M, YAZICI K, SARI M, ISIK S, SAATCI M... Etlik Piliç Ebeveynlerinde Kuluçkalık Yumurta Kabuk Renginin Kuluçka Sonuçları, Piliçlerin Performansı, Karkas Özellikleri, İç Organ Ağırlıkları ve Bazı Stres İndikatörlerine Etkisi SEKEROGLU A, DUMAN M... Effects of Angiostatin on in vitro Embryonic Rat Development ERTEKIN T, ULGER H, NISARI M, KARACA O, UNUR E, SAHIN U, ELMALI F... Amorozisli Buzağıların Kan Serumlarında β-karoten ve A Vitamini Düzeyleri GUL Y, ISSI M... Inhibition of Corneal Neovascularization by Ranibizumab (Lucentis): An Experimental Study in Rabbit Cornea EKINCI M, YIGIT FU, OBA ME, CAGATAY HH, HUSEYINOGLU U, YAKAN S, ARSLAN B... Esmer Irkı Sığırlarda Süt Verimi Üzerine Etkili Faktörlerin Path Analizi İle Belirlenmesi TAHTALI Y, SAHIN A, ULUTAS Z, SIRIN E, ABACI SH KISA BİLDİRİ (Short Communication) Polymorphism in Melatonin Receptor A (MTRNA) Gene in Chios, White Karaman and Awassi Sheep Breeds SEKER I, OZMEN O, CINAR KUL B, ERTUGRUL O... Investigation of Toxin Genes of Staphylococcus aureus Strains Isolated from Gangrenous Mastitis in Ewes TEL OY, ASLANTAS O, KESKIN O, YILMAZ ES, DEMIR C OLGU SUNUMU (Case Report) Tatlı Su Istakozlarından (Astacus leptodactylus) Saprolegnia sp.ve Aeromonas hydrophila İzolasyonu AVSEVER ML, HILMIOGLU POLAT S, TURK N, METİN DY EDİTÖRE MEKTUP (Letter to Editor) Generalized Tetanus in A Dog After Ovariohysterectomy SAHAL M, HAYDARDEDEOGLU AE, CINGI CC

8 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Comparision of Principal Component Regression with the Least Square Method in Prediction of Internal Egg Quality Characteristics in Japanese Quails Tülin ÇİÇEK RATHERT * Fatih ÜÇKARDEŞ ** Doğan NARİNÇ *** Tülin AKSOY *** * Kahramanmaraş Sütçü İmam Üniversitesi Ziraat Fakültesi Zootekni Bölümü, TR-46 Kahramanmaraş - TÜRKİYE ** Ordu Üniversitesi Ziraat Fakültesi Zootekni Bölümü, TR-522 Ordu - TÜRKİYE *** Ankdeniz Üniversitesi Ziraat Fakültesi Zootekni Bölümü, TR-7 Antalya - TÜRKİYE Makale Kodu (Article Code): KVFD Summary The purpose of this study is to determine the inner egg quality characteristics albumen height, albumen width, albumen length, yolk diameter and yolk height using principal component regression. For this reason 4 eggs of Japanese quails between the 2 th and 24 th week of age were analysed. The birds had not been object of selection and they were paired randomly. The problem of multicollinearity occurs in regression models between independent variables in case of high correlation. In case of multicollinearity, parameter estimations and hypothesis results contradict each other through large standard deviation caused by Least Square method (LS). One of the methods that are applied in such a case is principal component regression (PCR). PCR leads to small standard deviation and more accurate and more reliable regression equations. For this research the external egg quality traits egg weight (X), egg width (X2), egg length (X3) and shape index (X4) were used as variables. By processing these variables using LS and PCR the inner egg quality traits albumen height, albumen width, albumen length, yolk diameter and yolk height were estimated. In either method the regression estimating equations of the inner egg quality were significant (P<.). The goodness of fit of the regression estimating equations was 29.24%-68.25% when LS and 29.2%-66.72% when PCR was applied. Keywords: Principal component regression, Multicollinearity, Least square method, Japanese quail Japon Bıldırcınlarında Yumurta İç Kalite Özelliklerinin Tahmin Edilmesinde Temel Bileşenler Regresyon Yöntemi İle En Küçük Kareler Yönteminin Karşılaştırılması Özet Bu çalışmanın amacı Japon bıldırcınlarında iç kalite özelliklerinden olan Ak yüksekliği, Ak genişliği, Ak uzunluk, Sarı uzunluk ve Sarı Yüksekliğinin Temel Bileşenler Regresyon yöntemiyle belirlenmesidir. Bu amaçla 2-24 haftalık yaşlar arasında bulunan, seleksiyon uygulanmamış, rastgele çiftleşmiş Japon bıldırcınlarından toplanan yumurtalar kullanılmıştır. Regresyon modelinde bağımsız değişkenler arasında yüksek bir korelasyon durumunda çoklu bağlantı adı verilen bir problem meydana gelir. Çoklu bağlantı durumunda parametre tahminleri en küçük kareler yöntemi ile standart hataları büyük ve hipotez sonuçları çelişki içindedir. Çoklu bağlantı (multicollinearity) problemi ile uğraşan yöntemlerden biri temel bileşenler regresyon yöntemidir. Temel Bileşenler Regresyon yöntemi kullanarak küçük standart hata, daha doğru ve güvenilir regresyon denklemleri elde edilir. Bu çalışmada Japon bıldırcınlarında yumurta dış kalite özelliklerinden; yumurtanın ağırlığı (X), yumurtanın genişliği (X2), yumurtanın uzunluğu (X3) ve şekil indeksi (X4) değişkenleri kullanılmıştır. Bu değişkenlerle yumurta iç kalite özelliklerinden; ak yüksekliği, ak genişliği, ak uzunluğu, sarı uzunluğu ve sarı yüksekliği hem en küçük kareler yöntemi hem de temel bileşenler regresyon yöntemi ile tahmin edilmiştir. Her iki yöntemde yumurta iç kalite özelliklerinin regresyon tahmin denklemleri önemli bulunmuştur (P<.). Regresyon tahmin denklemlerinin uyum iyiliği LS yönteminde %29.24-%68.25, PCR yönteminde ise %29.2-%66.72 aralığında bulunmuştur. Anahtar sözcükler: Temel bileşenler regresyon, Çoklu bağlantı, En küçük kareler metodu, Japon bıldırcını İletişim (Correspondence)

9 688 Comparision of Principal... INTRODUCTION Japanese quails are used as a model in poultry breeding because of their various characteristics. They are also used commercially in meat and egg production in many countries -6. Inner egg quality characteristics such as albumen and yolk indices are of high importance in determining egg quality in the context of commercial egg production. These characteristics both indicate the commercial value of the products and help estimate the quality of the chick and breed stock, respectively,7. For these reasons receiving information on inner egg quality without breaking the shell is crucial. Without breaking the egg, regression prediction equations are used to determine internal egg quality characteristics. However, some problems can be faced in the case that estimated independent variables highly dependent each other. Principal ones of these problems are multicollinearity and non-significant regression parameters that are close to zero. The methods that were developed to cope with these problems are called as biased regression predictors. The most commonly used one is Principal Component Regression (PCR). In this study this method is also considered to be used. One of the aims of this study is to determine multicolinearity and to present the comparison PCR method with Least Squares Method. The purpose of this study is to determine the inner egg quality characteristics albumen height, albumen width, albumen length, yolk diameter and yolk height using principal component regression. MATERIAL and METHODS In this study, 4 eggs of Japanese quails between the 2 th and 24 th week of age were analyzed. The birds had not been object of selection and they were paired randomly. The birds were fed with starter fodder containing 24% HP, 2.9 kcal/kg ME for the first 3 weeks, with mixed fodder containing 2% HP, 2.8 kcal/kg ME between the 4 th and the 6 th week and with laying fodder containing 7% HP, 2.7 kcal/kg ME after the 6 th week. During the first 3 weeks 23 h/day lighting were applied, in the following periods 6 h lighting and 8 h darkness. The eggs were examined for egg weight (g), egg length (mm), egg width (mm), shell thickness (mm) and shell weight (g). Egg weights were measured by digital balance to the nearest. g. Egg width, egg length, yolk width, albumen length and -width were measured by digital compass to the nearest. mm. Yolk and -albumen heights were measured by micrometer to the nearest. mm. Egg quality characteristics were calculated by using the Haugh unit formula,7,8. One method for estimating parameters in multiregression is Least Square method (LS). LS is not only advantageous for estimating parameters but it is also an unbiased method that reduces the deviance between observed value and estimated value in a model to a minimum. To ensure the validity of this model, assumptions such as independence of errors, normal distribution and non-correspondence of independent variables must be valid. If any of these assumptions is not given, the reliability of the model is reduced and interpretations can become wrong. To estimate the inner egg qualities albumen height, -width and - length, yolk length and -height, it was made use of the outer egg quality characteristics egg weight (X ), egg width (X 2 ), egg length (X 3 ) and shape index (X 4 ). To estimate the inner egg qualities LS based multi-regression was applied. In case that the assumptions mentioned above do not apply, the regression parameters calculated by LS method drift apart from the real values. Different measurements of the same experimental object (egg) can lead to strong correlations among independent valuables. This is called multicollinearity in regression models 9,,3. In such a case parameters variance increases significantly and appear non-significant according to t-test. A lot of researchers do not attend to the levels of signification when using regression equations. To avoid this problem the use of Principal Component Regression (PCR), a biased estimation method, instead of LS is preferable,3. In this study, both LS based multi regression and PCR were used because significant relations had to be expected among the different measurements due to the fact that more than one measurement was taken to estimate inner egg quality traits. Moreover, detailed data was given on multicollinearity. Multicollinearity as a problem in regression equations can be categorized through some criteria. It is possible to range the most frequent methods for detecting multicollinearity as follows:. Simple correlation coefficient: High correlation between independent variables (r.75) suggests multicollinearity. 2. Variance Inflaction Factor (VIF): Variance inflaction factor is a method to detect multicollinearity. Diagonal elements of the matrix including (X X) - = C are likely to create multicollinearity 2. In calculating VIF values, partial correlation coefficients are utilized. The VIF factor is calculated with the following formula: C ij R ij Here R ij is the partial correlation coefficient. If the VIF factor C ij, multicollinearity is assumed. 3. (X X) Eigenvalues of the matrix: To detect the severity of multicollinearity (X X) it is benefited from the eigenvalues of the matrix. In case that there is no multicollinearity, the value of the eigenvalues equals. When at least eigenvalue is different from or at least (i)

10 689 ÇİÇEK RATHERT, ÜÇKARDEŞ NARİNÇ, AKSOY eigenvalue is near, multicollinearity is proved. Examining eigenvalues separately, however, is not very meaningful. Therefore, Akdeniz and Çabuk 9 suggested a condition index based on the biggest and smallest eigenvalue. In calculating the smallest square estimators for the condition index, the eigenvalues of the used correlation matrix X X are shown as; ( max 2... p min ) The condition index is calculated with the following formula: CI max min If CI <, there is little multicollinearity and a serious problem cannot be observed. Multicollinearity is mediumleveled in CI 3, while 3 < CI indicates a severe multicollinearity and more than one multicollinearity must be assumed 4,5. Principal Component Regression LS estimator and multilinear regression model have the following form in matrix rotation: Y X e (ii) (iii) Y represents the dependent variable, X the independent variable, β the estimated coefficient and e the error in the model. The estimator variables in the regression model have the following form after the necessary transformations in equation iv have been carried out: ˆ (X'X) X'Y (iv) In PCR, mean subtraction from both dependent and independent variables is performed and the subtraction result is divided by standard deviation. Thus dependent variables are transformed to main components for PCR analysis. This transformation is expressed mathematically as follows: (X'X) PDP' Z'Z Here X X is the diagonal matrix of the eigenvalues, P: X X the eigenvector matrix, and Z the data matrix. P P = I. After this transformation the correlation between the components is removed. The variable X is replaced with variable Z. When PCR is applied, the smallest component that causes multicollinearity is removed. For this purpose eigenvalues are used. The model which has the smallest component near to zero among the components is removed from the system. As a result of removing this component the problem of multicollinearity is solved with the utmost probability 6. To estimate inner egg quality variables by evaluating outer egg quality traits LS, multiregression and PCR were used; necessary calculations were performed with NCSS software 6. RESULTS The correlation matrix between inner and outer egg quality variables are presented in Table. The results given in Table indicated that correlation between shape index and egg length, between albumen length and yolk width were non-significant (P>.5), apart from them they were significant (P<.5). The Least Square Method and Principal Component Regression values are given in Table 2. Multicollinearity was found in the parameters ˆ 2, ˆ 3 and ˆ 4 through LS method. However, multicollinearity was not found in PCR method. Table. Correlation matrix of dependent and independent variables Tablo. Bağımlı ve bağımsız değişkenlerin korelasyon matrisi Variables Egg Weight (X ) Egg Width (X 2 ) Egg Length (X 3 ) Shape Index (X 4 ) Egg weight (X ). Egg width (X 2 ).76 **. Egg length (X 3 ).668 **.768 **. Shape index (X 4 ).252 **.494 ** Albumen height.6 **.578 **.492 **.27 * Albumen width.63 **.782 **.749 **.98 * Albumen length.625 **.753 **.736 **.6 Yolk width.492 **.48 **.488 **.75 Yolk height.496 **.59 **.442 **.34 ** ** P<., * P<.5

11 69 Comparision of Principal... Table 2. Least squares method and PCR multicollinearity Tablo 2. En küçük kareler tekniği ve temel bileşenler analizinde çoklu bağlantı Parameters LS VIF PCR VIF ˆβ ˆβ ψ ˆβ ψ.8 3 ˆβ 3.85 ψ.78 4 ψ Since some VIF s are higher than, multicollinearity is a problem Table 3. Eigenvalues of correlations and condition index Tablo 3. Korelasyonların özdeğerleri ve koşul indeksi No Eigenvalue Condition Index PC PC PC PC4 ψ ψ Multicollinearity Eigenvalues of correlations and condition index are given in Table 3. Particularly, eigenvalue and condition index values were higher in LS method than values. In PCR method, results were below the expected critical results. Estimation equations of inner egg quality characteristics received from LS and PCR analyses and goodness of fit are presented in Table 4. DISCUSSION Table shows that except for egg height-shape index all correlations among outer egg quality traits were found significantly positive (P<.). Particularly the correlations between egg weight and egg width (76%) and egg width and egg length (76.8%) respectively were high. The results of this study were in accordance to the results of Poyraz 7, Akbaş et al. 8 and Kul and Şeker 9. Examining the relation between inner and outer egg quality, it is asserted that the correlations between shape index and yolk width as well as between shape index and albumen length were nonsignificant (P>.5). These results were similar to the results of Alkan et al.. Although the correlations between shape index, albumen height, albumen width and yolk height Table 4. Estimation equations of inner egg quality characteristics received from LS and PCR analyses (standart errors in parantheses) and goodness of fit Tablo 4. En küçük kareler yöntemi ve temel bileşenler regresyon analizinden elde edilen yumurta iç kalitesinin parametre tahminleri (standart hata değerleri parantez içinde) ve uyum iyiliği Inner Egg Quality Variables Methods Parameters ˆβ ˆβ ˆβ 2 ˆβ 3 ˆβ R 2 Sig 4 Albumen height LS PCR NS (5.5) (.65) (.26) (.57) (.64) (.64) (.) (.9) (.5).3958 **.3958 ** Albumen width Albumen length Yolk height Yolk width LS PCR LS PCR LS PCR LS PCR Sig: Significance level, ** P<., NS: Non-significant, Not revealed NS NS.422 NS (48.997) (.626) (.974) (.59) (.69).6825 ** (.625) (.93) (.9) (.46).6672 ** (57.979) (.74) (2.335) (.785) (.723).628 ** (.723) (.8) (.3) (.54).628 ** (4.824) (.89) (.597) (.456) (.87).2924 ** (.85) (.28) (.26) (.4).292 ** (35.832) (.458) (.44) (.3) (.452).354 ** (.447) (.67) (.64) (.33).3537 **

12 69 ÇİÇEK RATHERT, ÜÇKARDEŞ NARİNÇ, AKSOY were significant, they were found low (P<.5). Apart from these, the correlations between inner and outer egg quality variables were found to be highly significant and at a high grade positive (P<.). These results were in accordance to the results of Alkan et al. Narinç et al. 5 Kul and Şeker 9, Üçkardeş et al. 2. LS method was applied in several studies, such as Alkan et al. Akbaş et al. 8 and Kul and Şeker 9. These studies report a high correlation among inner egg quality traits. However, they did not use regression estimating equations. It is likely that in these studies multicollinearity occurred. The fact that especially correlations between different outer egg quality variables appeared significant and high, is evidence to suggest that it is a result of multicollinearity 2. The VIF values belonging to LS and PCR methods are given in Tablo 2. VIF values of regression parameters, ˆ 2, ˆ 3 and ˆ 4 in LS method were found to be higher than of critical value. In the case of relationship, sthandart errors of regression parameters multiwere too high. Likewise, the results in Table 4 indicated that standard errors of LS regression parameters were too high. Even some parameters which were close to zero were non-significant. These results agreed with multicollinearity problem. The VIF values were less than in PCR values given in Table 2. According to these results, standard errors of the parameters were lower than those in LS method. PCR parameter values give in Table 4 were lower than LS method and even non-significant parameters became significant, which are similar to the results presented by Üçkardeş et al. 2. In Table 3 the eigenvalues of the correlation have taken more than one different value and the 4 th eigenvalue was found very high when the condition index was examined. Thus it was proved that multicollinearity is present in the values estimated with LS, which is similar to the results presented by Üçkardeş et al. 2. As seen in Table 4, PC4 has a value very near to zero as a result of PCR analysis. Therefore a PCR analysis of PC4 was carried out again. The VIF values belonging to the parameters as a result of PCR analysis are given in Table 2. As a remedy for multicollinearity in these values PCR analysis was carried out. The regression estimation equations, which were received from LS and PCR methods in order to determine inner egg qualities by using outer egg quality parameters, are given in Table 4. The regression estimation equations of all inner egg qualities were highly significant (P>.). However, the standard deviation of estimated parameters received from LS was higher than that of parameters received from PCR. The measures of goodness of fit of estimation equations received from each method were very near to each other. According to these results in both LS and PCR the highest resulting values were for albumen width (66.72% %), while the lowest were for yolk height (29.2% %). Some parameters were non-significant in LS (P>.5). Particularly the standart deviation for ˆ parameters were very high. These results suggest that it is of high importance to determine inner egg quality traits without breaking the shell. It is obvious that if multicollinearity is present, principal component regression, a biased estimation method, is preferable to LS in order to estimate inner egg quality characteristics because more accurate and more reliable regression estimation equations with lower standard deviation are achieved. The review of the literature showed that there is no study that PCR was not applied in determining inner egg quality traits. As an alternative to avoid multicollinearity Üçkardeş et al. 2 have used Ridge Regression in estimating. It has been observed that their results are in accordance with the results of this study. As a result it can be asserted that in estimating inner egg quality traits by using data related to outer egg quality traits, PCR leads to more accurate and more reliable estimation equations than LS method. Acknowledgements The research with the project number of was supported by the Akdeniz University Scientific Research Projects Management. The management and handling of the birds were performed according to the regulations required by the European Convention for the Protection of Animals kept for Farming Purposes. REFERENCES. Alkan S, Karabağ K, Galiç A, Karslı T, Balcıoğlu MS: Effects of selection for body weight and egg production on egg quality traits in Japanese quails (Coturnix coturnix japonica) of different lines and relationships between these traits. Kafkas Univ Vet Fak Derg, 6 (2): , Narinç D, Aksoy T, Karaman E: Genetic parameters of growth curve parameters and weekly body weights in Japanese quail (Coturnix coturnix japonica). J Anim Vet Adv, 9 (3): 5-57, Balcıoğlu MS, Yolcu Hİ, Fırat MZ, Karabağ K, Şahin E: Japon bıldırcınlarında canlı ağırlık ve canlı ağırlık artışına ait genetik parametre tahminleri. Akdeniz Üniv Ziraat Fak Derg, 7 (): 8-85, Narinç D, Karaman E, Aksoy T: Estimation of genetic parameters for carcass traits in Japanese quail using Bayesian methods, S Afr J Anim Sci, 4 (4): , Narinç D, Karaman E, Firat MZ, Aksoy T: Japon bıldırcınlarında bazı yumurta verim özelliklerine ait varyans unsurlarının farklı tahmin yöntemleri kullanarak elde edilmesiyle çok özellikli genetik parametre ve BLUP tahminleri, Kafkas Univ Vet Fak Derg, 7 (): 7-23, Alkan S, Karabağ K, Galiç A, Karslı T, Balcıoğlu MS: Determination of body weight and some carcass traits in Japanese quails (Coturnix coturnix japonica) of different lines. Kafkas Univ Vet Fak Derg, 6 (2): , Haugh RR: The Haugh Unit For Measuring Egg Quality. U. S. Egg Poultry Magazine. 43, , , Tserveni Gousi AS, Yannakopoulos AL: Carcase characteristics of Japanese quail at 42 days of age. British Poultry Science, 27 () : 23-27, 986.

13 692 Comparision of Principal Akdeniz F, Çabuk A: Ridge regresyon teorisinde 97-2 arasındaki gelişmeler. V. Ulusal Ekonometri ve İstatistik Sempozyumu 2-22 Eylül, Çukurova Üniversitesi, Adana, 2.. Ortabaş N: Principal Components in The Problem of Multicollinearity. Dokuz Eylül University, Natural and Applied Science, p. 46, 2.. Albayrak SA: Çoklu bağlantı halinde enküçük kareler tekniğinin alternatifi yanlı tahmin teknikleri ve bir uygulama. Zonguldak Karaelmas Üniv Sosyal Bil Derg, (): 5-26, Marquardt DW: Generalized ınvers, ridge regression, biased linear estimation and non-linear estimation. Techonometrics, 2, 59-62, Vinod HD: Double bootstrap for shrinkage estimators, J Econometrics, 68, , Pagel MU, Lunneborg CE: Empirical evaluation of ridge regression, Psychological Bulletin, 97, , Gujarati DN: Basic Econometrics, 3 rd ed., McGraw-Hill, New York., NCSS Inc: Ncss User Guide 2, Kaysville, NCSS Inc., Poyraz Ö: Kabuk kalitesi ile ilgili yumurta özellikleri arasındaki fenotipik korelasyonlar. Lalahan Hayl Araş Enst Derg, 29, 66-79, Akbaş Y, Altan O, Koçak C: Effects of hen s age on external and internal egg quality characteristics. Turk J Vet Anim Sci, 2, , Kul S, Şeker I: Phenotypic correlations between some external and internal egg quality traits in the Japanase quail (Coturnix coturnix japonica). Int J Poult Sci, 3 (6): 4-45, Üçkardeş F, Narinç D, Efe E, Aksoy T: Ridge regresyon yöntemiyle Japon bıldırcını yumurtalarında ak indeksinin tahmin edilmesi. 7-9 Ekim Kümes Hayvanları Kongresi, Kayseri, Bildiri Kitabı, s. 97, 2.

14 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Merada Otlatma ve Meraya İlave Konsantre Yem Verilmesinin Kuzularda Performans ve Rumen Parametrelerine Etkisi [] Özet İsmail KAYA * Tarkan ŞAHİN * Dilek AKSU ELMALI ** Yücel ÜNAL *** [] Bu çalışma KAÜ-BAP tarafından (27 VF-8) desteklenmiştir * Kafkas Üniv. Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı, TR-36 Kars - TÜRKİYE ** Mustafa Kemal Üniversitesi Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı, TR-34 Hatay - TÜRKİYE *** Ağrı İbrahim Çeçen Üniversitesi Fen Edebiyat Fakultesi, TR-4 Ağrı - TÜRKİYE Bu çalışmada, kuzuları merada otlatma ve meraya ilave konsantre yem verilmesinin besi performansı, rumen ph, toplam uçucu yağ asitleri ve amonyak azotu üzerine etkisi araştırılmıştır. Ayrıca, vejetasyon dönemine bağlı olarak meranın besin madde içerikleri de belirlenmiştir. Araştırmada sütten kesilmiş 2-3 aylık yaşta, 8 baş Tuj ırkı erkek kuzu kullanılmıştır. Araştırmada kuzular 6 başlı üç gruba ayrılmıştır. Meraya ilave olarak kuzulara %8.5 HP ve 2.65 kcal/kg ME içeren konsantre yem verilmiştir. Kuzulardan 6 başı yalnız merada otlatılmış (Mera Grubu), 6 tanesine meraya ilave olarak kuzu başına 2 g konsantre yem (Mera + Ek Yem Grubu I) ve 6 baş kuzuya da meraya ek olarak 4 g konsantre yem (Mera + Ek Yem Grubu II) verilmiştir. Kuzular, günde 8 saat süreyle merada otlatılmıştır. Ek yemler merada otlatma sonrası verilmiş ve kuzuların günde iki defa su içmeleri sağlanmıştır. Hayvanlar ayda bir tartılarak canlı ağırlık artışları belirlenmiştir. Araştırma 3 ay sürdürülmüştür. Merada otlatma ve ilave konsantre yem verilmesi, kuzuların canlı ağırlıklarında bir fark oluşturmamıştır (P>.5). Günlük canlı ağırlık artışı merada otlayan, meraya ilave 2 g ve 4 g konsantre yem verilen kuzularda sırasıyla günde 53, 6 ve 83 g olarak belirlenmiştir. Merada otlatma ve ilave konsantre yem verilmesinin kuzuların rumen sıvısı ph, TUYA ve NH 3-N değerlerinde herhangi bir farklılık oluşturmadığı saptanmıştır (P>.5). Meranın KM ve HS içeriği vejetasyonun ilerlemesiyle atarken (% , % ), HP içeriği ise %. den %6.25 e inmiştir (P<.5). Sonuç olarak, meraya ilave konsantre yem verilmesinin kuzularda performans ve rumen parametrelerinde bir farklılık oluşturmadığı saptanmıştır. Meranın besin madde içeriğinde ise vejetasyona bağlı olarak önemli değişikliklerin olduğu belirlenmiştir. Anahtar sözcükler: Kuzu, Mera, Ek yem, Büyüme, Rumen parametreleri The Effects of Grazing and Concentrate Supplementation at Pasture on Performance and Rumen Parameters in Lambs Summary Makale Kodu (Article Code): KVFD In this study, the effect of grazing and concentrate supplementation on fattening performance, rumen ph, total volatile fatty acids and ammonia nitrogen concentration in lambs were investigated. The effect of vegetation period on nutrient content of the pasture were also determined. Eighteen Tushin lambs, 2-3 months age and weaned were used in experiment. Lambs were divided into three groups with their weight and each group consists of 6 lambs. Concentrate with 8.5% CP and 2.65 kcal/kg ME was fed to lambs in addition to pasture. Six lambs were only grazed (Pasture Group). Six lambs were supplemented 2 g concentrate with the pasture (Pasture + Suppl. I Group) and six lambs were supplemented 4 g concentrate with the pasture (Pasture + Suppl. II Group). Lambs were grazing on the pasture 8 h in a day. Supplementated feeds were given after the grazing and water was supplied two times in a day. The lamb body weight gains were determined monthly. The experiment was lasted three month.s There were no significant effect of grazing and supplementation on body weight of lambs (P>.5). Daily weight gain of grazing and supplementation groups were determined 53, 6, 83 g respectively. There were no significant differences in rumen fluid ph, TVFA and NH 3-N between the grazing or supplementation groups (P>.5). Dry matter and CF contents of pasture were increased with respect to the vegetation period ( %, %), but CP was decreased from.% to 6.25% (P<.5). As a result, supplementation of concentrate feed to grazing lambs on the pasture were no effect on performance and rumen parameters in lambs. On the other hand there were differences nutrient contents of pasture with vegetation. Keywords: Lamb, Pasture, Supplemented feed, Growth, Rumen parameters İletişim (Correspondence) /33

15 694 Merada Otlatma ve Meraya... GİRİŞ Koyunların besin madde ihtiyacının karşılanmasında kaba yemler ve özellikle meralar önemli yer tutmaktadır. Ancak meraların besin madde içerikleri, iklim, otlatma, bitki florası, vejetasyon dönemi gibi faktörlere bağlı olarak değişmektedir 2 Buğdaygil - baklagil karışımı meraların otlatma sezonu boyunca ham protein (HP) içeriğinin, otlatma sezonunun başlangıcından sonuna doğru bitki olgunlaştıkça azaldığı (% ) ve merada baklagillerin oranı otlatma sezonu boyunca artarken buğdaygillerin oranının ise düştüğü saptanmıştır 3. Kars ve yöresi çayır - meraları üzerinde yapılan çalışmada 4 (Mayıs - Temmuz), HP oranının %2.45 ten %9.68 e düştüğü, ham selülozun (HS) ise, %24.66 dan %33.58 e yükseldiği belirlenmiştir. Diğer bir araştırmada 5 vejetasyon dönemine bağlı olarak meranın HP içeriğinin önemli ölçüde düştüğü saptanmış, başka bir denemede ise 6, vejetasyonun ilerlemesine bağlı olarak meranın besin madde içeriklerinde önemli farklılıkların ortaya çıktığı bildirilmiştir. Bir kaba yem olan meraların besin madde içeriğindeki bu değişimler ve mera yeminin tüketimi, büyüme ve bitirme dönemi kuzularında, maksimum günlük ağırlık artışını sınırlamaktadır 7. Kuzuların büyüme ve bitirme dönemlerinde maksimum performans için ilave besin maddesi içeren yeme ihtiyaç duyulmaktadır 7. Merada otlayan sütten kesilmemiş 2 aylık erkek Morkaraman ve Tuj ırkı erkek kuzular üzerinde otlatma mevsiminde yapılan bir çalışmada 8, hayvanlar merada otlatılmış ve meraya ek canlı ağırlıklarının %.75 i oranında konsantre yemle beslenmiştir. Günlük canlı ağırlık artışı merada otlayan ve ek yem verilen grupta 28 ve 248 g olarak belirlenmiştir. Bir başka araştırmada 5, merada otlatma sezonu boyunca tokluların günde ortalama 22 g canlı ağırlık kazandığı ve vejetasyonun ilerlemesiyle günlük canlı ağırlık artışının da düştüğü saptanmıştır. Öte yandan 2.5 aylık yaşta sütten kesilen İvesi, Morkaraman ve Tuj ırkı kuzuları meraya ek 45 g konsantre yem (%6 HP, 2.5 kcal/kg metabolik enerji (ME)) verilerek yapılan bir denemede 9 kuzuların günlük 55, 72 ve 48 g canlı ağırlık artışı sağladığı bulunmuştur. Diğer taraftan, merada otlayan hayvanlarda mevsimsel rumen fermentasyon özelliklerinin bilinmesi, hayvanın merayı daha etkin değerlendirme ve performansını artırmada ek yemleme düzeyinin belirlenmesi açısından önemlidir. Kolver ve Veth, meraya dayalı beslenen sığırların rumen toplam uçucu yağ asitleri (TUYA) miktarının mm arasında değiştiğini ifade etmektedirler. Kaya ve ark. 8 yaptıkları araştırmada, merada otlayan ve ek yem verilen kuzuların rumen sıvısı örneklerinde ph, toplam uçucu yağ asitleri ve amonyak azotu değerlerini sırasıyla 6.38, 6.9; 36, 47 mmol/l ve 3, 32 mg/l olarak belirlemişlerdir. Kars ili arazi varlığının yaklaşık /3 ünü çayır - meralar oluşturmakta ve koyun-kuzu yetiştiriciliği büyük ölçüde meraya dayalı olarak yapılmaktadır. Ancak merada otlatma döneminin kısa olması ve vejetasyona bağlı olarak besinsel değerinin düşmesi, hayvanlardan istenen verimin alınmasını engellemektedir. Bu nedenle merada otlatma sürecince ilave konsantre yem verilmesi, istenen verime ulaşmada önem arz etmektedir. Kars ve yöresinde, merada otlayan kuzularda yapılan daha önceki çalışmalarda 6,8 kuzuların, sütten kesilmeyip, merada anneleri ile otlatıldığı ve tek düzey ilave konsantre yem verildiği görülmektedir. Bu çalışmada, otlatma sezonunda meranın besin madde içeriğindeki değişim ile sütten kesilmiş kuzulara, meraya ilave olarak iki farklı düzeyde konsantre yem verilmesinin, besi performansı ve rumen metabolitlerine etkisi araştırılmıştır. MATERYAL ve METOT Araştırmada sütten kesilmiş 2-3 aylık yaşta, 8 baş Tuj ırkı erkek kuzu kullanılmıştır. Meraya ilave olarak kuzulara %8.5 HP ve 2.65 kcal/kg ME içeren konsantre yem verilmiştir. Araştırmada kuzular 6 başlı üç gruba ayrılmıştır. Bu kuzulardan 6 başı merada otlatılırken (Mera Grubu), 6 başına meraya ilave yem olarak kuzu başına 2 g konsantre yem (Mera + Ek Yem Grubu I) ve 6 baş kuzuya da meraya ek olarak 4 g konsantre yem (Mera + Ek Yem Grubu II) verilmiştir. Ek yemler merada otlatma sonrası verilmiş ve kuzuların günde en az iki defa su içmeleri sağlanmıştır. Kuzular, günde 8 saat süreyle merada otlatılmıştır. Araştırma 3 Mayıs - 3 Ağustos 28 tarihleri arasında 3 ay sürdürülmüştür. Hayvanlar ayda bir tartılarak canlı ağırlık artışları belirlenmiştir. Deneme sonunda hayvanlardan rumen sıvısı akşam otlatma ve konsantre yem ilavesinden iki saat sonra rumen sondası ile alınmıştır. Rumen sıvısında ph ölçümü hemen yapılmış, rumen amonyak azotu düzeyi ile total uçucu yağ asitleri analizi için iki farklı steril şişeye 3 ml rumen sıvısı alınmıştır. Toplam uçucu yağ asitleri (TUYA) ve amonyak azotu (NH 3 -N) düzeyi, Markham Steam Distilasyon Sisteminde 2 belirlenmiştir. Hayvanların otladığı meranın, vejetasyona bağlı olarak besin madde içeriklerini belirlemek için ayda bir defa olmak üzere, meranın dört değişik yerinden mera örnekleri alınmıştır. Bu amaçla, 5 cm 2 lik mera alanının otu, toprak seviyesinin bir cm üzerinden ot biçme makası ile kesilmiştir. Mera örnekleri ile konsantre yemin KM, HP, ham kül (HK) ve HS, ham yağ (HY) ve azotsuz öz madde (NÖM) düzeyleri A.O.A.C. ye göre 3 belirlenmiştir. Gruplara ait istatistiksel hesaplamalar ve grupların ortalama değerleri arasındaki farklılıkların önemliliği için

16 695 KAYA, ŞAHİN AKSU ELMALI, ÜNAL Varyans Analiz Metodu, gruplararası farkın önemlilik kontrolü için de Duncan Testi uygulandı. İstatistiki Analizler SPSS, (Inc., Chicago, II, USA) programına göre yapıldı. BULGULAR Hayvanların otladığı meranın vejetasyona göre besin madde içerikleri ile konsantre yemin besin madde kapsamı Tablo de verilmektedir. Kuzuların deneme başı canlı ağırlıkları ile ayda bir yapılan tartı sonuçları Tablo 2 de gösterilmiş olup, deneme sonu canlı ağırlıklar arasında bir fark bulunamamıştır (P>.5). Günlük canlı ağırlık artışı ise Tablo 3 te sunulmaktadır. Rumen sıvısı ph, NH 3 -N ve TUYA değerleri ise Tablo 4 te belirtilmektedir. Tablo. Meranın vejetasyona bağlı besin madde değişimi ile konsantre yemin kompozisyonu Table. Nutrient content of pasture with respect to vegetation periods and concentrate feed Yemler KM OM HK HP HY HS NÖM Mera % KM l. Biçim ll. Biçim lll. Biçim lv. Biçim P * * * * * * - SEM Konsantre Yem * İstatiksel farklılık vardır, P<.5, - İstatiksel farklılık yoktur, P>.5, SEM: Ortalamalara ait standart hata Tablo 2. Gruplarda ortalama canlı ağırlık değişimleri, kg Table 2. Average body weight changes in groups, kg Gün Mera Mera + Ek Yem I Mera + Ek Yem II P SEM Başlangıç İstatiksel farklılık yoktur, P>.5, SEM: Ortalamalara ait standart hata Tablo 3. Gruplarda ortalama günlük canlı ağırlık artışı, g/gün Table 3. Average daily body weight gains in groups, g/gün Gün Mera Mera + Ek Yem I Mera + Ek Yem II P SEM İstatiksel farklılık yoktur, P>.5, SEM: Ortalamalara ait standart hata Tablo 4. Gruplarda rumen sıvısı ph, toplam uçucu yağ asitleri, (TUYA, mmol/l) ve amonyak azotu (NH 3-N, mg/l) değerleri Table 4. Rumen fluid ph, total volatile fatty acids (TVFA, mmol/l) and ammonia nitrogen (NH 3-N, mg/l) values in groups Parametre Mera Mera + Ek Yem I Mera + Ek Yem II P SEM ph TUYA NH 3-N İstatiksel farklılık yoktur, P>.5, SEM: Ortalamalara ait standart hata

17 696 Merada Otlatma ve Meraya... TARTIŞMA ve SONUÇ Kuzuların otladıkları mera alanının KM içeriği, vejetasyonun ilerlemesiyle %3.33 ten %74.89 a ve HS düzeyi %29.8 den %34.68 e yükselmiş, HP içeriği ise %. den %6.25 e inerek, deneme sonunda otlatma başlangıcına göre %56.76 oranında azalmıştır. Meranın HY kapsamında vejetasyona bağlı olarak azalma olurken; OM, ve NÖM içerikleri ise dalgalı bir dağılım göstermiştir. Meraların besin madde içeriklerinde vejetasyona bağlı olarak meydana gelen değişiklikler bazı çalışma sonuçları 4-8,4 tarafından desteklenmektedir. Gerek merada otlayan, gerekse meraya ilave konsantre yem verilen gruplardaki kuzuların canlı ağırlıkları, deneme süresince birbirinden önemli bir farklılık göstermemiştir (P>.5). Deneme sonu itibarıyla merada otlayan, meraya ilave 2 ve 4 g konsantre yem verilen gruplardaki canlı ağırlıklar sırasıyla, 44., ve kg olarak belirlenmiştir. Merada otlayan kuzulara günde 4 g konsantre yem verilmesi, merada otlatılan gruba göre ortalama 2.78 kg daha fazla canlı ağırlık sağlamıştır. Gruplarda günlük canlı ağırlık artışı önemli bir farklılık oluşturmamıştır (P>.5). Ancak, özellikle denemenin ikinci ayında günlük canlı ağırlık artışında belirgin bir artış şekillenmiştir. Merada otlatma dönemi süresince ortalama günlük canlı ağırlık artışı gruplarda 52.8, 6.6 ve 83. g olarak tespit edilmiştir. Sütten kesilmiş Tuj kuzularla, 28 gün süreyle sadece merada otlatma, mera + 4 g, mera + 6 g ve mera + 8 g ek konsantre yem verilerek yapılan bir denemede 5, kuzuların günlük canlı ağırlık artışı 3.9, 88.2, 95.3 ve 9. g olarak tespit edilmiştir. Bu araştırma sonuçları, çalışmamızla uyumluluk göstermektedir. Ayrıca, Macit ve ark. 9 tarafından 2.5 aylık yaşta sütten kesilen İvesi, Morkaraman ve Tuj ırkı kuzulara meraya ilave olarak günde 45 g konsantre yem verilerek 7 gün süreyle yapılan çalışmada, belirlenen günlük canlı ağırlık artışları (55, 72, 48 g), sonuçlarımızla benzerlik arz etmektedir. Diğer taraftan merada otlayan kuzuların günlük canlı ağırlık artışı, Aksoy ve ark. nın 6, merada otlayan Tuj kuzularının günde 57 g canlı ağırlık artışı sağladıkları bildirişi ile uyumluluk içindedir. Ayrıca, sütten kesilmemiş kuzuların merada otlatılması ile kazanılan günlük canlı ağırlık artışı değerleri 6, bu denemede merada otlayan ve ilave konsantre yem verilen kuzulardan elde edilen veriler ile benzer bulunmuştur. Fakat, Karslı ve ark. 5 tokluların 7 günlük merada otlatma sezonu boyunca günde ortalama 22 g canlı ağırlık kazandığını ifade ettikleri bulgusu, denemenizde merada otlayan kuzulardan elde edilen değerden düşük saptanmıştır. Aynı şekilde, Eliçin ve ark. nın 7 Tuj kuzuları ile yaptıkları çalışmada belirledikleri günlük canlı ağırlık artışının (5 g), çalışmamızdan düşük olduğu tespit edilmiştir. Kaya ve ark. 8 sütten kesilmemiş 2 aylık Morkaraman ve Tuj ırkı erkek kuzuları, merada otlatma ve meraya ilave konsantre yem vererek yaptıkları çalışmada, saptanan günlük canlı ağırlık artışı, bu deneme sonuçlarından yüksek bulunmuştur. Diğer taraftan nadasa ekilen arpa + fiğ karışımı üzerinde otlayan sütten kesilmiş kuzularla yapılan araştırmada 8, belirlenen günlük ortalama 244 g canlı ağırlık artışı, denememizdeki verilerden yüksek bulunmuştur. Ayrıca, aynı çalışmada 8 otlatmaya ilave olarak günde 5 g konsantre yem verilmesinin, kuzularda sağladığı günlük canlı ağırlık artışının (269 g) çalışmamızdaki değerden fazla olduğu tespit edilmiştir. Araştırmalardaki değişik sonuçlar, denemeye alınan kuzuların ırk, yaş ve ağırlıklarının farklı olması, sütten kesilme durumu ve otlatma yapılan meraların botaniksel ve kimyasal bileşimlerinin farklılığından kaynaklandığı ile açıklanabilir. Rumen sıvısı ph değeri, merada otlatılan grupta, konsantre yem ilavesi yapılan gruplardan önemli bir fark göstermemiştir. Çalışmada merada otlayan hayvanlar için elde edilen ph değeri, meraya dayalı beslenen sığırların rumen ph değerinin arasında değiştiği bildirişine uygundur Ayrıca kaba yemle beslenen hayvanlarda rumen ph değerinin 6.68 olduğu verisi de çalışmamıza yakınlık göstermektedir 9. Aynı benzerlik Kaya ve ark. nın 8 merada otlayan kuzularda saptadıkları ph değerinde (6.38) de gözlenmektedir. Ayrıca, ilave konsantre yem verilen grubun ph değerinin düşük çıkması, konsantre yemle beslenen hayvanlarda rumen sıvısı ph değerinin, kaba yemle beslenenlere göre daha düşük olduğu bildirişiyle desteklenmektedir 2. Rumen sıvısı TUYA değerleri, deneme grupları arasında istatistik bakımdan farklılık göstermemiştir. Kaya ve ark. 4 merada otlayan ve konsantre yem ilavesi yapılan kuzularda saptadıkları rumen sıvısı TUYA değerleri, bu araştırma sonuçlarından daha yüksek çıkmıştır. Diğer taraftan rumen TUYA için bulduğumuz değer, Kolver and De Veth tarafından meraya dayalı beslenen sığırların rumen TUYA miktarının mm arasında değiştiğini belirten veriler tarafından desteklenmektedir. Araştırmamızda, merada otlayan ve ilave konsantre yem verilen gruplarda rumen sıvısı NH 3 -N konsantrasyonu önemli bir fark göstermemiş ve mg/l olarak bulunmuştur. Ruminantlarda rumen NH 3 -N konsantrasyonunun rasyona ve yemleme sonrası süreye bağlı olarak 2-. mg/l arasında değiştiği bildirilmektedir 2. Satter ve Roffler 22 ise rumen amonyak azotu konsantrasyonunun 8-56 mg/l arasında değiştiğini kaydetmişlerdir. Rumen sıvısı NH 3 -N konsantrasyonu için belirlediğimiz değer, Mc Donald 23 merada otlatmadan 3 saat sonra rumen NH 3 -N konsantrasyonunun 3 mg/l verisi ile Kaya ve ark. nın 8 belirlediği değerlerden düşük bulunmuştur. Bu farklılıklar rumen sıvı alma zamanı, mera kalitesi ve konsantre yem içerik ve miktarına bağlı olarak değişebilmektedir.

18 697 KAYA, ŞAHİN AKSU ELMALI, ÜNAL Sonuç olarak, otlatma yapılan mera vejetasyonun döneminin ilerlemesiyle büyük ölçüde değerini yitirmektedir. Meranın yeşil olduğu dönemlerde kuzular merayı iyi değerlendirmekte ve 9 günlük deneme süresince günde ortalama 53 g canlı ağırlık sağlamaktadır. Meraya ilave konsantre yem verilmesi, kuzularda canlı ağırlık artışına olumlu etki yapmakta ve günde 4 g konsantre yem verilen kuzular, merada otlayan kuzulara göre günlük 3 g daha fazla canlı ağırlık kazanabilmektedir. Diğer taraftan merada otlatma ve ilave konsantre yem verilmesinin kuzuların rumen sıvısı ph, TUYA ve NH 3 -N değerlerinde herhangi bir farklılık oluşturmamıştır. KAYNAKLAR. Ensminger ME, Oldfield JE, Heinemann WW: Pasture and Range Forages, In, Feeds and Nutrition. 2nd ed., pp , The Ensminger Publishing Company, California, Holmes W: Grass Its Production and Utilization. p. 89. The British Grassland Society by Blackwell Scientific Publications. London Marshall SA, Campbell CP, Buchanan-Smith JG: Seasonal changes in quality and botanical composition of a rotationally grazed grass-legume pasture in southern Ontario. Can J Anim Sci, 78, 25-2, Kaya I, Öncüer A, Ünal Y, Yıldız S: Nutritive value of pastures in Kars district I. botanical and nutrient composition at different stages of maturity. Turk J Vet Anim Sci, 28, , Karslı MA, Deniz S, Nursoy H, Denek N, Akdeniz H: Vejetasyon döneminin mera kalitesi ve hayvan performansı üzerine etkilerinin belirlenmesi. Turk J Vet Anim Sci, 27, 7-24, Işık S, Kaya I: Vejetasyon döneminin mera kalitesi ile merada otlayan Tuj ırkı koyun ve kuzuların besi performansı üzerine etkisi. Kafkas Univ Vet Fak Derg, 7 (): 7-, Scott GE: Nutrition in Sheep Production Handbook. Rev/Rngbnd ed., pp. 5-6, Sheep Industry, Kaya I, Saatci M, Ünal Y, Öncüer A, Kırmızıbayrak T: Yeşil dönemde merada otlatma ve konsantre yem ilavesinin mera kalitesi ile Morkaraman ve Tuj kuzularda büyüme, rumen ph, toplam uçucu yağ asitleri, amonyak azotuna etkisi. Lalahan Hay Araşt Enst Derg, 44 (): 33-39, Macit M, Şahin S, Esenbuğa N, Karaoğlu M: Growth and carcass characteristics or three fat-tailed pure breeds under grazing with concentrate supplemantation. Turk J Anim Sci, 27, , 23.. Kolver ES, De Veth MJ: Prediction of ruminal ph from pasture-based diets. J Dairy Sci, 85, , 22.. Anonymus: Kars İlinin Arazi Varlığı ve Arazi Yapısı. gov.tr/taryapi.asp#arazi, Erişim tarihi: Markham R: A Steam distilation apparatus suitable for Micro-Kjeldahl Analysis. Biochem J, 36, 79, AOAC: Official Methods of Analysis of the Association of Official Analytical Chemists. 4 th ed., Arlington, Virginia, USA, Muruz H, Baytok E, Aksu T, Terzioğlu Ö: Erçiş-Altındere Tarım işletmesi doğal merasının kalitesi. YYÜ Vet Fak Derg,, 66-7, Eliçin, A, Geliyi, C, İlaslan M, Ertuğrul M, Cengiz F: Tuj kuzularının değişik miktarlarda kesif yem ile desteklenen merada besi gücü ve karkas özellikleri. Ankara Üniv Ziraat Fak Yıllığı, Ankara, Aksoy AR, Saatci M, Özbey M, Dalcı MT: Tuj ırkı koyunların verim özellikler. I. Döl verimi ve büyüme. Selçuk Üniv Vet Bil Derg, 7 (): 73-77, Eliçin A, Geliyi C, Ertuğrul M, Cengiz F, İlaslan M, Aşkın Y: Farklı yöntemlerle beslenen tuj koyunlarının besi gücü ve karkas özellikleri. Ankara Üniv Ziraat Fak Yıllığı, 39, , Eliçin A, İlaslan M, Munzur M, Cangir S, Karabulut A: Nadas alanlarına ekilen fiğ + arpa karışımlarında otların sütten kesilmiş kuzuların besi gücü ve karkas özellikleri üzerinde araştırmalar. Büyük ve Küçükbaş Hayvancılık Ülkesel Araştırma Projeleri Raporu. Çayır-Mera ve Zootekni Araştırma Enst, 36-4, Dehority BA, Tirabasso PA: Effect of feeding frequency on bacterial and fungal concentrations. ph and other parameters in the rumen. J Anim Sci, 79, , Ørskov ER, Fraser C: The effect of processing of barley-based supplements on rumen ph rate of digestion and voluntary intake of dried grass in sheep. Br J Nutr, 34, 493-5, Dziuk HE: Digestion in the Ruminant Stomach. In, Swenson MJ (Ed.): Dukes Physiology of Domestic Animals. p London, Cornell Univ Press, Satter LD, Roffler RE: Influence of nitrojen and carbohydrate inputs on rumen fermentation. In, Haresign W, Cole DJA (Eds.): Recent Developments in Ruminant Nutrition. London, Butterworths, p. 5-39, Mc Donald IW: The absorbtion of ammonia from the rumen of sheep. Biochemist J, 42, , 954.

19 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE * ** *** General Structure and Economic Analysis of Fish Farms in Ordu Province - Turkey Murat DAĞTEKİN * Ebru YILMAZ ** Metin GÜREL *** Central Fisheries Research Institute, TR-625 Yomra/Trabzon - TURKEY Ordu University Faculty of Marine Sciences, Department of Fisheries Technology, TR-524 Fatsa/Ordu - TURKEY Provincial Directorate of Agriculture, Project Statistics Unit, TR-522 Ordu - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, economic analyses and general structure of fish farms in 29 Ordu, which has an important position in aquaculture sector in Turkey, researched. The data used in the study were obtained from face to face interviews, surveys and observations. In the study, the fish farms which were registered to the provincial directorate of agriculture in Ordu and make production actively were evaluated. The farms were analyzed under three groups having, -3 and >3 ton/year capacities considering their annual productions by 29. General profiles of the producers were presented according to the groups. Production and economic structures of the fish farms were researched and the differences between the fish farms were tried to be revealed. The solution offers were also tried to be presented to solve the problems by determining the faults seen at the production structure of the farms. Keywords: Economic analysis, Ordu province, Fish farms Özet Ordu İlindeki Su Ürünleri Yetiştiricilik İşletmelerinin Genel Yapısı ve Ekonomik Analizi Bu çalışmada, Türkiye de su ürünleri yetiştiriciliği sektöründe önemli bir konumda bulunan Ordu ilindeki su ürünleri yetiştiriciliği yapan işletmelerin 29 yılı içindeki ekonomik analizleri ve genel yapıları incelenmiştir. Araştırmada kullanılan veriler, yüz yüze görüşmelerle, anket ve gözlem yoluyla elde edilmiştir. Çalışmada Ordu ilinde Tarım İl Müdürlüğü ne kayıtlı bulunan ve aktif olarak üretim yapan işletmeler değerlendirmeye alınmıştır. İşletmeler, 29 yılı itibariyle, yıllık üretimleri göz önünde bulundurularak, kapasiteleri, -3 ve >3 ton/yıl olmak üzere üç grup altında incelenmiştir. Üreticilerin genel profili gruplara göre değerlendirilmiştir. İşletmelerin üretim ve ekonomik yapıları temel alınarak işletme grupları arasında farklılıklar ortaya konulmuştur. Ayrıca işletmelerin sorunları tespit edilerek çözüm önerileri sunulmuştur. Anahtar sözcükler: Ekonomik analiz, Ordu ili, Yetiştiricilik işletmeleri INTRODUCTION Fishery authorities agree concerning the idea that recently catching has reached it s maximum level with million tons over the world. Thereby, protection of existing stocks becomes much more important for providing higher fertility, instead of increasing the catching in sea and inland waters. In parallel with population growth fishery requirement has been increasing as well. The aim is to enhance aquaculture. Promotion of aquaculture largely depends upon evaluation of existing water sources to optimum level. Establishment of fish farms expedient to present water and enlarging the scope of old fish farms in order to benefit from the existing water source is the most important point 2. In Turkey, approximately 74% of fishery production is done through capture fisheries. Even though fish culture İletişim (Correspondence) /2

20 7 General Structure and... is rapidly increasing, still stays about 26%. In addition, it is seen that increasing aquaculture through capture fisheries is impossible. Therefore, aquaculture has great significance on supplying the increasing demand 3. In Turkey, aquaculture shows steady increase. Hence, fish farms are provided product, fingerling and organization supports within the scope of fish farms supports. In addition, fish farms, agricultural insurance premium support are also provided. Furthermore, farmers are able to use low interest investment and establishment credits. These kinds of supports enable fish farms to enlarge and farmers to establish new ones. Ordu has an essential role in terms of aquaculture. The amount of fingerling support by Provincial Directorate of Agriculture is the proof of it. In 28, (only for fingerling) , support was provided to Ordu Province 4. Rainbow trout culture has been extended almost all regions in the country and this is essential not only for employment but for also improvement of underdeveloped areas. Concordantly, it is necessary to make constitutional and bio-technical analysis of trout farmers and reveal the problems and their solutions 5. Especially fish farms should be monitored and their data should be updated firstly about production amount, technical installation, pest control and struggling with diseases and then about other constitutional features for actual and effective projection of planners or units related to subject 6. The purpose of this study is to explore general structure, economic analysis and annual performances (in 29) of fish farms produced in Ordu. MATERIAL and METHODS The material of this study was primary data obtained from fish farms in inland and marine through observation and survey. In survey, farms were to respond questions about general structure, physical and technical features and economic structure of their businesses. In the study, complete inventory method was applied as a sampling method. Three farms in research area did not want to conduct the survey. Also farms which do not make aquaculture are out of evaluation. Herewith, of 42 licensed 23 farms (Fig. ) were applied survey and their aquaculture activities were evaluated. Farms were categorized into three as; farms with tons yearly production, between -3 tons yearly production and more than 3 tons yearly rearing. Surveys were applied to owners of farms or administrators of those in order to evaluate 29 year activities. Capital structure of them was designated through classification in terms of capital functions. As a business, analysis method standard process was conducted. In this context, operation cost and rearing expenses were determined and then gross profit, net profit, expenses cost, production expenses, margin, capital asset interest, and profitability rate were confirmed. For the confirmation of these rates and amounts; Gross Production Value (output value) is defined as gross profit obtained from whole business or one part of business activities (fish sale, fingerling, food and etc.) 7. Expenses cost is the total of standby and variable expenses of business 7. Fig. Map showing the investigeted fish farms are located in the area Şekil. Çalışmada incelenen işletmelerin bulundukları noktalar

21 7 DAĞTEKİN YILMAZ, GÜREL Rearing cost is assessed through adding actual capital interest value to expenses cost value 8. Gross Product is assessed through subtracting variable expenses from sales of reared fish. Net profit is assessed through subtracting expenses cost from gross products. Amortizations (annual depreciation share) is assessed by direct line method. The value of stock is estimated to its estimated economic life 7,9. The calculation of depreciation share is as following: AP:S/n (AP: Annual depreciation share, S: stock value). Standby capital Interest is obtained by multiplying annual interest rate to half of machine or homestead value. Annual interest rate is % in this calculation. Profitability is defined as the rate of expenses profit to actual capital rate. This is a criterion used in evaluation of yearly activities and comparing with each other 7,. For the calculation of profitability rate 7,9, are used. Profitability rate which conveys the relationship of total investment capital and its income is calculated by adding debts to net profit and rating it to total capital 7,9. Rate of Return on Investment: [(Net profit + debt interests) / (Investment capital)]* The height of the rate shows business is profitable or efficient economically 7,9. Capital Turnover Rate: It is the rate of gross rearing value means annual endorsement to investment capital. For the calculation: Capital Turnover Rate:(Gross production value/investment capital)/* 7,9. When lowness of capital turnover is compared with farmer s gross rearing rate, it is clear that farmer has relatively more investments. He should either reduce investment capital or increase gross rearing value. For the analysis of the data SPSS and Excel programs are used. RESULTS There was 42 licensed fish farms in Ordu. Two of them which were in marine have restrictive injunction. On the one hand, eight farms were broken down actual aquaculture. There were also 6 farms which were preauthorized but not started actual aquaculture yet. The oldest fish farms in Ordu were founded in 8 years ago while new one were established 5 years ago. In research field, all of the farms in freshwater the rearing were done in concrete ponds; in sea it was in offshore cage. Ages of fish farmers were mainly between 4 and 49 means midlife (Fig. 2). It was found that fish farmers were generally primary school graduated (44.%) (Fig. 3). Almost half of (52%) of farmers had alternative income source beyond aquaculture. Crop and livestock rearing (5%) were mostly preferred. Besides this, it was possible to see other occupational groups (Marine fish farmers proclaimed that they had no alternative occupation but except fish culture). While marine fish farms used their all actual capacity, fresh water farms used 76.% of their capacity. 75% of fresh water farms did not intend to enlarge their capacity. 9.% of those farms give the reason as lack of water source, 5.% point out lack of finance and 5.% inconvenience land structure. Briefly, it was clear that the reason was lack of water source. On the contrary, 67.% of marine fish farms were positive approach to capacity development. Moreover, 52.% of the fish farms had hatchery for the aquaculture. 85.% of those determine their fingerling was sufficient for further rearing unlike. Those farms also purchase fish from outside. 5.% of the farms sell their product. On the other hand, 48.% of the fish farms had not got hatchery. It signifies that these farms were foreigndependant. Fingerling provided from other provinces or other farms carry diseases risks and it may cause big losses in the future. In addition, 55.% fresh water fish farms had hatchery in their body. It is specified that none of the farms in research had agricultural insurance against risks. This is a proof of the farms were unaware of future risks afterwards there can be great loss in the region due to diseases, turbidity, chemical wastes, flood and etc. Fish farmers were asked that how long they can continue their operations in any kinds of economic recession. Farms make rearing in inland water and sea fish cage responded as and.5 years respectively. Fig 2. Farmers age dispersion Şekil 2. İşletme sahiplerinin yaş dağılımı Fig 3. Farmers education level Şekil 3. İşletme sahiplerinin eğitim düzeyi

22 72 General Structure and... Farmers were questioned that how they evaluate their income obtained from aquaculture. Marine sea cage farms answered that they have no investment since they are small whereas 67.% maritime farms try to develop their capacity by using their income. Of farms on inland water 75.% have no marketing problem in order for their aquaculture amount is limited and for the consumption they use restaurant like fish farms. Unlike the inland water fish farms, coastal side farms have marketing difficulties due to long distance to central settlements and heavy road conditions. Indeed, all of the marine aquaculture encounters marketing problems. Active capital in farms involves land, building, pond or cage, brood stock, machine and equipment, fish and money capital whereas debit capital includes debts and stocks. Table shows active and debit capital of farms in terms of amount and rate. Among farms with in active capital the biggest margin belongs to fish capital in 6.%, 29.%, 67.% respectively. Own capital is calculated by subtracting debts from active capital. Even as the margin of debit capital in capital stock is 94.%, 94.% and %, debts comprise lower percentage of liabilities assets. Table 2 gives values and rates of expenses and production costs. As seen in Table 2 expenses costs are 6.44, and The total fixed cost, part of expenses costs, is 8.285, 2.88 and Nevertheless, variable costs have the highest amount among expenses and production costs. Variable costs are ranked as 7.859, 2.97 and Food cost is the most important outcome component in expenses and production outcomes with 23.%, 24.5% and 59.% respectively. Farms incomes and rates are shown in Table 3. The biggest income source is shown in the table fish sales. Farms in coastal sites prefer and focus on trout rearing while farms which make rearing in sea cages would prefer sea bass and trout rearing. It is clear from the table that fish species for income source are limited fish eggs and fingerling sales are not income source for those farms. It is a big handicap for them. Margin, net profit, investment capital profitability ratio, debt interest and standby capital interest of company groups are seen in (Table 4). In fact, margin has great importance in terms of monitoring the activities in company analysis 7,. As seen in the table the farms in I. group has quite lower margin; yet, differences are occurred in other two groups. Farms gross margin is calculated as 2.666, and 43.3 ; net profit is calculated respectively as 4.38, and (Table 4). It is found that capital turnover rates are 42.%, 37.% and 72.% ranking from smaller to bigger fish farms. The profitability rates specifying the relationship between total investment capital and net profit are 4.%, 2.% and 22.% for first, second and third group farms respectively. Table. Capital structure of the investigated farms ( ) Tablo. İşletmelerde sermaye yapısı ( ) A. ACTIVE CAPITAL I. GROUP % II. GROUP % III. GROUP % I. LANDLORD S ASSETS FARM Land Building Pond or cage TOTAL LANDLORD S ASSETS II. TENANT S ASSETS Machine and equipment Brood stock Fish Cash Material capital TOTAL TENANT S ASSETS B. LIABILITIES ASSETS Debts Own capital TOTAL LIABILITIES ASSETS TOTAL ACTIVE CAPITAL

23 73 DAĞTEKİN YILMAZ, GÜREL Table 2. Expenses and production costs of farms ( ) Tablo 2. İşletmelerde işletme ve üretim masrafları ( ) VARIABLE COSTS I. Group % II. Group % III. Group % Procurement of fingerling Food Temporary labor Veterinary and medicine Food Electricity Marketing TOTAL VARIABLE COSTS FIXED COSTS Permanent labor Family labor Debt interest Land rent Water rent Maintenance Amortizations Standby capital interest TOTAL FIXED COSTS TOTAL EXPENSES COSTS Table 3. Gross production value (GPV) and income source out of aquaculture of the investigated farms ( ) Tablo 3. İncelenen işletmelerin yetiştiricilik dışı gelir kaynakları ve toplam üretim değeri ( ) AQUACULTURE INCOME I. Group % II. Group % III. Group % Trout Sea bass Sea bream Fingerling Fish eggs TOTAL INCOME SOURCE OUT OF AQUACULTURE Retirement Crop Livestock Tradesman Hotel, guest house or else Interest income Others TOTAL TOTAL FAMILY INCOME DISCUSSSION Compared with farmers in other provinces, the dispersion of farmers ages has similarities. In the study done in Trabzon, the ages of farmers are between 4 and 49. In Tokat it is between 28 and 57 2 in Samsun for sea cage farmers it is between 42 and 49, coast business it is In Sivas it is between 25 and When credit use concern is considered, it is seen that 52.% of fish farmers used credit in setting up process.

24 74 General Structure and... Table 4. Gross margin, net profit, rate of return on investment and standby capital interest rates of farms Tablo 4. İşletmelerin brüt kar, net kar, yatırım sermayesi ve sabit sermaye faiz oranları I. Group II. Group III. Group Gross Margin ( ) Net profit ( ) Rate of return on investment (%) Debt interest ( ) 39 8 Standby capital interest ( ) Another study done in trout farms in Erzurum has proved 5 of the farms used credit in setting up or culture process 5. Nevertheless, in Sivas, shows that 4.3% of farms were set up by using Source Use Support Fund (SUSF) and 85.7% from own capital 4. Concerning studies done in Tokat, Samsun, Sivas and Erzurum, it is stated that the problems of obtaining loan such as high loan rate, low loan amount, difficulty in collateral surety and reimbursement in short time are common problems of business managers in Ordu. When the education level of fish farmers are taken into consideration, it is obvious aquaculture has similarities in the country. The research in Sivas shows that 36.9% of owners are graduated from primary school and the education level is low 2. In Samsun they are mostly graduated from primary school and high school 3. It is reported that 53.8% of rainbow trout farmer owners in Black Sea Region are graduated from primary school 6. In another research in Mediterranean Region 39.9z% of farmers are graduated from primary school. Emre at al. 6 and Karatas et al. 5 signify in their studies, a considerable part of entrepreneurs have formation about aquaculture and most of them have insufficient experiences in fish rearing. Therefore, some troubles may occur in those businesses. In their study 4, it is stated that 42.9% of farmer owners are primary school graduated and their education level is low. According to, Adıgüzel and Akay 2 it is indicated in their study, apart from fish culture 52.6% of company managers have different occupations as public staff, other agricultural activities and works of tradesman. In another study 3 it is claimed that 54.2% of sea cage farms and 6% of coastal fish farms have different occupations beside aquaculture. Dogan and Yıldız 7 confirmed in their study that 33.3% of farmers they studied on have income from aquaculture only; 33.3% of deal with commerce in different fields; 2.6% do farming. Karatas et al. 5 proclaimed that 42.8% of fish farmers have no adding income source but in aquaculture area; 57.2% have income source from agriculture and commerce aboard aquaculture income. Thereunto, the majority of coastal trout farmers in Ordu serve their products in their own restaurants to their customers. Similarly, in other study done by Dogan and Yıldız 7 it is seen that many farmers have considerably high income in same way. 2.% of farms in Tokat implied that for why there is lack of water source, they have difficulty in aquaculture rearing and hence, they are not able to develop their capacity 2 57.% of sea cage fish farms and 25.% of inland aquaculture farms in Samsun indicated that they would like to reduplicate their capacity 3. For a successful aquaculture proper hatchery planning is a necessity 8. Adıgüzel and Akay 2 suggest that 63.% of the farms have a separate hatchery structure and.5% of them use their ground floor as hatchery. Karatas et al. 5 emphasize that 9 of the farms they work on are able to produce fish eggs and fingerling for their own needs. They predicate 64.3% of the farms have separate hatchery and 35.7% have hatchery at their ground floor. None of the farms in research have food unit. Moreover, they consume convenience food (for adult fish pellet, for fingerling granule). Most of the farms claim that the main problem in food procurement is high cost of food. According to research, dry food is utilized similarly 2-6,9. Meanwhile, fish farmers had not organized as a farmer s union yet in Ordu. It seems that they were unaware of this issue. Farmers investigated had no membership to such unions and others; however, most of them have willingness to be united 2,4,6,9. Under any kinds of troubles (diseases and etc.) during rearing period, Provincial or District Directorate of Agriculture is the first address for the farmers. Other organizations are second steps. Trabzon Central Fisheries Research Institute and Universities plays an information desk role. In Trabzon farmers follow the same ways for their problems 2. Concerning the similar research, marketing seems one of the main problems and according to farms, high demand and lower supply and lower fish sales prices lead to marketing problem 2. The most important ones can be supposed as high food prices, diseases (fungal or parasite and etc.), turbidity and flood, marketing problems, obtaining loan problems and so on. According to Adıgüzel and Akay 2 research, the biggest capital in Tokat was building and pond capital (4.9%). Unlike this, fish capital stands at 26.%. In accordance with

25 75 DAĞTEKİN YILMAZ, GÜREL research done in Kırklareli, farms sort into three groups and biggest capital is again fish capital (3.%, 26.% and 26.% respectively) 9. According to Adıgüzel and Akay 2 food cost is 28.% of expenses costs. Cetin and Bilgüven 2 suggest that food cost is the highest outcome component in trout farms with 6.5. For Yavuz et al. 22 it is 63.4% and for Aydın and Sayılı 23 it is 5.9%. When the general results are taken into consideration, farms in Turkey have almost the same structure at all. In research done in Kırklareli similar results are estimated as 2.%, 29.3% and 4.2% 24. Provincial profitability rate of trout culture fish farms in South Marmara Region is 64.% 2. In Tokat the concerned rate is calculated as 37.9% 8. Though, throughout Turkey the rate is found as 28.8% 25. Farms under research have rather low profitability rate; thereby, it is possible to indicate those farms concerned are unprofitable. This is a proof that farms turnover rates are notably in good position. The lowness of capital turnover rate predicates company owner transfers income obtained from the facility to other fields. In South Marmara this rate is 48.9% and it is 59.% in Thracian Region 2,24. According to research in Yene River in Kırklareli done margin in three facility groups is estimated as , and ; net profit as 6.23, 3.32 and respectively. Taking into account that I. and II. Group fish farms show similarities to farms in Kırklareli, but gross margin and net profit values are different 9. Ordu has pretty convenient structure for aquaculture. It is necessary to protect existing water source and utilize the water consciously in order to improve rearing. It is highly essential to promote fishery to farmers and provide adequate support policies for the improvement of aquaculture. For the year 23, aquaculture production estimated lower limit and upper limit respectively as, between and ton 26. Such a scenario would have important functions fish farms in Ordu. In research, it is pointed out that most of the farms are family business farms. It conveys a great importance to employee fishery technician/engineer or fishery technology engineer in the company for the sustainability and rapid improvement of aquaculture so then under any diseases problem quick and deliberate solution can be achieved. More often monitoring and high quality product serving should be supported. Owing to Black Sea Region climatic conditions, water discharge and quality can show differences time to time (water used in fish farms). Necessary structural measurements should be taken against potential flood and overflow. Against turbidity resulting from excessive precipitation settling tank and system should be installed. Agricultural Insurance against risks and formulation of farmer s union within Ordu is very significance for the sustainability of the fish farms. It is indicated that farms rantability is not high; thence, different methods to improve efficiency would be necessary. One of the ways is to reduce food outcomes, part of variable costs. In other words, decrease in feed conversion ratio and decrease in consumption will increase the efficiency. In accordance with the results, supports for fingerling and fish sales can bring farms to a certain level. The other way to improve efficiency is to establish hatchery and sell fish eggs and fingerling. Thus, gross production value would be extended as well. In line with it, farms will be provided sufficient conditions to work efficiently. Fish farmers have great effort not to contract debt or loan credit from any organizations or institutions. However, it means they take any risks for new investments. Acknowledgement We wish to thank Esen ALP, Ilhan AYDIN, Burak OZKAN, Bilal AKBULUT, Muharrem AKSUNGUR and Mustafa ZENGIN for their help. REFERENCES. Brown L, Kane H: Think about the Future-Re-Evaluation of Bearing Capacity of the World. TEMA-TUBITAK, 6 th ed., Ankara, Akbulut B, Kurtoglu IZ, Ustundag E, Aksungur M: Historical development and future projection of fish culture in Black Sea Region. J Fish Sci, DOI:-353 jfscom 29, Anonymous: Turkish Statiscal Institute (TUIK) Publication. Ankara - Turkey, Anonymous: General Directorate of Agricultural Production and Development (TUGEM) production data, Accessed: Buyukcapar HM, Sezer O: Structural and bio technical features of trout fish farms in Rize Province. KSU J Sci Eng, 9, 77-8, Emre Y, Diler I, Sevgili H, Oskay DA, Sayın C: Examining the structural features of trout fish farms in Mediterranean Region (2-23). J Turk Aqua Life, 5, 82-88, İnan IH: Agriculture economics and management. Exp and Upd 6th ed., p 372, Tekirdağ, Sayılı M, Karatas M, Yücer A, Akca H: Structural and economical analysis of trout culture fish farms in Tokat Province. Ekin J, 7, 66-72, Acil F, Demirci R: Agricultural Economy Course. Ankara University Agri Fac Publ, No: 88, Ankara - Turkey, İnan IH: Agriculture Economics and Management. Exp and Upd 4th ed., p 272, Tekirdağ, Dagtekin M, Ak O: Fish farming industry s socio-economic analysis and marketing patterns in Trabzon - Turkey. EIFAC Antalya Turkey, Adıguzel F, Akay M: Economic analysis of rainbow trout culture fish farms in Tokat province. GOU J Agri Fac, 22 (2): 3-4, Aydın A: Structural and economical analysis of designed trout fish farms in Erzurum province. Msc Thesis, Ataturk Univ Fac of Sci Dept of Fish Erzurum, Ustundag E, Aksungur M, Dal A, Yılmaz C: Structural analysis and evaluation of efficiency of fishery culture fish farms in Black Sea Region. Res Rep, CFRI, Trabzon, 29 p, 2.

26 76 General Structure and Karatas M, Sayılı M, Koc B: Structural and economical analysis of trout culture fish farms in Sivas Province. BIBAD J Bio Sci Res, (2): 55-6, Kocaman EM, Aydın A, Ayık O: Structural and economical analysis of trout culture fish farms in Erzurum Province. Aegean Unv J Fish, 9 (3-4): , Dogan K, Yıldız M: Socio-economic analysis of employees working in rainbow trout (Oncorhynchus mykiss) culture fish farms in Marmara Region. IU J Fish, 23, 7-27, Alpbaz A: Practical Trout Culture. Aegean Unv Fish Fac Publ, İzmir, Uzmanoglu S, Soylu M: Economical analysis of fishery fish farms on River Yene (Balkaya-Kırklareli). J Fish Sci, 2 (2): 64-73, Dagtekin M: Fishery production and marketing pattern in Trabzon Province. Msc Thesis, Cukurova Univ, Fac of Sci The Dept of Agr Eco Adana, Cetin B, Bilguven M: Structural and economical analysis of trout culture fish farms in South Marmara Region. Aegean Unv Fish Symp in th in Edu, pp8, Yavuz O, Kocaman EM, Ayık O: Structural and economical analysis of trout culture fish farms in Erzurum Province. J Agr Fac Univ Ataturk, 26 (): 64-75, Aydın O, Sayılı M: Structural and economical analysis of trout culture fish farms in Samsun province. GOU Agri Fac Bull, 26 (2): 97-7, Soylu M: Economical analysis of trout culture fish farms in Thracian Region. Aegean Unv J Fish, 2 (3-4): 23, Rad F: Technical and economical analysis of rainbow trout (Oncorhynchus mykiss Walbaum, 792) culture fish farms in Turkey, PhD Thesis, Ankara Univ Fac of Sci Dep of Fish, pp 7, Ankara, Saygı H, Kop A, Bayhan A: The forecast of the future production amounts of the some fish species being cultivated in Turkey, Kafkas Univ Vet Fak Derg, 7 (): 3-2, 2.

27 Kafkas Univ Vet Fak Derg 7 (5): 77-72, 2 DOI:.9775/kvfd RESEARCH ARTICLE Dairy Firms Characteristics and Practices Intended for Economic Sustainability and Food Safety in Aydın Region of Turkey [] Ferit ÇOBANOĞLU * Ayşe Demet KARAMAN ** Renan TUNALIOĞLU * Gülden OVA *** [] This study was summarized from the project Food Safety Practices in Food Businesses in Aydın, ZRF-2, supported by the Scientific Research Project at Adnan Menderes University (ADU) * Adnan Menderes Üniversitesi, Ziraat Fakültesi, Tarım Ekonomisi Bölümü, TR-9 Aydın - TÜRKİYE ** Adnan Menderes Üniversitesi, Ziraat Fakültesi, Gıda Mühendisliği, TR-9 Aydın - TÜRKİYE *** Ege Üniversitesi, Mühendislik Fakültesi, Gıda Mühendisliği, TR-35 Bornova, İzmir - TÜRKİYE Makale Kodu (Article Code): KVFD Summary Many factors are able to impact economic sustainability and food safety concepts in dairy firms. This study aimed at identifying key constraints for economic sustainability and food safety practices in dairy firms. The paper consisted of a survey study carried out by 28 firms in Aydın, Turkey. In order to analyze the firms characteristics and operations efficiently, they were separated into six groups based on a cluster analysis. The research was performed in two dimensions. In the first dimension, descriptive statistics, such as age, education level of the firm managers/owners, the number of product mixes, and total employees, reel firm capacity, net firm income, were identified due to their critical value being related with economic sustainability. In the other dimension, present practices and attitudes were analyzed for economic sustainability and food safety approaches. Small-scale production and marketing facilities focused on the domestic market were the most important characteristics of the firms. In the short run, although it was discovered that these firms would be able to achieve economic sustainability and sufficient food safety practices in the region, they would need to research enlargement facilities related to firm size and access to the international market conditions in the long run. Keywords: Dairy firms, Economic sustainability, Food safety, Milk processing, Turkey Ekonomik Sürdürülebilirlik ve Gıda Güvenliğine Yönelik Olarak Türkiye nin Aydın Yöresindeki Süt ve Süt Ürünleri Firmalarının Karakteristikleri ve Uygulamaları Özet Süt ve süt ürünleri firmalarında, birçok faktör ekonomik sürdürülebilirlik ve gıda güvenliği konseptlerine etki edebilmektedir. Söz konusu çalışma, süt ürünleri firmalarında ekonomik sürdürülebilirlik ve gıda güvenliği uygulamalarına yönelik anahtar kısıtları tanımlamayı amaçlamaktadır. Makale, Türkiye nin Aydın ilindeki 28 süt ürünleri firması ile yapılan anket çalışmasından oluşmaktadır. Firmaların karakteristiklerini ve uygulamalarını etkili olarak analiz edebilmek için, firmalar kümeleme analizine dayalı olarak 6 gruba ayrılmıştır. Araştırma iki boyutta yürütülmüştür. Birinci boyutta; firma yöneticileri/sahiplerinin yaşı, eğitim düzeyi, ürün çeşidi, toplam işçi sayısı, reel firma kapasitesi ve net firma geliri gibi ekonomik sürdürülebilirlik açısından önemli olan bazı parametreler tanımlanmıştır. Diğer boyutta ise; mevcut uygulamalar ve tutumlar ekonomik sürdürülebilirlik ve gıda güvenliği yaklaşımlarına yönelik olarak analiz edilmiştir. Küçük ölçekli üretim ve iç pazara yoğunlaşan pazarlama koşulları, firmaların en önemli karakteristikleridir. Kısa dönemde, yöredeki firmalar ekonomik sürdürülebilirlik ve yeterli gıda güvenliği uygulamalarını sürdürebilecek gibi görünmesine rağmen, uzun dönemde ise firmalar, ölçeğini genişletmek ve uluslararası pazar koşullarına ulaşabilmenin imkanlarını araştırmak durumundadırlar. Anahtar sözcükler: Süt ve süt ürünleri firmaları, Ekonomik sürdürülebilirlik, Gıda güvenliği, Süt işleme, Türkiye İletişim (Correspondence)

28 78 Dairy Firms Characteristics and... INTRODUCTION Due to the strategic value of milk and milk products for the nutrition of human beings and the role of dairy industry in rural development and food economics, determining economic sustainability and food safety practices implemented in dairy firms is a very important topic. Sustainability is a multifunctional concept and thus is not easy to assess or to evaluate. It includes the ecological, economic, and social dimensions of sustainability 2. Sustainability follows a normative approach; the Brundtland Commission 3 defines sustainability as a concept that meets the present needs without compromising the needs of future generations. Different approaches can be used to measure sustainability at farm and firm levels 4-6. Moreover, indicator sets were developed by the European Commission 7 and the Organization of Economic Cooperation and Development (OECD) 8. Another methodology, the Sustainable Value Approach (SV), follows an idea of financial economics that the return on costs must cover the costs of capital 9. Food safety in the Turkish dairy sector is far less than satisfactory, since milk delivered to milk collection centers is generally obtained from small-scale family farms and is not of the desired quality from a food safety and food quality perspective. European Union (EU) milk quality levels are only reached by a limited number of large scale dairy farms. This was documented in a recent study on the role and importance of the milk collection centers in Izmir. It was found that quality control analysis of raw milk cannot be carried out because of the lack of qualified specialists and equipment inadequacies. A study reveals that there were a large number of dairy processors in the Izmir province that handle rather small volumes of milk and have little control over the raw milk supply. Most managers have a limited education concerning their positions, and resources were too limited in these firms, thus limiting their ability to adopt most regulations 2. There were many constraints in the Turkish dairy industry on food safety concepts in respect to detailed literature reviews; however, there were not sufficient research papers analyzing economic sustainability and food safety approaches into the framework of integrated approach in dairy firms. Thus, the objective of this paper was to assess the economic sustainability performance and food safety practices implemented in the dairy firms established in Aydın, Turkey. MATERIAL and METHODS The data used in the study that was directly collected by surveys from the managers/owners of the dairy firms. In the study, the dairy firms established in Aydın were investigated. This province is situated in the west of Turkey and has critical value in both dairy cows and milk production. In April-July 2, 28 dairy companies, constituted of all dairy product firms in the region, were visited and data were collected via surveys. The distribution of the firms were located in Çine (6), Center (5), Söke (4), Nazilli (3), Koçarlı (2), Germencik (), Yenipazar (), Ortaklar (), Bozdoğan (), Umurlu (2), Karpuzlu (), and Kuşadası () in the Aydın region. The study was performed in two dimensions. In the first dimension, age, education level, and experience of the managers/owners, the number of product mixes and total employees, real milk processing capacity per day, and net annual income were determined. In the other dimension, present practices and attitudes were analyzed according to their economic sustainability and food safety approaches by using the responses to their statements. The five-point Likert scale was utilized in the determination of frequency, and attitudes were an ordinal measurement system, increasing from to 5. A five-point Likert scale 3, in which was set as highly inferior and 5 was set as highly superior, was applied to collect data. An increase in Likert scale averages means that there is greater adherence to sustainability as well as more compatible attitudes 4. The variable costs that were calculated from the dairy firms data belongs to raw materials (milk in particular), labor, utilities/fuel, electricity, water, packing materials, and other materials expenses. Depreciation of buildings, machines, and other movable properties, unpaid labor, and management costs were evaluated in fixed costs. While depreciation costs would be estimated for buildings, machines, and other materials, it was considered to be 4%, %, and 2% of their current prices, respectively. Total incomes of the firms were calculated based on the current prices of processing milk and milk products. Net income per dairy firm was calculated by subtracting the total costs from total income of the firm 5. All variables prices, including inputs and outputs, were recorded very carefully, and all calculations were performed with the (US dollar) $ equaling (Turkish Lira) TL.5, according to the exchange rate from April to July 2, which matches the period of the study. A typology of dairy firms was set up from collected data. It took into account different elements of a processing system and characteristics. These parameters were age and education level of the firm managers/owners, real milk processing capacity per day, and net income of the firm. We carried out a hierarchical cluster analysis using Ward s method 6 applying Squared Euclidean Distance as the distance or similarity measure. This helped to determine the optimum number of clusters with which we should work. The data was analyzed using SPSS for Windows 6.. First, descriptive statistics of the firms were summarized. For the variables, a Normal Distribution test was applied by the Jarque-Bera test 7,8. Because the variables obtained from Likert scales did not display normal distribution, the Kruskal-Wallis one-way analysis of variance was engaged. This is a nonparametric test, which is used to compare three or more groups of sample data. Using the hypothesis in the Kruskal-Wallis test, a null hypothesis (H ) assumes that the samples, dairy firms, are from identical populations; alternative hypotheses (H a ) assume that the sample comes from different populations. A Chi-square (χ 2 ) with k- (the

29 79 ÇOBANOĞLU, KARAMAN TUNALIOĞLU, OVA number of groups-) degrees of freedom was used to approximate the significance level for the test 9. RESULTS Table provided a descriptive summary of the dairy firms and firm managers/owners characteristics used in this study. While the age of the firm managers/owners would vary between 28 and 7, the average education level was a high school degree. Their average experience in dairy industry was years. While the number of product mixes was between 2 and 9, these products were concentrated in milk, butter, cheese, yogurt, and dried milk (milk powder). The average milk processing capacity per day ranged between. and 4 tons. Finally, the net annual firm income obtained from the dairy firms varied between $. and $7... These indicators stressed that the dairy firms in the Aydın region showed small and/or middle-scale characteristics. The attitudes and perceptions of the managers in the firms are shown in Table 2 for the preprocessing phase. It was specified that the differences among the firm groups Table. Descriptive statistics for the dairy firms and firm managers/owners characteristics Tablo. Süt ve süt ürünleri firmaları ve yöneticileri/sahiplerinin karakteristiklerine yönelik tanımlayıcı istatistikler Characteristics Explanations Mean Min Max Std. deviation Age years Education level : primary school, 2: high school, 3: university, 4: postgraduate Experience in dairy industry years Product mix number Employees number Reel firm capacity milk processing capacity per day (ton) Net firm income annual income ($) Table 2. Likert scale averages concerning the practices of the dairy firms in the preprocessing stage with regard to economic sustainability and food safety approaches Tablo 2. Ekonomik sürdürülebilirlik ve gıda güvenliği yaklaşımlarına ilişkin olarak işleme öncesi aşamada süt ve süt ürünleri firmalarının uygulamalarını dikkate alan Likert ölçeği ortalamaları Statements Group I (n=9) Group II (n=4) Group III (n=3) Group IV (n=5) Group V (n=3) Group VI (n=4) Chi-square (χ 2 ) Do you give sufficient care to the sufficient conditions of milking, collecting, and transportation of milk? Do you take into consideration, before purchasing the raw milk, whether it should have good quality, composition, and contents? Do you carry out research studies that would confirm the raw milk to be clean and imbued with sufficient ** quality? Do you take into consideration that the transportation lorry for raw milk should be clean and appropriate (having sufficient heat in particular) for usage? Do you purchase the raw milk from producer cooperatives in general? * Do you always purchase the raw milk from producers? Do you give sufficient warnings on obtaining and processing procedures in milk according to the Turkish * Food Codex? Do you always buy the milk from producers and/or producer cooperatives at a sensible price level? Do you always take into consideration the cost of transportation and shipping of the milk at a reasonable price level? Do you pay attention to the milk contents, whether they have dry matter without fat, acidity, or antibiotic ** content, and whether the milk is colostrum or not? Do you take into consideration whether the producers have carried out good practices? * Values are means, * Significant for P<., ** Significant for P<.5 P value

30 7 Dairy Firms Characteristics and... were statistically significant (P<.5) for the statements; carrying out research studies, which would provide the raw milk as clean and imbued with sufficient quality and paying attention to the milk contents, whether they have dry matter without fat, acidity, antibiotic content, and whether it is colostrum or not. There were statistical differences among the firm groups (P<.) for several statements, including purchasing the raw milk from producer cooperatives in general, giving sufficient warnings on obtaining and processing procedures in milk according to the Turkish Food Codex, and taking into consideration whether the producers have carried out good practices. The rest of the statements were not statistically different among the firm groups. The attitudes and impressions of the manager/owners in dairy firms were clarified in the processing stage (Table 3). Although in many of the circumstances statistical differences among the firm groups were not obtained, there were statistical differences (P<.5) on two particular statements. These included ) making an analysis of the water used in the firm in order to learn its contents, and 2) giving sufficient importance to carrying out the product in loading, transporting, and delivering process that are suitable for the Turkish Food Codex in healthy, reasonable, and hygienic conditions. The perceptions and practices of the managers in the firms are given in Table 4 after the processing stage. There were statistical differences among the firm groups in the statement that customers would determine the product varieties (P<.5), and the marketing profiles were developed as a result of whole-sale in general (P<.). For the rest of the circumstances, no statistical differences were obtained among the firm groups. DISCUSSION Although most of the dairy firms in the region showed small and/or middle-scale characteristics, the managers/ owners of the firms were younger, had high education levels, and earned a relatively sufficient net income. These structural parameters were explained in many studies for specific regions of Turkey and/or in general The main conclusions obtained from the study which defined key constraints intended for economic sustainability and sufficient food safety practices in the dairy firms in the region revealed five main issues. The issue is that implementation of good practices to obtain sustainability would not show different characteristics in small and largesized dairy firms, except the few parameters indicated in the paper. As a second issue, most of the firms would buy raw milk from small dairy farms. Only small part of the factories functioning in the milk and dairy industry belong to the cooperatives. Therefore, most of the firms could not implement key solutions as necessities for a sustainable milk supply chain. The third issue is that most managers of the small-sized dairy firms, called mandiras, were not informed well or at all and could not implement good practices when necessary. On the other hand, the managers indicated they might be suffering from a lack of ability to establish and use advanced technology in the firms. The fourth issue is that although good practices intended for sustainability and food safety at a firm level would be implemented relatively well in preprocessing and processing stages, some of the applications would not be performed in the post-processing stages in most cases. Perhaps this is the most interesting result obtained from Table 3. Average Likert scale for the attitudes of the firm managers during the processing period Tablo 3. İşleme periyodu süresince firma yöneticileri tutumlarına yönelik ortalama Likert ölçeği Statements Do you make the classifications of the raw milk in the firm? Do you give enough warnings for delaying the raw milk in the cold air conditions? Group I (n=9) Group II (n=4) Group III (n=3) Group IV (n=5) Group V (n=3) Group VI (n=4) Chi-square (χ 2 ) P Value Do you pay attention to the straining of the milk? Do you take sufficient value for applied heat processing in the milk? Do you take into consideration the thermal processing norms (heat and time) carried out in the processing stage of the raw milk? Do you make an analysis of the water used in the firm in order to learn its contents? * Do you pay attention to treating the product so it is suitable for the Turkish Food Codex (TFC) during all of its processing stages? Do you give sufficient importance to carrying out the product in loading, transporting and delivering processes that are suitable for the Turkish Food Codex in healthy, reasonable, and hygienic conditions? * Values are means, * Significant for P<.5

31 7 ÇOBANOĞLU, KARAMAN TUNALIOĞLU, OVA Table 4. The analysis of the perceptions of the managers for the dairy firms in regard to defining key constraints after the processing term Tablo 4. İşleme sonrası dönemde anahtar kısıtları belirlemeye yönelik olarak süt ve süt ürünleri firmaları yöneticileri tutumlarının analizi Statements Group I (n=9) Group II (n=4) Group III (n=3) Group IV (n=5) Group V (n=3) Group VI (n=4) Chi-square (χ 2 ) Do the customers determine the product varieties? ** Do the marketing profiles occur as a result of retail in general? Do the marketing profiles occur as a result of wholesale in general? * Do the marketing profiles consist of awarding? Do the marketing profiles occur in boutiques (small retail stores)? Are the marketing profiles formed by the franchise? Do you create the advertisement activities for promotion? Do you make the advertisement activities refer to taste? Do you make the advertisement activities as visual publications? Do you make the advertisement activities in poster form? Do you try to improvement functioning competition? Do you give sufficient importance to improving new products? Do you put the products, ready to sell, in the store at a precise time? Do the food safety systems aid the marketing of the products? Values are means, * Significant for P<., ** Significant for P<.5 P Value the study. Because the firms that carried out the survey study showed small-scale characteristics and implemented marketing activities for the domestic market, they would not need accelerating activities, such as advertisements and product segmentation, after the processing phase. However, most of the firms may be suffering from lack of competitive conditions and marketing facilities in the process of EU membership for Turkey in the long run. The fifth critical issue emphasized that there were some technical, socio-economic, and financial constraints to implementing good practices intended for sustainability and food safety concepts. Although many efforts have been accelerated to overcome the current constraints by the government, agricultural associations, and nongovernmental organizations, substantive approaches from preprocessing stages to after processing phases in the milk supply chain should be completely employed on the basis of technical, socio-economic, and financial approaches in the dairy sector. REFERENCES. Günlü A: An investigation of firm concentration rate of dairy industry in raw milk marketing: A case study of Burdur province. Kafkas Univ Vet Fak Derg, 7 (): -6, Barbier EB: The concept of sustainable economic development. Environmental conservation. Int J Env Sci, 4, -, Brundtland Kommission: Unsere gemeinsame zukunft. Eggenkamp Verlag, Greven, Hülsbergen KJ: Entwicklung und anwendung eines bilanzierungsmodells zur bewertung der nachhaltigkeit landwirtschaftlicher systeme. Shaker Verlag, Aachen, Schaffner A, Hövelmann L: Der DLG nachhaltigkeitsstandard nachhaltige landwirtschaft-zukunftsfähig. DLG, Frankfurt, TLL: Umwelt - testbetriebsnetz Thüringen 3. und 4. Auswertejahr (23/4) ergebnisse und schlussfolgerungen. USL-projektstelle des VDLUFA beim verband für agrarforschung und - bildung, VAFB, Jena, Europäische Kommission: Mitteilung der Kommission an den Rat und das Europäische Parlament: Indikatoren für die Integration von Umweltbelangen in die Gemeinsame Agrarpolitik, KOM (2) 2. Brüssel, OECD: Environmental indicators for agriculture. OECD, Paris, Figge F, Hahn T: The cost of sustainability capital and the creation of sustainable value by companies. J Indust Ecol, 9, 47-58, 25.. Koletzko B: Food safety situation in Turkey. DG International Policies of the Union, Policy Department Economic and Scientific Policy. IP/A/ ENVI/NT/28-2, PE European Parliament, 28.. Demirbaş N, Gölge E, Tosun D, Çukur F: Food safety practices in milk collection centers in Turkey: A case study. Brit Food J, (8): , 28.

32 72 Dairy Firms Characteristics and Demirbaş N, Karagözlü C: Constraints in meeting food safety and quality requirements in the Turkish dairy industry: A case study of Izmir province. J Food Prot, 7 (2): , Malhotra NK: Marketing Research: An Applied Orientation. 2 nd ed., Prentice-Hall, Englewood Cliffs, Davis JA: Elementary Survey Analysis. Printice Hall, New Jersey, 9-32, Anonim: Tunceli ili süt ürünleri ve tulum peyniri imalatı ve paketleme tesisi ön fizibilite etüdü. Doğu Anadolu Projesi Ana Planı. T.C. Başbakanlık Devlet Planlama Teşkilatı Müsteşarlığı, Milligan G, Cooper M: An examination of procedures for determining the number of clusters in a data set. Psychomet, 5 (2): 59-79, Gujarati DN: Basic Econometrics. 3rd ed., McGraw-Hill, Boston, MA, Akkaya S, Pazarlioglu V: Ekonometri I (Econometrics I). Anadolu Matbaacilik, Izmir, Kruskal WH, Wallis WA: Use of ranks in one-criterion variance analysis. J Am Stat Assoc, 47 (26): , Azabağaoğlu MÖ, Gaytancıoğlu O, Kubaş A, Erbay R: Analysis of the marketing structure of the dairy industry in the Trakya region and the determination of emerging issues with multidimensional scaling. Turk J Agric For, 27, 7-22, Gönenç S, Tanrıvermiş H: An overview of the Turkish dairy sector. Int J Dairy Tech, 6 (): -, Armagan G, Koc A, Ozden A: Food safety at the dairy farm level: Knowledge, practices and attitudes of farmers. Milk Sci Int, 64 (): 6-9, Demir P, Aral S: The economic and socio-economic analysis of integration for production and industry in dairy industry enterprises in Kars province. Kafkas Univ Vet Fak Derg, 6 (4): , 2.

33 Kafkas Univ Vet Fak Derg 7 (5): 73-79, 2 DOI:.9775/kvfd RESEARCH ARTICLE Effects of Short-Acting Anaesthetics on Haemodynamic Function as Determined by Doppler Ultrasonography in Rabbits * ** *** Mahir KAYA * Zeynep PEKCAN ** Yusuf ŞEN *** Başak BOZTOK *** Oytun Okan ŞENEL *** Ali BUMİN *** Atatürk University, Faculty of Veterinary Medicine, Department of Surgery, TR-2524 Erzurum - TURKEY Kırıkkkale University, Faculty of Veterinary Medicine, Department of Surgery, TR-745 Kırıkkkale - T URKEY Ankara University, Faculty of Veterinary Medicine, Department of Surgery, TR-6 Ankara - TURKEY Makale Kodu (Article Code): KVFD Summary This study was carried out to determine the effects of short-acting anaesthetics on haemodynamic function determined by Doppler ultrasonography. Prior to anaesthesia, Doppler parameters [peak systolic blood flow velocity (psbfv), end-diastolic blood flow velocity (edbfv), minimum diastolic blood flow velocity (mdbfv) and resistive index (RI)] were obtained from the right common carotid artery (CCA), abdominal aorta (AA) and right kidney in New Zealand rabbits (n=24). Animals were then divided into 3 groups to be anaesthetized with propofol (Group P), 2.5% thiopental sodium (Group T) and xylazine/ketamine HCl (Group XK). During anaesthesia the same Doppler measurements were made. Compared with baseline values, psbfv obtained from CCA increased in Group P (P<.2) and insignificantly changed in Groups T and XK. psbfv measured from AA in Groups T and XK decreased as compared with baseline values. In the right kidney, psbfv in Group P and edbfv in Group T increased, whereas RI value in Groups T and XK decreased. In conclusion, comparing baseline values, propofol anaesthesia did not significantly alter RI measured from CCA and kidney and blood flow velocities measured from AA. The data suggest that propofol anaesthesia in rabbits results in minimal changes in Doppler parameters. Keywords: Short-acting anaesthetic, Haemodynamic function, Doppler ultrasonography, Rabbit Özet Kısa-Etkili Anesteziklerin Tavşanlarda Hemodinamik Fonksiyonlara Etkilerinin Doppler Ultrasonografi ile Değerlendirilmesi Bu çalışma, kısa etkili anesteziklerin Doppler ultrasonografi ile saptanan hemodinamik fonksiyonlara etkilerini belirlemek amacıyla yürütüldü. Anestezi öncesi Yeni Zelanda tavşanlarının (n=24) sağ arteria carotis communis (CCA), aorta abdominalis (AA) ve sağ böbreğinden Doppler parametreleri [en yüksek sistolik kan akım hızı (psbfv), diyastol sonu kan akım hızı (edbfv), en düşük diyastolik kan akım hızı (mdbfv) ve rezistif indeks (RI)] elde edildi. Hayvanlar propofol (Grup P), %2.5 tiyopental sodyum (Grup T) ve ksilazin/ ketamin HCl (Grup XK) ile anestezi altına alınarak, üç grup oluşturuldu. Anestezi sırasında aynı ölçümler tekrarlandı. Bazal değerler ile karşılaştırıldığında CCA dan elde edilen psbfv Grup P de yükseldi ve Grup T ve XK daki değişim önemsizdi. Grup T ve XK da AA dan ölçülen psbfv bazal değerler ile kıyaslandığında azaldı. Sağ böbrekte, Grup P nin psbfv ve Grup T nin edbfv değerleri artarken, Grup T ve XK da RI değeri azaldı. Sonuç olarak, propofol anestezisi bazal parametreler ile karşılaştırıldığında, CCA deki RI, intrarenal RI ve AA daki kan akımı hızlarını önemli ölçüde değiştirmediği tespit edildi. Veriler propofol anestezisinin tavşanlarda Doppler parametrelerini minimal düzeyde etkilediğini göstermektedir. Anahtar sözcükler: Kısa-etkili anestezik, Hemodinamik fonksiyon, Doppler ultrasonografi, Tavşan İletişim (Correspondence)

34 74 Effects of Short-Acting Anaesthetics... INTRODUCTION Vascular Doppler ultrasonography (DU) is commonly employed in small animal medicine,2. Doppler ultrasonography provides real-time anatomic and dynamic vascular flow data, including peripheral vascular resistance 3, which makes identifying pathological changes possible 4,5. Vascular impedance data cannot be obtained from absolute velocity. Vascular resistance indices, such as resistive index (RI) and pulsative index (PI), have therefore been developed to enable the evaluation and comparison of Doppler wave forms 3. Blood flow is determined without sedation in human medicine. However, prior to imagining, sedation may be required for restraining in veterinary medicine because poor patient cooperation, high respiratory and heart rates and voluntary movement could interfere with the outcome, especially in cases that require detailed investigations such as abdominal vascular ultrasonography 2,6. Propofol is a unique non-barbiturate, non-steroid, short -acting general intravenous anaesthetic agent used to provide sedation and to induce and maintain anaesthesia 7. It is highly lipophilic and quickly metabolized, largely to inactive glucuronide conjugates. Thiopental was introduced into veterinary practice in 937. Over the next 7 years it has become the most widely used induction agent, particularly for cats and dogs 8. Alike propofol, thiopental is associated with a rapid smooth induction and a rapid recovery 9. Equivalent cardiovascular and respiratory effects are produced by both anaesthetic agents 8. The combination of ketamine - xylazine has also been used for several species for many years and is still popular for laboratory animal medicine. It is associated with a rapid onset, good or excellent sedation over -2 h, excellent analgesia lasting 5 to 3 min and a smooth recovery. Anaesthetic agents may also alter systemic and renal haemodynamics through affecting vascular resistance 2,3 in DU imaging. A combination of atropine, diazepam, acepromazine, and ketamine was shown to reduce the renal RI in healthy dogs 2. In cats, sedation with a combination of atropine, acepromazine, and ketamine did not alter the renal RI 4. However, anaesthesia with isofluorane increased both the renal RI and PI in cats 5. In the literature, there are no sufficient data from comparison of short-acting anaesthetic agents effects on DU parameters. This study was conducted to evaluate the effects of propofol, thiopental sodium and xylazine/ketamine anaesthesia, frequently used in veterinary medicine and experimental research, on blood flow velocities and resistive index values obtained from the common carotid artery (CCA), abdominal aorta (AA) and kidney using duplex DU in rabbits. MATERIAL and METHODS Animals, Management, and Experimental Groups Twenty-four male New Zealand White rabbits were used. Mean body weight was 3.8±.59 kg (mean ± SD) and age ranged between 4 and 27 weeks with a mean of 9±6 weeks. Animals were housed in individual cages on dust-free wood shavings in a room with temperature of 2-24 C and a 2:2 h light-dark cycle. The rabbits were fed a commercial pelleted diet and given water ad libitum. All animals were adapted to housing conditions for at least 7 days. After obtaining baseline Doppler parameters, rabbits were randomly divided into one of 3 groups: Group P (propofol, Pofol, Sandoz, Turkey), Group T (thiopental sodium, Pentothal, Abbott, Italy), and Group XK (xylazine/ketamine HCl, Rompun, Bayer, Germany; Ketasol, Interhas, Turkey). The experimental protocol was approved after Institutional Ethics Committee, and animals were handled in compliance with the Principles of Laboratory Animal Care. Anaesthesia and Ultrasonography Protocols Heart and respiratory rates were monitored before and during the anaesthesia provided by each agent. A venous catheter was inserted in the lateral ear vein. Animals in Groups P, T, and XK were anaesthetized with propofol (8 mg/kg ±.76, IV), 2.5% thiopental sodium (2 mg/kg ±.24, IV), and xylazine/ketamine HCl (4 mg/kg plus mg/kg, IV), respectively. The dosages were determined to achieve a stable and light level of anaesthesia, characterized by good muscle relaxation and hypnosis with stable baseline vascular variables. Anaesthesia lasted for 5 min. Before assigning rabbits into experimental groups, the ventral part of the cervical region and the right and ventral abdominal regions were shaved. After gel application, DU measurements of the right CCA were made in dorsal recumbence, whereas DU measurements of the AA and right kidney were made in lateral recumbence. Measurements made from CCA were peak-systolic blood flow velocity (psbfv), end-diastolic blood flow velocity (edbfv) and RI values; those made from AA were minimumdiastolic blood flow velocity (mdbfv), psbfv, edbfv; and those made from the arcuate artery and/or interlobar artery of the kidney were psbfv, edbfv and intrarenal RI value. The RI value was calculated using the equation: [(psbfv-edbfv)/psbfv]. The same DU measurements were obtained from the same locations while rabbits were under anaesthesia. A linear probe with a multifrequency feature (7.5- MHz) was used in DU (Esaote AU5, Genoa, Italy). High pulse repetition frequency was used during examination of the AA and right CCA. The probe was positioned over the ventral cervical region in order to measure the vascular

35 75 KAYA, PEKCAN, ŞEN BOZTOK, ŞENEL, BUMİN parameters of the right CCA. Doppler spectra were obtained on the transversal and longitudinal planes for right CCA. At examination of the AA, the probe was placed over the abdominal region at the caudal end of the thorax, where the pulsating aorta can be seen longitudinally just ventral to the vertebrae, to the left of and parallel to the adjacent caudal vena cava, touching each other. The probe position was adjusted until distinct parallel vessel walls of the AA and right CCA were visible. These vascular structures were then evaluated with colour DU. Gain and flow sensitivity measurement adjustments were maintained at the optimal level so as to fill the vessel lumen during systole but not to produce artifact in neighbouring tissues. The Doppler sample volume was placed centrally within the vessel and the sample volume cursor was adjusted to align with the vessel walls and blood flow. An angle between 45 and 6 was consistently achieved between the vessel and ultrasound beam. Once the sample volume had been correctly positioned, Doppler examinations were carried out in duplex Doppler mode. Recorded velocity spectra were assessed for quality by clarity of the visual and audible signals and then stored to measure psbfv, mdbfv and edbfv. The RI for CCA was derived from psbfv and edbfv. For renal DU, kidney morphology was evaluated at the dorsal and sagittal planes during ultrasonography. The wall filter and sample volume were maintained at a minimum level during renal DU. Measurements were taken at a 6 angle. Colour DU was used to visualize the intrarenal vasculature (arcuatae and interlobular arteries). Thus, spectral samples were obtained from one of these arteries using duplex Doppler. Doppler flow spectra recorded for analysis consisted of at least three consecutive similarpatterned wave forms. The mean intrarenal RI in the right kidney was determined by averaging nine Doppler waveforms from the interlobar or arcuate arteries at three separate locations (three waveforms at cranial, middle, and caudal poles) as previously described. Statistical Analysis Velocities, RI values, heart and respiratory rates differences between groups were analyzed using oneway ANOVA (SAS 999, User s Guide Statistics, Version 8, Statistical Analysis System, SAS Inst. Inc., Cary, USA). Data were presented as means with pooled SEM. Differences were considered significant at P<.5. RESULTS Heart and Respiratory Rates All anaesthetic agents produced a rapid and smooth induction of anaesthesia in all animals. These agents provided adequate hypnosis and relaxation for DU measurements. Heart and respiratory rates are presented in Table. Heart rate decreased in the Groups T and X/K (P<.2) but did not change in the Group P when compared with baseline values. Respiratory rate decreased during anaesthesia regardless of the agents (P<.). Flow Patterns Continuous forward flow was observed in the AA. Colour stemming from blood flow uniformly filled the lumen. Dark colour was observed inside the lumen at diastole, and during systole this turned into a bright colour indicating high velocity. Despite flow being constant in the right CCA, the colour in the lumen centre was lighter and brighter compared to that in the periphery close to the vascular wall. At sagittal imaging in the right kidney, good quality colouring was observed in the renal cortex and interlobar vascular structures. Following the administration of anaesthetics, no noteworthy change in color DU of the AA and right CCA and kidney was observed. The AA had a plug flow velocity profile and its waveform was a high-resistance flow pattern. It had a sharp systolic peak with a large and clear spectral window. The velocity distribution was narrow. The systolic peak was followed by a retrograde flow wave, followed by a forward flow wave (three-phasic flow wave) (Fig ). In the right CCA the systolic peaks were sharp without a clear spectral window. There were notable double systolic peaks. The systolic peak was not followed by retrograde wave (intermediate resistance flow pattern). In mid-diastole a forward flow wave with a higher velocity was visible. Then, flow velocity declined again (Fig 2). In intrarenal vessels, spectral wave forms had a blunted parabolic flow velocity profile. This continuous forward flow was a low resistance flow pattern. The systolic peaks were broader with a very small, closed spectral window. In conscious rabbits, there were early systolic peaks (Fig 3A), which continued in Group P but discontinued in Groups T and XK. End-diastolic blood flow velocity was clearly increased in Group T (Fig 3B). Table. Effect of different anaesthetics on heart and respiratory rates Tablo. Farklı anesteziklerin kalp ve solumun oranlarına etkisi Groups Variable B P T XK SEM P< Heart rate 234 a 247 a 63 b 79 b 3..2 Respiratory rate 72 a 42 b 37 b 38 b.2. B = Baseline value; P = Propofol; T = Thiopental sodium; XK = Xylazine HCl plus Ketamine HCl Different superscripts within the same row significantly differ (P<.5)

36 76 Effects of Short-Acting Anaesthetics... Blood Flow Velocities and Resistive Index Values Compared to baseline, psbfv in the right CCA increased in Group P (P<.2), whereas remained unchanged in Groups T and XK (Table 2). The RI value obtained from CCA however did not change in Group P, but decreased in Group T and XK (P<.). The edbfv value obtained from CCA was not affected by the anaesthetic agents. The psbfv obtained from AA decreased in Groups T and XK (P<.), whereas that in Group P did not change in comparison with baseline (Table 2). mdbfv and edbfv values measured from AA were comparable within the groups, but both did not change comparing with baseline. The psbfv value from the RK in Groups T and XK did not Fig. Duplex Doppler ultrasound image of the abdominal aorta, peak systolic blood flow velocity (psbfv), minimum diastolic blood flow velocity (mdbfv) and end-diastolic blood flow velocity (edbfv) in longitudinal plane. Plug flow velocity profile the systolic peaks (empty arrow) are sharp, and white arrow represent a clear spectral window. The systolic peak is followed by a retrograde flow wave (mdbfv) in early diastole with a high-resistance flow pattern and the retrograde flow wave is followed by a forward flow wave (white broken arrow) Şekil. Aorta abdominalisin duplex Doppler ultrasonografik görüntüsü, en yüksek sistolik kan akım hızı (psbfv), en düşük diyastolik kan akım hızı (mdbfv) ve diyastol sonu kan akım hızı (edbfv). Plug akım hız grafiğinde sistolik tepe (boş ok) keskin ve beyaz ok açık spektral pencereyi göstermektedir. Sistolik tepeyi yüksek dirençli akım örneğinde görülen erken diyastoldeki ters akım dalgası (mdbfv) takip etmekte ve ters akım dalgasını, ileri akım dalgası (beyaz kesik ok) izlemektedir Table 2. Effect of different anaesthetics on the Doppler parameters of the right common carotid artery (CCA), abdominal aorta (AA) and right kidney (RK) Tablo 2. Farklı anesteziklerin sağ ateria carotis communis (CCA), aorta abdominalis (AA) ve sağ böbreğin (RK) Doppler parametrelerine etkisi Variables 2 Groups SEM P< B P T XK CCA AA RK psbfv 3.6 b 42.3 a 26.4 b 3. b 3..2 edbfv RI.67 a.7 a.54 b.58 b.2. psbfv 49.3 a 5.7 a 27.4 b 32.4 b 3.6. mdbfv 7.4 ab.6 a 5.8 b 6.9 ab.2.7 edbfv 2.5 ab 5.6 a 9.5 b 9.4 b.6.4 psbfv 3. b 4.8 a 3.6 b 3. b edbfv 3.8 b 7.5 ab 2.9 a 6.3 ab 2..2 RI.54 a.58 a.34 c.45 b.3. B = Baseline values; P = Propofol; T = Thiopental sodium; XK = Xylazine HCl plus Ketamine HCl Different superscripts within the same row significantly differ (P<.5) 2 psbfv = peak-systolic blood flow velocity (cm/s); edbfv = end-diastolic blood flow velocity (cm/s); RI = resistive index; mdbfv = minimum-diastolic blood flow velocity (cm/s)

37 77 KAYA, PEKCAN, ŞEN BOZTOK, ŞENEL, BUMİN Fig 2. Duplex Doppler ultrasound image of the right common carotid artery, exhibiting peak systolic blood flow velocity (psbfv) and end-diastolic blood flow velocity (edbfv) in transversal plane. The systolic peaks are sharp. White arrow indicates second systolic peaks. The spectral window is closed. In mid-diastole a forward flow wave with a higher velocity (broken white arrow) is visible. The flow velocity then falls again Şekil 2. Transversal planda sağ arteria carotis communisin duplex Doppler ultrasonografik görüntüsü, en yüksek sistolik kan akım hızı (psbfv), en düşük diyastolik kan akım hızı (mdbfv). Sistolik tepe keskin bir şekilde sonlanmaktadır. Beyaz ok, ikinci sistolik tepeyi işaret etmektedir. Spektral pencere kapalıdır. Diyastolde hızın daha da yükselmesine bağlı olarak ileri akım dalgası (kesik beyaz ok) görülmektedir. Sonra akım hızının tekrar düştüğü izlenilmektedir Fig 3. Duplex Doppler ultrasound images of the right kidney, exhibiting peak systolic blood flow velocity (psbfv) and end-diastolic blood flow velocity (edbfv) in sagittal plane. A. In a consciouss rabbit low resistance flow pattern is indicated by continuous, broad systolic peaks and diastole with gradually decreasing edbfv. Early systolic peaks (ESPs, broken arrow) observed immediately before the systolic peak. B. Broading in psbfv and increased edbfv in a rabbit from Group T. Early systolic peaks are not apparent Şekil 3. Sagittal planda sağ böbreğin duplex Doppler ultrasonografik görüntüsü, en yüksek sistolik kan akım hızı (psbfv), diyastol sonu kan akım hızı (edbfv). A. Bilinçli bir tavşanda düşük dirençli akım örneği, devamlı, köşeli sistolik tepe ve dereceli olarak azalan edbfv diyastol ile görülmektedir. Sistolik tepeden hemen önce görülen erken sistolik tepeler (ESPs, kesik ok) izlenmektedir. B. Grup T deki bir tavşanda psbfv de kütleşme ve artmış edbfv görülmektedir. Erken sistolik tepeler izlenilmemektedir

38 78 Effects of Short-Acting Anaesthetics... change, whereas increased in Group P compared to baseline (Table 2). Only in Group T, edbfv value for kidney increased compared to baseline (P<.2). The intrarenal RI value in Group P remained unchanged and decreased in Groups T and XK, at a greater extent in Group T than Group XK (Table 2). DISCUSSION Doppler Ultrasonography is a non-invasive and accurate method for evaluating blood flow invariety of vessels 6. Percutaneous ultrasonographic examination allows immediate visualization of vascular effects in awake and anesthetized animals. It is also comparable with perivascular ultrasonographic flow probes as a non-invasive method 7. Anaesthetic agents may change systemic and renal haemodynamics and subsequently affect vascular resistance. Doppler flow technology using high-resolution vessel images combined with haemodynamic monitoring can provide extensive data on cardiovascular effects of drugs 8. Administration of propofol has limited effects on heart contractility 9, although it induces arterial hypotension primarily by reducing vascular tone and venous return 2 as well as producing peripheral vasodilatation 7. However, Nakamura et al. 2 demonstrated that clinically relevant concentrations of propofol did not have direct vasodilator effects. On the other hand, Baumgartner et al. 22 indicated that injections of propofol (8 mg/kg - ) to rabbits produced an immediate, transient vasodilatation, a significant decrease in ventricular performance and an increase in peripheral vascular resistance. These were accompanied by increases in psbfv and RI obtained from CCA and AA and by decrease in edbfv obtained from AA. Similarly, psbfv obtained from CCA in Group P increased as compared to both baseline and Groups T and XK (Table 2; P<.2). A correlation can be established between propofol increasing blood flow and peripheral vascular resistance in the CCA 7,22. In the present study, psbfv, edbfv and RI obtained from CCA increased during injection of propofol (Table 2). Calculation of the RI and PI permits indirect determination of changes in systemic vascular resistance within the distribution area of measured vessels 8. Increased arterial pressure not only increases the force that pushes blood through the vessels but simultaneously distends the vessels, resulting in lowered vascular resistance. This may also account for a slight elevation in RI obtained from CCA. However, increases in psbfv, mdbfv and edbfv obtained from AA in Group P were insignificant (Table 2). Despite the hypotensive and vasodilatory effects of propofol, which cause a decrease in velocity values, blood flow indices obtained from AA in Group P was minimally affected. It is known that the rapid intravenous injection of thiopental causes a decrease in blood pressure even in normovolemic animals. After an initial fall, the blood pressure returns to approximately the preanaesthetic level, albeit often with a persistent tachycardia. Thiopental seems to have a direct depressant effect on the myocardium and under certain circumstances may produce cardiac arrhythmias. Thiopental modifies the vasomotor response to increases in intrathoracic pressure (Valsalva manoeuvre). In the presence of thiopental, excessively vigorous controlled respiration will produce a fall in arterial pressure by increasing mean intrathoracic pressure. Induction doses of thiobarbiturates produce a central and peripheral cardiovascular depression, and consequently lower blood pressure 2. Administration of xylazine - ketamine results in large variations in cardiac function 23,24 and contractility 25. Combination of xylazineketamine (5 mg/kg - 35 mg/kg) also induces a drop of blood pressure, heart rate, and respiratory rate in rabbits 26. In a study involving rabbits the intravenous injection of xylazine-ketamine (.4 mg/kg - 4 mg/kg, IV) increased vessel diameter of CCA and AA and decreased mean volumetric flow in CCA 27. Although there was a change in RI value in CCA, psbfv obtained from AA decreased. In our study, psbfv obtained from right CCA in both Group T and Group XK did not change, but psbf obtained from AA decreased (P<.; Group T: 49%, Group XK: 34% (Table 2). This could be related to the negative effect of thiopental and ketamine-xylazine on volumetric blood flow and blood pressure. In comparison with baseline values, RI obtained from CCA exhibited a significant decrease in Groups T and XK (P<.). However, the changes in psbfv and edbfv obtained from CCA in Groups T and XK were insignificant (Table 2). Intrarenal RI is calculated from blood flow velocities in vessels during the cardiac cycle and reflects renal haemodynamics 28. This index is particularly useful in diagnosing and evaluating obstructive uropathy 29-3 and is correlated with renal disease severity 28. Intrarenal RI and heart rate are negatively correlated in humans 32. However, Novellas et al. 3 emphasized that some animals had a decreased heart rate during sedation, but relationship between renal RI and heart rate was not determined before or during sedation. No relationship was detected in our study. Although propofol has been reported to affect haemodynamics by negative inotropy and vasodilation, its effect on renal blood flow in healthy subjects is minimal 33,34. While propofol may reduce renal function, similar to other anaesthetic compounds, in healthy animals, the depression in renal blood flow appears to be less than that during anaesthesia induction using volatile anaesthetics 35. Although there was an increase in both psbfv (45%) and edbfv (27%) in Group P, intrarenal RI did not change in comparison with baseline values, suggesting that the haemodynamic effects of propofol anaesthesia in rabbits is not detrimental enough to alter intrarenal RI. Changes in psbfv were insignificant in

39 79 KAYA, PEKCAN, ŞEN BOZTOK, ŞENEL, BUMİN Groups T and XK, while the rise in edbfv in both groups was remarkable (Group T: 5%, Group XK: 2%). In Group T in particular, the significant increase in edbfv and broading in systolic peaks shows that thiopental may cause a less resistant flow in rabbits (Fig 3). In conclusion, while propofol induces no significant change in RI obtained from CCA and blood flow velocities obtained from AA and intrarenal RI, thiopental and xylazine/ketamine anaesthesia significantly reduced RI value obtained from CCA as well as intrarenal RI and psbfv and edbfv obtained from AA. The results of this study indicate that propofol has a minimal effect on Doppler parameters in anaesthesia/doppler procedures in rabbits. REFERENCES. Szatmari V, Sotonyi P, Vörös K: Normal duplex Doppler waveforms of the major abdominal blood vessels in dogs. A review. Vet Radiol Ultrasound, 42, 93-7, Riesen S, Schimd V, Gaschen L, Busato A, Lang J: Doppler measurement of splanchnic blood flow during digestion in unsedated normal dogs. Vet Radiol Ultrasound, 43, , Novellas R, Gopegui RR, Espada Y: Effects of sedation with midazolam and butorphanol on resistive and pulsatility indices in healthy dogs. Vet Radiol Ultrasound, 48, , Astrand H, Sandgren T, Ahlgren AR, Lanne T: Non-invasive ultrasound measurements of aortic intima-media thickness: implications for in vivo study of aortic wall stress. J Vascular Surg, 37, , Drelich-Zbroja A, Jargiello T, Szymanska A, Krzyzanowski W, El- Furah M, Szczerbo-Trojanowska M: The diagnostic value of levovist in Doppler imaging of visceral arteries in patients with abdominal angina before and after angioplasty. Eur J Ultrasound, 6, , Lee H, Chang D, Lee Y, Eom K, Choi H, Seo K, Choi M, Yoon J: Use of color Doppler imaging for determining the resistive index of the medial long posterior ciliary artery in clinically normal conscious dogs. Am J Vet Res, 63, 2-24, Hofmeister EH, Williams CO, Braun C, Moore PA: Propofol versus thiopental: Effects on peri-induction intraocular pressures in normal dogs. Vet Anaesth Analg, 35, , Hall LW, Clarke KM, Trim CM: General pharmacology of the injectable agents used in anaesthesia. In, Veterinary Anaesthesia. rd ed, pp WB Saunders Co VanNatta ME, Rex DK: Propofol alone titrated to deep sedation versus propofol in combination with opioids and/or benzodiazepines and titrated to moderate sedation for colonoscopy. Am J Gastroenterol, : , 26.. Difilippo SM, Norberg PJ, Suson UD, Savino AM, Reim DA: A comparison of xylazine and medetomidine in an anaesthetic combination in New Zealand white rabbits. Contemp Top Lab Anim Sci, 43, 32-34, 24.. Muir WW, Skarda RT, Milne DW: Evaluation of xylazine and ketamine hydrochloride anesthesia in horses. Am J Vet Res, 38, 95-2, Rivers BJ, Walter PA, Letourneau JG, Finlay DE, Ritenour ER, King VL, O Brien TD, Polzin DJ: Duplex Doppler estimation of resistive index in arcuate arteries of sedated, normal female dogs: Implications for use in the diagnosis of renal failure. J Am Anim Hosp Assoc, 33, 69-76, Lee SW, Hankes GH, Purohit RC, Bartels JE, Cartee RE, Pablo L, Conti JC: Comparative study of ultrasonography and arteriography of the carotid artery of xylazine-sedated and halothane-anesthetized goats. Am J Vet Res, 5, 9-3, Rivers BJ, Walter PA, O Brien TD, Polzin DJ: Duplex Doppler estimation of Pourcelot resistive index in arcuate arteries of sedated normal cats. J Vet Intern Med,, 28-33, Mitchell SK, Toal RL, Daniel GB, Rohrbach BW: Evaluation of renal hemodynamics in awake and isofluorane-anesthetized cats with pulsedwave Doppler and quantitative renal scintigraphy. Vet Radiol Ultrasound, 39, , Carroll B: Doppler sonographic imaging of the vascular system. Report of the ultrasonography task force. JAMA, 265, , Doursout MF, Joseph PM, Liang YY, Hartley CJ, Chelly JE: Role of propofol and its solvent, intralipid, in nitric oxide-induced peripheral vasodilatation in dogs. Br J Anaesth, 89, , Lin GS, Spratt RS: Hemodynamic imaging with pulsatility index and resistive index color Doppler US. Radiology, 24, , Bilotta F, Fiorani L, La RI, Spinelli F, Rosa G: Cardiovascular effects of intravenous propofol administered at two infusion rates: A transthoracic echocardiographic study. Anaesthesia, 56, 266-7, Rouby JJ, Andreev A, Leger P, Arthaud M, Landault C, Vicaut E, Maistre G, Eurin J, Gandjbackh I, Viars P: Peripheral vascular effects of thiopental and propofol in humans with artificial hearts. Anesthesiol, 75, 32-42, Nakamura K, Hatano Y, Hirakata H, Nishiwada M, Toda H, Mori K: Direct vasoconstrictor and vasodilator effects of propofol in isolated dog arteries. Br J Anaesth, 68, 93-97, Baumgartner C, Bollerhey M, Henke J, Wagner S, Ungerer M, Erhardt W: Effects of propofol on ultrasonic indicators of haemodynamic function in rabbits. Vet Anaesth Analg, 35, -2, Roth DM, Swaney JS, Dalton ND, Gilpin EA, Ross J: Impact of anesthesia on cardiac function during echocardiography in mice. Am J Physiol Heart Circ Physiol, 82, , Gao XM, Kiriazis H, Moore XL, Feng XH, Sheppard K, Dart A, Du XJ: Regression of pressure overload-induced left ventricular hypertrophy in mice. Am J Physiol Heart Circ Physiol, 288, , Xu Q, Ming Z, Dart AM, Du XJ. Optimizing dosage of ketamine and xylazine in murine echocardiography. Clin Exp Pharmacol Physiol, 34, , Sandford TD, Colby ED: Effects of xylazine and ketamine on blood pressure, heart rate, and respiratory rate in rabbits. Lab Anim Sci, 3, , Baumgartner C, Bollerhey M, Ebner J, Laacke-Singer L, Schuster T, Erhardt W: Effects of ketamine-xylazine intravenous bolus injection on cardiovascular function in rabbits. Can J Vet Res, 74, 2-28, Petersen LJ, Petersen JR, Talleruphuus U, Ladefoged SD, Mehlsen J, Jensen HA: The pulsatility index and the resistive index in renal arteries. Associations with long-term progression in chronic renal failure. Nephrol Dial Transplant, 2, , Kaya M, Bumin A, Şen Y, Alkan Z: Comparison of excretory urography, ultrasonography-guided percutaneous antegrade pyelography, and renal Doppler ultrasonography in rabbits with unilateral partial ureteral obstruction: An experimental study. Kafkas Univ Vet Fak Derg, 6, , Kırmızıgül AH, Kaya M, Bumin A, Kalınbacak A: Evaluation of resistive index parameter in peritoneal dialysis in dogs with experimental bilateral proximal ureteral obstruction. Kafkas Univ Vet Fak Derg, 3, 33-38, Platt JF, Rubin JM, Ellis JH: Distinction between obstructive and nonobstructive pyelocaliectasis with duplex Doppler sonography. Am J Roentgenol, 53, 997-, Mostbeck GH, Gössinger HD, Mallek R, Siostrzonek P, Schneider B, Tscholakoff D: Effect of heart rate on Doppler measurements of resistive index in renal arteries. Radiology, 75, 5-53, Mather LE, Selby DG, Runciman WB: Effects of propofol and of thiopentone anaesthesia on the regional kinetics of pethidine in the sheep. Br J Anaesth, 65, , Runciman WB, Mather LE, Selby DG: Cardiovascular effects of propofol and of thiopentone anaesthesia in the sheep. Br J Anaesth, 65, , Selby DG, Mather LE, Runciman WB: Effects of propofol and of thiopentone anaesthesia on the renal clearance of cefoxitin in the sheep. Br J Anaesth, 65, , 99.

40 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Etilen Glikol ile Direkt Transfer Metoduna Göre Dondurulan in vivo Sığır Embriyolarının Transferi Sedat Hamdi KIZIL * Numan AKYOL ** Tahir KARAŞAHİN * Muharrem SATILMIŞ * * Lalahan Hayvancılık Merkez Araştırma Enstitüsü, TR-6852 Ankara - TÜRKİYE ** Tarımsal Üretim ve Geliştirme Genel Müdürlüğü, TR-653 Ankara - TÜRKİYE Özet Bu çalışmanın amacı, etilen glikol direkt transfer metoduna göre dondurulan in vivo sığır embriyolarının taşıyıcı hayvanlara nakledilerek gebelik elde edilmesidir. Projenin ilk aşamasında; 56 adet iyi kalite in vitro üretim sığır embriyosu etilen glikol direkt transfer metoduna göre dondurulmuştur. Çözündürme sonrası TCM-99 +.mm β-merkaptoetanol + % fötal buzağı serumu (FCS) içeren solüsyon içerisinde, saat inkubasyonda, 36 adet embriyonun re-ekspansiyonu ve zonadan çıktığı görülmüş, canlılık oranı %64.28 olarak tespit edilmiştir. İkinci aşamada; süperovulasyon protokolü uygulanan kültür ırkı ineklerden 8 adet iyi kalite embriyo toplanmıştır. Embriyolar.8M etilen glikol +.M sakkaroz içeren %2 yeni doğmuş buzağı serumlu (CS) Dulbecco nun fosfat tampon solüsyonu (D-PBS) içerisine alınarak.25 ml lik steril payetlere çekilmiştir. Yerleştirme her bir payete bir embriyo olacak şekilde yapılmış ve payetler oda sıcaklığında 5 dk. ekilibrasyona bırakılmıştır. Programlanabilir dondurma cihazının, metil alkol bulunan haznesi içerisine payetler yerleştirilerek, -7 o C den itibaren soğutma işlemine başlanmıştır. -7 o C de 2 dk. sonra payetlere seeding yapılmış ve 8 dk aynı ısıda bekletilmiştir. Soğutma işlemine -3 o C ye kadar.3 o C/dak. düşürülecek şekilde devam edilmiş ve direkt -96 o C deki sıvı azot içerisine alınarak embriyolar muhafaza altına alınmıştır. Çözündürmede, sıvı azot içerisinden alınan payet önce 5-6 sn. havada tutulmuş, 3 o C deki su banyosunda sn. tutularak çözdürülmüştür. Önceden prostaglandin F2α ile senkronize edilen 8 baş taşıyıcı inekte kızgınlığının yedinci gününde rektal palpasyon ile korpus luteum (CL) tespiti yapılmıştır. CL tespit edilen taşıyıcılara, kriyoprotektan uzaklaştırılmadan embriyolar, cerrahi olmayan yöntemle, ipsilateral olarak nakledilmiştir. Nakil sonrası 6. günde taşıyıcı hayvanların rektal palpasyon ile yapılan gebelik kontrollerinde, 5 taşıyıcı hayvanın gebe olduğu tespit edilmiş ve gebelik oranı %62.5 olarak bulunmuştur. Gebeliklerin hepsi doğumla sonuçlanmıştır. Bu çalışmada, kriyoprotektan olarak etilen glikol ün sığır embriyolarının dondurulması ve direkt transferinde kullanılabileceği sonucuna varılmıştır. Anahtar sözcükler: Embriyo, Sığır, Etilen glikol, Direkt transfer Transfer of in vivo Embryos Frozen by Direct Transfer Method with Ethylene Glycol in Cattle Summary Makale Kodu (Article Code): KVFD The aim of this study was to be obtained pregnancy after the transfer of in vivo cattle embryos frozen by direct transfer method with ethylene glycol. First of all, 56 in vitro produced cow embryos of good quality were frozen by direct transfer method with ethylene glycol. After thawing, embryos were transferred into TCM mm β-mercaptoethanol + % foetal calf Serum (FCS) medium to check in vitro survival at h. The re-expansion and hatching rate of blastocysts was 64.28% (36 blastocysts). At the second stage; 8 good quality embryos were collected from superovulated culture breed cows. Embryos were equilibrated for 5 min in room temperature in.8m ethylene glycol +.M sucrose in dulbecco s phosphate buffered saline (D-PBS) supplemented with 2% newborn calf serum (CS). Embryos were then loaded individually into a.25 ml straw and placed directly into a cooling chamber of a programmable freezer with methyl alcohol precooled to -7 C. After 2 min, straw was seeded, maintained at -7 C for 8 min more, and then cooled to -3 C either at.3 C/min before being into liquid nitrogen. The frozen embryos were thawed by allowing the straw to stand in air for 5 to 6 sec and then immersing them in a 3 C water bath. Embryos frozen-thawed in the presence of EG were nonsurgically transferred into the uterine horn into the recipient without diluting the cryoprotectant. Synchronized recipient cows with prostaglandine F2α were received one embryo each in the horn ipsilateral to the corpus luteum (CL). Pregnancies were diagnosed by rectal palpation 6 days after embryo transfer. Eight frozen-thawed embryos were transferred directly to eight recipients and five recipients gave birth to five normal calves. The pregnancy rate was 62.5%. This result indicated that EG can be used effectively for cattle embryo freezing and transfer as a suitable cryoprotectant. Keywords: Embryo, Bovine, Ethylene glycol, Direct transfer İletişim (Correspondence) /232

41 722 Etilen Glikol ile Direkt... GİRİŞ Embriyolarının dondurulmasında, permeabl özellikteki; gliserol, dimetilsülfoksit (DMSO), propilen glikol (PG), etilen glikol (EG) ve asetamid ile permeabl olmayan; galaktoz, sakkaroz, ve trehaloz gibi sakkaritler ve makromolekül olarak da; polietilen glikol (PEG), Polivinilpirolidon (PVP), sığır serum albumini (BSA) ve Fikol 7 gibi kriyoprotektanlar kullanılmıştır. Orijinal yavaş dondurma ve çözündürme yöntemlerinin dahada kolaylaştırılması sonucunda embriyo muhafaza yöntemlerinde ilerlemeler sağlanmıştır 2. Fare embriyolarında, EG nin en az toksik olduğu, bunu sırasıyla; gliserol, DMSO, PG ve asematid in izlediği tespit edilmiştir. %4 EG ve %8 Fikol içeren vitrifikasyon solüsyonunda sakkaroz un bulunmasının toksik etkiyi azalttığı belirtilmiş, trehaloz, glukoz, fruktoz ve galaktoz gibi diğer bazı şekerlerinde aynı etkiyi gösterdiği vurgulanmıştır 3. EG nin, fare ve rat embriyolarını, dondurmanın zararlı etkisinden koruduğu ve diğer türlerin embriyolarında DMSO e göre daha yüksek canlılık oranı elde edildiği bildirilmiştir 4..5M EG,.5M PG,.5M DMSO ve.4m gliserol (GL) ile dondurulan in vivo embriyoların çözüm sonrası canlılık oranları sırasıyla; %7, %, %25 ve %3 olarak tespit edilmiştir 5. Embriyo nakli sonrası gebelik oranları; in vivo taze nakilde %7 6, düve ve ineklerde yapılan bir araştırmada sırasıyla, %56.5 ve %27.2 7, donmuş in vivo embriyo naklinde % , in vivo ve in vitro embriyoların taze naklinde sırasıyla, %64.8, %49.2 ve %9 EG ile direkt transfer donmuş nakilde, %59., % bulunmuş ve.3m metil cellosolve (MC) de; %48.3 ve %47.6 ve.8m EG de; %5. ve %63. olarak tespit edilmiştir. EG, MC, dietilen glikol (DEG) ve PG ile dondurulmuş embriyoların çözündürme sonrası, canlılık ve gebelik oranları sırasıyla, %5 ve %74, %53.6 ve %48, %56.9 ve %3, %58 ve %4 olarak bulunmuştur..5m EG direkt transfer dondurma yönteminde, yüzeysel pozisyon nakil sonrası gebelik oranları, derin pozisyonda elde edilenlerden 2 daha yüksek iken, EG direkt transfer yöntemi ile dondurulmuş ithal embriyolarda, deneme ve kontrol gruplarında sırasıyla, %5 ve % ve gliserolle dondurulmuş ithal in vivo embriyolarda ise %32.8 olduğu tespit edilmiştir 4. Bu çalışmada amaç; in vitro sığır embriyolarında, etilen glikol direkt transfer metodunun yapılabilirliğinin tespit edilmesi, in vivo sığır embriyolarında da uygulanabilirliğinin ortaya konulması ve ardından taşıyıcı hayvanlara suni tohumlama kolaylığında nakledilerek gebelik elde edilmesidir. MATERYAL ve METOT Proje iki aşamalı olarak gerçekleştirilmiştir. İlk aşamada, direkt transfer metodunun in vitro embriyolarda uygulanma şansı araştırılmış, ikinci aşamada ise anılan metodun in vivo embriyolarda da yapılabilirliği tespit edilmiş ve saha koşullarında taşıyıcı hayvanlara nakledilerek gebelikler tespit edilmiştir. İlk aşamada; mezbahadan getirilen ovaryumlardan, oosit kumulus kompleksleri, 2-8 mm çaplı folliküllerden aspire edilmiştir. Aspirasyon sonrası elde edilen oositler µl lik TCM-99 mikrodamlaları içerisinde 2-22 saat maturasyona tabi tutulmuştur. Bracket Oliphant (BO) mikrodamlaları içerisinde 5-6 saat fertilizasyon sonrası, µl lik Charles Rosencrans (CRaa) mikrodamlaları içerisinde yedi gün kültüre edilmiştir. Embriyolar önce, %.4 BSA + %2 yeni doğmuş buzağı serumu (CS) (ısı ile inaktive edilmiş) içeren D-PBS medyumununda içerisinde yeraldığı,.8m EG ve.m sakkaroz içeren dondurma solüsyonu ile birlikte payetlere çekilmiştir. Blastosist safhasında iyi kalitede embriyolar, Şekil de görüldüğü gibi her payete bir embriyo olacak şekilde yerleştirilmiş, açık payet ucu polivinil alkol ile kapatılmış ve oda sıcaklığında (25 o C de) 5 dk. da ekilibre edilmiştir. Solüsyonların ve embriyonun payet içerisindeki konumları aşağıdaki şekilde gösterilmiştir. Programlanabilir dondurma cihazının (CL59 Cryologic /Avustralya) metil alkol bulunan haznesi içerisine payetler yerleştirilerek, -7 o C den itibaren soğutma işlemine başlanmıştır. Aynı sıcaklık derecesinde 2 dk. bekleme sonrasında, payetlere pamuk tıkaca yakın olan kısımdan seeding yapılmış ve payetler 8dk. daha aynı sıcaklıkta bekletilmiştir. Soğutma işlemine -3 o C ye kadar.3 o C/dk. düşürülecek şekilde devam edilmiş ve sıvı azot (-96 o C) içerisine alınmıştır. Çözündürme işlemi için; payetler sıvı azot içerisinden alınmış, önce 5-6 sn. havada tutulmuş, 3 o C deki su banyosu içerisinde dondurma solüsyonunun sn. de tamamen çözünmesi beklenmiştir. Sonra payetin polivinil alkol ile kapalı ucu makas ile kesilmiş ve Şekil. Solüsyonların ve embriyonun payet içerisindeki konumları Fig. Solutions and embryo in straw

42 723 KIZIL, AKYOL KARAŞAHİN, SATILMIŞ çözündürme sonrasında embriyolar stereo mikroskop altında bulunduktan sonra, canlılıklarının kontrolü amacıyla %2 yeni doğmuş buzağı serumu (CS) içeren, D-PBS de yıkanarak TCM-99 +, mm β-merkaptoetanol + % fötal buzağı serumu (FCS) içeren kültür mikrodamlalar içerisine alınmıştır. %98 bağıl nem, %5 CO 2 ve 38.5 C sıcaklıktaki inkubatörde saat inkubasyona tabi tutulmuştur. Re-ekspanse olan ve zonadan çıkan embriyolar canlı olarak değerlendirilmiştir. Toplam olarak, 56 adet iyi kalite in vitro embriyo elde edilmiş ve Etilen glikol direkt transfer metoduna göre dondurulmuştur. İkinci aşamada; süperovulasyon uygulanan ineklerden, yedi günlük yaşta ve blastosist safhasında iyi kalite in vivo embriyolar elde edilmiştir. Bu embriyolar önce, %.4 BSA + %2 CS (ısı ile inaktive edilmiş) içeren D-PBS medyumunun da içerisinde yer aldığı dondurma solusyonu içerisine alınmıştır. İn vitro embriyolarda uygulanan dondurma ve çözündürme işleminin aynısı in vivo embriyolara da uygulanmıştır. Dondurulan embriyoların içerisinde bulunduğu payetler, çözündürüldükten sonra, önce temiz kağıt havlu ile kurulanmış ve ardından polivinil alkol ile kapalı olan uç temiz bir makas ile kesilmiş, pamuk tıkaç kısmı aşağıda olacak şekilde nakil kateterine yerleştirilerek, taşıyıcı hayvanlara nakledilmiştir. Nakil öncesinde, prostaglandin F2α ile sinkronize edilmiş taşıyıcı ineklere, rektal palpasyon ile kızgınlığın yedinci gününde CL tespiti yapılmıştır. CL tespit edilen taşıyıcı hayvanlara, nakil öncesinde üst epidural anestezi uygulanmıştır. Nakiller, ipsilateral olarak ve her bir taşıyıcıya sadece bir kez olacak şekilde ve çözüm sonrası 5 dk. içerisinde gerçekleştirilmiştir. Taşıyıcı olarak seksüel siklusu normal, sağlıklı 8 baş inek kullanılmıştır. Nakilleri takip eden 6. günde rektal palpasyon ile gebelik kontrolleri yapılmıştır. BULGULAR İn vitro üretilen, 56 adet iyi kalite inek embriyosunun dondurma çözündürme sonrası saatlik kültüründe, 36 adet embriyonun re-ekspanse ve zonadan çıkmış olduğu görülmüştür. Canlılık oranı %64.28 olarak tespit edilmiştir. Süperovule ineklerden elde edilen 8 adet embriyo, 8 adet taşıyıcı hayvana nakledilmiştir. Nakil sonrası 6. günde, taşıyıcı hayvanların rektal palpasyon ile yapılan gebelik kontrollerinde, 5 taşıyıcının gebe olduğu tespit edilmiştir. Gebelik oranı %62.5 olarak bulunmuştur. Gebeliklerin tamamı doğumla sonuçlanmıştır. TARTIŞMA ve SONUÇ İn vitro embriyolarda dondurma çözündürme sonrası elde etmiş olduğumuz %64.28 lik canlılık oranı sonucu, bazı araştırmacıların bildirdiklerinden yüksek ve bazı araştırmacıların bildirdiklerinden düşük 4,5 bulunmuştur. Elde edilen canlılık oranı, çalışmada uygulanan bu dondurma metodunun, dondurmaya karşı daha duyarlı olan in vitro üretim embriyolar için uygun olduğunu ve in vivo embriyolarda da uygulanabileceğinin göstergesi olmuştur. Dondurma çözündürme sonrası, in vivo embriyo naklinden elde etmiş olduğumuz %62.5 lik gebelik oranının, bazı araştırmacıların bildirdikleri oranlardan yüksek 3 bulunması, bu metodun in vivo sığır embriyolarında başarılı bir şekilde uygulanabileceğini ortaya koymuştur. Bazı araştırmacıların sonuçları ile uyumlu bulunması 9,,2,5,7-2, Etilen glikol direkt transfer metoduna göre in vivo embriyoların başarılı bir şekilde dondurulabileceğini ve çözüm sonrası taşıyıcılara nakilde, dünya literatürlerine uygun gebelik sonucu alınabileceğinin göstergesidir. Bazı araştırmacıların bildirdiklerinden düşük,6 olması ise, embriyo değerlendirilmesindeki subjektif ölçülerden, transfer sayısı ve dondurma metodu faklılıklarından kaynaklananabileceğini düşündürmektedir. Sonuç olarak; embriyo transferinin henüz yaygınlaşmadığı ülkemizde, düşük toksisiteye sahip bir kriyoprotektan olan etilen glikolün, sığır embriyolarının dondurulmasında kolaylıkla kullanılabileceği ve çözündürülmüş embriyoların saha koşullarında güvenle uygulanabileceği kanaatine varılmıştır. Çözündürme sonrasında, payet içerisinde embriyolar kriyoprotektandan uzaklaştırılmadan ve suni tohumlama kolaylığında taşıyıcı hayvanlara direkt nakledilebilecektir. Bu çalışma; başka araştırıcıların, bu konuda yapacakları çalışmalara katkı sağlayacaktır. KAYNAKLAR. Kasai M: Vitrification: Refined strategy for the cryopreservation of mammalian embryos. J Mamm Ova Res, 4, 7-28, Ohboshi S: Cryopreservation of mammalian embryos by vitrification. Anim Sci Tech, 69, 69-77, Kasai M: Simple and efficient methods for vitrification of mammalian embryos. Anim Reprod Sci, 42, 67-75, Miyamoto H, Ishibashi T: Survival of frozen-thawed mouse and rat embryos in the presence of ethylene glycol. J Reprod Fert, 5, Voelkel SA, Hu YX: Use of ethylene glycol as a cryoprotectant for bovine embryos allowing direct transfer of frozen-thawed embryos to recipient females. Theriogenology, 37, , Akyol N, Kızıl SH, Tuncer PB: İneklerde süperovulasyon ve embriyo transferi çalışmaları. Lalahan Hay Araşt Enst Derg, 44 (): -5, Köse M, Dursun Ş, Bülbül B, Kırbaş M: İsviçre Esmeri ineklerde FSH ile süperovulasyon ve embriyo transferi çalışmaları. Hayvancılık Araştırma Dergisi, 6 (): -6, Sungur H, Yurdaydın N: Sığır embriyosunun dondurulması ve transferi. Lalahan Hay Araşt Enst Derg, 34 (-2): -24, Riha J, Machatkova M, Pavlok A: Viability of fresh and frozen transferred IVP bovine embryos. Czech J Anim Sci, 47, , 22.. Sakakibara H, Takagi M, Yamamoto M, Ooe M, Suzuki T: Efficacy of methyl cellosolve as a cryoprotectant for cryopreservation of bovine embryos. J Reprod Dev, 42, 5-2, Suzuki T, Takagi M, Yamamoto M, Boediono A, Saha S, Sakakibara H, Oe M: Pregnancy rate and survival in culture of in vitro fertilized Bovine embryos frozen in varios cryoprotectants and thawed using a one step system. Theriogenology, 4, , 993.

43 724 Etilen Glikol ile Direkt Yamashina H: Pregnancy rates and uterine-horn positions for transfer of frozen-thawed bovine embryos. J Japan Vet Med Assoc, 55, , Bülbül B, Dursun Ş, Kırbaş M, Köse M, Ümütlü S: Düvelerde embriyo transferi öncesi flunixin meglumin uygulamasının gebelik oranı üzerine etkisi. Kafkas Univ Vet Fak Derg, 6 (): 5-9, Sungur H, Alaçam E, Tekeli T, Kadak R, Pakdil N, Whitager RO: İsviçre Esmeri düvelerde dondurulmuş embriyo nakli uygulamaları. Lalahan Hay Araşt Enst Derg, 29 (-4): 8-89, Dochi O, Imai K, Takakura H: Birth of calves after direct transfer of thawed bovine embryos stored frozen in ethylene glycol. Anim Reprod Sci, 38, 79-85, Yamashina H: Pregnancy or abortion rates and quality of frozenthawed bovine embryos imported from North America or Europe. Japanese J Large Anim Clinics, 25, -6, Wurth YA, Reinders JMC, Rall WF, Kruip T: Developmental potential of in vitro produced bovine embryos following cryopreservation and single-embryo transfer. Theriogenology, 42, , Lopatarova M, Cech S, Holy L, Dolezel R: The effect of vitrification in open pulled straws on pregnancy rates after transfer of in vivo produced bovine embryos. Vet Med, 5, , Dochi O, Yamamoto Y, Saga H, Yoshiba N, Kano N, Maeda J, Miyata K, Yamauchi A, Tominaga K, Oda Y, Nakashima T, Inohae S: Direct transfer of bovine embryos frozen-thawed in the presence of propylene glycol or ethylene glycol under on-farm conditions in an integrated embryo transfer program. Theriogenology, 49, 5-58, Martinez AG, Brogliatti GM, Valcarcel A, De Las Heras MA: Pregnancy rates after transfer of frozen bovine embryos a field trial. Theriogenology, 58, , 22.

44 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Determination of BMP-5, BMPR-B and GDF-9 Gene Mutations of the Indigenous Sheep Breeds in Turkey [] Feraye ESEN GÜRSEL * Iraz AKIŞ * Hanefi DURAK ** Ahmet MENGİ * Kemal ÖZTABAK * [] This study is supported by The Research Support Unit of Istanbul University as the Project number 2432 * İstanbul Üniversitesi Veteriner Fakültesi, Biyokimya Anabilim Dalı, TR-3432 Avcılar, İstanbul - TÜRKİYE ** Dicle Üniversitesi Veteriner Fakültesi, Biyokimya Anabilim Dalı, TR-228 Diyarbakır - TÜRKİYE Makale Kodu (Article Code): KVFD Summary The high ovulation rate and fertility are very important production traits in sheep production. The aim of the study was to determine the BMP-5, BMPR-B and GDF-9 gene mutations which are related with the high ovulation with high ovulation rate in Chios, Kivircik, Awassi and Imrose sheep breeds. Fifty sheep from each breed were provided for this study. Blood samples for all the animals were collected in sterile-2 ml tubes containing EDTA. Genomic DNAs were isolated using a standard salt-out method. Thereafter target sites were amplified with polymerase chain reaction (PCR). FecX I, FecX H, FecX G, FecX B mutations in BMP-5 gene, FecB mutation in BMPR-IB gene and FecG H mutation in GDF-9 gene were determined by restriction fragment length polymorphism (RFLP) method. All individuals were non-carriers for these mutations, except FecX G mutation in BMP-5 gene. The animals analyzed in this study were found to be heterozygous carriers for FecX G mutation. There may be other genes affecting fertility in Anatolian breeds. For the genetically explanation of multiple lambing, especially in Chios sheep, it was concluded that different genes should be investigated in the further studies. Keywords: BMP-5, BMPR-B, GDF-9, Mutation Türkiye deki Yerli Koyun Irklarında BMP-5, BMPR-IB ve GDF-9 Genlerindeki Mutasyonların Belirlenmesi Özet Koyun yetiştiriciliğinde çoklu gebelik yetiştiriciler tarafından geliştirilmesi istenilen bir özelliktir. Bu çalışmada Türkiye deki yerli ırk koyunlar arasında yer alan Sakız, Kıvırcık, İvesi ve İmroz ırkı koyunlarda çoklu gebeliği etkilediği ileri sürülen BMP-5, BMPR-B ve GDF-9 genlerindeki mutasyonlar araştırılması amacıyla yapılmıştır. Bu amaçla her bir ırktan birbiri ile akraba olmayan 5 adet hayvan kullanılmıştır. Tüm hayvanlarda kan toplanması vedna izolasyonun ardından, BMP-5, BMPR-IB ve GDF-9 genlerindeki hedef bölgeler polimeraz zincir reaksiyonu (PCR) ile çoğaltılmıştır. BMP-5 geninde yer alan FecX I FecX H FecX G FecX B mutasyonları, BMPR- IB geninde yer alan FecB mutasyonu ve GDF-9 geninde yer alan FecG H mutasyonuları restriksiyon parçacık uzunluğu polimorfizmi (restriction fragment length polymorphism- RFLP) metodu kullanılarak belirlenmiştir. Analizi yapılan tüm koyun ırklarında BMP- 5 geninde yer alan FecX I (AA), FecX H (AA), FecX B (BB), FecB (AA), mutasyonlarında genotipler homozigot bulunmuşken sadece FecX G (AB) ve GDF-9 geninde yer alan FecG H (AB) mutasyonlarındaki genotipler heterozigot bulunmuştur. Yapılan çalışmalarda heterozigot genotiple çoklu doğum arasında pozitif bir korelasyon olduğu ileri sürülmektedir. Ancak Sakız ırkı koyunların bir batıdaki ortalama doğum sayısı 2 ve üzeri olmasına karşın çalışmanın sonucunda bunun incelenen genlerdeki mutasyonlardan kaynaklanmadığı ileri sürülebilir. Daha sonra yapılacak çalışmalarda özellikle sakız ırkı koyunlarda çoklu doğumun genetik olarak açıklanması amacıyla farklı genlerin incelenmesinin gerekli olduğu sonucuna varılmıştır. Anahtar sözcükler: BMP-5, BMPR-B, GDF-9, Mutasyon İletişim (Correspondence) /726

45 726 Determination of BMP-5, BMPR-B... INTRODUCTION Many mammals such as goats and cattle have an ovulation rate of or sometimes 2 whereas others, including rats, mice, hamsters, cats, dogs and pigs have ovulation rates between 4 and 5. Sheep s physiological characteristics including ovulation rate and fecundity can vary greatly due to considerable variation among more than 9 different breeds. It has been known that different ovulation rates in sheep are originated from the effect of a gene group 2. Piper et al. 3 presented that the Booroola gene (FecB, Bone Morphogenetic Protein Receptor-B (BMPR-B), also known as Activin-like Kinase (ALK6), was the first major gene that increases the ovulation rate and litter size in the Booroola strain of Merino sheep 3. Since the first discovery of FecB gene, several genes affecting ovulation rate and litter size have been detected in sheep. Some of the most important of these genes are Growth Differentiation Factor 9 (GDF9) and Bone Morphogenetic Protein 5 (BMP5, also known as Growth Differentiation Factor 9B (GDF9B) genes 4. The Booroola gene (FecB) was the first major gene for prolificacy identified in sheep and it is located on chromosome 6 5,6. One copy of FecB increases ovulation rate by about.5 and two copies (homozygous carriers) increase by about 3 2. According to increased ovulation rates, these extra ovulations increase litter sizes about and.5 respectively. It has been shown that, effect of FecB is caused by a point mutation in position 83 leading to an arginine/glutamine transition (Q249R) in the bone morphogenetic protein B receptor (BMPR-B) expressed in oocytes and granulose cells 7,8. It has been known that BMP-5 is essential for female fertility and folliculogenesis in sheep. BMP-5 is a member of the transforming growth factor beta (TGFβ) superfamily which is specifically expressed in oocyte of the developing follicule 4,9. BMP-5 regulates granulose cell proliferation and differentiation by suppressing follicle-stimulating hormone receptor expression and promoting granulose cell mitosis and all these actions play significant roles in mammalian fertility. Previously, four various mutations were found (Inverdale, Hanna, Belclare and Galway) in the BMP-5 gene and they are located on the sheep X chromosome 9. Inverdale allele (FecX I ) corresponds to a T/A transition at position 896 in the cdna coding for the BMP-5. One copy of FecX I allele increases ovulation rate by about. and litter size by about.6 in heterozygous ewes 2,3. However, homozygous females have small non-functional ovaries and are infertile 4. The second mutation in the BMP 5 is FecX H mutation. Ovulation rate and litter sizes in heterozygous carriers and infertility of homozygous females are identical in Inverdale and Hanna families 5. Hanna allele (FecX H ) corresponds to a C/T transition at position 87 resulting in a premature stop codon at amino acid 23 of the mature protein 8 and this stop codon leads to a loss of bioactivity of the BMP- 5 protein. The other two mutations in BMP-5 are FecX G (Galway) and FecX B (Belclare) mutations. Galway allele corresponds to a C/T transition at nucleotide 78. FecX G mutation leads up to a premature stop codon at amino acid 239 of unprocessed protein thus no mature protein is produced 8,. Belclare allele corresponds to a G/T transition at nucleotide. Serine to isoleucine change occurs at amino acid 99 of the mature protein (S99I) in FecX B mutation. GDF9 (FecG H ) has been mapped on sheep chromosome 5 6. The gene consists of 2 exons seperated by 26 bp intron and encodes a propeptide containing 453 amino acid residues. The active mature peptide is 35 amino acids long 7. The GDF9 mutation is a C/T transition at position 84 of the cdna substituting a serine for a phenylalanine at position 77 of the mature protein (S77F) 4. Ovulation rates of heterozygous animals are 2 times greater than those of the wild-type animals. Homozygous animals for this mutation are anovulatory and sterile. However, ovarian follicles can be developed to an abnormal type 5 early antral stage, differing from the homozygous FecX carriers 8. This study is designed to define the mutations of BMB- B, BMP-5, GDF-9 genes which are suggested to be related to high ovulation rate in native sheep breed especially in Chios than, Kivircik, Awassi and Imrose sheep; thereby discovering the genetic features will make basis for studies which will be intended for the development of fecundity. MATERIAL and METHODS Animals and DNA Extraction In this study, a total 2 healthy, randomly chosen sheep of the indigenous Turkish sheep breeds were investigated; Kivircik sheep from four flocks (n=5), Chios sheep from three flocks (n=5), Imrose sheep from three flocks (n=5) and Awassi sheep from four flocks (n=5). Information from the breeder was considered in order to avoid family connections. Blood samples were taken into 2 ml sterilized tubes with EDTA from V. jugularis. Genomic DNA was isolated by standard salt-out method 8. PCR-RFLP Analysis The PCR for BMPR-B, BMP5 and GDF9 were carried out in a final volume of 25 µl containing U Taq DNA polymerase (Fermantas Life Sciences, Canada), µl XPCR buffer (75 mm Tris-HCl (ph 8.), 2 mm (NH 4 ) 2 SO 4,.% Tween 2),.5 mm MgCl 2, 5- ng genomic DNA, µm dntp (Takara, Biotechnology Co, Ltd, Japan) and pmol of each primer. After digestion with restriction enzymes, all products were separated by using electrophoresis in 2% agarose gel and visualized with ethidium bromide.

46 727 GÜRSEL, AKIŞ DURAK, MENGİ, ÖZTABAK BMPR-B (FecB) Genotyping The Primer sequences used for the FecB AvaII site: BMPR-B F CCA GAG GAC AAT AGC AAA GCA AA and BMPR-B R: CAA GAT GTT TTC ATG CCT CAT CAA CAC GGT C. Amplification program were 94 C for 5 min; 35 cycles of 94 C for 6 s, 58 C for 6 s, 72 C for 6 s; and a final extension at 72 C for min. The PCR products were digested with AvaII restriction enzyme (Fermantas Life Sciences, Canada) at 37 C for 6 h. After digestion, FecB mutation yield 6 and 3 bp fragments (BB) or non-carrier products remain uncut at 9 bp (AA). Heterozygotes should produce fragments of 9, 6 and 3 bp (AB). BMP-5 Genotyping The primer sequences, restriction enzymes and product lengths are described in Table. The non-carriers for FecX I, FecX H and FecX G mutations produce uncut products, whereas non-carriers for FecX B mutation reveal fragments of 22 and 3 bp. GDF9 (FecG H ) Genotyping The Primer sequence for the FecG H DdeI site: F: ATG GAT GAT GTT CTG CAC CAT GGT GTG AAC CTG A and R: CTT TAG TCA GCT GAA GTG GGA CAA C. Amplification program were 94 C for 5 min; 35 cycles of 94 C for 6 s, 58 C for 6 s, 72 C for 6 s; and a final extension at 72 C for min. The PCR product was digested with AvaII restriction enzyme (Fermantas Life Sciences, Canada) at 37 C for 6 h. Digestion of the 39 bp fragment in GDF-9 gene with DdeI restriction enzyme can reveal three genotypes. Homozygous carriers should produce an un-cut fragment of 39 bp (BB), the homozygous non-carriers should produce fragments of 8 and 3 bp (AA) and heterozygotes should produce fragments of 39, 8 and 3 bp (AB). Statistical Analyses The genotype and allele frequencies of BMB-B, BMP-5 and GDF-9 gene polymorphisms and G statistic test were used to determine whether the populations are in Hardy- Weinberg equilibrium using POPGENE32 software 9. RESULTS The distribution of allele and genotype frequencies of BMB-B, BMP-5 and GDF-9 genes for Kivircik, Chios, Imrose and Awassi breeds are given in Table 2. In this study, four point mutations in the BMP-5 gene have been investigated in indigenous Anatolian sheep breeds and animals for the FecX I, FecX H and FecX B Table. The primer sequences, restriction enzymes and product lengths of FecX I, FecX H, FecX G and FecX B mutations Tablo. FecX I, FecX H, FecX G ve FecX B mutasyonlarına ait Primer sekansları, restriksiyon enzimleri ve ürün uzunlukları Mutation Primers Enzyme Products FecX I FecX H FecX G FecX B F: GAAGTAACCAGTGTTCCCTCCACCCTTTTCT 24 and3 bp (BB) R: CATGATTGGGAGAATTGAGACC XbaI 54, 24 and 3 bp (AB) 54 bp(aa) non-carrier F: TATTTCAATGACACTCAGAG 28 and 22 bp (BB) R: GAGCAATGATCCAAGTGATCCCA SpeI 24, 28 and 22 bp (AB) 24 bp (AA) non-carrier F:CACTGTCTTCTTCTTCTTACTGTATTTCAATGAGAC 2 and 29 bp (BB) R.GATGCAATACTGCCTGCTTG HinfI 4,2 ve 29 bp (AB) 4 bp (AA) non-carrier F: GCCTTCCTGTGTCCCTTATAAGTATGTTCCCCTTA 22 and 3 bp(bb) non-carrier R: TTCTTGGGAAACCTGAGCTAGC DdeI 53,22 and 3 bp (AB) 53 bp (AA) Table 2. Genotype frequencies of polymorphisms in BMP-5, BMPR-B and GDF-9 genes in Anatolian sheep breeds Tablo2. Anadolu koyun ırklarında bulunan BMP-5, BMPR-B ve GDF-9 gen polimorfizmlerinin genotip frekansları Genotype Frequency Breed n FecX I (BMP-5) FecX H (BMP-5) FecX B (BMP-5) FecX G (BMP-5) FecB (BMPR-B) FecG H (GDF-9) AA AB BB AA AB BB AA AB BB AA AB BB AA AB BB AA AB BB Awassi 5 Chios 5 Imrose 5 Kivircik 5

47 728 Determination of BMP-5, BMPR-B... mutations were homozygous non-careers. Animals were found as heterozygous carrier for only FecX G mutation in the BMP-5 gene. Animals for the FecG H mutation in GDF-9 gene were determined to be heterozygous and non-career animals for FecB mutation in BMPR-B gene was found in the study. DISCUSSION The FecX G mutation in the BMP-5 gene was only observed in some of the Belclare, Cambridge, Garole, Kendapada and Small tailed Han sheeps in previous studies. This mutation leads to a premature stop codon occurs at residue 239 of proprotein. Animals homozygous for any of these four mutations are steril with extremely similar looking ovarian phenotypes because a block in folliculogenesis prevents follicles progressing past the primary stage 4,9. Ovulation rates are significantly higher in heterozygote animals due to the accelerated follicular development 4. Hanrahan et al. 4 reported the estimate for the effect of FecX G.77 and.8 in Belclare ewes and Cambridge ewes, respectively. For the FecG H mutation in GDF-9 gene all individuals from four breeds have been found to be heterozygous. These results reflected that none of the animals in this study carried the FecG H mutation, because in the presence of the mutation DdeI enzyme could not recognize the restriction site and the fragment remains uncut. The FecG H mutation in the GDF-9 gene was only observed in Belclare and Cambridge breeds. This point mutation resulted in a S77F transition in the mature region of GDF-9 protein. Ewes that have single copy of FecG H mutation, are fertile and they have increased ovulation rates according to the results of Hanrahan et al. 4. Ghaffari et al. 2 reported that 239 individuals from Shal breed were observed to be non-careers. Generally 2-35% twinning was detected in Shal flocks. They assumed that other genes identified in this breed may affect the fecundity. In this study, it was observed that only non-career animals for FecB mutation in BMPR-B gene and our findings for FecB mutation were similar with the results of Karslı and Balcıoğlu 2. One copy of FecB increases ovulation rate by about.5 and two copies (homozygous carriers) increase by about 3. Considering increasement of ovulation rates, these extra ovulations increase litter sizes about and.5 respectively 8. In an earlier study conducted on prolificacy of Awassi sheep in Israel, prolificacy values of non-carrier homozygote, heterozygote and carrier homozygote ewes was found to be.28,.9 and.92, respectively 22. The Anatolian breeds for this study had a disadvantage in terms of this mutation. The litter sizes of Kivircik, Imrose, Awassi and Chios breeds were found to be.-.3,.2-.38,.3-.4 and respectively 23. In this study, it was investigated six mutations in four Anatolian breeds. All of the individuals in the study were non-careers, except for FecX G mutation. These results showed that Kivircik, Imrose, Awassi and Chios breeds had an advantage for fertility due to heterozygosity for FecX G mutation. However, for other mutations there was no consistence between fertility rates and the frequencies of the mutated alleles. It was concluded that there may be different mutations significantly affecting fertility rates in Anatolian breeds. The genetic factors affecting fecundity should be investigated further by linkage analyses especially in Chios breed due to its higher twinning rates. REFERENCES. Terrill CE: The distribution of breeds as related to domestication and development of modern genotypes. In, Foote WC, Bunch DT (Eds): The Domestication of Sheep: Their Ancestors, Geography, Time Period and People Involved. Proceedings of A Workshop By The International Sheep and Goat Institude, 4-2, Utah State University, Logan, Davis GH: Major genes affecting ovulation rate in sheep. Genet Sel Evol, 37, S-S23, Piper, LR, Bindon BM, Davis GH: The single gene inheritance of the high litter size of the Booroola Merino. In, Land RB, Robinson DW (Eds): Genetics of Reproduction in Sheep. pp. 5-25, Butterworths, London, Hanrahan JP, Gregan SM, Mulsant P, Mullen M, Davis GH, Powell R, Galloway SM: Mutations in the genes for oocyte-derived growth factors GDF9 and BMP5 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biol Reprod, 7, 9-99, Montgomery GW, Lord EA, Penty JM, Dodds KG, Broad TE, Cambridge L, Sunden SL, Stone RT, Crawford AM: The Booroola fecundity (FecB) gene maps to sheep chromosome 6. Genomics, 22, 48-53, Mulsant P, Lecerf F, Fabre S, Schibler L, Monget P, Lanneluc I, Pisselet C, Riquet J, Monniaux D, Callebaut I, Cribiu E, Thimonier J, Teyssier J, Bodin L, Cognie Y, Chitour N, Elsen JM: Mutation in the bone morphogenetic protein receptor-ib is associated with increased ovulation rate in Booroola ewes. Proc Natl Acad Sci, 98, 54-59, Wilson T, Wu XY, Juengel JL, Ross IK, Lumsden JM, Lord EA, Dodds KG, Walling GA, McEwan JC, O Connell AR, McNatty KP, Montgomery GW: Highly prolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphogenetic protein IB receptor (ALK-6) that is expressed in both oocytes and granulosa cells. Biol Reprod, 64, , McNatty KP, Smith P, Moore LG, Reader K, Lun S, Hanrahan JP, Groome NP, Laitinen M, Ritvos O, Juengel JL: Oocyte-expressed genes affecting ovulation rate. Mol Cell Endocrinol, 234, 57-66, Galloway SM, McNatty KP, Cambridge LM, Laitinen MP, Juengel JL, Jokiranta TS, McLaren RJ, Luiro K, Dodds KG, Montgomery GW, Beattie AE, Davis GH, Ritvos O: Mutations in an oocyte-derived growth factor gene (BMP5) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat Genet, 25, , 2.. Chu MX, Liu ZH, Jiao CL, He YQ, Fang L, Ye SC, Chen GH, Yang JY: Mutations in BMPR-IB and BMP-5 genes are associated with litter size in small tailed Han sheep (Ovis areas). J Anim Sci, 85, , 27.. Fabre S, Pierre A, Mulsant P, Bodin L, DiPasquale E, Persani L, Monget P, Monniaux D: Regulation of ovulation rate in mammals: Contribution of sheep genetic models. Reprod Biol Endocrinol, 4, 2, Davis GH, McEwan JC, Fennessy PF, Dodds KG, Farquhar PA: Evidence for the presence of a major gene influencing ovulation rate on

48 729 GÜRSEL, AKIŞ DURAK, MENGİ, ÖZTABAK the X chromosome of sheep. Biol Reprod, 44, , Davis GH, McEwan JC, Fennessy PF, Dodds KG: Discovery of the Inverdale gene (FecX). Proc New Zealand Soc Anim Prod, 55, , Davis GH, McEwan JC, Fennessy PF, Dodds KG, McNatty KP, Wai-Sum O: Infertility due to bilateral ovarian hypoplasia in sheep homozygous (FecXI FecXI) for the Inverdale prolificacy gene located on the X chromosome. Biol Reprod, 46, , Davis GH, Bruce GD, Dodds KG: Ovulation rate and litter size of prolific Inverdale (FecXI) and Hanna (FecXH) sheep. Proc Assoc Adv Anim Breed Genet, 4, 75-78, Sadighi M, Bodensteiner KJ, Beattie AE, Galloway SM: Genetic mapping of ovine growth differentiation factor 9 (GDF9) to sheep chromosome 5. Anim Genet, 33 (3): , Bodensteiner KJ, Clay CM, Moeller CL, Sawyer HR: Molecular cloning of the ovine growth/ differentiation factor-9 gene and expression of growth/differentiation factor-9 in ovine and bovine ovaries. Biol Reprod, 6, , Miller LM, Paszek AA, Schook LB, Louis CF: Denser marker coverage provides greater evidence for carcass trait QTL on SSCP. Anim Genet, 29, 6-74, Yeh F, Yang RC, Boyle T: Popgene (v..32), Microsoft Windows-based freeware for Population Genetic Analysis. Retrieved from ualberta.ca/ fyeh/pop32.exe. 2, Accessed: Ghaffari M, Nejati-Javaremi A, Rahimi-Mianji G: Lack of polymorphism in the oocyte derived growth factor (GDF9) gene in the Shal breed of sheep. S Afr J Anim Sci, 39 (4): , Karslı T, Balcıoğlu MS: Türkiye de yetiştirilen altı yerli koyun ırkında BMPR-IB (Booroola) geninde FecB allel varlığının PCR-RFLP yöntemiyle araştırılması. Kafkas Univ Vet Fak Derg,6, 33-36, Gootwine E, Reicher S, Rozov A: Prolificacy and lamb survival at birth in Awassi and Assaf sheep carrying the FecB (Booroola) mutation. Anim Reprod Sci, 8, 42-4, Kaymakçı M, Sönmez R: İleri Koyun Yetiştiriciliği. s. 35, Meta Basım Matbaacılık Hizmetleri, İzmir, 26.

49 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Estimation of Partial Gas Production Times of Some Feedstuffs Used in Ruminant Nutrition Mustafa ŞAHİN * Fatih ÜÇKARDEŞ ** Önder CANBOLAT *** Adem KAMALAK * Ali İhsan ATALAY * * Department of Animal Science, Faculty of Agriculture, Sutcu Imam University, TR-46 Kahramanmaras - TURKEY ** Department of Animal Science, Faculty of Agriculture, Ordu University, TR-522 Ordu - TURKEY *** Department of Animal Science, Faculty of Agriculture, Uludag University, TR-659 Bursa - TURKEY Makale Kodu (Article Code): KVFD Summary The aim of this study was to determine the gas production kinetics of wheat straw, alfalfa hay and barley grain and estimate t25, t5, t75 and t95 using Y = A(-exp -ct ) exponential model. Gas productions were determined at, 3, 6, 2, 24, 48, 72 and 96 h incubation times. At all incubation times gas production of barley grain was significantly (P<.) higher than those of wheat straw and alfalfa hay. The in vitro gas production rate (c) and total gas production (A) of barley grain was significantly (P<.) higher than those of wheat straw and alfalfa hay. Time to produce 25, 5, 75 and 95% of total gas production (t25, t5, t75 and t95) of barley grain also were significantly (P<.) lower than those of wheat straw and alfalfa hay. As a result, in addition to the c and A, using Y = A(-exp - ct ) exponential model the estimation of t25, t5, t75 and t95 will provide more useful data to compare feedstuffs in terms of in vitro fermentation studies. Keywords: In vitro gas production, Partial gas production times, Wheat straw, Alfalfa hay, Barley grain Ruminant Beslemede Kullanılan Bazı Yemlerin Kısmi Gaz Üretim Zamanlarının Tahmini Özet Bu çalışmanın amacı, buğday samanı, yonca otu ve arpa danesinin gaz üretim kinetiklerini, t25, t5, t75 ve t95 gibi kısmi gaz üretim zamanlarını Y = A(-exp -ct ) üssel fonksiyonunu kullanarak belirlemektir. Gaz üretimi, 3, 6, 2, 24, 48, 72 ve 96 saatlerinde belirlenmiştir. Bütün inkübasyon zamanlarında arpa danesinden üretilen gaz miktarı, buğday samanı ve yonca otundan üretilen gazdan önemli (P<.) derecede daha fazla bulunmuştur. Arpa danesinin gaz üretim hızı (c) ve üretilen toplam gaz miktarı (A), buğday samanı ve yonca otunun gaz üretim hızlarından ve üretilen toplam gaz miktarından önemli (P<.) derecede daha fazla bulunmuştur. Arpa danesine ait kısmi gaz üretim zamanları (t25, t5, t75 ve t95), buğday samanı ve yonca otuna ait kısmi gaz üretim zamanlarından önemli (P<.) derecede daha düşük bulunmuştur. Sonuç olarak, c ve A parametrelerine ilave olarak, Y = A(-exp -ct ) üssel fonksiyonu kullanarak, kısmi gaz üretim zamanlarının (t25, t5, t75 ve t95) hesaplanması, yemlerin in vitro fermantasyon açısından karşılaştırılması için daha fazla ve yararlı datalar sağlamıştır. Anahtar sözcükler: İn vitro gaz üretimi,, Kısmi gaz üretim zamanları, Buğday samanı, Yonca otu, Arpa danesi INTRODUCTION Recently the in vitro gas production technique has been widely used to compare the ruminant feedstuffs. In this method the feedstuffs are subjected to fermentation in glass syringes or bottles with buffered rumen liquid. The gas produced during fermentation is determined at time intervals such as 3, 6, 2, 24, 48, 72 and 96 h. The gas production data at time intervals is fit to some mathematical models to obtain gas production kinetics such as gas production rate and extent. In addition to raw gas production data at time intervals, this gas production İletişim (Correspondence)

50 732 Estimation of Partial Gas... kinetics are widely used to compare the ruminant feedstuffs in terms of fermentation. (Y = a + b( - exp -ct ) and t y A - BQ t Z model are widely used to fit gas production data obtained at different time intervals using packet programs such as NEWAY, Graphpad, CurveExpert and Maximum Likelihood and FIG. P -6. Although (Y = a + b( - exp -ct ) exponential model was widely used to fit in situ degradation data it was suggested that the exponential model can be used to fit in vitro gas production data -3. However, recently many researchers have preferred to choose (Y = A( - exp -ct ) exponential model instead of (Y = a + b( - exp -ct ) model. a values should be zero when t is equal to. There is no gas production since the fermentation of sample is not started 7-. However, this is not the case in practice. Generally positive or negative a values were obtained when (Y = a + b( - exp -ct ) was used to fit the gas production data. Most of researchers have interpreted a values as gas production from the quickly soluble fraction of sample fermented. On the other hand, some researchers preferred t to use the y A - BQ t Z instead of the exponential model Since Maximum Likelihood packet program allow the calculation t 5 and t 95 when gas production data is fitted t to y A - BQ t Z model 5,2-4. However, so far, most of researchers who used the exponential model have ignored the calculation of some parameters such as time (h) to produce 5% of total gas production (t 5 ) and time (h) to produce 95% of total gas production (t 95 ) although they are very important parameters to compare the feedstuffs using in vitro gas production,4-6. So far, there is limited information about the calculation of the time (h) to produce %25, 5, 75 and 95 of total gas production (t 25, t 5, t 75 and t 95 respectively) when the exponential model is chosen to fit the gas production data. Therefore the aim of this study was to determine the gas production kinetics of wheat straw, alfalfa hay and barley grain and estimate t 25, t 5, t 75 and t 95 using (Y = A( - exp -ct ) exponential model. MATERIAL and METHODS In this experiment, total three feedstuffs (wheat straw, alfalfa hay and barley grain) which are the locally available and widely used feedstuffs in ruminant rations were chosen to obtain the gas production when they are subjected to fermentation in vitro. All chemical analyses were carried out in triplicate. Dry matter (DM) was determined by drying the samples at 5 o C overnight and ash by igniting the samples in muffle furnace at 525 o C for 8 h. Nitrogen (N) content was measured by the Kjeldahl method 7. CP was calculated as N X EE were determined by the method of 7. Neutral detergent fiber (NDF) content was determined by the method of Van Soest et al. 8. ADF and ADL contents were determined following the method of Van Soest 9. Wheat straw, alfalfa hay and barley grain samples milled through a mm sieve were incubated in vitro rumen fluid in calibrated glass syringes following the procedures of Menke et al. 2. Rumen fluid was obtained from.5-2 years old three fistulated kivircik sheep fed twice daily with a diet containing alfalfa hay (6%) and concentrate (4%). The water was given ad libitum. The sheep were kept in individual metabolic cages..2 gram dry weight of samples was weighed in triplicate into calibrated glass syringes of ml. The syringes were prewarmed at 39 o C before the injection of 3 ml rumen fluid-buffer mixture into each syringe followed by incubation in a water bath at 39 o C. Readings of gas production were recorded before incubation () and 3, 6, 2, 24, 48, 72 and 96 h after incubation 2. Total gas values were corrected for blank incubation. Cumulative gas production data were fitted to non-linear exponential model as: Y= A(-exp -ct ) Where Y is gas production at time t, A is the total gas production (ml/2 mg DM), c is the gas production rate constant (h ) and t is the incubation time (h). t 25 (time (h) to produce 25% of total gas production) was calculated as follows ct 25 Y A( exp ) 25 A A( exp A A ct ( exp ct 25 exp 25 ct exp ct 25 ln(.75) t 25 t 25 ln(.75) c.288 c ) ct 25 t 5, t 75, t 95 were estimated in a similar way, putting 5/, 75/ and 95/ values instead of 25/ in the equation mention above. The equations for t 5, t 75 and t 95 were given below:.693 t 5, c ).386 t 75, c t 95 c

51 733 ŞAHİN, ÜÇKARDEŞ CANBOLAT, KAMALAK, ATALAY One-way analysis of variance (ANOVA) was carried out to determine the effect of feedstuffs type on gas production and their kinetics using General Linear Model of Statistica for Windows. Significance between individual means was identified using Tukey s multiple range tests. Mean differences were considered significant at (P<.). Standard errors of means were calculated from the residual mean square in the analysis of variance. RESULTS The proximate chemical composition of wheat straw, alfalfa hay and barley grain are given in Table. There are considerable variations among feedstuffs in terms of chemical composition. The gas production at different time intervals is given in Fig.. At all incubation times gas production of barley grain was significantly higher than those of wheat straw and alfalfa hay. The gas production kinetics of wheat straw, alfalfa hay and barley grain is given in Table 2. There are significant (P<.) differences among feedstuffs in terms of gas production kinetics. The in vitro gas production rate and extent of barley grain was significantly (P<.) higher than those of wheat straw and alfalfa hay. The t 25, t 5, t 75 and t 95 of barley grain also were significantly higher than those of wheat straw and alfalfa hay. DISCUSSION As can be seen from Fig. at all incubation time gas production of barley grain was significantly higher than those of wheat straw and alfalfa hay possibly due to high fermentable carbohydrate content of barley grain. It is well known that gas production is associated with volatile fatty acid (VFA) production following fermentation of substrate so the more fermentation of a substrate the greater the gas production, although the fermentation end Table. Chemical composition of wheat straw, alfalfa hay and barley grain Tablo. Buğday samanı, yonca otu ve arpa danesinin kimyasal bileşimi Composition Feedstuffs (g/kg DM) WS AH BG SEM Sig. CP 3.3c 5.6a 2.b.227 *** Ash 6.5b 7.a 2.5c.7 *** EE 2.c 3.2c 2.3b.37 *** NDF 79.5a 44.b 7.8c.98 *** ADF 54.3a 33.3b.7c.555 *** ADL.a.2a.9b.66 *** a b c Row means with common superscripts do not differ (P>.5); s.e.m. - standard error mean; Sig. - significance level; CP - Crude protein, EE - Ether extract, NDF - Notral detergent fiber, ADF - Acid detergent fiber, ADL - Acid detergent fiber Gas production (ml) Fig. Gas production of wheat straw (WS), alfalfa hay (AH) and barley grain (BG) Şekil. Buğday samanı, yonca otu ve arpa danesinin gaz üretimi 2 WS AH BG Incubation time (h)

52 734 Estimation of Partial Gas... Table 2. Gas production parameters of wheat straw, alfalfa hay and barley grain Table 2. Buğday samanı, yonca otu ve arpa danesinin gaz üretim parametreleri Estimated Feedstuffs Parameters WS AH BG SEM Sig. c.8b.65c.96a.2 *** A 4.37c 66.95b 87.66a.66 *** t b 4.38a 3.c. *** t 5 8.6b.56a 7.24c.239 *** t b 2.a 4.47c.475 *** t b 45.65a 3.29c.28 *** a b c Row means with common superscripts do not differ (P>.5); s.e.m. - standard error mean; Sig. - significance level; c - gas production rate (%); A - potential gas production (ml); t - time (h) to produce 25% of total gas production; t time (h) to produce 5% of total gas production; t 75 - time(h) to produce 75% of total gas production; t 95 - time (h) to produce 95% of total gas production; *** P<. products do influence more closely with gas production 2. Differences between total gas productions could be explained by the differences in total VFA production and molar proportion of VFA 2. Generally the higher the gas productions rate the lower t 25, t 5, t 75 and t 95 will be obtained. The time (h) to produce a given gas production is positively correlated with gas production rate. As can be seen from Table 2 t 25, t 5, t 75 and t 95 of barley grain were significantly lower than those of wheat straw and alfalfa hay although barley grain had a significantly higher total gas production than those of wheat straw and alfalfa. The total gas production should be taken into consideration when feedstuffs are compared in terms of t 25, t 5, t 75 and t 95 values. As a result, in addition to the c and A, using (Y = A( - exp -ct ) exponential model the estimation of t 25, t 5, t 75 and t 95 will provide more useful data to compare feedstuffs in terms of in vitro fermentation studies. REFERENCES. Orskov ER, McDonald P: The estimation of protein degradability in the rumen from incubation measurements weighed according to rate of passage. J Agric Sci, 92, , Blummel M, Orskov ER: Comparison of an in vitro gas production and nylon bag degradability of roughages in predicting feed intake in cattle. Anim Feed Sci Technol, 4, 9-9, Getachew G, Blummel M, Makkar HPS, Becker K: In vitro gas measuring techniques for assessment of nutritional quality of feeds: A review. Anim Feed Sci Technol, 72, 26-28, Kamalak A, Canbolat O, Gürbüz Y, Ozay O, Özköse E: Chemical composition and its relationship to in vitro gas production of several tannin containing trees and shrub leaves. Asian-Austral J Anim Sci, 8 (2): 23-28, Theodorou MK, Willams BA, Dhanoa MS, McAllan AB, France J: A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim Feed Sci Technol, 48, 85-97, Kamalak A, Gürbüz Y, Finlayson JH: Comparison of in vitro dry matter degradation of four maize silages using the Menke gas production method. Turk J Vet Anim Sci, 26, 3-8, Kamalak A, Canbolat Ö, Özkan ÇÖ, Atalay Aİ: Effect of Thymol on in vitro gas production, digestibility and metabolizable energy content of alfalfa hay. Kafkas Univ Vet Fak Derg, 7 (2): 2-26, Larbi A, Duguma B, Mollet M, Smith JW, Akinlade A: Edible forage production, chemical composition, rumen degradation and gas production characteristics of Calliandra calothyrsus (Messin) provenances in the humid tropics of West Africa. Agroforest Syst, 39 (3): , Chaji M, Naserian AA, Valizadeh R, Mohammadabadi T, Mirzadeh KH: Potential use of high-temperature and low-temperature steam treatment, sodium hydroxide and an enzyme mixture for improving the nutritional value of sugarcane pith. S Afr J Anim Sci, 4 (): 22-32, 2.. Hervás G, Ranilla, MJ, Mantecón ÁR, Tejido ML, Frutos P: Comparison of sheep and red deer rumen fluids for assessing nutritive value of ruminant feedstuffs. J Sci Food Agric, 85 (4): , 25.. Mohammadabadi T, Chaji M, Tabatabaei S: The effect of tannic acid on in vitro gas production and rumen fermentation of sunflower meal. J Anim Vet Adv, 9 (2): , France J, Dhanoa MS, Theodorou MK, Lister SJ, Davies DR, Isaac D: A model to interpret gas accumulation profiles associated with in vitro degradation of ruminant feeds. J Theor Biol, 63, 99-, Lopez S, France J, Dhanoa SM, Mould F, Dijkstra J: Comparison of mathematical models to describe disappearance curves obtained using the polyester bag technique for incubating feeds in the rumen. J Anim Sci, 77, , Kamalak A, Canbolat O, Gürbüz Y, Erol A, Ozay O: Effect of maturity stage on chemical composition, in vitro and in situ dry matter degradation of tumbleweed hay (Gundelia tournetortii L.). Small Rum Res, 58, 49-56, Pell AN, Pitt ER, Doane HP, Schofield P: The development use and application of the gas production at Cornell university, USA. Brit Soc Anim Sci, 22, 45-54, Macheboeuf D, Milgen VJ: Comparison of five models used to describe gas accumulation profiles in the gas test method with horse caecal fluid as inoculum. in vitro techniques for measuring nutrient supply to ruminants. Brit Soc Anim Sci, 22, 85-86, AOAC: Official Method of Analysis. Association of Official Analytical Chemists. 5 th ed., pp.66-88, Washington, DC. USA Van Soest PJ, Robertson JD, Lewis BA: Methods for dietary fibre, neutral detergent fibre and non-starch polysaccharides in relation to animals nutrition. J Dairy Sci, 74, , Van Soest PJ: The use of detergents in the analysis of fibrous feeds. II. A rapid method for the determination of fiber and lignin. JAOAC, 46, , Menke KH, Raab L, Salewski A, Steingass H, Fritz D, Schneider W: The estimation of the digestibility and metabolizable energy content of ruminant feedingstuffs from the gas production when they are incubated with rumen liquor in vitro. J Agric Sci Camb, 93, , Beuvink JMW, Spoelstra SF: Interactions between substrate, fermentation end products, buffering systems and gas production upon fermentation of different carbohydrates by mixed rumen microorganisms in vitro. Appl Microbiol Biotechnol, 37, 55-59, 992.

53 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Alabalık (Oncorhynchus mykiss) Filetosundan Kroket Yapımı ve Kalite Niteliklerinin Belirlenmesi Nermin BERİK * Cem ÇANKIRILIGİL * Dilek KAHRAMAN * * Çanakkale Onsekiz Mart Üniversitesi, Su Ürünleri Fakültesi, Avlama ve İşleme Teknolojisi Bölümü, TR-7 Çanakkale - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada gökkuşağı alabalığı (Oncorhynchus mykiss) etinden kroket hazırlanmıştır. Elde edilen kroketlere besin değeri ve duyusal analizler uygulanmıştır. Besin bileşimine göre taze ette sırasıyla su, protein, yağ, kül ve karbohidrat miktarları %76.4, %5.7, %4.58, %2.5, %.8 olarak saptanmıştır. Kroket hamurunda %7.24, %2.3, %6.9, %4.43, %6.2 ve tüketilmeye hazır kızartılmış kroketlerde ise %62.64, %.38, %.87, %5.43, %.68 olarak bulunmuştur. Balık etindeki amino asitler başta glutamik asit g/ g olmak üzere; aspartik asit.736 g/ g, lizin.629 g/ g ve lösin.48 g/ g en yüksek düzeylerde bulunmuşlardır. Alabalık etinde saptanan esansiyel aminoasitler hammadde ve ürünlerde de tespit edilmiştir. Alabalık kroketlerinin duyusal analiz (genel beğeni) sonuçları 8. (çok iyi) bulunmuştur. Çalışmamız; yetiştirici, gıda üreticisi ve tüketicinin yararlanacağı veriler sunmaktadır. Bu durumda, alabalık kroketlerinin sektör ve ekonomiye katkı sağlayacağı öngörülmektedir. Anahtar sözcükler: Alabalık, Besin kompozisyonu, Protein, Balık kroketi, Amino asit Determination of Quality Attributes and Production of Fingers from Rainbow Trout (Oncorhynchus mykiss) Fillet Summary In this study, fish fingers from rainbow trout (Oncorhynchus mykiss) were prepared and analyzed for their nutritional composition and sensory properties. In the fresh meat, water, protein, lipid and ash compositions were 76.4%, 5.7%, 4.58%, 2.5% and.8% respectively. The nutritional composition of the fish fingers changed significantly during preparation: in the finger paste and fried fingers the water, protein, lipid, ash and carbohydrate contents were 7.24%, 2.3%, 6.9%, 4.43%, 6.2% and 62.64%,.38%,.87%, 5.43%,.68% respectively. Amino acids in fish meat were found in high levels, heading glutamic acid g/ g, aspartic acid.736 g/ g, lysine.629 g/ g and leucine.48 g/ g. Essential amino acids, which were determined in trout meat, were also stated in raw material and products. The results of trout fish fingers sensory analysis (general approval) were found 8. (very good). Our study presents data that breeder, food producer and consumer can benefit. In this situation, it is predicted that trout fish fingers will make contribution to sector and economy. Keywords: Trout, Proximate composition, Protein, Fish finger, Amino acid GİRİŞ Hazır gıdalar toplumun büyük kesimi tarafından tüketilmektedir. Ancak bu gıdalar genelde karbohidrat ve doymuş yağlar açısından zengindir. Bu durumun tüketici sağlığı bakımından uygun olmadığı; şişmanlık ve buna bağlı hastalıklara yol açtığı bilinmektedir -3. Hazır gıdaların sağlıklı besin özelliklerini taşımaları, lezzet ve görünümleri kadar önemlidir. Su ürünleri kaynaklı gıdaların üretiminin arttırılması gerekmektedir. Balık, hazır gıda ürünlerine dönüştürülebilecek iyi bir kaynaktır. Alabalık üretim miktarının fazla olması ürün devamlılığı açısından çok önemlidir. Türkiye de 29 yılında ton üretilerek yetiştiricilik yoluyla elde edilen balık üretiminde ilk sırayı almıştır 4. Türkiye de kişi başına düşen yıllık balık tüketiminin düşük olması 5 ve bu miktarın arttırılması büyük önem arz etmektedir. Su ürünleri tüketimini yaygınlaştırmak için beklentileri karşılayacak İletişim (Correspondence) /257

54 736 Alabalık (Oncorhynchus mykiss)... şekilde; tat, koku ve tekstürü değiştirilerek yeni ürünler elde etmek gerekmektedir 6. Bu amaçla kroket, pane, krakerler, nugget, köfte ve sucuk gibi ürünler oluşturulmuş; duyusal, kimyasal ve mikrobiyolojik kalite kriterleri incelenmiştir 7-2. Alabalık etinden bu çalışmaya benzer şekilde; balık köftesi 3, burger 4 ve sebze soslu kaplanmış alabalık 5 gibi ürünler elde edilmiştir. Kroket üretimi için ise sardalya (Sardina pilchardus), mezgit (Merlangius merlangus), sudak (Sander lucioperca), sazan (Carassius gibelio) ve aynalı sazan (Cyprinus carpio) balıkları kullanılmıştır 5-7. Farklı araştırmacılar, deneysel çalışma sonuçlarını paylaşmış olmalarına karşın; kaplanmış su ürünleri Türkiye de endüstriyel anlamda kabul görmemiştir. Ülkemizde su ürünleri genellikle taze tüketilmekte, çok az işlenmektedir. İşlenen ürünler ise büyük oranda dışsatım olarak değerlendirilmektedir 4. Özellikle son yıllarda kaplama ürünlere olan talep çoğalmış ve dışalım artmıştır. Bu çelişkiyi ortadan kaldırmak için çalışmaların arttırılması gerekmektedir. Bu bağlamda ürünlerin sektör bazında uygulanabilirliği; tüketicinin yanı sıra, büyük ölçekli üreticilerin de beklentilerine uygunluğu dikkate alınmalıdır. Çalışmalar amacına ulaştığında ise; sürdürülebilir balıkçılıkla beraber yetiştiricilik, gıda endüstrisi, tüketiciler gibi geniş kitlelerin çıkarlarını koruyacaktır. Bu çalışmada alabalık etinden üretilen kroketlerin fiziksel, kimyasal ve duyusal kalite nitelikleri belirlenmeye çalışılmıştır. MATERYAL ve METOT Materyal Sunulan çalışmada kullanılan kg Gökkuşağı alabalığı (Oncorhynchus mykiss) yerel bir balık çiftliğinden satın alınmıştır. Metot Balıklar beş saat içerisinde strafor kutuda ve yaprak buz kullanılarak, soğuk zincir koşullarına uygun şekilde laboratuvara getirilmişlerdir. Kroket yapımı ve analizler Su Ürünleri Fakültesi laboratuarlarında gerçekleştirilmiştir. Alabalıkların boy ve ağırlık ölçümleri yapılarak, derisiz filetoları alındıktan sonra et ve ürün verimleri (randıman) hesaplanmıştır. Hammadde ürüne dönüştürülmeden önce bir saat süreyle tuzlu buzlu suda bekletilmiştir. İlk aşamada, üç farklı formülasyonla kroket hamurları hazırlanmıştır. Ön denemelerde panelistler tarafından tercih edilen kroket hamurlarının formülasyonu Tablo de gösterilmiştir. İkinci aşamada, üç farklı formülasyonla ürünleri kaplamak için karışımlar (kroket kaplama) hazırlanmıştır. Deneme gruplarının içinden en tercih edilen formülasyon Tablo 2 de görülmektedir. Kroketlerin yapımında kullanılan akış şeması Şekil de gösterilmiştir. Çalışmada hammadde, Tablo. Alabalık kroketlerinin formülasyonu Table. Trout finger formulation Kroketin Bileşimi Miktar (%) Balık eti 7. Galeta unu 4.8 Buğday unu 4. Nişasta. Kaşar peynir 3.8 Soğan 4.73 Dereotu.73 Tuz.22 Karabiber.33 Beyaz biber.34 Kırmızı toz biber.42 Köri (çeşitli baharatlardan oluşan hazır karışım).2 Kişniş.22 Hindistan cevizi (coconut).22 Toplam Tablo 2. Kaplama karışımının formülasyonu Table 2. Battered mix formulation Kaplama Materyalinin Bileşimi Miktar (%) Yumurta beyazı 7. Yumurta sarısı 2.8 Buğday unu 8.38 Buğday nişastası 5. Tuz.22 Karbonat 2.5 Toplam kroket hamuru ve kızartılmış kroketlere; fiziksel, kimyasal ve duyusal analizler uygulanmıştır. Fiziksel Analizler Çalışmada kullanılan balık örneklerinin et verimi 8, ürün verimi 8 ve ph 9 ölçümleri yapılmıştır. Kimyasal Analizler Çalışmada balık, kroket hamuru ve kızartılmış kroket örneklerinde su 2, protein 2, amino asit 22, yağ 23 ve kül 2 miktarları saptanmıştır. Tüm analizler üç tekerrürlü olarak yürütülmüştür. Karbohidrat 24 miktarı matematiksel yöntem kullanılarak bulunmuştur. Duyusal Analizler Duyusal analizler on iki panelist tarafından gerçekleştirilmiştir. Panelistler 22-5 yaş aralığında, su ürünleri ve/veya gıda alanında uzman bireylerden oluşturulmuştur. Kızartılmış kroketler renk, koku, tat, görünüş ve genel beğeni başlıkları altında değerlendirilirken; 8-9 (çok iyi), 6-7

55 737 BERİK, ÇANKIRILIGİL KAHRAMAN Balıkların temizlenmesi ve derisiz filetoların çıkartılması Filetolara fırında ön pişirme işleminin uygulanması ( o C de dakika) Filetoların kıyma haline getirilmesi Kroket hamurunun oluşturulması Ürünlere şekil verilmesi Kaplama işlemi (yumurta, süt, maden suyu, un) Derin yağda ön kızartma işlemi (8 o C de 2 saniye) Duyusal analiz uygulaması Şekil. Alabalık kroket üretimi işlem akış şeması Fig. Flow chart of the trout fingers production process (iyi), 4-5 (orta), 2-3 (kötü), - (çok kötü) puan aralığındaki hedonik skala kullanılmıştır 25. İstatistiksel Analizler İstatistiksel analizlerde verilerin homojenliği test edildikten sonra (Levene) gruplar arasındaki farklılıklar tek yönlü ANOVA yöntemine göre belirlenmiştir 26. BULGULAR Çalışmada toplam kg gökkuşağı alabalığı kullanılmıştır. Elde edilen ürün g olup, ürün verimi %79 olarak hesaplanmıştır. Balıkların boyu 83 cm ile 6 cm arasında olup; ortalama 73.7 cm dir. Balıkların ağırlıkları g ile g arasında olup; ortalama g dır. Derisiz fileto edilen alabalıkların et verimi %55 olarak tespit edilmiştir. Kroket yapımında kullanılan çeşitli gıda maddelerinin eklenmesi, ürün verimini arttırmaktadır. Ürün elde etme aşamalarındaki ph ölçümleri sırasıyla; alabalık etinde 6.77±. kroket hamurunda 6.74±. ve kızartılmış kroketlerde 6.72±.2 olarak bulunmuştur. Çalışmamızda hammadde ve ürünlerde hidrojen iyon aktivitesinin, üretim aşamasında değişim göstermediği saptanmıştır (P>.5). Besin değeri analiz bulguları Tablo 3 te gösterilmektedir. Balık etinden kroket yapımı ve ısıl işlem aşaması sonrasında su oranlarında azalma; protein, yağ, kül ve karbohidrat oranlarında ise artış saptanmıştır (P<.5). Amino asit sonuçları ise Tablo 4 te gösterilmektedir. Genel olarak taze balık etinden hamura dönüşüm ve kızartma aşamalarından sonra aminoasit miktarlarında azalma görülmüştür (P<.5). Çalışmada alabalık kroketlerinde elde edilen duyusal analiz sonuçlarına göre (Tablo 5), kızartılmış kroketler çok iyi olarak değerlendirilmişlerdir. En yüksek puanları renk (8.±.7) ve genel beğeni (8.±.7) almıştır. Tablo 3. Alabalık eti, kroket hamuru ve kızartılmış kroketlerin besin değeri bulguları (%) Table 3. Nutrient analysis results of trout meat, finger paste and fried fingers (%) Ürün Parametreleri Su (%) Protein (%) Yağ (%) Kül (%) Karbohidrat (%) Alabalık Eti 76.4±.78 a 5.7±.2 a 4.58±.5 c 2.5±. c.8±.4 c K. Hamuru* 7.24±.6 b 2.3±.7 b 6.9±.2 b 4.43±.2 b 6.2±.23 b K. Kroket** 62.64±.5 c.38±.4 c.87±.4 a 5.43±.3 a.68±.7 a n = 3, ± standart hata. Aynı sütunda farklı harfler arasındaki farklar istatistiksel açıdan önemlidir (P<.5) * Kroket hamuru, ** Kızartılmış kroket

56 738 Alabalık (Oncorhynchus mykiss)... Tablo 4. Alabalık eti, ürün hamuru ve kızartılmış kroketlerin amino asit bulguları (g/ g) Table 4. Amino acid analysis results of trout meat, finger paste and fried fingers (g/ g) Amino Asitler Alabalık Eti Kroket Hamuru K. Kroket (Ürün) Aspartik asit.736±.6 a.39±.5 c.44±.7 b Asparjin <.7 <.7 <.7 Arjinin.66±.5 a.738±.3 b.698±.3 c Histidin.298±.2 a.27±.4 b.22±.4 c Lizin*.629±.2 a.±.5 c.±.4 b Lösin*.48±.5 a.49±.3 b.86±.5 c Valin*.89±.4 a.698±.3 b.682±.3 b Metiyonin*.72±.3 a.43±.4 b.43±.4 b Fenilalanin*.725±.2 a.72±.2 b.656±.2 c İzolösin*.724±.2 a.588±.4 b.55±.4 c Treonin*.769±.2 a.583±.2 b.546±.2 c Triptofan* <.22 <.22 <.22 Tirosin.52±.3 a.359±.4 b.285±.4 c Sistin.262±.2 a.238±.2 b.246±.2 b Alanin.46±.5 a.77±.2 b.722±.2 c Hidroksiprolin <.262 <.262 <.262 Ornitin <.33 <.33 <.33 Sarkosin <.22 <.22 <.22 Sitrulin <.8 <.8 <.8 Prolin.734±.2 b.898±.4 a.533±.2 c Glutamik asit 2.435±.5 b 2.88±.2 b 2.8±.2 c Glisin.788±.3 a.639±.2 b.585±.3 c Serin.736±.2 a.7±.3 b.62±.2 c Amino Asitlerin Toplamı n=3, ± standart hata. Aynı satırda farklı harfler arasındaki farklar istatistiksel açıdan önemlidir (P<.5) * Esansiyel amino asitler Tablo 5. Kızartılmış kroketlere uygulanan duyusal analiz bulguları Table 5. Sensory analysis which applies to fried fingers Ürün Renk Koku Tat Görünüş Genel Beğeni Kroket 8.±.7 7.7± ±.83 8.±.72 8.±.7 n=2, ± standart hata Puanlama: 8-9 çok iyi, 6-7 iyi, 4-5 orta, 2-3 kötü, - çok kötü TARTIŞMA ve SONUÇ Bazı çalışmalarda alabalıklarda et verimi, bulgularımızla uyumlu olarak; %52.7-%64.92 aralıklarında bildirilmiştir Balıklarda et veriminin yüksek olması özellikle ticari ürünlere dönüştürülürken önemlidir. Önceki çalışmalarda buz içerisindeki alabalıkta ph değerleri 6.39 ve 6.5 olarak bildirilmiştir 3,32. Çalışmamızda ise, hammaddenin ürüne dönüştürülmesi sırasında; ph değişikliği olup olmadığını saptamak amacıyla ölçümler yapılmıştır. Alabalıklarımız buz içerisinde temin edilmiş olup, ph bulguları literatüre uygundur. Sazanlarda yapılan bir çalışmada, taze balık etinde ph değerinin 6.48, kızartılmamış balık kroketinde ve kızartılmış krokette olduğu saptanmıştır 6. Bu sonuçlar, ürünlerdeki ph miktarının taze ete oranla fazla değişmediğini göstermektedir. Alabalıklarda yapılmış olan çalışmalarda filetoların besin değeri bulguları; su % , protein % , yağ % ve karbohidrat %.43 olarak bulunmuştur 32,33. Filetolarda elde ettiğimiz besin değeri bulgularının literatürlerle benzer olduğu görülmektedir. Diğer bir çalışmada ise alabalıktaki protein miktarının %26.75 kadar yüksek olduğu tespit edilmiş olup; balıkların protein miktarını yem içeriklerinin, çevre ve fizyolojik koşulların etkilediği bilinmektedir. Balık kroketlerinde elde edilen sonuçlara bakıldığında süpermarkette satılan Alaska

57 739 BERİK, ÇANKIRILIGİL KAHRAMAN pollock kroketlerinde su %78.39, protein %7.29, yağ %.48 ve kül %.5 oranlarında olduğu bildirilmektedir 34. Sazan balığı kroketlerinde su, protein, yağ ve kül miktarları sırasıyla %68.5, %5.5, %6. ve %2.2 olarak tespit edilmiştir 35. Farklı bir çalışmada su, protein, yağ, kül ve karbohidrat miktarları sırasıyla; sardalya kroketinde (%52.4, %4.39, %6.6, %2.6 ve %4.8), mezgit kroketinde (%63., %6.7, %5.98, %3.33 ve %.97) ve sudak kroketinde (%69.73, %4.28, %5.75, %2.75 ve %7.49) incelenmiştir 6. Çalışmamızda balık etinin yanı sıra kaşar peyniri, süt gibi ek gıdaların kullanılması nedeniyle protein ve yağ miktarında artış beklenmektedir. Bulgulara göre yağ miktarında artış, protein miktarında ise azalma olmuştur. Bu durum uygulanan işleme teknolojisi ve karışım üründeki karbohidrat ağırlıklı diğer malzemelerin, protein içerikli olanlara göre daha fazla olmasından kaynaklanmaktadır. Buğday, galeta unu ve nişasta ilaveleri ise karbohidrat miktarını arttırmıştır (Tablo 3). Araştırma bulgularımıza benzer olarak; sazan balıklarından yapılan kroketlerde su ve protein miktarının, balık etine kıyasla kızartılmamış ve kızartılmış kroketlerde azaldığı; buna karşın yağ ve kül miktarının arttığı gözlemlenmiştir 7. Aminoasitler lezzetten sorumlu aromatik bileşenlerdir 36. Su ürünlerinin biyolojik olarak değerli gıdalar olmalarının en önemli nedenlerinden birisi de içerdiği esansiyel amino asitlerdir. Bitkisel proteinler lisin ve metiyonin gibi esansiyel amino asitleri çok az miktarlarda içermektedir 37 ; bu nedenle sağlıklı beslenme için hayvansal protein alınması gereklidir. Alabalıklardan marinat yapılan bir çalışmada, etteki toplam amino asit miktarı yaklaşık 5 g/ g olarak saptanmıştır 38. Literatürde bildirilen alaalık etindeki amino asit bulguları çalışmamızla uyumludur 5. Çalışmamızda toplam amino asit miktarları alabalık etinde 6.5 g/ g, kroket hamurunda 4 g/ g ve kızartılmış kroketlerde 3.2 g/ g olarak bulunmuştur. Her grupta aspartik asit, lizin, lösin ve glutamik asit diğer aminoasitlerden daha fazla miktarda tespit edilmiştir. Araştırmamızda esansiyel aminoasitlerden lizin, lösin, valin, Treonin, izolösin, fenilalanin, metiyonin ve triptofan her üç grupta da tespit edilmiştir. İnsanlarda iki yaşına kadar esansiyel amino asit olan arjinin ve histidin de her üç grupta tespit edilmiştir. Alabalık etinde ve kroketlerde en fazla bulunan esansiyel amino asit lizin; kroket hamurunda ise lösin olduğu saptanmıştır (Tablo 4). Sazan kroketlerinde yapılan duyusal analiz bulgularına göre; renk, koku, tat ve genel beğeni özellikleri 8.75 olarak değerlendirilmiştir 35. Farklı bir çalışmada da sazan kroketlerinde genel beğeni 8.47 ortalama puanını almıştır 7. Mezgit, sardalya ve sudak kroketlerinde genel beğeni iyi olarak nitelendirilmiştir 6. Alabalık kroketlerinde elde ettiğimiz duyusal analiz değereri (Tablo 5), farklı araştırmacıların balık kroket çalışmalarında bildirdikleri gibi çok iyi bulunmuştur. Gökkuşağı alabalığından, tüketici beğenilerine uygun, kabul edilebilir kroketler üretilebileceği belirlenmiştir. Su ürünleri kaplama ürünlere çevrildiklerinde, daha fazla kişiye sevdirilerek; işlenmiş ürün tüketim alışkanlığı arttırılabilecektir. Bunun yanında, talep artışına bağlı olarak, dışalım ürünlerine kıyasla daha uygun fiyatlarla tüketiciye ulaştırılabileceklerdir. Gıda güvenliğine uygun olarak çalışan işletmelerde üretildiklerinde; halkın lezzetli ve aynı zamanda iyi kalitede gıda tüketmesine katkı sağlanacaktır. Bu tip ürünler sektörün talebine göre değişik ambalaj, soğuk muhafaza koşulları ve gıda tüzüğüne uygun koruyucu katkı maddeleri kullanılarak uzun raf ömürlerine sahip olacak şekilde üretilebilirler. KAYNAKLAR. Toprak İ, Şentürk Ş, Yüksel B, Özer H, Çakır B, Bideci AE: Toplumun beslenmede bilinçlendirilmesi, saha personeli için toplum beslenmesi programı eğitim materyali. İzmir, s. 49, Uskun E, Öztürk M, Kişioğlu AN, Kırbıyık S, Demirel R: İlköğretim öğrencilerinde obezite gelişimini etkileyen risk faktörleri. SDÜ Tıp Fak Derg, 2 (2): 9-25, Güleç M, Yabancı N, Göçgeldi E, Bakır B: Ankara da iki kız öğrenci yurdunda kalan öğrencilerin beslenme alışkanlıkları. Gülhane Tıp Dergisi, 5, 2-9, TUİK: Su ürünleri istatistikleri TUİK: Su ürünleri istatistikleri Çaklı S: Su Ürünleri İşleme Teknolojileri - 2. s. 6-62, Ege Üniversitesi Basımevi, Bornova, İzmir Yanar Y, Fenercioğlu H: The utilization of carp (Cyprinus carpio) flesh as fish ball. Turk J Vet Anim Sci, 23 (4): , Metin S, Erkan N, Varlık C: The application of hypoxanthine activity as a quality indicator of cold stored fish burgers. Turk J Vet Anim Sci, 26, , Akkuş Ö, Varlık C, Erkan N, Mol S: Determination of some quality parameters of fishballs prepared from raw and boiled fish. Turk J Vet Anim Sci, 28 (): 79-85, 24.. Rasco BA, Downey ES, Dong MF, Ostrander J: Consumer acceptability and color of deep-fried fish coated with wheat or corn distillers dried grains with solubles (DDGS). J Food Sci, 52 (6): 56-58, 26.. Boran M, Köse S: Storage properties of three types of fried whiting balls at refrigerated temperatures. Turk J Fish Aquatic Sci, 7 (): 65-7, Berik N, Kahraman D: Kefal balığı sucuklarında duyusal ve besin kompozisyonun belirlenmesi. Kafkas Univ Vet Fak Derg,6 (Suppl-A): S59-S63, Öksüztepe G, Çoban ÖE, Güran HŞ: Sodyum laktat ilavesinin taze gökkuşağı alabalığından (Oncorhynchus mykiss W.) yapılan köftelere etkisi. Kafkas Univ Vet Fak Derg, 6 (Suppl-A): S65-S72, Taşkaya L, Çaklı Ş, Kışla D, Kılınç B: Quality changes of fish burger from rainbow trout during refrigerated storage. Ege Univ Su Ürün Derg, 2 (-2): 47-54, Tokur B, Çaklı Ş, Polat A: The quality changes of trout (Oncorhynchus mykiss w., 792) with a vegetable topping during frozen storage (-8 C). Ege Univ Su Ürün Derg, 23 (3-4): , Çaklı Ş, Taşkaya L, Kışla D, Çelik U, Ataman CA, Cadun A, Kılınç B, Maleki RH: Production and quality of fish fingers from different fish species. Eur Food Res Technol, 22 (5-6): , İzci L: Utilization and quality of fish fingers from prussian carp (Carassius gibelio Bloch, 782). Pak Vet J, 3 (4): 27-2, Öztan A: Et Bilimi ve Teknolojisi. Genişletilmiş 4. Baskı. s. 2-3, TMMOB Gıda Mühendisleri Odası Yayınları, Kitaplar Serisi, Yayın No:, Ankara. 25.

58 74 Alabalık (Oncorhynchus mykiss) Landvogt A: Errors in ph measurement of meat and meat products by dilution effects. 37th International Congress of Meat Science and Technology, 8 (): 59-62, Hortwitz W: Official methods of analysis of aoac international (Oma). Washington: Association of Official Analytical Chemists, AOAC: Official Methods of Analysis. 7th ed., Vol II. Assoc. Off. Anal. Chem., Wash. D.C., USA Fleming J, Taylor T, Miller C, Woodward C: Analysis of complex mixtures of amino acids using the HP5 Modular HPLC. Application Note , Publication No E. Agilent Technologies Inc Palo Alto, CA, USA, Folch J, Lees M, Sladane-Stanley GHA: Simple method for the isolation and purification of total lipids from animal tissue. J Biol Chem, 226 (): , Keskin H: Gıda Kimyası. İstanbul Üniv Yay., Sayı: 98, Kimya Fak. No: 2, s. 46, Mason RL, Nottingham SM: Food 37 and Food 72, Sensory Evaluation Manual. The University of Queensland, Zar JH: Biostatistical analysis. Prentice-Hall, 4th ed., New Jersey, Korkmaz AŞ, Kırkağaç M: Tatlı suda beton havuzlarda ve denizde ağ kafeslerde yetiştirilen gökkuşağı alabalıklarının (Oncorhynchus mykiss) et verimi, vücut kompozisyonu ve enerji kapsamı. Ankara Üniv Ziraat Fak Tarım Bil Derg, 4 (4): 49-43, Rasmussen RS, Oenfeld TH: Effect of growth rate on quality traits and feed utilisation of rainbow trout (Oncorhynchus mykiss) and brook trout (Salvelinus fontinalis). Aquaculture, 84 (3-4): , Varlık C, Ugur M, Gökoglu N, Gun H: Su Ürünlerinde Kalite Kontrol İlke ve Yöntemleri, Gıda Teknol Dern, Ankara, Berik N: Kültür gökkuşağı alabalık (Oncorhynchus mykiss W., 792) filetosunun soğukta depolanması. Yüksek Lisans Tezi, İstanbul Üniv. Fen Bil. Enst., İstanbul, Rodríguez CJ, Besteiro I, Pascual C: Biochemical changes in freshwater rainbow trout (Oncorhynchus mykiss) during chilled storage. J Sci Food Agric, 79): , Uysal İ, Çaklı Ş, Çelik U: Kültür şartlarında extruder pelet yemle beslenen Abant Alabalığı (Salmo trutta abanticus T., 954) ile Gökkuşağı Alabalığı (Oncorhynchus mykiss W., 792) nın biyokimyasal komposizyonları. Ege Üniv Su Ürün Derg, 9 (3-4): , Ayas D: Gökkuşağı alabalığı (Oncorhyncus mykiss), hamsi (Engraulis encrasicolus) ve sardalya (Sardina pilchardus) nın sıcak tütsülenmesi sonrasındaki kimyasal kompozisyon oranlarındaki değişimleri. Ege Üniv Su Ürün Derg, 23 (/3): , Celik U, Cakli S, Taskaya L: The biochemical composition, physical and chemical quality control of frozen fishery product for consumption in a supermarket. Ege Üniv Su Ürün Derg, 9 (-2): 85-96, Tokur BS, Ozkütük EA, Ozyurt G, Ozyurt CE: Chemical and sensory quality changes of fish fingers, made from mirror carp (Cyprinus carpio L., 758) during frozen storage (-8ºC). Food Chem, 99 (2): , Ruiz-Capillas C, Moral A: Changes in free amino acids during chilled storage of hake (Merluccius merluccius l.) in controlled atmospheres and their use as a quality control index. Eur Food Res Technol, 22 (3): 32-37, Turan H, Kaya Y, Sönmez G: Balık etinin besin değeri ve insan sağlığındaki yeri. Ege Üniv Su Ürün Derg, 23 (-3): 55-58, Özden Ö: Changes in amino acid and fatty acid composition during shelf-life of marinated fish. J Sci Food Agric, 85 (2): 25-22, 25.

59 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE [] * Evaluation of Manure Management in Dairy Cattle Farms: The Case of İzmir - Tire (Turkey) Region [] İlkay ÖZTÜRK * Halil Baki ÜNAL * This study was prepared from MSc thesis and supported by Ege University Scientific Research Projects Commission (Project No: 28-ZRF-22) Ege University, Faculty of Agriculture, Department of Agricultural Structures and Irrigation, TR-35 Bornova/Izmir - TURKEY Makale Kodu (Article Code): KVFD Summary The objective of this research is to evaluate the current manure management systems in dairy cattle farms, which are the members of Tire Dairy Cooperative, in Tire-İzmir Region. In this context; characteristics of farms, manure management systems and their statistical interactions were determined. Also, methane emissions through manure management were estimated for two different approaches of Intergovernmental Panel on Climate Change (IPCC) and SWOT analyze for manure management in region was done. According to results of the research, it is noticed that farmers do not care about technical standards and legal regulations on planning the barn placement and storing the manure. It is determined that 74% of the examined farms use mechanization possibilities to collect the manure from paddocks. In 78% of the farms manure is stored as a bulk inside or outside of the farm, in 6% of the farms it is stored on paddocks and in 6% of the farms it is stored in a pit. In 99% of the farms, manure is used as fertilizer on fields without taking precautions for fermentation and also it is burned directly in % of the farms. Statistical analyses show that, manure collection and storage practices have significant interactions with farm characteristics while manure usage practices have no significant interactions with farm characteristics. Methane emissions for the region were calculated.2 Gg year- for the first approach and.3 Gg year- for the second approach. SWOT analyze shows that, manure management practices and infrastructure are better in big farms and the cooperative may make a significant contribution to usage of modern systems in the region. Keywords: Dairy cattle farms, Barn, Manure management, Methane emissions, Tire Özet Süt Sığırcılığı İşletmelerinde Gübre Yönetiminin Değerlendirilmesi: İzmir - Tire Yöresi Örneği Bu araştırmada, İzmir-Tire yöresinde kooperatife kayıtlı süt sığırcılığı işletmelerinde mevcut gübre yönetim sistemleri ve uygulamalarının değerlendirilmesi amaçlanmıştır. Bu kapsamda işletme özellikleri ile gübre yönetim sistemleri ve aralarındaki istatistiksel ilişkiler araştırılmıştır. Ayrıca gübre yönetiminden kaynaklanan metan gazı emisyon değerleri Hükümetler Arası İklim Değişikliği Paneli (IPCC) Rehberinde belirtilen iki ayrı yaklaşıma göre tahminlenmiş ve gübre yönetim uygulamalarına ilişkin GZFT analizi yapılmıştır. Araştırma sonuçlarına göre, işletmelerin ahır yeri seçimi ve gübre depolamada, teknik standartlar ve yasal düzenlemelerde belirtilen esaslara uymadığı anlaşılmıştır. İşletmelerin %74 ünde gübre toplamada mekanizasyon kullanıldığı belirlenmiştir. Gübrenin, işletmelerin %78 inde işletme içinde ya da dışında yığın halinde, %6 sında padoklarda ve %6 sında ayrı bir gübre çukurunda depolandığı anlaşılmıştır. Gübrenin, işletmelerin %99 unda olgunlaştırılması için gerekli önlemler alınmadan tarım arazilerinde kullanıldığı, % inde ise aynı zamanda yakacak olarak değerlendirildiği saptanmıştır. İşletme özelliklerinin gübre toplama ve depolama uygulamaları üzerinde istatistiksel açıdan önemli bir etkiye sahip olduğu, gübre değerlendirme uygulamaları üzerine etkisinin ise istatistiksel olarak önemli olmadığı belirlenmiştir. Araştırma alanındaki metan gazı emisyonu birinci yaklaşıma göre.2 Gg yıl-, ikinci yaklaşıma göre ise.3 Gg yıl- olarak belirlenmiştir. Yapılan GZFT analizi sonuçları yöredeki gübre yönetim altyapı ve uygulamalarının büyük kapasiteli işletmelerde daha iyi olduğunu, gübrenin biyokütle olarak değerlendirilmesine ilişkin modern uygulamaların gerçekleştirilmesinde kooperatif şeklindeki örgütlenmenin önemli bir katkı sağlayabileceğini göstermiştir. Anahtar sözcükler: Süt sığırcılığı işletmesi, Ahır, Gübre yönetimi, Metan emisyonu, Tire İletişim (Correspondence) /

60 742 Evaluation of Manure Management... INTRODUCTION The main aims of manure management in dairy cattle farms are to preserve the animals health, to reduce to minimum water and air pollution, to keep the spread of pests under control, to conform to current legislation, and to balance fixed investment, operation costs, work force and the use of feed -2. It has been stated that manure management cannot be standardized Europe-wide because of differences in such factors as housing, manure management practices and climate 3. Manure management practices in Europe and Asia have been the cause of serious environmental pollution, and the manure produced has not been used efficiently in the production of agricultural fertilizer or biogas 4. Morse Meyer et al. 5 have found that in farms in California too, manure management practices cause environmental pollution and that not enough use is made of the manure. In Turkey, the capacity of dairy cattle farms has risen in recent years, and the resultant increase in manure production has created a serious problem of environmental pollution. In order to solve this problem, it is necessary to apply the basic principles, technical standards and legal requirements relating to the choice of place of housing and manure management in dairy farming 6-. In addition, it is necessary to dispose of and recycle this animal manure in an environmentally acceptable way, including the use of biomass-energy systems 2-4. Methane gas emissions from animal production are estimated either by direct measurement techniques or by the use of various methods of estimation 5. Intergovernmental Panel on Climate Change (IPCC) has two tiers to estimate the methane emissions from manure management. Approach is a simplified approach that relies on default emission factors drawn from previous studies. The Approach approach is likely to be sufficient for most animal types in most countries. Approach 2 is a more complex approach that requires country-specific information on livestock characteristics and manure management practices. The Approach 2 approach is recommended when the data used to develop the default values do not correspond well with the country s livestock and manure management conditions. Because cattle characteristics vary significantly by country, it is recommended that countries with large cattle populations consider using the Approach 2 approach for estimating methane emissions from cattle and cattle manure 6. In Turkey, use of the first approach of the methodology proposed in the IPCC guidelines has been adopted due to lack of the specific data 7. Total methane gas emissions from manure management have been rising recently: they are stated to have reached Gg in 26, 78% of which is from cattle manure 8. Biomass, as well as being an economic and sustainable source of energy, can also help with the country s aim of reducing greenhouse gas emissions. The conversion of biomass in the production of biogas from manure is a common practice in the world today. In Asian countries like India and China, small biogas plants are in operation, while in countries such as Germany, Britain, the Netherlands and Denmark biogas plants with a larger production capacity are more widespread. These kinds of plants are set up either on large animal-rearing farms or in areas with intense animal husbandry 9,2. However, deficiencies in the technical and legal arrangements and a lack of information have resulted in Turkey still being at the development stage in bioenergy production 2,22. İzmir has approximately 3% of the cattle population of Aegean Region and in İzmir the biggest portion is belongs to Ödemiş (38%) and Tire (9%) districts relatively 23. It is of great importance in terms of providing a sustainable environment for research to be carried out on manure management practices and the resulting methane emission on the dairy farms existing in the area, and to determine the potential as biomass of the manure produced. In this study, a determination was made of manure management systems and their operation in the Tire district of Izmir province, which contains a significant share of the dairy farming industry of Turkey and which at the same time is organized into cooperatives. This included making an assessment based on the relative standards and legal provisions relating to infrastructure and practices regarding manure management on selected farms, their operational characteristics, manure management practices, and greenhouse gas emissions, and suggestions were made for enabling a sustainable environment. MATERIAL and METHODS The study was carried out on selected dairy cattle farms which were members of the Tire Dairy Cooperative in the Tire district of Izmir province. The number of farms was calculated as 65, with a 9% safety margin, from among the farms registered with the cooperative, on the basis of proportional sample volume 24,25. These farms were selected randomly. Characteristics of the farms (education level of the farm manager, year of establishment, the number of animals, housing type, system and location) and manure management practices (collection, storage and treatment) were determined in questionnaire and survey studies performed in 28. Statistical evaluation of the relationship between farm characteristics and manure management practices was performed using SPSS, descriptive statistics were calculated in determining distribution, and correlation analysis was performed to determine the relation between

61 743 ÖZTÜRK, ÜNAL manure management practices and farm characteristics. In comparing farm characteristics, the farms were grouped separately according to their animal numbers and the year of establishment. In addition, SWOT analysis was carried out with regard to manure management on the farms, determining the strengths, weaknesses, opportunities and threats involved in current manure management. The values of methane gas emissions arising from manure management on the farms were calculated using two different approaches set out in the guidelines of the Intergovernmental Panel on Climate Change 6,26. In the first approach, Annual Total Emission values (ATE st approach ) (Gg year - ) were calculated by means of Equation using regional location, climate and dairy cattle population data. YTE = EF. P. -6 () In the equation, EF is the emission factor (kg head - year - ) and was derived according to regional and climate data from tables in the guidelines. In the calculations, the Asian region and warm climatic conditions (average annual temperature C) were taken into account 27. P is the population of dairy cattle in the Tire area. This was taken as 2.3 head, based on data from According to the second approach, in which manure practices which were in use were taken into account, Annual Total Emission values (ATE 2nd approach ) (Gg year - ), were found by Equation using the specific emission factor (EF i ) for the region where the study was conducted. Values of EF i were found by means of Equation 2. EF VS.365. B i i o i.,67. ( jk ) MCF jk. MS ij (2) In Equation 2, index i indicates the animal type category, index j represents the manure management system category, and index k is the climatic system category. Thus, EF i is the annual emission factor for the type and population of animals (kg); VS i is the daily amount of volatile solid matter for the type of animals (kg head - day - ); Bo i is the maximum methane production capacity for manure per animal (m 3 kg - VS); MCF jk is the methane conversion factor for the various manure management systems in the climatic systems of the research area (%); and MS ijk is the animal fraction in the manure management systems in the climatic system of the research area (%). The parameters VS, B o and MS were determined from the relevant tables in accordance with average live weight of dairy cattle in the region, and MCF values from the relevant tables in the IPCC guidelines in accordance with manure management practices and climate conditions. RESULTS Characteristics of the Farms Fig. shows the distribution of the farms according to the characteristics which were examined. Only 4% of farm managers were educated to high school or university level, and 53% of the farms had been established in 99 or later. The number of animals on 7% of the farms was below 4 animal units. Most of the barns (%89) were of an open or semi-open type. The free system is used in 92% of these barns. When the location of the animal houses was examined, it was determined that on 63% of farms, animal housing and human habitation were together in the village, while Fig. Characteristics of farms Şekil. İşletmelerin özellikleri

62 744 Evaluation of Manure Management... on others animal and human housing was together outside the settlement, or human habitation was in the village and animal housing was away from human settlement. Manure Management Practices in the Research Area Fig. 2 shows the distribution of the farms according to their manure collection, storage and treatment practices. On 74% of farms, manure was removed mechanically from the barn (Fig. 2a) and in 78%; it was stored piled up on or off the farm (Fig. 2b). On 74% of these farms, the manure was piled up on the farm, and the distance between the dung heap and human dwelling was 25 m on average. On 5% of farms where manure was stored on the farm, it was found that manure was piled on the paddocks and was cleared out once a year. On farms where the manure was stored off the farm, it was determined that it was stored on fields belonging to the farm. On only 6% of farms have a manure pit in use (Fig. 2b). On these farms, the manure pits had a soil floor, were close by the exit of the barn and were open. On farms without a pit, manure was stored on the soil and uncovered. There were no modern manure management systems on the farms for efficient biomass production and conversion. The manure was used on 99% of the farms as fertilizer for crop-growing. It was determined that on % of the farms, the manure was also being used as fuel (Fig. 2c). Relationships between Farm Characteristics and Manure Management Practices Table shows the correlation analysis for the relationships between the manure management practices determined on the farms and the farm characteristics. A significant direct relationship at a level of % was found between manure storage method and farm manager s education level, or in other words, a high education level on the part of the farm manager meant the use of a manure pit on large farms. There was a significant relationship at a 5% level between the year of establishment of the farm and the method of manure storage; that is, pits were used on farms that had been established recently. Relationships were found at the % Fig 2. Distribution of farms according to manure management systems Şekil 2. İşletmelerin gübre yönetim uygulamalarına göre dağılımı Table. Correlation analysis results related to interactions between manure management practices and farm characteristics Tablo. İşletme özelikleri ile gübre yönetim uygulamaları arasındaki ilişkilere ait korelasyon analizi sonuçları Manure Management Practices Farm Characteristics Collection Storage Treatment The Number of Animals.43 **.299 * -.3 Education Level of The Farm Manager ** -.44 Year of Establishment *.6 Farm Location Housing Type.397 ** Housing System ** P<., * P<.5

63 745 ÖZTÜRK, ÜNAL level of significance between the size of the farm and the manure collection method, and at 5% with the storage method. A relationship at the level of % of significance was found between housing construction type and manure collection method (Table ). Emission Values of Methane Gas Arising from Manure Management on the Farms MCF and MS values used in calculating EF according to the second approach in the IPCC guidelines are given in Table 2, and EF and ATE values are given in Table 3. ATE second approach and ATE first approach were estimated as.3 Gg year - and.2 Gg year - respectively according to the various approaches to emission estimation (Table 3). Table 4 shows the strengths, weaknesses, opportunities and threats of manure management in the dairy farms in the study area. Table 2. MCF and MS values according to manure management systems Tablo 2. İşletmelerin gübre yönetim sistemlerine göre MCF ve MS değerleri Manure Management Systems Population for each of Manure Management System (%) MCF and MS Values From the IPCC Guide for Temperate Climate and the Region MCF and MS Values Determinated for the Research Area MCF (%) MS (%) MCF jk (%) MS ijk (%) Solid Storage Pit Storage (Solid) Daily Spread Pasture/Range/Paddock Burned for Fuel.. Total Table 3. EF and ATE values according to emission estimating approaches Tablo 3. Emisyon tahminleme yaklaşımlarına göre EF ve YTE değerleri Emission Estimating Approaches Parameters was Selected from the Related Tables in the Guide Parameters Determinated for the Research Area EF (kg head - year - ) YTE (Gg year - ) Second approach VS i (kg head - day - ) B oi (m 3 CH 4 kg VS - ) ΣMCF jk (%) ΣMS ijk (%) First approach Emission factor was selected from the related table in the Guide Table 4. SWOT analyze results related to manure management practices in the region Tablo 4. Araştırma alanındaki gübre yönetim uygulamalarına ilişkin GZFT analizi sonuçları Strengths The use of mechanisation is widespread in collecting manure in animal housing Manure is collected frequently from animal housing, so that the housing is clean Pits are used to store manure on larger farms Farm owners are willing to use modern manure management methods Farms are organised in a cooperative Opportunities As the trend to alternative energy sources increases, there will be a related increase in modern manure management practices The fact that cattle farming is widespread gives the necessary potential for modern manure exploitation practices The fact that cattle farms are grouped in an organisation encourages cooperative R&D work with the public and private sectors and with universities Financial support is available from the EU for research projects on developing manure management practices Weaknesses Farms are not large and the education level of farm owners is low. The farms infrastructure is inadequate for manure disposal Manure produced on the farms is not exploited as a source of income Manure produced on the farms is not used as modern biomass The necessary practices are not followed for the manure to mature Current manure management practices on farms have a detrimental effect on human health and the environment Threats The small size and the inadequate infrastructure of the farms and the low educational level of the owners has a negative effect on the application of modern management systems The fact that modern manure management systems are not in use on small farms prevents appropriate exploitation of the manure

64 746 Evaluation of Manure Management... DISCUSSION Manure Management on the Farms Compared with dairy farms in other parts of Turkey, the farms in the region under study are on a larger scale and are better in terms of the housing of the animals However, it was found that the manure management and infrastructure of dairy cattle farms in the Tire area is insufficient and does not conform to the relevant technical standards and regulations. Manure is not made use of efficiently in the area, and it constitutes a significant problem for human health and environmental pollution. Animal housing was closer to human dwellings than the distance recommended by the Minimum Distance Curve of the Ministry of the Environment and Forests (225 m for a farm with animal units) 35. Distance between the dung heap and human dwelling was determined to be inadequate for proper hygiene 7. On only 6% of farms have a manure pit in use and these pits had been constructed without taking into account such factors as capacity, distance from human dwellings, prevailing wind direction or rainfall, which are specified in the standards 7,35. On farms without a pit, manure was stored on the soil and uncovered and this method leads to unwanted results such as seepage of the runoff into the soil, disease, smell and flies. These problems are made worse by rainy weather. This can have a negative effect on the health of humans and animals, and on the hygiene of the surrounding area. The necessary procedures were not being followed to turn this manure into fertilizer that would be beneficial on the fields 36. In the Tire area as in other parts of Turkey, manure management practices and the lack of infrastructure are causing severe problems, and insufficient use is being made of the manure 3,3,34,37,38. Farms in the area are small and scattered, making the use of modern management systems difficult. On the other hand, it was seen that farm owners who were members of cooperatives were inclined towards the application of modern manure management systems. Statistical analyzes show that, in closed barns on small farms, generally no use was made of mechanization for manure collection. No statistical significant relationship was found between manure treatment system and any of the characteristics of the farms under study in the research area. Methane Emissions and Improvement of Manure Management in the Region ATE second approach and ATE first approach were estimated as.3 Gg.year - and.2 Gg.year - respectively according to the various approaches of IPCC to emission estimation. Although the climate and population data used in the two approaches was the same, the use of individual emission factors calculated for the existing manure management practices in the study area in the second approach caused methane gas emissions to come out lower in this approach. EF values in the first approach were taken as 6 kg.head -. year -. This value was determined for dairy cattle in a warm climatic zone in the Asian area of the IPCC guidelines, and is an average value taking in a wide area and a large population. As specified in IPCC Guide, when manure is stored or treated as a liquid (e.g., in lagoons, ponds, tanks, or pits), it tends to decompose anaerobically and produce a significant quantity of methane. When manure is handled as a solid (e.g., in stacks or pits) or when it is deposited on pastures and rangelands, it tends to decompose aerobically and little or no methane is produced. In the Guidelines, it is accepted that about half of cattle manure is used as fuel in the Asian area, and the rest is used in dry systems 6. However, it was found that in the study area, only % of cattle manure was being burned and 99% of manure was handling as other manure management practices (solid storage, pit storage (solid), daily spread, pasture/ range/paddock). For this reason, the emission value calculated according to the second approach, in which the population is taken into account, is seen to be lower than the value calculated by the first approach regarding manure management practices in the research area. This can be said to derive from the use of solid systems in the area which do not cause high emissions, and from the fact that manure is used less as a fuel than in the Asian region. However, the low estimated emission value do not shows that the current manure management systems are good for human and animal health and hygiene. In the same way, in studies by Gonzalez and Ruiz 39 in Mexican conditions, by Gupta et al. 4 in India and Gac et al. 4 in France, the emission factor for cattle according to the values recommended by the IPCC guidelines was considerably higher than the individual emission factor values determined for the study areas. This was said to arise from the values predicted in the first approach being determined according to manure management practices generalized for very wide areas. The results of SWOT analysis show that the small capacity of the farms in the region, the insufficiency of the infrastructure and the low education level of the farm owners hinder successful manure management, but that the current organization into cooperatives can contribute to developing and spreading modern manure management practices. In order to provide for an environmentally sensitive and successful manure management system in the dairy farms of the area which is not detrimental to human and animal health, there is a need for animal housing systems which enable mechanization and which conform to technical standards and legal provisions, and for manure pits

65 747 ÖZTÜRK, ÜNAL which are well-designed and do not leak. In addition, the establishment of large-capacity biogas plants to produce bioenergy and organic fertilizer would contribute to a reduction in greenhouse gases. In order to arrive at a truer estimate of Turkey s methane gas emission from manure management, it is necessary to take into account current manure management practices and the breeds of animal used, and to determine the area s particular emission factors according to the second approach of the IPCC. REFERENCES. MWPS: Dairy housing and equipment handbook, 4th ed. Midwest Plan Service, Ames Iowa, Field LY, Embleton KM: Livestock manure handling on the farm. EPA, Accessed: 24 January Menzi H: Manure management in Europe: Results of a recent survey, In, Venglovsky J, Greserova G (Eds): Proceedings of the th International Conference of the RAMIRAN Network, High Tatras, Slovak Republic, 93-2, May 4-8, Burton B, Martinez J: Contrasting the management of livestock manures in Europe with that practiced in Asia: What lessons can be learnt? Outlook on Agriculture, 37 (3): 95-2, Morse Meyer D, Garnett I, Guthrie JC: A Survey of dairy manure management practices in California. J Dairy Sci, 8, , TSE: Kümesler - Yer Seçimi ve Yapım Kuralları. Türk Standardı 468, Türk Standartları Enstitüsü, Ankara, TSE: Hayvan Barınakları - Gübrelik İnşa Kuralları, Türk Standardı 5244, Türk Standartları Enstitüsü, Ankara, TSE: Sığır Ahırları - İnşa Kuralları, Türk Standardı 5689, Türk Standartları Enstitüsü, Ankara, Çevre Bakanlığı: Hava Kalitesinin Korunması Yönetmeliği. Resmi Gazete, Sayı: 9269, Çevre ve Orman Bakanlığı: Tarımsal Kaynaklı Nitrat Kirliliğine Karşı Suların Korunması Yönetmeliği. Resmi Gazete, Sayı: 25377, 24.. Çevre ve Orman Bakanlığı: Çevresel Etki Değerlendirmesi Yönetmeliği. Resmi Gazete, Sayı: 26939, Çevre ve Orman Bakanlığı: Kümes ve ahır gübrelerinin geri kazanılması ve bertarafı. TÜBİTAK-MAM ESÇAE Proje Raporu, Çevre ve Orman Bakanlığı, Atık Yönetimi Daire Başkanlığı, Ankara, 27. Accessed: February Ünal HB, Yılmaz Hİ: Süt sığırı ahırlarının tasarımı. Tarım ve Köy İşleri Bakanlığı, Ege Tarımsal Araştırma Enstitüsü Müdürlüğü, Yayın No: 28, Menemen, İzmir, EEA: Waste (Turkey), soer/countries/tr/ soertopic_view?topic= waste. Accessed: 27 December Johnson KA, Johnson DE: Methane emissions from cattle. J Anim Sci. 73, , IPCC: Guidelines for National Greenhouse Gas Inventories: Reference Manual Accessed: 27 Jun Çevre ve Orman Bakanlığı: Sera Gazları Emisyon Envanteri Çalışma Grubu 26 Taslak Raporu. Çevre ve Orman Bakanlığı, Ankara, TÜİK: Sera Gazı Emisyon Envanteri. Türkiye İstatistik Kurumu, Ankara, 26. Accessed: 4 February Öztürk M: Hayvan gübresinden biogaz üretimi. T.C. Çevre ve Orman Bakanlığı, 25. biyogaz.htm. Accessed: 4 January Nielsen JBH, Popiel PO: The future of biogas in Europe: Visions and targets until 22. In, Europian Biogas Workshop: The Future of Biogas in Europe - III, Esbjerg, Denmark,4-6 June Balat M: Use of biomass sources for energy in Turkey and a view to biomass potential. Biomass and Bioenergy, 29, 32-4, Özgür MA: Review of Turkey s renewable energy potential. Renewable Energy, 33, , TÜİK: Hayvansal üretim istatistikleri. Türkiye İstatistik Kurumu, Ankara, 29. Accessed: 4 February Miran B: Temel İstatistik.. Baskı, Ege Üniversitesi Basımevi, İzmir, Newbold P: Statistics for Business and Economics. Prentice Hall International, New Jersey, IPCC: IPCC good practice guidance and uncertainty management in national greenhouse gas inventories, 2. or.jp/index.html. Accessed:27 Jun DMİ: Türkiye iklimi, Devlet Meteoroloji İşleri Genel Müdürlüğü, Ankara, Accessed: February Tarım Bakanlığı: Tarımsal Istatistikler. İzmir Tarım İl Müdürlüğü, İzmir, Accessed: May Armağan G, Koç A, Kızılkaya K: Ege Bölgesi nde süt sığırcılığı konusundayapılan araştırmalara ait bazı verilerin birleştirilmesi ile süt sığırcılığı işletmelerinde büyüklük gruplarının belirlenmesi. ADÜ Ziraat Fak Derg, (2): 2-26, Bakır G: Van İlindeki özel süt sığırcılığı işletmelerinin yapısal durumu. YYU Ziraat Fak Tarım Bilimleri Derg, 2 (2): -, Karaman S: Tokat yöresinde hayvan barınaklarından kaynaklanan çevre kirliliği ve çözüm olanakları. GOÜ Ziraat Fak Derg, 22 (2): 57-65, Soyak A, Soysal Mİ, Gürcan EK: Tekirdağ ili süt sığırcılığı işletmelerinin yapısal özellikleri ve bu işletmelerdeki siyah alaca süt sığırlarının çeşitli morfolojik özellikleri üzerine bir araştırma. Tekirdağ Ziraat Fak Derg, 4 (3): , Tugay A, Galip Bakır G: Giresun yöresindeki özel süt sığırcılığı işletmelerinin irk tercihleri ve barınakların yapısal durumu. 4uzbk.sdu.edu.tr/4UZBK/HYB/4UZBK_59.pdf. Accessed: 4 December Yaslıoğlu E, Arıcı İ: Bursa bölgesinde süt sığırcılığına uygun soğuk ahır tiplerinin geliştirilmesi üzerine bir araştırma. Tekirdağ Ziraat Fak Derg, 2 (2): 95-4, Çevre ve Orman Bakanlığı: Endüstri Tesislerinden Kaynaklanan Hava Kirliliğinin Kontrolü Yönetmeliği, Resmi Gazete Sayı: 26236, Anon: Organik gübreler ve önemi. makaleler/organik_gubreler_ve_onemi.htm. Accessed: 8 May Atılgan A, Erkan M, Saltuk B, Alagöz T: Akdeniz Bölgesi ndeki hayvancılık işletmelerinde gübrenin yarattığı çevre kirliliği. Ekoloji, 5 (58): -7, Önal AR, Özder M: Edirne ili damızlık sığır yetiştiricileri birliğine üye işletmelerin yapısal özellikleri. Tekirdağ Ziraat Fak Derg, 5 (2): 97-23, Gonzalez E, Ruiz RG: Methane emission factors from cattle manure in Mexico. Bioresource Technology, 8, 63-7, Gupta PK, Jha AK, Koul S, Sharma P, Pradhan V, Gupta V, Sharma C, Singh N: methane and nitrous oxide emission from bovine manure management practices in India, Environmental Pollution, 46, , Gac A, Béline F, Bioteau T, Maguet K: A French inventory of gaseous emissions (CH 4, N 2 O, NH 3 ) from livestock manure management using a mass-flow approach. Livestock Science, 2, , 27.

66 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Identification of Economic Incentives Directed Toward Food Safety Practices: The Case of Turkish Meat Processing Firms [] Ferit ÇOBANOĞLU * Ayşe Demet KARAMAN ** Renan TUNALIOĞLU * Gülden OVA *** [] This study was summarized from the project Food Safety Practices in Food Businesses in Aydın, ZRF-2, supported by the Scientific Research Project at Adnan Menderes University (ADU) * Adnan Menderes Üniversitesi, Ziraat Fakültesi, Tarım Ekonomisi Bölümü, TR-9 Aydın - TÜRKİYE ** Adnan Menderes Üniversitesi, Ziraat Fakültesi, Gıda Mühendisliği, TR-9 Aydın - TÜRKİYE *** Ege Üniversitesi, Mühendislik Fakültesi, Gıda Mühendisliği, TR-35 Bornova, İzmir - TÜRKİYE Makale Kodu (Article Code): KVFD Summary Food safety concepts have a major impact on food processing at the firm level. This study introduces economic incentives intended for food safety practices in meat processing plants in Aydin, western Turkey. Survey studies were employed using a whole count method with 26 meat processing firms, and questions were prepared for in-depth firm level interviews. The evaluations were accomplished on the basis of meat processing capacities per day:.-.5,.5-. and.-3. tones, classified as small, middle and large scale firms, respectively. Although many good practices were carried out in the plants, the never responses were found to be more prevalent in small scale enterprises. It was found to be necessary to stress more vigorous enforceable incentives for these businesses. Keywords: Food safety, Meat processing, Small scale firms, Good practices Gıda Güvenliği Uygulamalarına Yönelik Olarak Ekonomik Teşvik Edici Unsurların Tanımlanması: Türk Et İşleme Firmaları Örnek Olayı Özet Gıda güvenliği konseptleri, firma düzeyinde gıda işlenmesinde önemli bir etkiye sahiptir. Bu çalışma, Türkiye nin batısında yer alan Aydın ilindeki et işleme firmalarında, gıda güvenliği uygulamalarına yönelik olarak ekonomik teşvik edici unsurları tanımlamaktadır. Survey çalışması, tam sayım yöntemi kullanılarak, 26 et işleme firmasının tamamı ile görüşülerek yapılmış olup, sorular firma düzeyinde belirli bir derinlik ile hazırlanmıştır. Değerlendirmeler, günlük olarak gerçekleştirilen et işleme kapasiteleri esas alınarak yapılmıştır:.-.5,.5-. ve.-3. ton işleme kapasitesine sahip işletmeler sırasıyla, küçük, orta ve büyük ölçekli işletmeler olarak değerlendirilmiştir. İşletmelerde birçok iyi uygulama gerçekleştirilmesine rağmen, asla cevapları, küçük ölçekli işletmelerde daha yoğun olarak bulunmaktadır. Bu işletmeler için, daha fazla teşvik edici unsurların vurgulanmasının gerektiği tespit edilmiştir. Anahtar sözcükler: Gıda güvenliği, Et işleme, Küçük ölçekli firmalar, İyi uygulamalar INTRODUCTION Modern food safety policies came into being at the turn of the twentieth century in response to scandals in the meat packing and food processing industries. A second generation of policies is emerging now, also driven by scandals and crises of trust, including the early 99s E. coli O57:H7 outbreak in the United States and the BSE scandal of the late 99s in the United Kingdom. Behind the current crises lie economic and technological transformations in both food and the food supply system. Institutions are rushing to catch up with the implications these changes have for public health risks 2. On the supply side, food can be modeled as a quality-differentiated product in which safety is only one of several attributes produced 3. Safety, like its counterparts, has a shadow İletişim (Correspondence)

67 75 Identification of Economic... price. The degree to which the cost of producing safety is separable from the cost of producing other product attributes is an empirical question, but as a general rule, suppliers must invest resources to produce safety. The food economics literature identifies three elements that create incentives for firms to adopt enhanced food safety controls: (a) market forces, (b) food safety laws and regulation, and (c) product liability laws 4,5. In practice, all of these broad groups of incentives act to varying degrees to secure a safe food supply, although statutory food safety standards are used most frequently as the principal approach 6. It provides an excellent overview of theoretical literature on both supply and demand applicable to food safety economics 7. Overall, the existing literature suggests that the motivation for food businesses to implement enhanced food safety controls reflects the prior expectations of decision makers regarding the potential benefits and costs associated with adoption of specific practices, such as Hazard Analysis and Critical Control Point (HACCP) 8. In cases where business decision makers perceive high costs of implementation relative to the expected benefits, and where the hurdles associated with adoption are not easily overcome, there may be less motivation to implement enhanced food safety controls. In such cases, there may be a leading role for regulation. However, where regulatory and market-based inducements for the adoption of enhanced food safety controls are interconnected and operate side-by-side 9, it is important to understand the nature and magnitude of distinct public and firmlevel private incentives and the impact that government regulatory action has on these. More generally, there is a need for greater economic analysis of the entire set of incentives for food suppliers to implement enhanced food safety controls and how these vary, both individually and collectively, across firms and markets. There could be seen relatively insufficient research studies in Turkey on this issue. In a study, it was declared that in order to improve rabbit meat safety and prevent harms to public health, the control of contamination routes at production stage of rabbit meat was an important measure. For this purpose, it was recommended that food safety programmes focusing on a farm-to-table approach should be put in to practice in rabbit meat production. On the other hand, it was stressed that together with the increasing density of slaughter of the industrial meat enterprises in Turkey, it will be implemented more regular economic and hygienic practices 2. In a detailed study, it was indicated that directors and employees often had insufficient knowledge regarding the basics of food hygiene in Turkey. Their results indicated that proper food safety practices and prerequisite food safety programs for the HACCP were often not being followed in many food businesses 3. In another study, they identified the lack of knowledge about HACCP and other food safety programs as the main barriers for food safety in food businesses. Training programs, both in basic food safety and HACCP, were suggested to support implementation of prerequisite programs and HACCP in food businesses 4. However, their assessments consisted of hospital food services, catering establishments, hotels, kebab houses, takeaways and restaurants, and did not include meat processing firms. In particular this study explores the lack of sufficient and detailed information of food safety on the part of the meat plants. The purpose of this paper is to investigate the set of economic incentives directed toward the meat processing businesses for food safety practices and the ways in which these vary according to the company implementations. The Turkish meat processing firms served as a case study, because there has been no previous detailed study conducted in this area. MATERIAL and METHODS The first group contains the statistics, including the total number, addresses and the relevant documents of chicken and red meat processing firms in the Aydin region, which were obtained from the Aydin Provincial Agricultural Directorate (APAD). The second group is composed of data that was directly collected by surveys from the managers of the meat processing companies. The interviews were performed during April-June in 2. The third group s data consists of the related published materials on an international level. In this study the meat and meat product companies located in Aydin were investigated. This province is situated in the western part of Turkey, and it has critical value in both meat and meat product processing. From April to July 2, 26 meat processing companies, all of the meat product enterprises in Aydin, were visited and data were collected via surveys by the whole count method. The locations of the firms carried out in the survey study in the Aydin region were Center (2), Nazilli (3), Incirliova (3), Kuyucak (2), Kusadasi (2), Germencik (), Soke (), Cine (), and Didim (). Firstly, the grouping of the facilities was based on the real meat processing capacity. The evaluations were established on the basis of meat processing quantities per day:.-.5,.5-. and.-3. tones, classified as small, middle and large scale firms, respectively. The study focused on the perceptions and attitudes of managers regarding food safety and key barriers and economic incentives in the preprocessing, processing and after processing stages. The five-point Likert scale was engaged in the determination of frequency and attitudes, and an ordinal measurement system increasing from to 5 was employed. A five-point Likert scale 5, in which was set as highly inferior and 5 highly superior was applied to collect data. An increase in Likert scale averages means that there is greater adherence to sustainability as well as more compatible

68 75 ÇOBANOĞLU, KARAMAN TUNALIOĞLU, OVA attitudes 6. The data was analysed using Predictive Analytics Software (PASW) 9 7. The tests employed in this analysis are discussed below. For the continuous variables, a normal distribution test was applied using the Jarque- Bera test 8,9. Because all of the variables did not display normal distribution, the Kruskal-Wallis one-way analysis of variance was engaged. The Kruskal-Wallis test was developed by Kruskal and Wallis jointly and is named after them. It is a nonparametric (distribution free) test, which is used to compare three or more groups of sample data. The test is used when assumptions of ANOVA are not met. ANOVA is a statistical data analysis technique that is used when the independent variable groups are more than two. In ANOVA, it is assumed that the distribution of each group will be normally distributed. In the Kruskal-Wallis test, no assumptions about the distribution are made. In this study, the evaluations were carried out on the basis of the meat processing capacities per day. Using the hypothesis in the Kruskal-Wallis test, a null hypothesis (H ) assumes that the samples, meat processing firms in the paper, are from identical populations; alternative hypotheses (H a ) assume that the sample comes from different populations. A Chisquare (χ 2 ) with k- (the number of groups-) degrees of freedom was used to approximate the significance level for the test 2. RESULTS The key parameters related to the opinions of the managers and their business activities in the preprocessing stage are presented in Table. The crucial variables shown in Table 2 are directed toward food safety in processing at the firm level. An investigation of the perceptions of the managers in the meat processing firms with regard to defining key barriers after the processing stage was specified in Table 3. DISCUSSION The first findings obtained from the study indicated in the preprocessing stage that while the never responses were predominantly provided in many circumstances such as incorporate practices suitable for the Turkish Food Codex, take care when cutting and preparing the meat by myself, maintain the importance of producers to implement good practices, the always replies were obtained more frequently in statements such as take care when slaughtering and transporting, give importance to sufficient quality and texture of the meat, purchase meat from the slaughterhouses, and consider purchasing the Table. Distribution of the meat processing firms intended for the key practices directed towards food safety concept in preprocessing stage (n= 26) Tablo. İşleme öncesi aşamada gıda güvenliği konseptlerine yönelik olarak anahtar uygulamalar için et işleme firmalarının dağılımı Statements Small Size Never (n, %) Seldom (n, %) Sometimes (n, %) Generally (n, %) Always (n, %) Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Chi- Square (χ 2 ) P Value Take pain over slaughter and transporting 4 (5.4) (.) 2 (7.7) (.) (.) 5 (9.3) (.) 2 (7.7) 6 (23.2) 2 (7.7) * Give importance of the meat had sufficient quality and texture 3 (.5) (.) 3 (.5) 2 (7.7) (.) 4 (5.4) (.) 2 (7.7) 3 (.5) 2 (7.7) (.) 6 (23.2) (.) (.).347.5* Take practices suitable for Turkish Food Codex 9 (34.7) (.) 2 (7.7) 3 (.5) 2 (7.7) (.) 2 (7.7) (.) 2 (7.7) 2 (7.7) (.) 3 (.5) (.) (.) * Make sure of the transporter bus as clean, at convenient temperature and veterinary inspection (.) (.) 3 (.5) (.) 7 (27.) (.) 3 (.5) 5 (9.4) 2 (7.7) * Buy the meat from the slaughterhouses 3 (.5) 3 (.5) 2 (7.7) (.) (.) 3 (.5) (.) (.) 5 (9.4) (.) 6 (23.2) * Take care of cutting and preparing the meat by myself 5 (57.9) 2 (7.7) 2 (7.7) (.) (.) 2 (7.7) (.) (.) (.) (.) * Consider buying the meat at low cost from the producers 3 (.5) (.) (.) (.) (.) 7 (27.2) (.) 3 (.5) 6 (23.) 2 (7.7) * Consider transporting the meat at low cost 3 (.5) (.) 2 (7.7) ( 3.8) (.) 6 (23.3) (.) 3 (.5) 5 (9.4) * Take care of official seal and report belongs to veterinary (.) 3 (.5) (.) (.) 7 (27.) (.) 6 (23.) (.) (.) 2 (7.7) 3 (.5) 2 (7.7) * Give importance for the producers implemented good practices 9 (34.6) 2 (7.7) 2 (7.7) 4 (5.4) (.) (.) (.) 2 (7.7) 2 (7.7) (.) (.) 4 (5.4) (.) (.) * Small, middle and large sized meat processing firms consisted of 9, 4 and 3 businesses, respectively, * NS-not significant

69 752 Identification of Economic... Table 2. Characterization of the meat processing firms for the crucial variables aimed at food safety in processing period (n= 26) Tablo 2. İşleme periyodunda gıda güvenliği için kritik değişkenlere yönelik et işleme firmalarının karakterizasyonu Statements Small Size Never (n, %) Seldom (n, %) Sometimes (n, %) Generally (n, %) Always (n, %) Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Chi- Square (χ 2 ) P Value Consider for the classification process as to animal varieties and fat content of the meat 5 (9.3) 4 (5.5) 2 (7.7) (.) (.) 2 (7.7) (.) 6 (23.2) * Implementation of the processing practices in respect of the present quality safety systems 2 (7.7) (.) 2 (7.7) 3 (.4) 2 (7.7) 2 (7.7) (.) 2 (7.7) 4 (5.5) (.) 4 (5.5) 2 (7.7) * Take care of the meat had health certification and convenient at internal heat (.) (.) 6 (23.2) (.) 4 (5.5) (.) 2 (7.7) 3 (.4) 2 (7.7) 5 (9.3) (.) * Keeps the meat at cold storage conditions (.) (.) (.) 6 (23.2) (.) (.) 6 (23.2) (.) 2 (7.7) 5 (9.3) 3 (.4) * Give importance to fermentation temperature depended on the bones of the meat and product variables (.) (.) 4 (5.5) 3 (.5) 3 (.6) 2 (7.7) 4 (5.5) 2 (7.7) 2 (7.7) * Always being aware of water content and results of the analyses 8 3 (.5) 3 (.5) (.) (.) 4 (5.5) (.) (.) (.) 4 (5.5) (.) * Take practices suitable for Turkish Food Codex (TFC) at packaging stage (.) 2 (7.7) (.) (.) 7 (27.) (.) 4 (5.5) 5 (9.3) 2 (7.7).23.54* Give sufficient importance for loading, transporting and delivering process suitable for (TFC) 2 (7.7) (.) 3 (.5) (.) 6 (23.3) (.) 3 (.5) 2 (7.7) (.) 5 (9.3) * Small, middle and large sized meat processing firms composed of 9, 4 and 3 businesses, respectively, * NS-not significant meat at a low cost from the producers. It may be inferred that the managers of the meat processing firms might be able to give sufficient care linked with food safety approaches, although there were some barriers explored in the research. It was indicated that food producers (farmers, food processors, food retailers) will supply food safety if it is profitable for them to do so. However, the provision of safer food will require the use of more resources (greater selectivity in choosing raw materials, more hygienic handling procedures, better chill-chain facilities, etc.). Thus, it was stressed that the marginal cost of producing additional units of food safety is likely to rise 2. In another study conducted among Turkish food businesses, food safety practices were reported to be the main barrier to implementing a HACCP (Hazard Analysis of Critical Control Points) based food safety management system. The lack of prerequisite programs, lack of knowledge, inadequate Turkish sources related to HACCP, cost and time were also considered barriers. Problems in the implementation of HACCP in Turkey food businesses have been designated as inadequate equipment and physical conditions of the facility 3. The critical point should be made that this very complex legal regulation has still been implemented in Turkey despite the barriers. Maybe the never responses that were frequently obtained on incorporate practices suitable for the Turkish Food Codex, take care when cutting and preparing the meat by myself, maintain the importance of producers to implement good practices were given for that reason. However, the legal regulations that have been implemented so far in Turkey have shown very complex characteristics. Thus, that complexity may be creating problems in maintaining a centralized structure for monitoring and intervention, in order to ensure effectiveness of food safety control and monitoring in many instances. The recent enforcement of Law No requiring the services of veterinary, plant health, food and feed laws published on 3.6.2, as required by the EU accession period 22, may result in more satisfied results in the near future. According to the second results obtained in processing stages, there were no statistical differences among the small, middle and large sized meat processing firms during the processing period. The never and seldom responses were frequently given on consider the classification process as to animal varieties and fat content of the meat, maintain awareness at all times of water content and results of the analyses, assure that the meat had health certification. Generally, sometimes and always replies were obtained from maintain practices

70 753 ÇOBANOĞLU, KARAMAN TUNALIOĞLU, OVA Table 3. The perceptions of the managers for the meat processing firms with regard to defining key barriers after the processing stage (n= 26) Tablo 3. İşleme sonrası süreçte anahtar engellerin tanımlanmasına yönelik olarak et işleme firmaları yöneticilerinin algıları Statements Small Size Never (n, %) Seldom (n, %) Sometimes (n, %) Generally (n, %) Always (n, %) Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Small Size Middle Size Large Size Chi- Square (χ 2 ) P Value Customers determine the product varieties 9 (34.7) (.) (.) (.) 2 (7.7) (.) (.) 6 (23.2) 2 (7.7) 2 (7.7).3.568* Determine the product varieties by myself 6 (23.) 2 (7.7) 2 (7.7) (.) (.) (.) 2 (7.7) (.) (.) (.) (.) (38.5) 2 (7.7) * Marketing profiles occur as a result of retail in general 2 (7.7) (.) (.) (.) (.) 2 (7.7) (.) (.) 4 (5.4) (.) (42.4) 3 (.5) 2 (7.7) * Marketing profiles occur as a result of wholesale in general (42.5) 2 (7.7) 2 (7.7) (.) (.) (.) (.) (.) 5 (9.3) * Marketing profiles consist of awarding 6 (6.7) 3 (.5) 3 (.5) 2 (7.7) (.) (.) (.) (.) (.) (.) (.) (.) (.).9.634* Marketing profiles occur in boutiques (small retail store) 9 (73.2) 3 (.5) 3 (.5) (.) (.) (.) (.) (.) (.) (.) (.) (.) (.) (.) ** Marketing profiles formed by the franchise 9 (73.) 4 (5.4) 2 (7.7) (.) (.) (.) (.) (.) (.) (.) (.) (.) (.) (.) *** Create the advertisement activities for promotion 5 (57.9) 3 (.6) 2 (7.7) (.) (.) (.) (.) (.) (.) * Make the advertisement activities refer to taste 6 (6.6) 4 (5.4) 2 (7.7) (.) (.) (.) 2 (7.7) (.) (.) (.) (.) (.) (.).33.59* Make the advertisement activities as visual publications (42.6) 2 (7.7) (.) (.) (.) (.) 4 (5.4) 3 (.5) (.) * Make the advertisement activities in poster form 4 (53.9) 4 (5.5) 2 (7.7) (.) (.) (.) (.) (.) 2 (7.7) (.) (.) * Small, middle and large sized meat processing firms composed of 9, 4 and 3 businesses, respectively, * NS-not significant, **Significant for P<., ***Significant for P<.5 suitable for the Turkish Food Codex (TFC) at the packaging stage, assure that the meat had health certification, and stores the meat in cold storage conditions expressions. Despite the fact that it would take better outcomes on hygiene and food safety concepts in the processing stage, it may be deduced that meat processing firms were ready for good hygienic practices (GHP). It is well known that the Aydin Provincial Agricultural Directorate (APAD) has been working very seriously in the region at firm level processing directed at food safety. While it was emphasized that a lack of knowledge about HACCP and other food safety programs were identified as the main barriers for food safety in Turkey, hypermarkets and retail markets with large meat selling capacity want the meat processing firms to implement GHP directed toward stabilization of sustainable domestic markets 4. Those drivers may be enforcing meat firms to implement GHP intended for food safety approaches very seriously. An investigation of the perceptions of the managers in the meat processing firms with regard to defining key barriers after the processing stage, showed no statistical differences among identified variables in the three-sized business classification except for two statements. These expressions were marketing profiles occur in boutiques (small retail stores) and marketing profiles are determined by the franchise. Additionally, these statements were statistically significant at % (P<.) and 5% (P<.5) levels, respectively. All statements indicated that never replies were in the first range in the small sized firms specifically. It may be deduced that meat processing firms do not need the use of attractive marketing instruments. It can be reasoned that the firms can sell their goods in the domestic market without difficulty. Thus, although the meat processing firms have been working in relatively competitive conditions in the domestic market and have not been implementing good marketing practices efficiently, these businesses can sell their products regardless. It was indicated that a combination of product liability, governmental regulations, and market forces determine the current level of food safety 23. It may be inferred that managers of the firms considered that the current practices were sufficient for safely and sustainable marketing powers, especially since these negative responses were predominantly grouped in the small firms. Those plants did not want to spend money on practices that might obstruct the current marketing network in the

71 754 Identification of Economic... event that they were not implemented. This point of view was stressed in some crucial studies 6,24,25. They examined the negative incentives of higher per unit production cost of adopting food safety and quality practices for smaller firms. It was noted that because the monitoring and the record keeping requirements of regulations are largely fixed costs, the average cost per unit of production was higher for smaller firms than for larger firms 6. Therefore, size was another possible firm characteristic that could explain the importance of the cost of implementation as an incentive to adopt food safety and quality practices. REFERENCES. Sinclair U: The Jungle; New York: Doubleday, Jabber, and Company, Hoffman S: Food safety policy and economics. Discussion Paper, July 2. RFF DP -36, -36, Chambers RG: Applied production analysis: A dual approach. Cambridge: Cambridge University Press, Buzby JC, Frenzen PD, Rasco B: Product liability and microbial foodborne illness. Washington DC: United States Department of Agriculture, ERS Agricultural Economics Reports, 799-2, Loader R, Hobbs JE: Strategic responses to food safety legislation. Food Policy, 24, , Antle JM: Choice and efficiency in food safety policy. Washington DC: AEI Press, Antle JM: Economics analysis of food safety. In, Gardner B, Rausser G (Eds): Handbook of Agricultural Economics., 83-36, Amsterdam, Elsevier Science, Henson S, Heasman M: Food safety regulation and the firm: Understanding the compliance process. Food Policy, 23 (): 9-23, Henson S, Hooker N.H: Private sector management of food safety: Public regulation and the role of private controls. Int Food Agribusiness Manage Rev, 4, 7-7, 2.. Krishantha U, Mudalige J, Henson S: Economic incentives for firms to implement enhanced food safety controls: Case of the Canadian red meat and poultry processing sector. Rev Agric Econ, 28 (4): , 26.. Kursun O, Guner A, Ozmen G: Prevalence of Bacillus cereus in rabbit meat consumed in Burdur-Turkey, its enterotoxin producing ability and antibiotic susceptibility. Kafkas Univ Fak Derg, 7 (Suppl A): S3-S35, Kale MC, Aral Y, Aydın E, Cevger Y, Sakarya E, Güloğlu SC: Determination of by-product economic values for slaughtered cattle and sheep. Kafkas Univ Fak Derg, 7 (4): , Baş M, Ersun AŞ, Kivanç G: Implementation of HACCP and prerequisite programs in food businesses in Turkey. Food Control, 7, 8-26, Baş M, Yüksel M, Çavuşoğlu T: Difficulties and barriers for the implementing of HACCP and food safety systems in food businesses in Turkey. Food Control, 8, 24-3, Malhotra NK: Marketing Research: An Applied Orientation. 2nd ed., Prentice-Hall, Englewood Cliffs, Davis JA: Elementary Survey Analysis. pp. 9-32, Printice Hall, New Jersey, SPSS: PASW 9, Predictive Analytics Software, SPSS Inc., Chicago, USA, Gujarati DN: Basic econometrics. 3rd ed., McGraw-Hill, Boston, MA, Akkaya S, Pazarlioglu V: Ekonometri I (Econometrics I). Anadolu Matbaacilik, Izmir, Turkey, Kruskal WH, Wallis WA: Use of ranks in one-criterion variance analysis. J Am Stat Assoc, 47 (26): , Fearne A: The evolution of partnerships in the meat supply chain: Insights from the British beef industry. Int J Supply Chain Manag, 3, 4, ONTR: The services of veterinary, plant health, food and feed law published on Law no. 5996, Official Newspapers of Turkish Republic (ONTR), Buzby JC, Frenzen PD: Food safety and product liability. Food Policy, 24, , Holleram E, Bredahl ME, Zaibet L: Private incentives for adopting food safety and quality assurance. Food Policy, 24, , Taylor E: HACCP in small companies: Benefit or burden. Food Control, 2, , 2.

72 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Koyunculuk Açısından Batı Anadolu İllerinin Sınıflandırılması Yakut GEVREKÇİ * Funda E. ATAÇ * Çiğdem TAKMA * Yavuz AKBAŞ * Turgay TAŞKIN * * Ege University, Faculty of Agriculture, Department of Animal Science, TR-35 İzmir - TURKEY Özet Bu çalışmada, Batı Anadolu daki ilin (Afyonkarahisar, Aydın, Balıkesir, Bursa Çanakkale, Denizli, İzmir, Kütahya, Manisa, Muğla ve Uşak) koyunculuğunun yapısı karşılaştırmalı olarak incelenmiştir. Araştırmada, yıllarına ait Türkiye İstatistik Kurumu ndan elde edilen koyun sayısı, sağılan koyun sayısı, koyun süt verimi, kesilen koyun-kuzu sayısı, koyun-kuzu eti üretimi (ton), kırkılan koyun sayısı, yapağı üretimi verileri kullanılmıştır. Çok Boyutlu Ölçekleme (MDS) ve Kümeleme analizleri uygulanarak illerin koyunculuk açısından sınıflandırılması yapılmıştır. MDS ve kümeleme analizleri sonucunda koyunculuk bakımından Batı Anadolu illeri dört ana grup oluşturmuştur. Bu gruplar Afyonkarahisar - Balıkesir; İzmir - Manisa; Bursa - Çanakkale - Denizli- Kütahya - Uşak ve Aydın - Muğla şeklindedir. Anahtar sözcükler: Çok boyutlu ölçekleme analizi, Kümeleme analizi, Koyun, Batı Anadolu İlleri, Sınıflandırma Classification of West Anatolian Cities for Sheep Production Summary Makale Kodu (Article Code): KVFD In this study sheep production structures of West Anatolian cities (Afyonkarahisar, Aydın, Balıkesir, Bursa Çanakkale, Denizli, İzmir, Kütahya, Manisa, Muğla and Uşak) have been compared and classified. Data were obtained from Turkish Statistical Institute including numbers of sheep and milking sheep, sheep milk production, number of slaughtered sheep, sheep meat production, number of sheep shorn, wool production during years. Multidimensional Scaling and Cluster Analyses were used for classifying the cities for sheep production. Results from MDS and cluster analyzes show that four city groups for sheep production were available such as Afyonkarahisar - Balıkesir; İzmir - Manisa; Bursa - Çanakkale - Denizli - Kütahya - Uşak, and Aydın - Muğla. Keywords: Multidimensional scaling analysis, Cluster analysis, Similarity, Sheep, West Anadolu Cities GİRİŞ Batı Anadolu Bölgesi, sahip olduğu doğal kaynaklar nedeniyle, tarım ve sanayi potansiyeli yanında, önemli bir turizm merkezidir. Tüm bu sektörlerin başarısı ve sürdürülebilirliğinde tarım-çevre politikalarının belirlenen homojen alanlarda uygulanması önem taşımaktadır. Kırmızı et üretiminde bölge illeri birbirlerine yakın bir üretim gerçekleştirdikleri halde, süt üretiminde farklılıklar bulunduğu bilinmektedir. Türkiye nin %8.47 lik süt üretimi Ege Bölgesi nde gerçekleşmektedir. Ege Bölgesi süt üretiminde, İzmir ili %3.4 oranı ile önde gelmektedir. Daha sonra birbirine yakın üretimleriyle Afyonkarahisar, Muğla, Aydın ve Manisa illeri gelmektedir. En az üretim ise Uşak ilinde yapılmaktadır. TUIK 29 yılı verilerine göre, Türkiye geneline baktığımızda toplam kırmızı et üretiminin %22.82 sinin küçükbaşlardan elde edildiği görülmektedir. Toplam kırmızı et üretiminin %2.2 sine sahip olan Batı Anadolu Bölgesi nde ise küçükbaş hayvanlardan elde edilen toplam kırmızı etin oran %2.4 olurken bunun da %93.4 ünü koyun-kuzu eti oluşturmaktadır 2. Batı Anadolu Bölgesi, sahip olduğu doğal kaynaklar ve tarım potansiyeli nedeniyle koyunculuk açısından dikkat çekici olması nedeniyle bölge illerinin mevcut koyunculuk düzeyi ve aralarındaki farklar her zaman merak konusu olmuştur. İllerin koyunculuk açısından durumu çok değişkenli istatistik yöntemlerle değerlendirilip, iller arasındaki benzerlik ve farklılıklar ortaya konabilir. Çok değişkenli istatistiksel analizler, iki veya daha çok boyutlu rastgele değişkenleri bir bütün olarak ele alıp ve değişkenler arasındaki ilişkileri göz önüne alarak bir sonuç İletişim (Correspondence) /278

73 756 Koyunculuk Açısından Batı... üreten istatistiksel yöntemlerdir. Bu yöntemler sırasıyla; çok değişkenli varyans analizi, çok değişkenli kovaryans analizi, ayırma analizi, kümeleme (cluster) analizi, ana bileşenler analizi, faktör analizi, kanonik korelasyon analizi, çok değişkenli regresyon analizi, uyum analizi ve çok boyutlu ölçekleme analizi (MDS) dir 3. Bunlardan MDS analizi, çoğunlukla tarım ekonomisi ile ilgili çalışmalarda kullanılmaktadır. Nitekim Türkiye-Avrupa Birliği ilişkileri çok boyutlu ölçekleme analizi ile değerlendirilmiştir 4-6. Bir diğer çalışmada ise tarım ve çevre ilişkileri aynı yöntemle değerlendirilmiştir 7. İzmir ili Bayındır ilçesindeki işletmelerde Çok Boyutlu Ölçekleme analizi kullanılarak tarımsal ürün sigortası için risk düzeylerine göre bir ürün risk haritası hazırlanmıştır 8. Aynı araştırmacılar bir başka çalışmalarında ise 9 tarım işletmelerinde işgücü kullanımını bakımında üretim dallarını MDS ve kümeleme analizleri ile incelemişler ve bu üretim dallarını gruplandırmışlardır. Böylece gerek işletme ve gerekse makro düzeydeki üretim planlaması çalışmalarında daha az sayıda işgücü verisi toplanmasını sağlayabilecek bir altyapı önermişlerdir. Berber ve ark. ise tatlı su istakozlarının morfometrik ve üreme özellikleri ile su kaynağının bazı fizyo-kimyasal özellikleri arasındaki ilişkileri belirlemek amacıyla MDS analizinden yararlanmışlardır. Nanami ve Nishihira, kümeleme analizinden yararlanarak mercan kayalıklarında kayalık ve kumluk bölgelerdeki balık topluluklarını gruplandırmışlardır. Doğan 2, farklı çalışma alanlarında kullanılan kümeleme analizinin hayvan ıslahında da kullanıldığını göstermiştir. Erdoğan ve ark. 3, Türkiye de farklı haralarda ve halk elinde yetişen Arap atları arasındaki genetik farklılıkları kümeleme analizini kullanarak gruplandırmışlardır. Bu çalışmada, Batı Anadolu Bölgesi koyun yetiştiriciliğinin yapısal özellikleri MDS ve kümeleme analizleri ile incelenmiş, bu açıdan bölge illeri arasındaki benzerlik ve farklılıklar ortaya konmuş ve buna bağlı kimi somut öneriler geliştirilmiştir. MATERYAL ve METOT Çalışmada, Türkiye İstatistik Kurumu tarafından tutulan Batı Anadolu daki ile (Afyonkarahisar, Aydın, Balıkesir, Bursa Çanakkale, Denizli, İzmir, Kütahya, Manisa, Muğla ve Uşak) ait koyunculukla ilişkili bilgilerden yararlanılmıştır yılları arasına ait olan bu özellikler koyunkuzu sayısı, sağılan koyun sayısı, koyun süt verimi, kesilen koyun-kuzu sayısı, koyun-kuzu et üretimi, kırkılan koyun sayısı, yapağı üretimidir. Çalışma verilerin analizinde çok boyutlu ölçekleme analizi ve kümeleme analizi kullanılmıştır. Bu analizler SPSS programında 4 gerçekleştirilmiştir. MDS analizinde ALSCAL yaklaşımı uygulanmış, kullandığımız veriler aralıklı ölçüm düzeyinde olduğundan Öklid uzaklığı kullanılmıştır. Kümeleme analizi Aşamalı Kümeleme (Hiyeraşik Cluster) yöntemi kullanılmış, küme sayısı ikiden başlayarak birer artırılarak dört farklı gruplama gerçekleştirilmiştir. Analizde optimum kümeleri elde etmeyi amaçlayan Ward yaklaşımı uygulanmıştır. Kümeleme analizi için ön analizler yapılarak boyut sayısı incelenmiştir, buna göre üç boyutlu gösterim önemli çıkmadığı için analizler iki boyut üzerinden gerçekleştirilmiştir. MDS Analizi Çok boyutlu ölçekleme analizi (Multidimensional Scaling, MDS), n nesne ya da birimin p adet değişkene göre belirlenen uzaklıklarına dayalı olarak k boyutlu (k>p) bir uzayda gösterimini amaçlayan bir yöntemdir 5. Yöntem birçok alanda uygulanabilme özelliğine sahiptir. MDS, kümeleme analizi (cluster analysis) ve ayırma analizi (discriminant analysis) gibi sınıflama ve gruplama yöntemlerinin içinde yer almaktadır 6. Nesneleri farklılıklarına göre sıralama ve sınıflama yapabilen çok değişkenli bir analiz olan MDS, bu özelliğinden dolayı tıp, psikoloji, sosyoloji, eğitim, pazarlama gibi pek çok alanda uygulanabilmektedir 7. MDS analizinde genel amaç, mümkün olduğunca az boyutla, aralarındaki uzaklık değerlerini kullanarak, nesnelerin yapısını gerçeğe en yakın biçimde ortaya koymaktır 9,5,6. Bu yöntemle nesne veya bireyler arasındaki karmaşık ilişkiler, daha kolay anlaşılabilir ve açıklanabilir boyutlara indirgenebilmektedir. MDS analizi, orijinal uzaklıklar ile tahminlenen uzaklıklarının uyumluluğunu Shepard diyagramıyla değerlendirme imkanı sağlar. Bu diyagram ile orijinal uzaklıklar Y ekseninde, tahmini uzaklıklarla aralarındaki fark ise X ekseninde yer alacak biçimde bir serpilme grafiği oluşturulur 8. Ayrıca MDS analizinde, çok boyutlu gerçek şekil ile tahminlenen indirgenmiş boyutlu şekil arasındaki farklılığın bir ifadesi olan Stres değeri hesaplanır. Yani orijinal uzakgunluğu ölçen STRESS (STandardized REsidual Sum of lıklar (d y) ile tahminlenen uzaklıkları ( dˆ ) arasındaki uy- y Squares) ölçüsü, Stres = ( şeklinde hesaplanır. Stress değeri; stress.2 ise zayıf uyum; stress =. ise orta uyum; stress =.5 ise iyi uyum; stress =. ise tam uyum şeklinde yorumlanır 6. MDS analizinde kullanılan yaygın bir diğer uygunluk ölçütü de korelasyon katsayısının karesidir (R 2 ). R 2 nin %6 dan büyük olması, tahminlenen uzaklıklarının orijinal uzaklıklarla uyumunun iyi olduğunu ve MDS nin uygulanabileceğini göstermektedir. Kümeleme Analizi d ˆ y d y ) 2 ( d ) y Çok değişkenli istatistiksel tekniklerden birisi olan kümeleme analizi, grup sayısı bilinmeyen ve gruplandırılmamış verilerin benzerliklerine veya uzaklıklarına göre 2 ()

74 757 GEVREKÇİ, ATAÇ TAKMA, AKBAŞ, TAŞKIN sınıflandırılması için kullanılmaktadır. Analizde, dağınık bir halde bulunan veriler benzerliklerine göre bir araya getirilip sınıflandırarak benzer özelliklere sahip nesneler bir grupta, benzemeyenlerse ayrı bir grupta bir araya getirilmektedir. Kümeleme analizi bu özelliğinden dolayı diskriminant analizine, benzer değişkenlerin aynı gruplarda toplaması nedeniyle de faktör analizine benzerlik göstermekte olup veri indirgeme özelliği vardır 8. BULGULAR MDS Analizi Bulguları Veri setindeki orijinal uzaklıklar ile yöntemle tahminlenen uzaklıklarının uyumunu gösteren serpilme grafiği Şekil de verilmiştir. Şekil e göre, orijinal uzaklıklarla tahmin edilen uzaklıkların doğrusal bir ilişki gösterdiği, dolayısıyla bu değerlerin birbirlerine uyumlu olduğu saptanmıştır. Bu ise yöntemin başarı ile çalıştığının bir göstergesidir. Batı Anadolu koyunculuğunun MDS ile iki boyutlu olarak incelenmesinde Kruskal Stres istatistiği.8, belirleme katsayısı ise düzeylerinde hesaplanmıştır. Bulunan Distances Disparities Şekil. Orijinal uzaklıklar ile tahmin uzaklıklarının uyumuna ait serpilme grafiği Fig. Shepard diagram relationship between distances and disparities 4 5 Stres değerinin. dan küçük olması, orijinal uzaklıklarla tahmini uzaklıklar arasındaki uyumun iyi olduğunun bir diğer göstergesidir. Batı Anadolu da incelenen illerin birbirlerine olan yakınlık ve uzaklıklarını gösteren farklılıklar matrisi ise Tablo de verilmiştir. Farklılıklar matrisinde sıfıra yakın değerlere sahip iller birbirlerine incelenen özellikler açısından yakın iller kabul edilirken, ikinin üzerindeki değerlere sahip iller ise birbirine uzak olarak kabul edilmektedir. Buna göre Kütahya- Çanakkale, Kütahya-Denizli, Muğla-Aydın, Uşak-Denizli ve Uşak-Kütahya birbirine benzeyen iller olarak saptanmıştır. Farklılıklar matrisinin iki boyutlu gösterimi Şekil 2 de verilmiş olup, söz konusu benzerlik ve farklılıklar çok daha belirgin bir şekilde görülmektedir. Muğla, Aydın, Denizli, Uşak, Kütahya ve Çanakkale birbirlerine benzerlik düzeyleri nedeniyle bir grup olarak ele alınabilir. Farklılıklar matrisinde ikinin üzerinde değere sahip iller ise birbirine daha az benzemektedir. Örneğin Afyonkarahisar, İzmir, Bursa, Balıkesir ikinin üzerindeki değerleri ile diğer illerden farklılıklar göstermektedir. Diğer yandan Aydın-Balıkesir ve Muğla-Balıkesir dördün üzerindeki değerleriyle koyunculuk bakımından belirgin düzeyde birbirine en uzak iller olarak ortaya çıkmaktadır. Batı Anadolu daki illerin MDS analizi ile elde edilen iki boyutlu koordinat değerleri Tablo 2 de verilmiştir. Tablo 2 ye göre; Batı Anadolu koyunculuğunda birinci boyutta Afyonkarahisar, Balıkesir, İzmir ve Manisa pozitif yüke sahip olurken, bu illerden Balıkesir ve Afyonkarahisar un yükü birin üzerindedir. Bu nedenle Balıkesir ve Afyonkarahisar Batı Anadolu koyunculuğunda önemli illerdir. Diğer yandan aynı boyutta; Aydın, Bursa, Çanakkale, Denizli, Kütahya, Muğla ve Uşak negatif yüklere sahiptir. Bu illerden Aydın ve Muğla - in altındaki değerleriyle diğer illere göre koyunculukta en az etkiye sahip iller olarak karşımıza çıkmaktadır. Diğer iller ise koyunculukta orta derecede bir etkiye sahiptir. Tablo. Farklılıklar matrisi Table. Distance matrice İl Afyon Aydın Balıkesir Bursa Çanakkale Denizli İzmir Kütahya Manisa Muğla Aydın Balıkesir Bursa Çanakkale Denizli İzmir Kütahya Manisa Muğla Uşak

75 758 Koyunculuk Açısından Batı... Euclidean distance model,5, Afyon Dimension 2,5, Mugla Aydin Kutahya Usak Canakkale Denizli Manisa Şekil 2. Batı Anadolu illerinin koyunculuk açısından iki boyutlu gösterimi Fig 2. Two dimensional map of the West Anatolian cities for sheep production -,5 Izmir Balikesir Bursa -, -2 - Dimension 2 3 İkinci boyuta göre ise, birin üzerindeki pozitif yükü ile Afyonkarahisar bölge koyunculuğunda en belirgin ildir. Diğer iller ise sıfıra yakın yük değerlerine sahiptir. Bu illerden Çanakkale, Denizli, Kütahya, Manisa ve Uşak pozitif değerlere sahipken, Aydın, Balıkesir, Bursa, İzmir ve Muğla negatif değerlere sahip olmaktadır. Bu illerden Aydın, Bursa ve Muğla her iki boyutta da negatif işaretlidir. Bu nedenle; söz konusu iller Batı Anadolu koyunculuğunda en zayıf iller olarak kabul edilebilir. Kümeleme (Cluster) Analizi Bulguları Kümeleme analizinden elde edilen sonuçlara göre oluşan gruplar Tablo 3 te verilmiştir. İki gruplu kümelemede Afyonkarahisar, Balıkesir, İzmir ve Manisa birinci grupta yer alırken, Aydın, Bursa, Çanakkale, Kütahya, Denizli, Muğla ve Uşak ise ikinci grupta yer almaktadır. Üç gruplu kümelemede Afyonkarahisar ve Balıkesir birinci grupta, Aydın, Bursa, Çanakkale, Denizli, Kütahya, Muğla ve Uşak ikinci grupta yer alırken İzmir ve Manisa üçüncü grupta yer almaktadır. Dört gruplu kümelemede Afyonkarahisar ve Tablo 2. İki boyutlu MDS analizinde illerin koordinat değerleri Table 2. Coordinates of cities in MDS with two dimensions Uyarıcı Sayısı İller Koyun. Boyut 2. Boyut Afyon Aydın Balıkesir Bursa Çanakkale Denizli İzmir Kütahya Manisa Muğla Uşak Balıkesir birinci grupta yer alırken, Aydın ve Muğla ikinci grupta; Bursa, Çanakkale, Denizli, Kütahya ve Uşak üçüncü grupta, İzmir ve Manisa ise dördüncü grupta yer almaktadır. Beş gruplu kümelemede ise Afyonkarahisar birinci grupta, Aydın ve Muğla ikinci grupta, Balıkesir üçüncü grupta, Bursa, Çanakkale, Denizli, Kütahya ve Uşak dördüncü grupta, İzmir ve Manisa beşinci grupta yer almaktadır. Beş gruplu kümeleme analizine göre Ege Bölgesi nde incelenen il koyun verim özellikleri bakımından birbirlerinden farklı gruplarda yer almaktadır (Tablo 3). Bu sonuçlar, MDS ile elde edilen bulguları desteklemektedir (Tablo 2). Aşamalı kümeleme sonuçlarını göstermede dendogram Tablo 3. Kümeleme analizine göre illerin gruplandırılması Table 3. Grouping of cities by cluster analysis Gruplar 2 Gruplu 3 Gruplu 4 Gruplu 5 Gruplu. Grup 2. Grup 3. Grup - Afyon Balıkesir İzmir Manisa Aydın Bursa Çanakkale Kütahya Denizli Muğla Uşak 4. Grup - Afyon Balıkesir İzmir Manisa Aydın Bursa Çanakkale Denizli Kütahya Muğla Uşak 5. Grup Afyon Balıkesir İzmir Manisa Bursa Çanakkale Denizli Kütahya Uşak Aydın Muğla Afyon Balıkesir İzmir Manisa Bursa Çanakkale Denizli Kütahya Uşak Aydın Muğla

76 759 GEVREKÇİ, ATAÇ TAKMA, AKBAŞ, TAŞKIN grafiği de kullanılabilmektedir. Dendogram, Ward metodu kullanılarak elde edilmiş ve elde edilen dendogram Şekil 3 te verilmiştir. Şekil 3 e göre birbirine en çok benzeyen iller Denizli ile Uşak olurken, birbirine en uzak iller ise Afyonkarahisar ve Aydın olmuştur. Dinçer ve ark. nın 23 bildirdiğine göre, Afyonkarahisar, birçok özellik bakımından bir Orta Anadolu ili özelliği göstermekte ve bölgedeki diğer illerden ayrılmaktadır. Bu durum bu çalışmada uygulanan MDS ve kümeleme analizi sonuçları ile de doğrulanmıştır. Afyon Balikesi Izmir Manisa Aydin Mugla Bursa Canakkal Kutahya Denizli Usak Şekil 3. İllere göre Batı Anadolu koyunculuğunun durumunu gösteren dendogram Fig 3. Dendrogram of West Anadolu sheep by cities TARTIŞMA ve SONUÇ Türkiye de çok boyutlu ölçekleme analizinin değişik alanlarda kullanımı konusunda yapılan birçok çalışma bulunmaktadır 9,9,2. Hayvancılık alanında ise yöntemin kullanımı yaygın değildir. Bu çalışma ile Batı Anadolu da ilin koyunculuğu bu yöntemlerle mercek altına alınmıştır. Batı Anadolu da incelenen ilerin koyun yetiştiriciliğini, hem koyunculukla ilgili üretim değişkenleri açısından çok boyutlu ölçekleme ve kümeleme analizleri ile elde edilen sonuçlar, Türkiye de bölgesel iç göçe ilişkin ilgili devlet kurumlarının daha önceki yılları kapsayan araştırma sonuçlarıyla da paralellik göstermektedir 2. Bununla birlikte, çalışmada, MDS analizinde koyun yetiştiriciliği açısından ili, iki boyutlu konumlandırmak mümkün olmuştur. Afyonkarahisar ve Balıkesir illeri koordinat değerleri ile birinci boyuta göre diğer illere göre farklı bulunmuştur. İzmir-Manisa, Aydın-Muğla ve Çanakkale-Kütahya-Denizli- Bursa-Uşak illeri ise farklı birer grup oluşturmuştur. Buna göre, araştırmada incelenen özellikler bakımından Afyonkarahisar ve Balıkesir illerinin Batı Anadolu koyunculuğuna yön verdiği görülmektedir. Balıkesir, diğer illerle karşılaştırıldığında incelenen tüm özellikler bakımından daha üstün bulunmuştur. Afyonkarahisar ı Balıkesir den ayıran önemli özellikler ise, kesilen koyun-kuzu sayısı, üretilen koyun-kuzu eti ve dolayısıyla elde edilen deri miktarının yaklaşık kat daha az olmasıdır. Bu iki ilde son yıllarda Damızlık Koyun-Keçi Yetiştiricileri Birliklerinin daha etkin çalışması ile Tarım ve Köyişleri Bakanlığı nın bölgede uygulanan Halk Elinde Islah Projesi nde yer alması koyunculuk için bir ivme kazanmıştır. Özellikle hayvancılıkta en çok destek alan ikinci ilin Balıkesir olması, yöresel süt ve süt ürünlerine dayalı bir sektörün varlığı ve İstanbul gibi büyük tüketim merkezlerine sürekli mal ve hizmet sunması, bu ile ayrı bir önem kazandırmıştır 22. Çalışma sonuçlarına göre İzmir ve Manisa, toplam ve sağılan koyun sayısı, koyun sütü miktarı, kırkılan koyun sayısı ve elde edilen yapağı miktarı bakımından birbirine yakın değerleri ile Afyonkarahisar ve Balıkesir illerini takip eden ikinci bir grubu oluşturmaktadır. Kesilen koyunkuzu sayısı, toplam üretilen koyun-kuzu eti ve deri miktarı bakımından İzmir, bölgede ikinci, Manisa ise dördüncü sıradaki iller olarak belirlenmiştir. Çalışmada, Muğla, koyunculuk açısından toplam ve sağılan koyun sayısı, koyun sütü miktarı, kırkılan koyun sayısı ve elde edilen yapağı miktarı bakımından en düşük değerlere sahip il olarak bulunmuştur. Muğla ya bu özellikler açısından benzerlik gösteren il ise Aydın dır. Nitekim yapılan analizlerde bu iki il aynı grupta yer almıştır. Bunun nedenleri, Muğla ilinin gerek iklim özellikleri ve su-toprak potansiyelinin gerekse tarımsal yapısının Batı Anadolu Bölgesi karakterine uymaması olabilir. Dinçer ve ark. 23 tarafından yapılan çalışmada da, Muğla ili, incelenen Batı Anadolu daki iller arasında gelişme indeksi bakımından İzmir den sonra ikinci sırada yer alan il konumundadır. Aynı çalışmada tarım-çevre değişkenleri bakımından birbirine en fazla benzeyen iller Çanakkale ve Balıkesir iken; en farklı iki il ise Muğla ve Afyonkarahisar dır. Şahin ve ark. 9, yaptıkları çalışmada tarım ve çevre değişkenleri bakımından Ege Bölgesi nde birbirlerine benzeyen illeri İzmir, Manisa ve Aydın bulurken; Denizli, Kütahya, Balıkesir, Burdur, Çanakkale ve Isparta illeri benzer tarımçevre özellikleri göstermektedir. Kesilen koyun-kuzu sayısı, toplam üretilen koyun-kuzu eti ve deri miktarı açısından ise Kütahya ve Uşak en düşük değerlere sahipken, Çanakkale bu illeri takip etmekte, Muğla ve Aydın ise daha sonra gelmektedir. Çalışmadaki iller için Kıyı-Ege ve İç-Ege şeklinde de bir

77 76 Koyunculuk Açısından Batı... ayrım yapmak da olasıdır. Kıyı-Ege de bulunan İzmir ile buna yakın Manisa ili arasındaki benzerlik, İç-Ege deki Kütahya, Denizli ve Uşak illeri arasındaki benzerlik bu durumu göstermektedir. Şahin ve ark. nın 9 anılan Kıyı ve İç-Ege tanımlaması, bu araştırma sonuçları ile uyumludur. MDS ve kümeleme analizleri sonucunda; koyun yetiştiriciliği bakımından Batı Anadolu Bölgesi dört farklı gruba ayrılmıştır. Çalışma sonucunda, koyun yetiştiriciliğinde benzer özelliklere sahip illere yönelik olası ortak planlamaların yapılması sağlanabilir. Batı Anadolu Bölgesi nin Türkiye nin önemli bir tarım, sanayi ve turizm merkezi olması nedeniyle çevre faktörlerinin bölgede yer alan iller açısından incelenerek buna göre politikaların oluşturulması önem arz etmektedir. Bunun dışında bölgeler arası ve bölge içinde gerçekleşen göç de önemli bir faktördür. Bu çalışmada, ileri istatistik teknikler kullanılarak Batı Anadolu da koyun yetiştiriciliğinin geleceği açısından avantajlı ya da riskli olabileceği bölgeler belirlenmiştir. Bu bağlamda, Balıkesir ve İzmir ileri, Damızlık Koyun ve Keçi Yetiştirici Birlikleri nin koyunculuk açısından yaptığı atılımlar, oluşturulan pazar ağı ve ürün işleme potansiyelinin artırılması yönüyle dikkati çekmektedir. Diğer yandan koyunculuk verilerinden daha sağlıklı bilgiler elde edilebilmesi için Damızlık Koyun Keçi Yetiştiricileri Birlikleri nin numaralama dışında düzenli ve güvenilir bir kayıt sistemini oluşturması ve elde edilen bu kayıtların periyodik olarak değerlendirilmesi, değerlendirme sonuçlarını uygulamaya aktarması, ıslah programı kapsamında Tarım Bakanlığı, araştırma enstitüleri ve üniversitelerle sıkı bir işbirliği kurarak bölgesel ve ülkesel düzeyde koyunculuk ar-ge çalışmalarına daha fazla katkıda bulunması gereklidir. Ancak bu durumda ileri istatistik teknikler araştırmacılara çok daha anlamlı sonuçlar sunacaktır. KAYNAKLAR. Anonim: Ege Bölgesi Tarım Master Planı. T.C. Tarım ve Köyişleri Bakanlığı Strateji Geliştirme Başkanlığı. ANKARA, Türkiye İstatistik Kurumu (TUIK): Erişim tarihi: Şubat Yiğit E: Çok boyutlu ölçekleme yöntemlerinin incelenmesi ve bir uygulama. Yüksek Lisans Tezi, Ondokuz Mayıs Üniv Fen Bilimleri Enst, İstatistik Anabilim Dalı, Tatlıdil H, Cinel O: Türkiye nin AT üyeliği ve beşeri kalkınma durumu. Hazine Derg, 6, 53-68, Filiz Z, Çemrek F: Avrupa Birliği ne üye ülkeler ile Türkiye nin karşılaştırılması. VII. Ulusal Ekonometri ve İstatistik Sempozyumu, s. -4, İstanbul, Mayıs Şahin A, Abay C, Miran B: Tarımsal ve sosyo ekonomik özellikler açısından Türkiye nin AB ne uyum olanaklarının değerlendirilmesi: Bir MDS uygulaması. Türkiye VII. Tarım Ekonomisi Kongr, s. 7-24, Antalya, 3-5 Eylül Atış E: Tarım ve Çevre. Tarım ve Köyişleri Bakanlığı Strateji Geliştirme Başkanlığı, Ankara, 63-79, Şahin A, Miran B: Çiftçi algılarına göre bitkisel ürünlerin risk haritası: Bayındır ilçesi örneği, Ege Üniv Ziraat Fak Derg, 44 (3): 59-74, Şahin A, Atış E, Miran B: Daha etkin tarım-çevre politikaları için homojen alanların belirlenmesi: Ege Bölgesi Örneği. Ekoloji Derg, 7 (67): 5-23, 28.. Berber S, Yıldız H, Özen Ö, Mendeş M, Palaz M: Temporary timing of reproductive traits with respect to environmental variables in Turkish crayfish. Kafkas Univ Vet Fak Derg, 7 (3): , 2.. Nanami A, Nishihira M: The structure and dynamics of fish communities in a Okinawan coral reef: Effects of coral-based habitat structures at sites with rock and sandy sea bottoms. Environ Biol Fish, 63, , Doğan İ: Kümeleme analizi ile seleksiyon. Turk J Vet Anim Sci, 26, 47-53, Erdoğan M, Oğuz C, Kopar A, Özbeyaz C: Genetic varaibility among Arabian horses in Turkey. Kafkas Univ Vet Fak Derg, 5 (2): , SPSS: SPSS 4. for Windows. SPSS Inc, Chicago, IL, Özdamar K: Paket Programlar ile İstatistiksel Veri Analizi, 2. Kaan Kitabevi, Eskişehir, Tatlıdil H: Uygulamalı Çok Değişkenli İstatistiksel Analiz, Ziraat Matbaacılık A.Ş. Ankara, Daşdemir İ, Güngör E: Çok boyutlu karar verme metotları ve ormancılıkta uygulama alanları. ZKÜ Bartın Orman Fak Derg, 4 (4): -9, Çakmak Z: Kümeleme analizinde geçerlilik problemi ve kümeleme sonuçlarının değerlendirilmesi. Dumlupınar Üniv Sosyal Bil Derg, 3, 87-25, Fındıkkaya A: Çok boyutlu ölçekleme analizi ve bir uygulama denemesi. Yüksek Lisans Tezi, Uludağ Üniv Sosyal Bilimler Enst Ekonometri Anabilim Dalı İstatistik Bilim Dalı, Bursa, Doğan İ: Kuzularda büyümenin çok boyutlu ölçekleme yöntemi ile değerlendirilmesi. Uludağ Üniv Vet Fak Derg, 22 (2): 33-37, Bülbül S, Köse A: Türkiye de bölgelerarası iç göç hareketlerinin çok boyutlu ölçekleme yöntemi ile incelenmesi. İstanbul Üniv İşletme Fak Derg, 39 (): 75-94, Anonim: Balıkesir ili damızlık koyun keçi yetiştiricileri birliği dergisi. Ekim-Kasım-Aralık sayısı, (): 6-7, Dinçer B, Özaslan M, Satılmış E: İllerin sosyo-ekonomik gelişmişlik sıralaması Araştırması. Devlet Planlama Teşkilatı, Yayın No: 2466, Ankara, 996.

78 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE * ** The Effects of Dietary Flaxseed Oil Supplementations on Fatty Acids Composition of The Yolks in Quail (Coturnix Coturnix Japonica) Eggs Özcan Barış ÇİTİL * İskender YILDIRIM ** Sinan Sefa PARLAT ** Department of Animal Nutrition and Nutritional Disorders, Veterinary Faculty, Selcuk University, TR-4275 Konya - TURKEY Department of Animal Science, Agricultural Faculty, Selcuk University, TR-4275 Konya - TURKEY Makale Kodu (Article Code): KVFD Summary This experiment was carried out to determine effects of Japanese quail diets which is supplemented with different levels of omega-3 fatty acids compositions in yolk. In this study, one hundred-twenty laying quails at weeks of age (Coturnix coturnix japonica) were used. They were divided into 4 tretament groups, each group included 3 quails. The diets in treatment groups contained different levels of flaxseed oil,., 2., and 3.%, respectively. At the end of the experiment lasted for 2 days, 7 eggs taken from each group were subjected to analysis. The fatty acid compositions of egg yolks were determined by gas chromatography. Twenty seven different fatty acid components were determinated in the compositions of quail egg yolks. No differences were found in oil content among the groups. The increased ingestion of linolenic acid in diet reduced the formation of arachidonic acid in egg yolks of the treatment groups. The ω-3 fatty acid levels were higher in all treatment groups than that of control group. Supplemental flaxseed oil at the level of 3% increased the concentration of ω-3 in egg yolk. At the end of the experiment, the ω-3/ω-6 ratio increased from.5 (control) to.8 (3.%). It was observed that when flaxseed oil amounts was increased in quail rations, omega-3 fatty acid amounts in egg yolk was improved. Keywords: Quail egg yolk, Omega-3, Fatty acid, Flaxseed oil Özet Bıldırcın (Coturnix Coturnix Japonica) Rasyonlarına Keten Tohumu Yağı İlavesinin Yumurta Sarısının Yağ Asiti Kompozisyonu Üzerine Etkileri Bu araştırmada japon bıldırcını rasyonlarına farklı oranlarda ilave edilen keten tohumu yağının yumurta sarısında bulunan omega-3 yağ asidi kompozisyonları üzerine etkileri incelendi. Bu çalışmada 2 adet haftalık yaşta japon bıldırcını (Coturnix coturnix japonica) kullanılmıştır. Her bir grup 3 bıldırcından oluşan, dört gruba bölünmüştür. Denemede, rasyonlara, keten tohumu yağının %,, 2 ve 3 seviyeleri ilave edilmiştir. 2 gün süren denemenin sonunda her alt gruptan yumurta alınarak analiz edilmiştir. Yumurta sarılarının yağ asidi kompozisyonları gaz kromatografisi cihazında belirlenmiştir. Bıldırcın yumurtalarının kompozisyonlarında yirmi yedi farklı yağ asidi belirlenmiştir. Dört gruptan elde edilen yumurtaların ham yağ oranlarında farklılık bulunmamıştır. Rasyonlarda linolenik asitin artması, yumurtadaki araşidonik asitin oranını azaltmıştır. Yemlerine keten tohumu yağı ilave edilen deneme gruplarına ait yumurta sarısı ω-3 yağ asidi seviyesi, kontrol grubundaki yağ asidi seviyesinden daha yüksektir. Rasyonlara keten tohumu yağı ilavesi, yumurtadaki ω-3 yağ asidi oranını artırmıştır. Denemenin sonunda ω-3/ω-6 oranı.5 den (kontrol),.8 e (3.%) yükselmiştir. Japon bıldırcınlarında keten tohumu yağı miktarı artırıldığı zaman, yumurtadaki omega-3 yağ asitleri oranı artar. Anahtar sözcükler: Japon bıldırcını yumurtası, Omega3, Yağ asidi, Keten tohumu yağı İletişim (Correspondence)

79 762 The Effects of Dietary Flaxseed... INTRODUCTION Dietary fats or oil supplies were shown to change the fatty acid composition of egg yolk in laying hens. Fatty acids play important metabolic, structural and functional roles in physiology. ω-3/ω-6 ratio of 5: was recommended by researchers. This unsatisfactory ratio in human nutrition leads to falling regulation of ω-3 PUFA derived from endogenous synthesis of docosahexaenoic acid (DHA, C22:6, ω3) and eicosapentaenoic acid (EPA, C2:5, ω3), which are known to be important factors in the prevention of human cardiovascular diseases. A ratio of ω-3/ω-6 in food should contribute to maintenance and improvement of human health 2. Fish is one of the best known sources of ω-3 PUFA in human diet, as it is rich in EPA and DHA fatty acids. Another sources of ω-3 PUFA are oil seeds, particularly flaxseed, which has a high level of linolenic acid content (5-55%) 3. Several studies have demonstrated that ω-3 PUFA level in yolk was increased by the addition of flaxseed to poultry diet 4. The increased level of ω-3 PUFA promotes a qualitative change fatty acid composition in egg yolk. With ω-3/ω-6 ratio increasing contributes to a more beneficial human nutritional 5. Generally, except for fish, animal originated fats contain triglycerides consist of dominantly palmitic or stearic acids. As known, palmitic acid and stearic acid are longchain saturated fatty acids. It is attributed these fatty acids are commonly responsible for health problems such as cardio-vascular diseases of humans 6. Common varieties of flaxseed has high concentrations of polyunsaturated fatty acids, especially linolenic acid 7. ω-3 fatty acid content of eggs can be significantly increased by feeding flaxseed 8. Several reports have stated that the ration containing flaxseed oil, decreased the omega-6 fatty acids and omega-6/omega-3 fatty acid ratio significantly, whereas increased the amount of omega-3 fatty acid 9,. Enrichment of ω-3 PUFA in eggs of laying hens or quails is a successful strategy to ensure an adequate supply of ω-3 PUFA for the health of population. Production of ω-3 PUFA enriched eggs can be realized by adding common sources of ω-3 PUFA (i.e. fish oil, marine algae, or linseed) to the layer diet. Therefore, the aim of this study was to determine the effects of dietary oil, rich in omega-3 fatty acids, on the fatty acids composition of quail egg yolk. Additionally, this investigation aimed to improve the nutritional quality of quail egg yolk by increasing its ω-3/ω-6 ratio. MATERIAL and METHODS Animals and Diets In the periods of 2 days, 2 laying quails (Coturnix coturnix japonica) at weeks of age were housed in battery cages and assigned to four experimental diets. Quails were housed 5 per cage. Quails has been kept 4x3x3 cm sized stainless-steel cages. Animals were kept in the cages in a room at 22±2 o C and equal light/ dark periods (2/2 h). Experimental diets contained flaxseed oil levels of,.%, 2.%, 3.%, respectively. The chemical composition of all diets are listed in Table. Experiment was done Duzgunes of Research Farm in Selçuk University. Flaxseed oil that was used in the experiment was bought from Zade oil factory in Konya. Sample Collection Seven eggs from each dietary treatment were randomly selected and analyzed to determine the total lipid and fatty acids composition, at the end of the 2st day of experimental feeding. The yolks from each egg were separated mechanically and held in polyethylene packing (in N 2 atmosphere) at -8 C. Feed Analysis The contents of dry matter, ash, crude protein and crude fat were determined according to the methods of AOAC 2. Feeds were analyzed in Department of Animal Nutriton Laboratuary in Faculty of Veterinary in Selcuk University. Fatty Acid Analysis Total lipids were extracted from the egg yolk samples by the method of Folch et al. 3. Four-grams samples of egg yolk were homogenised with 8 ml of a 2: (v/v) mixture of chloroform-methanol, after 4 ml.88% NaCl was added; the liquid was mixed and left to stand for 2 h to allow phase separation. The chloroform-methanol extract was evaporated to dryness in a water bath at 5 C under N 2 flow. The lipid extracts were then converted to fatty acid methyl esters by using boron-trifluoridemethylation solution (catalogue no. 3-32). The Fatty acid methyl esters (FAMEs) were separated and analyzed by gas chromatograph (GC) Shimadzu 5-A, equipped with dual flame ionisation detector and a.8 m x 3 mm internal diameter packed glass column containing /2 Chromosorb WAW coated with % SP 233 in Department of Animal Nutrition in Selcuk University. The injector and detector temperatures were 225 and 245 C, respectively. Column temperature program was 9 C for 35 min then increasing at 3 C/min up to 22 C where it was maintained for 5 min. Nitrogen at a flow rate of 2 ml/min was used as the carrier gas. The fatty acid compositions were identified by the comparison of retention times with known as external standard mixtures, quantified by a Shimadzu Class-VP software sysytem. The results were expressed as percentage

80 763 ÇİTİL, YILDIRIM PARLAT distribution of fatty acid methyl esters. All the chemicals used for the gas chromatography analysis procedure were obtained from Supelco Inc. (Bellefonte, PA, U.S.A.). Statistical Analysis The results were subjected to variance analysis (ANOVA), at 5% significance level, by the Statistica Software 4 version 5.. The mean of values were compared by the Tukey test 5. RESULTS Fatty acid compositions of quail egg yolks are shown in Table 2. Supplementation of different levels of flaxseed oil containing ω-3 to quail layer diets, has led to a dramatically increase of the ω-3 fatty acid composition in the yolks of quail eggs. In this study, flaxseed oil supplementation of layer diets significantly increased ω-3/ω-6 in eggs (Table 3). In addition to these, addition of flaxseed oil to the diet increased the C8:3n-3 and n-3 fatty acid levels in eggs (P<.5). Gas chromatography (GC) analysis of fatty acid methyl esters from the lipids of egg yolk of quails revealed the presence of different 27 fatty acids. DISCUSSION The results of the peresent study show that the fatty acid composition of yolks were greatly affected by the level of flaxseed oil in diet. The main responses were obtained from three polyunsaturated fatty acids (C8:3, C2:4, and C22:6) when flaxseed oils were added to layer diets. The total lipid content of the eggs were also determined in current study. The fat contents of eggs were not influenced by the dietary treatment with flaxseed oil in the study. The lipid content was around 34% in dietary treatments. Similarly, Da Silva et al. 6 found that total lipid of egg of yolk was 34%. There were significantly differences (P<.5) for DHA, ω-3 levels and ω3/ω6 ratio among all the groups. The results observed in this study for ω-3 content were supported by Balevi et al. 7 and Ferrier et al. 8. In the present study, the å ω-3 amount in the eggs from the groups which consumed flaxseed oil in their diet were sinificantly higher than that of the control group. Our results were confirmed by Da Silva et al. 6 who reported that when.5, 3. and 5. g/kg flaxseed oil was added to Table. The Ingridients and chemical compositions of the experimental diets Tablo. Deneme rasyonlarının kimyasal kompozisyonları Ingredients (%) % Flaxseed Oil % Flaxseed Oil 2% Flaxseed Oil 3% Flaxseed Oil Corn Soybean meal Flaxseed oil Limestone Soybean oil Dicalcium phosphate Salt Vitamin...2. Mineral DL-Methionine Mineral vitamin supp L-Lys HCl..2 Ca P Lysin Cystine Energy ((kcal/kg) Total.... Dry matter % Crude ash % Crude protein % Crude fat %

81 764 The Effects of Dietary Flaxseed... Table 2. Fatty acids composition of experimental diets (%) Tablo 2. Deneme rasyonlarının yağ asidi kompozisyonları (%) Fatty Acids Name of Fatty Acid % Flaxseed Oil % Flaxseed Oil 2% Flaxseed Oil 3% Flaxseed Oil C 8: Kaprilic acid C 9: Nonanoic acid C 2: Lauric acid C 4: Myristic acid C 6: Palmitic acid C 8: Stearic acid C 2: Arashidic acid C 2: Heneikosanoic acid C 22: Behenic acid Σ SFA C 4: ω5 Myristoleic acid C 6: ω7 Palmitoleic acid C 8: ω9 Oleic acid C 2: ω9 Gadoleic acid C 22: ω9 Erucic acid Σ MUFA C 6:2 ω4 Palmitoelaidic acid C 8:2 ω6 Linoleic acid C 8:3 ω3 Linolenic acid C 2:4 ω6 Arachidonic acid C 2:5 ω3 Eicosapentaenoic acid C 22:3 ω3 Docosatrienoic acid C 22:4 ω6 Docosatetraenoic acid C 22:5 ω3 Docosapentaenoic acid C 22:6 ω3 Docosahegzaenoic acid Σ PUFA ω ω ω3/ω the diets of quail eggs, w-3 amounts in eggs were found to be as.5, 2.36 and 3.7%, respectively. In general, It has been respected the total contents of C 6:, C 8:, C 8: and C 8:2 fatty acids are accounted about 9% of the total fatty acids in egg 9. Similar results were identified in this study for all fatty acid contents of egg yolks. Palmitic acid was the primary saturated fatty acid at level of % in egg yolk of groups fed with different diets. These results were similar to research data reported by Manila et al. 2 and Cachaldora et al. 2 for egg. Cherian et al. 22 reported that Monounsaturated fatty acid content in laying quail egg yolks to be in very wide range of total fatty acids ( %). In this work, the MUFA contents were higher than SFA contents of quail egg yolks, as 48.96, 52., 5.99, and 5.9%, respectively. Gao and Charter 23 verified correlation between ω-3 and Arachidonic acid in their works. In this work, it was observed a decrease for arachidonic acid (P<.5) in egg yolks. Arachidonic acid contents were found in egg yolk of the treatment groups as.76,.7,.44, and.5%, respectively. These differences may be attributed to the competition between the two fatty acids families (ω-6 PUFA and ω-3 PUFA) for the Δ6 desaturase enzyme involved in the desaturation process. This enzyme has a large affinity for ω-3 fatty acids and needs a lower quantity of these acids than of the ω-6 series to generate the same amount of product 24. Thus, the increased ingestion of ω-3 in diet results in a significant decrease in the formation of Arachidonic acid. Parlat et al. 25 obtained higher levels of ω-3 PUFA in eggs of hens fed with enriched ω-3 diets. In regard to the importance of PUFA in the formation of ω-3 and ω-6 metabolites, a : ratio of dietary ω-3/ω-6 fatty acids

82 765 ÇİTİL, YILDIRIM PARLAT Table 3. Total Fatty acid compositions of egg yolks of quail fed diets with different amounts of flaxseed oil (%) Tablo 3. Keten tohumu yağının farklı miktarlarıyla beslenen japon bıldırcınlarının yumurta sarılarındaki yağ asidi kompozisyonları (%) Fatty Acids % Flaxseed Oil (n=7) % Flaxseed Oil (n=7) 2% Flaxseed Oil (n=7) 3% Flaxseed Oil (n=7) C 8:.±..2±..±..±..69 C :.±..±..±..±..87 C 2:.3±..±..3±.8.3±.8.54 C 4:.46±..45±.3.45±.3.47±.2.87 C 5:.3±.3 a.±. b.±. b.±. b. C 6: 25.3±6.7 b 25.2±.9 a 25.2±.32 a 24.89±.9 a. C 7:.8±.2 a.4±.2 b.2±. bc.2±. c. C 8: 8.4±.87 b 8.9±.7 a 6.58±.8 a 7.±.73 a.3 C 2:.7±.3.3±..3±..3±..57 C 22:.±.3 a.±. b.±. b.±. b. C 24:.57±..29±.6.4±.4.42±.5.24 Σ SFA C 4: ω5.2±. a.9±. b.9±. b.±. b. C 6: ω7 5.45±.27 b 4.6±.25 a 4.62±.7 a 4.89±.8 a.2 C 8: ω9 43.9±.72 b 47.±.22 a 46.99±.9 a 46.6±.7 a. C 2: ω9.24±.5.±.2.2±..2±..2 C 22: ω9.±.3 a.±. b.±. b.±. b. Σ MUFA C 8:2 ω6 3.74±3.28 b.67±.66 a.6±.44 ab.23±.7 a.4 C 8:3 ω3.24±.5 b.6±.2 b.47±.7 b.94±.2 a. C 2:2 ω3.±. b.7±.2 ab.8±.2 ab.8±.2 a.9 C 2:3 ω3.7±.2 ab.7±. ab.9±. b.2±. a. C 2:4 ω6.76±.39 a.7±.2 b.44±.5 c.5±.9 d. C 2:5 ω3.±.3 a.±. b.±. b.±. b. C 22:2 ω3.±.3 a.±. b.±. b.±. b. C 22:3 ω3.±.3 a.±. b.±. b.±. b. C 22:4 ω6.6±.3 a.5±. b.5±. b.5±. b. C 22:5 ω3.23±.4.29±.8.35±.8.4±.8.24 C 22:6 ω3*.2±.3 d.59±.3 c.69±.6 b.72±.7 a. Σ PUFA ω3*.76±.8 d.2±.7 c.6±.9 b 2.2±.9 a. ω6 5.66±3.73 a 2.6±.65 c 3.29±.46 b 2.62±.75 c.29 ω3/ω6*.5±.2 d.9±. c.2±. b.8±.2 a.3 SFA/PUFA 2.2±.49 b 2.55±.4 a 2.25±.8 a 2.25±.8 a. Total Lipid levels of egg yolks (%) SFA: Saturated Fatty Acid, MUFA: Monounsaturated Fatty Acid, PUFA: Polyunsaturated Fatty Acid * a - d Mean values within the same row sharing a common superscripts are significantly different at P<.5 P has been recommended in human diets 26. In the current study ω-3/ω-6 ratio of all the groups ranged from.5 to.8, whereas ω-3/ω-6 ratio of the control group were lower than that of other treatment groups (P<.5). Harper and Jacobson 27 have reported that the coronary disease were reduced when the diets enriched with ω-3. Simopoulos 28 has outlined that dietary ω-3/ω-6 ratio might be acceptable up to :4. In the current study, ω-3/ω-6 ratio were found in egg yolks of the groups as.5,.9,.2,.8%, respectively. Our results was supported by Da Silva et al. 6 who found that ω-3/ω-6 ratio was found from.5,.,.5,.22%, respectively. As conclusion, addition of different amounts of flaxseed oil to the quail diets did not have any negative effects on fatty acid composition in yolk content. The ω-3 fatty acid

83 766 The Effects of Dietary Flaxseed... content and ω-3/ω-6 ratio were improved by addition of the different amounts of flaxseed oil quail to diets. Therefore, it is concluded that ω-3 fatty acid compositions of egg yolk oil may be modified by the diets of quail, which could result in a beneficial nutritional effect for human health. REFERENCES. Sim JS, Bragg DB, Hodgson GC: Effect of dietary animal tallow and vegetable oil on fatty acid composition of egg yolk, adipose tissue and liver of laying hens. Poult Sci, 52, 5-57, Pfeuffer M: Physiologic effects of individual fatty acids in animal and human body, with particular attention to coronary heart disease risk modulation. Arch Tierzucht, Dummerstorf, 44, 89-98, Chen ZY, Ratnayake WMN, Cunnane SC: Oxidative stability of linseed lipids during baking. J Am Oil Chem Soc, 7 (6): , Milinsk MC, Murakami AE, Gomes STM, Matsushita M, De Souza NE: Fatty acid profile of egg yolk lipids from hens fed diets rich in n-3 fatty acids. Food Chem, 83, , Simopoulos AP: Redefining dietary reference values and food safety. World Rev Nutr Diet, 83 (3): , Caston L, Leeson S: Dietary flax and egg composition. Poult Sci, 69, 67-62, Genser MV: Description and composition of flaxseed. In, Flax Seed, Health, Nutrition and Functionality. pp The Flax Council of Canada. Winnipeg, MB, Canada, Jiang Z, Ahn DU, Sim JS: Effects of feeding flax and two types of sunflower seeds on fatty acid compositions of yolk lipid classes. Poult Sci, 7, , Balevi T, Coskun B: Effects of some dietary oils on performance and fatty acid composition of eggs in layers. Rev Med Vet, 5, , 2.. Hargis PS, Elswyk MEV, Hargis BM: Dietary modification of yolk lipid with menhaden oil. Poult Sci, 7, , 99.. Baucells M, Crespo N, Barroeta AC, Lopez-Ferrer S, Grashorn MA: Incorporation of different polyunsaturated fatty acids into eggs. Poult Sci, 79, 5-59, Association of Official Analytical Chemists (AOAC): Official Methods of Analysis. 7th ed. 2nd Revision. AOAC, Gaithersburg, MD, USA, Folch J, Lees M, Sloane-Stanley GH: A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem, 226, , Statistica. Statistica 5. Software. Tucksa, USA: Statsoft Duzgunes O, Kesici T, Kavuncu O, Gurbuz F: Arastırma ve Deneme Metotları, (Istatistik Metotları II) Ankara Üniversitesi Ziraat Fakultesi Yay. No: 2, Da Silva WA, Elias AHN, Aricetti JA, Sakamoto MI, Murakami AE, Gomes STM, Visentainer JV, De Souza NE, Matsushita M: Quail egg yolk (Coturnix coturnix japonica) enriched with omega-3 fatty acids. LWT- Food Sci Technol, 42 (2): , Balevi T, Coskun B, Aktumsek A: Use of oil industry by-products in broiler diets. Rev Med Vet-Toulouse, 52 (): 85-8, Ferrier LK, Caston LJ, Leeson S, Squires J, Weaver BJ, Holub BJ: Alpha-linolenic acid- and docosahexaenoic acid-enriched eggs from hens fed flaxseed: Influence on blood lipids and platelet phospholipid fatty acids in humans. Am J Clin Nutr, 62, 8-86, Tesedo J, Barrado E, Angeles SM, Tesedo A, De la Rosa F: Fatty acid profiles of processed chicken egg yolks. J Agr Food Chem, 54 (7): , Manilla HA, Husveth F, Nemeth K: Effects of dietary fat origin on the performance of broiler chickens and on the fatty acid composition of selected tissues. Acta Agraria Kaposvariensis, 3 (3): 47-57, Cachaldora P, Blas JC, García-Rebollar P, Álvarez C, Méndez J: Effects of type and level of supplementation with dietary ω-3 fatty acids on yolk fat composition and ω-3 fatty acid retention in hen eggs. (Short comm). Span J Agric Res, 3 (2): 29-22, Cherian G, Holsonbake TB, Goeger MP: Fatty acid composition and egg component of speciality eggs. Poult Sci, 8 (): 3-33, Gao YC, Charter EA: Nutritionally important fatty acids in hen egg yolks from different sources. Poult Sci, 79 (6): , Hussein N, Ah-Sing E, Wilkinson P, Leach C, Griffin BA, Millward DJ: Long-chain conversion of [3C]linoleic acid and a-linolenic acid in response to market changes in their dietary intake in men. J Lipid Res, 46 (2): , Parlat SS, Citil OB, Yildirim I: Effects of dietary fats or oils supplementations on fatty acid composition of yolk of brown eggs. Asian J Chem, 22 (2): , Simopoulos AP: Role of poultry products in enriching the human diet with ω-3 PUFA. Human requirement for ω-3 polyunsaturated fatty acids. Poult Sci, 79, 96-97, Harper CR, Jacobson TA: The fats of life: The role of omega-3 fatty acids in the prevention of coronary heart disease. Arch Intern Med, 6 (8): , Simopoulos AP: Omega-6/Omega-3 essential fatty acid ratio and chronic diseases. Food Rev Int, 2 (): 77-9, 24.

84 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Seroprevalence of Antibodies Against Neospora caninum in Cows in Van Province [] Muhammet ALAN * Yunus CETIN ** Said SENDAG *** Hasan Altan AKKAN **** Mehmet KARACA **** [] This study was funded by Yuzuncu Yil University, Scientific Research Projects Fund (Project No: 27-VF-B6) * Eskisehir Osmangazi University, Faculty of Agriculture, Department of Animal Science, TR-2648 Eskisehir - TÜRKİYE ** Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, TR-5 Burdur - TÜRKİYE *** Yuzuncu Yil University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, TR-658 Van - TÜRKİYE **** Yuzuncu Yil University, Faculty of Veterinary Medicine, Department of Internal Diseases, TR-658 Van - TÜRKİYE Makale Kodu (Article Code): KVFD Summary The objective of this study was to determine the seroprevalence of Neospora caninum by celisa among cows in Van province in Turkey. As material; 45 cows consisting of Brown Swiss, Simmental, Holstein, native species and crossbreds of these and given birth before at least one time were used. Approximately 7 ml blood sample was drawn from the jugular vein of each animal into the plain tubes. Sera obtained from the blood samples were stored at -2 C and processed using a commercial N. caninum antibody test kit (celisa; VMRD, Inc.) after two mounts from the last sampling. Inhibitions 3% were interpreted as seropositive and inhibitions <3% were interpreted as seronegative. Seroprevalence of antibodies against N. caninum in cows in Van province was 4.88% as a general average. Seropositive sample rate of the central districts was higher than the rate of central villages,.66% vs. 3.73%. On the other hand, seropositive sample rate of the animals came to the animal hospital from the central villages was higher than the rate of animals sampled in their places, 8.6% vs. 2.87%. In conclusion, the seroprevalence of N. caninum among cows in Van province in Turkey is lower or higher than those of some other provinces in Turkey and countries or regions in the world. The reason of this may be different cattle breeds, breeding systems and animal traffic among regions or countries. Along with main control measurements to contain N. caninum infection, diagnosing and culling of seropositive animals would give helpful results. Keywords: Neospora caninum, Seroprevalence, Cow, Van Özet Van Yöresinde İneklerde Neospora caninum Antikorlarının Seroprevalansı Bu çalışmada Van yöresindeki ineklerde Neospora caninum seroprevalansının celisa ile belirlenmesi amaçlanmıştır. Çalışmanın materyali olarak; Yerli Irklar, Holştayn, Simental, Esmer ve bunların melezlerinden oluşan ve önceden en az bir kez doğum yapmış 45 inek kullanıldı. Her bir hayvanın jugular venasından cam tüplere yaklaşık 7 ml kan örneği alındı. Kan örneklerinden elde edilen serumlar -2 C de depolandı ve son örnekleme işleminden iki ay sonra ticari bir N. caninum antikor test kiti (celisa; VMRD, Şti.) kullanılarak işlendi. Inhibisyon değeri %3 olanlar seropozitif ve <%3 olanlar seronegatif olarak yorumlandı. Genel bir ortalama olarak Van yöresinde ineklerde N. caninum antikorlarının seroprevalansı %4.88 bulundu. Seropozitif örnek oranı merkez mahallelerinde (%.66) merkez köylerinden (%3.73) daha yüksek idi. Diğer yandan, seropozitif örnek oranı merkez köylerden hayvan hastanesine gelen hayvanlarda (%8.6) köylerde, yerinde, örnek alınan hayvanlara göre (%2.87) daha yüksek olarak elde edildi. Sonuç olarak, Van yöresinde ineklerde N. caninum antikorları seroprevalansının Türkiye deki bazı iller ve dünyadaki bazı ülke veya bölgelerden düşük veya yüksek olduğu görülmektedir. Bunun nedeni farklı sığır ırkları, yetiştirme sistemleri ve bölgeler ya da ülkeler arası hayvan trafiği olabilir. N. caninum enfeksiyonunu kontrol altına almak için esas kontrol yöntemleriyle birlikte, seropozitif hayvanların tanısı ve sürüden uzaklaştırılması yararlı sonuçlar verebilir. Anahtar sözcükler: Neospora caninum, Seroprevalans, İnek, Van İletişim (Correspondence)

85 768 Seroprevalence of Antibodies... INTRODUCTION Neospora caninum is an intracellular protozoan parasite of class coccida,2 and recognized worldwide, in particular in dairy cattle 3-7. Neospora caninum was misdiagnosed as Toxoplasma gondii until 988 because of morphological similarities. After the first report as a cause of abortion in cattle, neosporosis has become a growing concern in dairy and beef cattle reproduction due to important economic losses 4. It has been associated with sporadic, endemic and epidemic abortions,2,8,9. Before the complete life cycle of the parasite was known, findings in epidemiological studies indicated that the presence of dogs on a farm, as the definitive host, increased the risk of N. caninum abortion in cattle. Dogs infected experimentally or under natural condition were shown to excrete N. caninum oocysts with their faeces. Until recently the dog was the only species verified to be a definitive host of the parasite. However, coyotes (Canis latrans) have been shown to be an additional definitive host by the other researchers,9. It is assumed that there may be other definitive hosts in wildlife and some common species have been investigated. For example, foxes have been shown to carry the parasite but it has not been verified that foxes shed oocysts, i.e. are actual definitive hosts. Transplacental or vertical transmission of the parasite from an infected dam to its fetus is the major natural route of infection 9-2. Cattle may also acquire N. caninum infection by horizontal (postnatal) infection through the ingestion of oocysts shed in the feces of the definitive hosts,2,9. There is a study 3 showing intermittent presence of N. caninum in blood and semen and shedding in semen in low numbers. Intrauterine inoculation via contaminated semen cause N. caninum infection in cattle 4. Although some infected cows abort, many fetal infections produce a congenitally infected calf. A congenitally infected heifer calf is capable of transmitting the infection onto the next generation when she becomes pregnant, thus maintaining the infection in the herd 8,9,2. The risk of abortion was 2.2 times higher in the Neospora-seropositive animals than in seronegative animals and significantly higher during the second term of gestation than during the first and third terms 5. N. caninum infection prior to pregnancy appears not to affect the fertility 6 and early fetal period, but does have a significant abortive affect after 9 days of gestation in dairy cows 7,8. The incidence of N. caninum-associated abortion peaks during the fifth to the seventh month of gestation 9. N. caninum infection fails to affect early gestation because the tachyzoites have not enough time for replication to cause foetal death. Nevertheless, it was pointed out that in fetuses from the first period, the N. caninum infection was severe with high parasite loads and important lesions. It could, therefore, be speculated that fetal death could be a consequence of the parasite invasion 2. There is some evidence that the epidemiology of neosporosis varies in dairy and beef cattle. Several studies have shown a lower prevalence of infection in beef cattle compared with dairy herds. The use of beef bull semen can reduce the risk of abortion in dairy cows, and annual screening for neosporosis, specifically the antibody titre to the protozoon, could be a useful predictor of abortion risk in reproductive health programes 9. Vertical transmission of infection is the predominant mode of infection and hence control efforts aimed at selectively culling seropositive animals from the herd are highly successful in reducing the level of infection 2. Repeated iscom ELISA test applied on tank bulk milk at regular intervals seems to be helpful and cost-effective for large epidemiological surveys, for monitoring control strategy plans for N. caninum, and for increasing the bio-safety level in dairy cattle farms 22,23. Although N. caninum is an important abortifacent agent and studied intensively in the world, only a few studies conducted in Turkey were encountered. The objective of this study was to determine the seroprevalence of N. caninum by celisa among cows in Van province in Turkey. MATERIAL and METHODS As material; 45 cows consisting of Brown Swiss, Simmental, Holstein, native species and crossbreds of these and given birth before at least one time were used. Three hundred and thirteen blood samples were collected from the cows in their stables in the villages. Sixty two blood samples were collected from the cows came from 38 villages of Van province to the animal hospital with any health issue. Remaining 75 blood samples were obtained from the animals bred in the stables in the central districts of Van Province. These samples were collected when the animals came to the animal hospital with any health issue. A registration sheet was filled in for every animal included. Approximately 7 ml blood sample was drawn from the jugular vein of each animal into the plain tubes. Sera obtained from the blood samples were stored at -2 C and processed using a commercial Neospora caninum antibody test kit (celisa; VMRD, Inc.) after two mounts from the last sampling. The commercial celisa tests were performed according to the instructions of the manufacturers. Inhibitions 3% were interpreted as seropositive and inhibitions <3% were interpreted as seronegative. The prevalence of N. caninum antibodies was expressed as percentage of samples considered positive with test used to the total samples examined. The prevalences of N. caninum antibodies among different sampling places or villages were compared using Chi-square analysis 29.

86 769 ALAN, CETIN, SENDAG AKKAN, KARACA RESULTS Seroprevalences of antibodies against Neospora caninum in cows in Van province are shown in Table as a whole. The results are detailed in Table 2 and Table 3. Seropositive sample rate of the central districts was higher than the rate of central villages,.66% versus 3.73%. On the other hand, seropositive sample rate of the animals came to the animal hospital from the central villages was higher than the rate of animals sampled in their places, 8.6% versus 2.87%. Reliable case histories of the 6 from 22 Neospora caninum seropositive cows during sampling were not available. Case histories of the other 6 cows are shown in the Table 4. Table. Seroprevalences of antibodies against Neospora caninum in cows in Van province Tablo. Van yöresindeki ineklerde Neospora caninum antikorlarının seroprevalansı Sampling Place Sample Seropositive Sample Seropositive Sample Number (n) Number (n) Rate (%) Central villages of Van province (sampling in the places) a Central villages of Van province (sampling in the animal hospital from cows came from 38 villages except the villages above) b Central districts of Van province (sampling in the animal hospital) c Total Detailed in Table 2, 2 Detailed in Table 3, Table 3; a, b, c: X 2 = 9.45 and P<. Table 2. Central villages of Van province sampled in the places, sample numbers, seropositive sample numbers and rates Tablo 2. Yerinde örnek alınan Van merkez köyleri, örnek sayıları, seropozitif örnek sayı ve oranları Villages. Bardakci (central districts) 2. Bardakci (Gariptepe disrict) 3. Hidir 4. Atmaca 5. Otluca Sample Number (n) Seropositive Sample Number (n) Seropositive Sample Rate (%) 4.6 a b.72 c 3.57 d 5 e Total a, b, c, d, e: X 2 = 2.66 and P>.5 Table 3. Central villages of Van province sampled in the animal hospital, sample numbers, seropositive sample numbers and total seropositive sample rate Tablo 3. Hayvan hastanesinde örnek alınan Van merkez köyleri, örnek sayıları, seropozitif örnek sayıları ve toplam seropozitif örnek oranı Villages Sample Numbers (n) Seropositive Sample Numbers (n) Villages Sample Numbers (n) Seropositive Sample Numbers (n) Seropositive Sample Rate (%). Agzikara 2. Sakalar 3. Yemlice 4. Asagi Ciftlik 5. Golgecik 6. Gedikbulak 7. Yumrutepe 8. Turgali 9. Degirmenozu. Kurubas. Kiratli 2. Citoren 3. Karagunduz 4. Ilikkaynak 5. Kigcak 6. Agarti 7. Enginsu 8. Dibek 9. Pirgarip Hizir 2. Topaktas 22. Kumluca 23. Donerdere 24. Gulsunler 25. Gollu 26. Ocaklı 27. Aktas 28. Ugurveren 29. Yolasan 3. Dagini 3. Ermisler 32. Tevekli 33. Colpan 34. Gulyazi 35. Kasimoglu 36. Ulusar 37. Karaca 38. Gunbasi Total

87 77 Seroprevalence of Antibodies... Table 4. Case histories of Neospora caninum seropositive cows obtained during sampling Tablo 4. Neospora caninum seropozitif hayvanların örnekleme sırasında elde edilen anamnez bilgileri Cows Case Histories Approximately months pregnant Approximately months pregnant Infertile Aborted two times in last pregnancies Normal birth 3 days ago Abort and infertility Approximately months pregnant Abort Approximately 8.5 months pregnant Infertile Normal birth 2 months ago Normal birth 6 months ago Normal birth 5 months ago Normal birth 4 days ago Normal birth 6 days ago and retained fetal membranes Normal birth month ago DISCUSSION Since the discovery of N. caninum, many diagnostic tests have been developed to help in diagnosing this parasitic infection 5. The diagnosis of N. caninum induced abortion in individual cattle is based upon examination of fetal tissues for histological lesions, for tachyzoites by immunohistochemistry, or for parasite DNA by PCR. Validated N. caninum-specific serological assays are necessary for accurate herd-based abortion diagnosis and for population-based epidemiological investigations of disease transmission, disease risk factors, and identification of additional definitive and intermediate hosts 3. The development of serological tests for Neospora infection fills an urgent need in the study of neosporosis. Because the complete host range and life cycle of N. caninum are unknown, antemortem serological tests specifically identifying Neospora-infected animals provide a valuable tool for epidemiologic and diagnostic investigations. Furthermore, the accurate identification of Neosporainfected cattle has important implications in the control of abortion since repeated abortion and congenital transmission can occur in some infected cows 3. In addition, serological testing provides a competitive cost advantage over other tests. Of the different serological assays, ELISA is the most suitable for high throughput screening of antibodies to this parasite 32. Competitive inhibition ELISA (celisa), also used in this study, is unreactive to antigens of 2 closely related apicomplexan protozoa Toxoplasma gondii and Sarcocystis cruzi. This ELISA test has been adopted by many laboratories in Canada as the test of choice for detecting antibody against N. caninum 5. Many cow-level and herd-level seroprevalences of N. caninum are reported from different countries of the world. There is some evidence that the epidemiology of neosporosis varies in dairy and beef cattle. Several studies have shown a lower prevalence of infection in beef cattle compared with dairy herds 9. In dairy cattle; the cow-level seroprevalences ranged from 5.6% to 7.% in western Canada, from 7.5% to 8.2% in Quebec and Ontario, from.4% to 25.5% in Atlantic Canada 5. The rates of 5.7% and 2% were obtained from nationwide of Japon 33 and Parana State of Brazil respectively 4. Individual dairy cattle prevalence of N. caninum was reported as 5.2% (by ELISA) in Greek. The prevalence varies between.5% and 2% in Sweden and % in Spain 7. The herd-level seroprevalence in Australia and New Zealand is usually about 3 to 35% 3. Herd prevalences in dairy cattle in European countries were reported to be 6% in Sweden, 49% in Germany, 63% in Spain and 76% in The Netherlands 7. Seroprevalence rates of N. caninum of about 5 to 6% have been reported in dairy herds in Quebec 3. In beef cattle; cow-level seroprevalences were reported as.5% for 98 and 9% for 998 in northern Alberta 5. Herd-level blood sampling could not be possible because of many reasons in this study. Samples were collected wherever possible; in stables, in pastures or in the animal hospital. The cows randomly sampled were from combined, meet and milk, yielder. Obtained general cow-level seroprevalence rate of N. caninum of 4.88% is seen as near to or lower than the rates given above for other countries, except for Sweden. If it is compared to the other some provinces in Turkey, the seroprevalence rate of 4.88% in Van province is about the same as the rates reported 25 for Malatya (4%), Mus (4.86%) and Bingol (4.69%) but lower than the rates of 7% for Kayseri 27, 9.2% for Sakarya 24 and 5% for Elazıg 25. There is an interesting report 28 that states a seropositive rate of 8.2% for imported Simmental cows and their offspring but no seropositivity in recently aborted local cow breeds in Kars province of Turkey. The reason for higher seropositive animals (8.6% and.66%) sampled in the animal hospital than seropositive animals (2.87%) sampled in the villages could be that some health problems causing the animals being led to the animal hospital, in fact, might be related to Neospora caninum infection. It was difficult to take a decision where dog population, thought as a disseminating factor of the infection, was higher. Case histories of Neospora caninum seropositive cows (Table 4) are similar to those explained in the former reports 2,5,7,2. In conclusion, the seroprevalences of N. caninum among cows in Van province in Turkey are lower or higher than those of some other countries or regions in the world. The reason of this may be different cattle breeds, breeding systems and animal traffic among regions or countries. Along with main control measurements to contain N.

88 77 ALAN, CETIN, SENDAG AKKAN, KARACA caninum infection, diagnosing and culling of seropositive animals would give helpful results. Acknowledgement The authors express their appreciations and thanks for the financial support of Scientific Research Projects Fund, Yuzuncu Yil University. REFERENCES. Frossling J: Epidemiology of Neospora caninum infection in cattle. Doctoral thesis, Swedish University of Agricultural Sciences, Uppsala, Sevgili M, Altaş MG: Neosporosis in cattle. Fırat Üniv Sağlık Bil Derg, 2 (): 79-83, Reichel MP: Neospora caninum infections in Australia and New Zealand. Aust Vet J, 78 (4): , Ogawa L, Freire RL, Vidotto O, Gondim LFP, Navarro IT: Occurrence of antibodies to Neospora caninum and Toxoplasma gondii in dairy cattle from the northern region of the Parana State, Brazil. Arq Bras Med Vet Zoo, 57 (3): 32-36, Haddad JPA, Dohoo IR, VanLeewen JA: A review of Neospora caninum in dairy and beef cattle - A Canadian perspective. Can Vet J, 46, , Medina L, Cruz-Vazquez C, Quezada T, Morales E, Garcia-Vazquez Z: Survey of Neospora caninum infection by nested PCR in aborted fetuses from dairy farms in Aguascalientes, Mexico. Vet Parasitol, 36, 87-9, Sotiraki S, Brozos C, Samartzi F, Schares G, Kiossis E, Conraths FJ: Neospora caninum infection in Greek dairy cattle herds detected by two antibody assays in individual milk samples. Vet Parasitol, 52, 79-84, Wouda W, Moen AR, Schukken YH: Abortion risk in progeny of cows after a Neospora caninum epidemic. Theriogenology, 49, 3-36, Anderson ML: Infectious causes of bovine abortion during mid- to late-gestation. Theriogenology, 68, , 27.. Bartels CJM, Wouda W, Schukken YH: Risk factors for Neospora caninum-associated abortion storms in dairy herds in the Netherlands (995 to 997). Theriogenology, 52, , Wouda W, Bartels CJM, Moen AR: Characteristics of Neospora caninum-assoclated abortion storms in dairy herds in the netherlands (995 to l997). Theriogenology, 52, , Andrianarivo AG, Anderson ML, Rowe JD, Gardner IA, Reynolds JP, Choromanski L, Conrad PA: Immune responses during pregnancy in heifers naturally infected with Neospora caninum with and without immunization. Parasitol Res, 96, 24-3, Ferre I, Aduriz G, del-pozo I, Regidor-Cerrillo J, Atxaerandio R, Collantes-Fernandez E, Hurtado A, Ugarte-Garagalza C, Ortega-Mora LM: Detection of Neospora caninum in the semen and blood of naturally infected bulls. Theriogenology, 63, 54-58, Serrano E, Ferre I, Osoro K, Aduriz G, Mateos-Sanz A, Martinez A, Atxaerandio R, Hidalgo CO, Ortega-Mora LM: Intrauterine Neospora caninum inoculation of heifers. Vet Parasitol, 35, 97-23, Lopez-Gatius F, Lopez-Bejar M, Murugavel K, Pabon M, Ferrer D, Almeria S: Neospora-associated abortion episode over a -year period in a dairy herd in north-east Spain. J Vet Med B, 5, , Lopez-Gatius F, Santolaria P, Almeria S: Neospora caninum infection does not affect the fertility of dairy cows in herds with high incidence of Neospora-associated abortions. J Vet Med B, 52, 5-53, Lopez-Gatius F, Pabon M, Almeria S: Neospora caninum infection does not affect early pregnancy in dairy cattle. Theriogenology, 62, 66-63, Stahl K, Bjorkman C, Emanuelson U, Rivera H, Zelada A, Moreno- Lopez J: A prospective study of the effect of Neospora caninum and BVDV infections on bovine abortions in a dairy herd in Arequipa. Peru Prev Vet Med, 75 (3-4): 77-88, Lopez-Gatius F, Santolaria P, Yaniz JL, Garbayo JM, Almeria S: The use of beef bull semen reduced the risk of abortion in Neosporaseropositive dairy cows. J Vet Med B, 52, 88-92, Collantes-Fernandez E, Rodriguez-Bertos A, Arnaiz-Seco I, Moreno B, Aduriz G, Ortega-Mora LM: Influence of the stage of pregnancy on Neospora caninum distribution, parasite loads and lesions in aborted bovine fetuses. Theriogenology, 65, , Hall CA, Reichel MP, Ellis JT: Neospora abortions in dairy cattle: Diagnosis, mode of transmission and control. Vet Parasitol, 28, 23-24, Varcasia A, Capelli G, Ruiu A, Ladu M, Scala A, Bjorkman C: Prevalence of Neospora caninum infection in Sardinian dairy farms (Italy) detected by iscom ELISA on tank bulk milk. Parasitol Res, 98, , Chanlun A, Emanuelson U, Chanlun S, Aiumlamai S, Bjorkman C: Application of repeated bulk milk testing for identification of infection dynamics of Neospora caninum in Thai dairy herds. Vet Parasitol, 36, , Oncel T, Biyikoglu G: Neosporosis caninum in dairy cattle in Sakarya, Turkey. Uludag Univ J Fac Vet Med, 22 (-2-3): 87-89, Aktas M, Saki CE, Altay K, Simsek S, Utuk AE, Koroglu E, Dumanli N: Survey of Neospora caninum in cattle in some provinces in the Eastern Anatolian Region. Acta Parasitol Turcica, 29 (): 22-25, Kurtdede A, Kuplulu S, Ural K, Cingi CC, Guzel M, Karakurum MC, Haydardedeoglu AE: Serodiagnosis of bovine neosporosis with immunocomb assay in Ankara region. Ankara Univ Vet Fak Derg, 53, 27-29, Ica A, Yildirim A, Duzlu O, Inci A: Seroprevalence of Neospora caninum in cattle in the region of Kayseri. Acta Parasitologica Turcica, 3 (2): 92-94, Akca A, Gokce HI, Guy CS, McGarry JW, Williams DJL: Prevalence of antibodies to Neospora caninum in local and imported cattle breeds in the Kars province of Turkey. Res Vet Sci, 78, 23-26, SAS: User s Guide Statistics. 5 th ed., SAS Iinit, Inc, Cary, NC, Baszler TV, Adams S, Vander-Schalie J, Mathison BA, Kostovic M: Validation of a commercially available monoclonal antibody-based competitive-inhibition Enzyme-Linked Immunosorbent Assay for detection of serum antibodies to Neospora caninum in Cattle. J Clin Microbiol, 39 (): , Baszler TV, Knowles DP, Dubey JP, Gay JM, Mathison BA, McElwain TF: Serological diagnosis of bovine neosporosis by Neospora caninum monoclonal antibody-based competitive inhibition Enzyme-Linked Immunosorbent Assay. J Clin Microbiol, 34 (6): , Wu JTY, Dreger S, Chow EYW, Bowlby EE: Validation of 2 commercial Neospora caninum antibody enzyme linked immunosorbent assays. Can J Vet Res, 66, , Koiwai M, Hamaoka T, Haritani M, Shimizu S, Zeniya Y, Eto M, Yokoyama R, Tsutsui T, Kimura K, Yamane I: Nationwide seroprevalence of Neospora caninum among dairy cattle in Japan. Vet Parasitol, 35, 75-79, 26.

89 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE [] * Farklı Tünek Sistemlerinin Etlik Piliçlerde Tibia ve Femur Kemiklerinin Morfolojik ve Kimyasal Özelliklerine Etkileri [] Özgür Barış BİRGÜL * Salim MUTAF * Sezai ALKAN * Bu çalışma Akdeniz Üniversitesi Bilimsel Araştırma Projeleri Yönetim Birimi tarafından desteklenmiştir (Proje No: ) Akdeniz Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR-77 Antalya - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada, farklı tünek sistemlerinin etlik piliçlerde tibia ve femur kemiklerinin morfolojik ve kimyasal özelliklerine olan etkilerinin belirlenmesi amaçlanmıştır. Araştırmada kontrol, yatay tünek, açılı tünek, 2 açılı tünek ve 4 o açılı tünek sistemleri kullanılmıştır. Tibia ve femur kemiklerinin morfolojik özellikleri bakımından uygulama grupları arasındaki farklılıklar önemsizken, cinsiyetler arasındaki farklılıklar önemli bulunmuştur (P<.). Tibia kemiğinin dayanıklılığı bakımından ise kontrol grubu ile diğer gruplar ve cinsiyetler arasında önemli farklılık saptanmıştır (P<.). Tibia kemiğinin kalsiyum ve fosfor içerikleri bakımından gruplar arasında önemli farklılıklar saptanırken, kuru madde ve kül içerikleri bakımından herhangi bir farklılık bulunmamıştır. Anahtar sözcükler: Etlik piliç, Tibia, Femur, Tünek sistemleri The Effects of Different Perch Systems on Morphological and Chemical Traits of Tibia and Femur Bones in Broilers Summary The aim of this study was to determine the effects of different perch systems on morphological and chemical traits of tibia and femur bones in broilers. Control, horizontal perch, angular perch, 2 o angular perch and 4 o angular perch systems were used in this study. There was found significant difference between the sexes (P<.), but differences among the groups were not significant in respect to morphological and chemical traits of tibia and femur bones. As with sexes, the difference between the control and other groups was found significant in terms of tibia bone strength (P<.). In addition, while there was found significant difference among the groups in point of tibia bone calcium and phosphorus contents, there was no difference in terms of dry matter and ash content. Keywords: Broiler, Tibia, Femur, Perch systems GİRİŞ Kanatlı eti son yıllarda insan beslenmesi açısından oldukça büyük öneme sahip olmuştur. Kanatlı etindeki yağ miktarının az, protein miktarı ve kalitesinin zengin değeri yanında üretim maliyetlerinin diğer et ürünlerine göre daha ucuz olması kanatlı etinin önemini arttırmıştır. Etlik piliç üretimi, nüfus çoğalmasına bağlı olarak oluşan tüketim artışları ile tüketici eğiliminin kırmızı etten beyaz ete yönelmesi ve maliyetinin düşük olması nedenleriyle ülkemizde de hızlı bir gelişme göstermiştir. Geçmişte ailelerin sadece kendi yumurta ve et gereksinimlerini karşılamak amacıyla yaptıkları kanatlı hayvan yetiştiriciliği günümüzde modern kesimhaneleri, kuluçkahaneleri, üretim, kuluçka, damızlık işletmeleri ve yem fabrikaları ile büyük bir endüstri haline gelmiştir. Bu ilerlemede, ıslah çalışmaları ile kesim kütlesine kısa zamanda ulaşan ve yemi çok etkin şekilde değerlendiren genotiplerin elde edilmesinin önemi büyüktür. Ancak canlı kütledeki hızlı artış, sindirim, solunum ve iskelet sisteminde bir takım İletişim (Correspondence)

90 774 Farklı Tünek Sistemlerinin... aksaklıkların ortaya çıkmasına neden olabilmektedir. Bacak kusurları da, bu gibi aksaklıklardan birisi olup büyük oranda büyümenin erken dönemindeki hızıyla ilişkilidir 2. Bacak kusurları etlik piliçlerin genetik potansiyellerinin gerektirdiği verim düzeylerini göstermelerini engelleyerek karkas kalitesinin gerilemesine ve ölümlere neden olan metabolik olaylar sonucu ortaya çıkan anatomik bir bozukluktur 3. Canlı ve karkas kütlelerindeki artışlara oranla bacak kaslarının ve iskelet sisteminin aynı ölçüde gelişmemesi tibiada bacak kusurlarına yol açmaktadır 4. Tünekler, hayvanların daha az kullandıkları bölgelerin merkez alanlarının kullanımlarını arttırmak için uygun olan yerlere konulmaktadır 5. Tünek kullanımının kanatlı üretimi içerisinde birçok yararları vardır. Tünekler, kanatlı kümeslerinde hayvanların daha rahat hareket etmelerini sağlamaktadır 6. Tünek kullanımının temel yararı, hayvanların hareketliliğini arttırmasıdır. Kanatlıların yaptıkları hareketler bacak kusurlarını azaltıcı bir etki göstermektedir 7,8. Tüneklerin kullanılmasıyla, piliçler tüneyerek basit yürüme hareketinden farklı olarak bacak kası ve eklemlerini çalıştırmaktadır. Bu durum, haftalar ilerledikçe etlik piliçlerin hareketlenmeleri için çok önemlidir. Çünkü yaş ilerledikçe canlı kütle artışından dolayı hareketlilik azalmaktadır 9. Tünek kullanımı harekete bağlı olarak etlik piliçlerin gelişmelerini etkilemekte, tünerken ya da yürürken kanat, göğüs ve bacak kasları gelişmektedir. Bununla birlikte, tünek kullanımının bacakları, kanatları ve kasları geliştirici etkileri de vardır. Bacak kusurları olan piliçler yemliğe ve suluğa ulaşmakta zorlandıkları için canlı kütle artışı gerilemekte ve buna bağlı olarak da sürüde bir örneklilik bozulmaktadır. Özellikle büyütme döneminde %.5 ile 5 arasında kayıplara yol açan bu kusurlar karkas kalitesinde de gerilemeye neden olmaktadır. Bakır, çinko ve mangan gibi mineraller çeşitli vücut fonksiyonlarında, yaşamın sürdürülmesinde, sağlığın korunmasında ve kemiklerin yapısal özelliklerinde önemli rol oynamaktadır 2,3. Günümüzde kafeste etlik piliç yetiştiriciliğinin giderek azalması ve yetiştiricilerin yer sistemini tercih etmesiyle birlikte yerde değişik barındırma koşullarının araştırılmasının gerekliliği ortaya çıkmıştır. Yerde barındırma ile ilgili yapılan çalışmalarda genellikle yerleşim sıklığı, altlık kalitesi ve karkas özellikleri üzerinde durulmuş, buna karşılık yerde barındırmada değişik taban ayrıntıları ve bunların etlik piliçlerdeki bacak kusurlarına olan etkileri üzerinde çok fazla durulmamıştır 3,4,5. Bu çalışmada, etlik piliçlerde hareketliliğin arttırılmasını sağlayan yerde barındırmadaki değişik taban ayrıntıları ve tünek kullanımının tibia ve femur kemiklerinin morfolojik ve kimyasal özelliklerine olan etkilerinin belirlenmesi amaçlanmıştır. MATERYAL ve METOT Materyal Araştırma, Akdeniz Üniversitesi Ziraat Fakültesi Zootekni Bölümü Hayvancılık Ünitesi nde bulunan perdeli tavuk kümesinde yaz aylarında tesadüf parselleri deneme desenine göre 4 tekerrürlü olarak yürütülmüştür. Piliçler 5 farklı barındırma koşulunda yetiştirilmiş olup bunlar; kontrol grubu (altlıklı), altlıklı + yatay (açısız) tünekli, atlıklı + º eğimli tünekli, altlıklı + 2º eğimli tünekli ve ızgaralı 4 eğimli merdiven tünekli guruplardan oluşmaktadır. Her bir bölme.8 x.4 m boyutlarında, 5 erkek, 5 dişiden oluşan toplam 3 piliç olacak şekilde düzenlenmiştir. Araştırmada, Ross 38 genotipine ait 3 erkek ve 3 dişi olmak üzere toplam 6 adet bir günlük yaştaki etlik civcivler kullanılmıştır. Denemede -3. haftalarda başlatma (%23 HP, 285 ME kcal/kg) ve 4-7. haftalarda ise büyütme (%2 HP, 3.2 ME kcal/kg) yemi kullanılmıştır (Tablo ). İlk gün 24 saat aydınlatma uygulanmış olup daha sonra ise 23 saat Tablo. Denemede kullanılan rasyonların içerikleri Table. The contents of diets used in the experiment Ham Maddeler Oranı (%) Ham Maddeler Oranı (%) Mısır 45. Mısır 55. S.F.K S.F.K 2. T.Y.S. 2. T.Y.S. 5.5 Bitkisel Yağ 5. Bitkisel Yağ 3.6 Balık Unu 3. Balık Unu 2.5 DCP 8.65 DCP 8.4 Mermer Tozu. Mermer Tozu.25 Tuz.4 Tuz.33 Vitamin 5/5.25 Vitamin 5/5.25 DL-Metiyonin.6 DL-Metiyonin.8 Mineral Kanatlı. Mineral Kanatlı. Ham protein 23 2 Metabolik enerji

91 775 BİRGÜL, MUTAF, ALKAN aydınlatma ve saat karartma uygulanmıştır. Üçüncü, dördüncü, beşinci, altıncı ve yedinci haftalardaki sıcaklık ve nem değerleri sırasıyla 29.38±.34ºC, %42.4±.9; 26.64±.29ºC, %39.56±.62; 26.26±.3ºC, %4.62±.6; 26.5±.24ºC, %47.23±.83 ve 25.26±.32ºC, %43.77±.9 olarak ölçülmüştür. Metot Denemede Kullanılan Tünek Sistemleri. Yatay Tünek: Yüksekliği cm, uzunluğu 9 cm ve 6 eşit parçaya ayrılmış 3 cm lik yan tünek çıtası bulunmaktadır. Yan tünek çıtaları arasındaki açıklık 5 cm dir. 2. º Eğimli Tünek: Yüksekliği 7 cm, uzunluğu 9 cm ve 6 eşit parçaya ayrılmış 3 cm lik yan tünek çıtası bulunmaktadır. Yan tünek çıtaları arasındaki açıklık 5 cm dir. 3. 2º Eğimli Tünek: Yüksekliği 33 cm, uzunluğu 9 cm ve 6 eşit parçaya ayrılmış 3 cm lik yan tünek çıtası bulunmaktadır. Yan tünek çıtaları arasındaki açıklık 5 cm dir Eğimli Merdiven Tünek: Yüksekliği 7 cm, uzunluğu, 5 cm ve 7 eşit parçaya ayrılmış 3 cm lik yan tünek çıtası bulunmaktadır. Yan tünek çıtaları arasındaki açıklık 5 cm dir. Tünek sistemlerine ait ayrıntılar Şekil de verilmiştir. Piliçler, araştırmanın ilk iki haftasında, LPG ile çalışan radyan ısıtıcıların kullanıldığı durolitle çevrilmiş bölmelerde tutulmuşlardır. Bölmelerdeki beton zemin üzerine, soğuktan korunması ve hijyenik koşulların sağlanması amacıyla cm kalınlığında ağaç talaşından altlık serilmiştir. Sıcaklık, civcivlerin bulunduğu düzeyde ilk hafta C, ikinci hafta 3-3 C tutulmuş ve ikinci haftadan sonra ek ısıtma yapılmamıştır. Civcivler, ilk iki hafta yetiştirildikleri bölmelerde de tünek uygulamalarına alışmaları için kullanılan tünek ayrıntılarının açılarına göre küçük modelleri yapılmış ve ilk günden itibaren bunları kullanmaları sağlanmıştır. Tibia Kemiğindeki Kimyasal Analizler Kuru Madde Analizi (KM): Kütleleri saptanan tibia kemikleri bir makas yardımı ile kesilerek -.5 cm uzunluğunda parçalara ayrılmış ve parçalanan kemikler 5 C ye ayarlı kurutma dolabında durağan kütleye ulaşana kadar kurutulmuşlardır. Kuru madde miktarı aşağıdaki eşitlikten bulunmuştur. KM (g) KM, % = x Kurutmaya konulan miktar (g) Ham Kül Analizi (HK): Parçalanmış kemikler, yem değirmeninde öğütülerek toz haline getirilmiş, alınan örnekler 6 C ye ayarlı yakma fırınında beyaz bir kül elde edilinceye Şekil. Tünek sistemlerinin ayrıntıları Fig. Deatils of perch systems

92 776 Farklı Tünek Sistemlerinin... kadar yakılmıştır. Hesaplamalar aşağıdaki eşitliğe göre yapılmıştır. HK (g) KM de HK, (%) = x KM (g) Fosfor Analizi: Her tekerrürden 3 erkek ve 3 dişi olmak üzere toplam 2 pilicin sol butunun tibia kemiği çıkartılmış, tibia kemikleri öncelikle küçük parçalara ayrılmış ve öğütülmüştür. Daha sonra, analize geçmeden önce 6 C de kurutma dolabında bir gece kurutulmuştur. Kemik örneklerine yaş yakma işlemi uygulanarak bünyelerinde bulunan organik maddeler uzaklaştırılmıştır. Yaş yakma işlemi için nitrik ve perklorik asit karışımı kullanılmıştır 6. Yaş yakma işlemi için kullanılan asit karışımı, özgül kütlesi.4 olan. ml nitrik asit (HNO 3 ) üzerine, 25 ml %7 lik perklorik asit (HClO 4 ) ilave edilerek hazırlanmıştır. Öğütülmüş kemik örneğinden.25 g örnek, ml lik erlenmayere konulmuş, üzerine 2 ml nitrikperklorik asit karışımı ilave edilmiş ve kemik örneklerinin asitle karışması için iyice çalkalanmıştır. Çalkalanan örneklerin üzerlerine huni yerleştirilerek bir gece çeker ocakta bekletilmiştir. Beklemiş örneklere, ayarlanabilir ısıtıcı üzerinde, 5-2 C sıcaklıkta yaş yakma işlemi uygulanmıştır. Bu işleme ml çözelti kalıncaya kadar devam edilmiştir. Çözeltiye bir miktar saf su ilave edildikten sonra, elde edilen çözelti, fosforsuz filtre kâğıdından süzülmüş ve ml ye tamamlanıp karıştırıldıktan sonra, plastik şişelere konularak buzdolabında saklanmıştır. Ölçüm zamanı geldiğinde hazırlanan çözeltiden ml alınarak üzerine 4 ml barton çözeltisi ve 9 ml saf su ilave edilip karıştırılarak spektofotometrede okunmuştur. Standart çözeltilerin hazırlanmasında.439 g KH 2 PO 4,. ml lik ölçü balonu içerisine bir miktar saf su ile eritildikten sonra saf su ile. ml ye tamamlanmıştır. Bu şekilde hazırlanan ppm lik stok fosfat çözeltisinden 8, 6, 24, 32, 4 ve 48 ppm lik standart fosfat çözeltileri oluşturulmuş ve örnekler, hazırlanan standart eğriye göre değerlendirilmiştir. Kemik örneklerindeki fosfor değerlerinin belirlenmesinde, hazırlanan standart çözeltilere göre çizilen standart eğri kullanılmıştır. Kalsiyum Analizi: Yaş yakma işlemi uygulanarak hazırlanmış çözeltiler, kalsiyum analizi için de kullanılmıştır. Elde edilen bu çözeltinin / oranında seyreltilmesiyle oluşan yeni çözeltiler flamefotometre de okunmuştur. Standartların hazırlanmasında kullanılan kalsiyum stok çözeltisinin hazırlanması için, g CaCO 3 (2 saat 2 C de kurutulmuş), içinde bir miktar saf su bulunan balon jojeye konularak, üzerine -5 damla HCl damlatılıp, CaCO 3 çözdürülmüş ve çözelti saf su ile. ml ye tamamlanarak (. ppm) hazırlanmıştır. Bu çözelti kullanılarak 4, 8, 2, 6 ve 2 ppm lik çözeltiler hazırlanmış ve standart kalsiyum değerlerinin belirlenmesinde, hazırlanan standart çözeltilere göre çizilen standart eğri kullanılmıştır. Tibia Kemiğindeki Çeşitli Ölçümler Taze olarak vücuttan ayrılmış olan sağ tibia kemikleri çevre dokulardan temizlenmiştir 7. Kemikler dijital terazide tartılarak ağırlıkları (g) ve beherde hacimleri (cm 3 ) ölçülmüştür. Kemiklerin uzunlukları (mm) distal ve proximal uçlarından, çapları (mm) ise kemik uzunluğunun orta noktasında dijital kumpas ile ölçülmüştür. Daha önce yapılan araştırmalarda kemik dayanıklılığının ölçülmesi için kapasitesi kn olan Instron Universal Machine de Three Point Bending yöntemiyle kemiklerin kırılma işlemi gerçekleştirilmiştir. Piliçler canlı iken kemik üzerine etkileyen kuvvet tibia kemiğinin dik ekseni üzerinde etkili olduğundan kemikler dikine konularak beton basınç presinin uyguladığı kuvvetle kırılmıştır. Şekil 2. Tibiotarsus un görünümü Fig 2. View of tibiotarsus Bu işlemde kemikler normal duruş pozisyonunu sağlamak için proximal ve distal uçlarından tahtanın ortasına yuva yapılarak yerleştirilmişlerdir. Yapılan araştırmalarda bu ölçümü yapabilecek en uygun ve en hassas alet olarak betonların da dayanıklılığının ölçüldüğü bilgisayar sistemli beton basınç presi kullanılmıştır. Sistemin hassasiyeti, N a ayarlanmıştır. Makine hızı 3 mm/dak. olup kemiğin kırılma anında dayanabildiği kuvvet değeri kaydedilmiştir. Tibia kemiğinin kırıldığı noktadaki çapı ölçülüp alanı belirlenmiş ve kırıldığı andaki kuvvete bölünerek kırılma dayanıklılığı saptanmıştır. İstatistik Analizler Tibia ve femur kemiklerine ait çeşitli ölçümler SAS paket programında Genel Doğrusal Model (General Lineer Model) yöntemiyle analiz edilmiştir. Tibia ve femur kemiklerinin

93 777 BİRGÜL, MUTAF, ALKAN morfolojik özellikleri arasındaki korelasyon katsayıları da hesaplanmıştır. Farklılığı yaratan gruplar Duncan Çoklu Karşılaştırma Testi ne göre belirlenmiştir 8. BULGULAR Tibia ve Femur Kemikleri Tibia ve femur kemiklerinin ölçümlerine ait ortalama değerler Tablo 2 de verilmiştir. Tibia ve femur kemikleri arasındaki korelasyon katsayıları Tablo 3 te verilmiştir. Tibia Kemiğinde Hacim Ölçümleri Tibia kemiğinde hacim ölçümlerine ait sonuçlar Tablo 4 te verilmiştir. Tibia Kemiğinin Dayanıklılığı Tibia kemiğinin dayanıklılığına ait değerler Tablo 5 te verilmiştir. Tablo 2. Tibia ve femur kemiklerinin morfolojik özelliklerinin değerleri Table 2. Morphological traits values of tibia and femur bones Gruplar Tuz Tcap Tkut Fuz Fcap Fkut Kontrol 3.94± ± ± ± ± ±.749 Yatay tünekli 4.587± ± ± ± ± ±.73 º eğimli tünekli 4.36± ± ± ± ± ±.79 2º eğimli tünekli 4.3±.75.89± ± ± ± ±.87 4 eğimli m. tünekli 2.78± ± ± ± ± ±.797 Cinsiyet Erkek 5.72±.52 a.45±.25 a ±.687 a ± ±.42 a 8.58±.544 a Dişi.843±.44 b 9.232±.24 b 2.65±.585 b ±.5.5±.29 b 6.523±.384 b a,b Farklı harflerle gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<.) Tuz: Tibia uzunuluğu (mm), Fuz: Femur uzunluğu (mm), Tcap: Tibia çapı (mm), Fcap: Femur çapı (mm), Tkut: Tibia kütlesi (g), Fkut: Femur kütlesi (g) Tablo 3. Tibia ve femur kemiklerinin morfolojik özelliklerinin korelasyon katsayıları Table3. Correlation coefficient of morphological traits of tibia and femur bones Morfolojik Özellikler Tcap Tkut Fuz Fcap Fkut Tuz.397**.49**.258**.392**.499** Tcap.494**.2.526**.339** Tkut **.588** Fuz ** Fcap.33** ** P<. Tuz: Tibia uzunuluğu (mm), Fuz: Femur uzunluğu (mm), Tcap: Tibia çapı (mm), Fcap: Femur çapı (mm), Tkut: Tibia kütlesi (g), Fkut: Femur kütlesi (g) Tablo 4. Tibia kemiğinin hacim değerleri (cm 3 ) Table 4. Tibia bone volume values (cm 3 ) Gruplar Hacim Kontrol 7.667±.567 Yatay tünekli 2.42±.983 º eğimli tünekli 8.25±.799 2º eğimli tünekli 9.875±.6 4 eğimli merdiven tünekli 8.47±.93 Cinsiyet Erkek 2.833±.537 a Dişi 7.37±.52 b a,b Farklı harflerle gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<.) Tibia Kemiğindeki Kimyasal Analizler Tablo 6 da kuru madde, kalsiyum (Ca), fosfor (P) ve kül analizlerinin yüzde ortalamaları verilmiştir. TARTIŞMA ve SONUÇ Tibia ve femur kemiklerinin morfolojik özellikleri bakımından gruplar arasındaki farklılıkların önemsiz, eşeyler arasındaki farklılıkların ise önemli olduğu bulunmuştur (P<.). Femur kemiğinin uzunluğu bakımından eşeyler arasındaki farklılıklar da önemsiz bulunmuştur. Femur kemiğinin uzunluğundaki farklılıklar önemsiz çıksa da erkeklerin femur kemikleri dişilerden daha uzun çıkmıştır. Yapılan ölçümlerde kemiklerin gelişimleri arasındaki fark-

94 778 Farklı Tünek Sistemlerinin... Tablo 5. Tibia kemiğinin dayanıklılık değerleri (N/mm 2 ) Table 5. Tibia bone strenght values (N/mm 2 ) Gruplar Dayanıklılık Kontrol 34.5±2.688 y Yatay tünekli 47.56±2.995 x º eğimli tünekli 44.23±3.36 x 2º eğimli tünekli ±2.64 x 4 eğimli merdiven tünekli 43.35±.52 x Cinsiyet Erkek 37.95±.296 b Dişi 47.3±.837 a a,b Farklı harflerle gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<.) x,y Farklı harflerle gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<.) Tablo 6. Kuru madde, kalsiyum, fosfor ve kül değerleri (%) Table 6. Dry matter, calcium, phosphorus and ash values of tibia bone (%) Grup Kuru Madde Kül Ca P Kontrol 42.42± ±.4.6±.53 b 6.22±.6 z Yatay tünekli 45.9± ±.84.3±.2 ab 6.84±.3 y º eğimli tünekli 48.5± ±.42.99±.7 a 7.2±. xy 2º eğimli tünekli 43.8± ±.9.3±.9 ab 7.±.4 xy 4 eğimli, Merdiven tünekli 4.55± ±.79.6±.3 a 7.43±.2 x x,y,z Farklı harflerle gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<.) lılıklar önemsiz olsa da en iyi ortalama yatay tünekli grupta saptanmıştır. Elde edilen sonuçlar, Applegatet ve Lilburn 9 tarafından bildirilen değerlerle uyum göstermektedir. Adı geçen araştırıcılar yaptıkları çalışmada, vücut ağırlıklarına bağlı olarak tibia ve femur özelliklerini incelemişlerdir. 43. günlük yaştaki vücut ağırlıkları ortalamalarını dişilerde 794 g ve erkeklerde ise 24 g bulmuşlar ve bunlara bağlı olarak da tibia ağırlıklarını dişlerde ve erkeklerde sırasıyla, 7.4 g ve 9. g olarak hesaplanmışlardır. Dişilerde ve erkeklerde tibia uzunlukları sırasıyla 7.6 mm ve.3 mm, çapları 8.2 mm ve 9.93 mm, femur ağırlıkları ise 4.57 g ve 5.48 g, femur uzunlukları 78. mm ve 74. mm, femur çaplarını ise 8.96 mm ve 9.8 mm olarak bulmuşlardır. Tibia ve femur kemikleri arasında incelenen özellikler bakımından önemli ölçüde korelasyonlar bulunmuştur (P<.). Buna göre Tuz ile Tcap, Tkut, Fuz, Fcap ve Fkut arasındaki korelasyonlar sırasıyla r=.397,.49,.258,.392 ve.499 olarak saptanmıştır. Tcap ile Tkut, Fcap ve Fkut arasındaki korelasyonlar ise sırasıyla r=.494,.526 ve.339 olarak bulunmuştur. Tkut ile Fcap arasında.288 ve Tkut ile Fkut arasında ise r=.588 bulunmuştur. Fuz ile Fkut arasındaki korelasyon r=.342 olup önemli çıkmıştır. Fuz ile Fcap arasındaki korelasyon r=.75, Fcap ile Fkut arasındaki korelasyon ise r=.33 olarak hesaplanmıştır (P<.). Tibia kemiğinin çapı ve uzunluğundaki artışla femur kemiği arasında doğrusal bir ilişki olduğu, aynı şekilde tibia ağırlığı arttıkça femur ağırlığının da arttığı gözlenmiştir. Tibia kemiğinde hacim ölçümlerinde yapılan analizler sonucunda gruplar arasındaki farklılıklar önemsiz bulunurken, eşeyler arasındaki farklılıklar önemli bulunmuştur (P<.). Gruplar arasındaki farklılıklar önemsiz bulunsa da tibia kemiğinde en yüksek hacim ortalaması yatay tünekli grupta (2.42±.983 cm 3 ) buna karşın en düşük hacim ortalaması ise kontrol grubunda (7.667±.567 cm 3 ) ortaya çıkmıştır. Erkek piliçlerde tibia kemiği hacim ortalaması 2.833±.537 cm 3 iken dişi piliçlerin tibia kemiği hacim ortalaması 7.37±.52 cm 3 olarak hesaplanmıştır. Etlik piliçlerin erkeklerinde canlı ağırlık ve tibia kemik özellikleri (uzunluk, çap ve ağırlık) dişilere oranla önemli derecede yüksek bulunduğundan, tibia kemiğinin hacim ortalamaları erkeklerde dişilere göre önemli düzeyde yüksek bulunmuştur (P<.). Bu sonuçlar Applegatet ve Lilburn 9 tarafından bildirilen değerlerle benzerlik göstermektedir. Tibia kemiği özellikleri (uzunluk, çap ve ağırlık) bakımından gruplar arasında önemli farklılıkların ortaya çıkmaması, tibia kemiği hacim ölçüm değerlerinin gruplar arasında önemsiz bulunmasında etken olmuştur. Tibia kemiğindeki kalsiyum ve fosfor miktarları bakımından grup ortalamaları arasındaki farklılıklar önemli (P<.), kuru madde ve kül arasındaki farklılıklar ise önemsiz bulunmuştur. Tibia kemiğinde dayanıklılık bakımından gruplar ve eşeyler aralarındaki farklılıkların önemli olduğu saptanmıştır (P<.). En iyi tibia kemik dayanıklılığı yatay tünekli (47.56±2.995 N/mm 2 ), buna karşın en düşük tibia kemik dayanıklılığı ise kontrol grubunda (34.5±2.688 N/mm 2 ) bulunmuştur. Eşeyin etkisi incelendiğinde, erkek piliçlerin tibia kemik dayanıklılığının (37.95±.296) dişilerin kemik dayanıklılığından (47.3±.837) daha düşük olduğu ortaya çıkmıştır. Erkek piliçlerin canlı ağırlıkları dişilerin canlı ağırlıklarından daha fazla olması yürüme kabiliyetlerini azaltmaktadır. Bu nedenle de, erkek piliçlerde kemik kusurlarının görülme oranı artmakta ve kemik dayanıklılığı dişilere göre daha düşük olmaktadır. Balog 2 tarafından yapılan ve tibia kemik dayanıklılığının araştırıldığı çalış-

95 779 BİRGÜL, MUTAF, ALKAN mada, tibia kemik dayanıklılığı rampalı grupta 32.4±6.87 kg ve 36.34±8.6 kg, rampasız grupta ise 33.23±6.45 kg ve 38.2±8.59 kg olarak bulmuştur. Güler ve Yalçın 2 ise tibia kemiğinin dayanıklılığını 6. haftada normal yemlikte 2.33 kg/f, rampalı yemlikte ise kg/f olarak saptamışlardır. Kemik dayanıklılığını etkileyen birçok faktör bulunmakta olup en önemlilerinden birisi büyüme hızıdır. Çünkü büyüme hızına bağlı olarak kemik kütlesi artmaktadır. Yine cinsiyet, yaş, ırk ya da genotip, fiziksel hareketlilik durumu, mekanik stres, beslenme durumu, vitaminler, enfeksiyonlar, bağışıklık sistemi, hormonlar ve toksinler de kemik dayanıklılığını etkileyen önemli faktörlerdir 22. Ayrıca, başka bir çalışmada kemik dayanıklılığı ile kemiğin ham kül içeriği arasında oldukça yüksek bir korelasyon bulunmuştur 23. Kuru madde ortalamaları grup düzeyinde yüzde olarak saptanmış olup gruplar arasındaki farklılıklar önemli çıkmamıştır. En yüksek kuru madde oranı eğimli tünekli grupta (%48.5±6.7) belirlenmiş olup bunu yatay tünekli grup (%45.9±2.7) izlemiştir. Görüldüğü gibi, en yüksek Ca değerleri eğimli tünekli (%.99±.7) ve 4 eğimli merdiven tünekli gruplarda (%.6±.3), buna karşın en düşük Ca değeri ise kontrol grubunda (%.6±.53) saptanmıştır. En yüksek P düzeyi 4 eğimli merdiven tünekli grupta (%7.43±.2), en düşük ise kontrol grubunda (%6.22±.6) bulunmuştur. Ca ve P arasında r=.566 düzeyinde korelasyon olduğu belirlenmiştir (P<.). Kül oranları bakımından gruplar arasındaki farklılıklar önemsiz bulunmuş olup elde edilen kül değerleri Yalçın ve ark. 24 tarafından bildirilen değerlerden yüksek, Tablante ve ark. 25 tarafından bildirilen değerlerle ise benzerlik göstermektedir. Yalçın ve ark. 24 kül oranını 7. haftada %35.37±.33, Tablante ve ark. 25 ise %52.9±.23 olarak bulmuşlardır. Kontrol grubu en dayanıksız grup buna karşın en dayanıklı grup ise yatay tünekli grup olmuştur. Erkek etlik piliçlerin kemik dayanıklılık ortalamaları dişilerin ortalamalarına göre daha düşük çıkmıştır. Bunda, erkek piliçlerinin tibia kemiği boylarının dişilere göre daha uzun ve bacak kusurlarının daha fazla olmasının etkisi vardır. KAYNAKLAR. Cahaner A, Yunis R, Lavi Y, Heller D: The effects of selection for rapid growth on antibody response and viability of commercial broilers.. Doğu Anadolu Kanatlı Yetiştiriciliği Sempozyumu, 2-24 Mayıs, Van, Wise DR: Skeletal abnormalities in table poultry - A review. Avian Pathol, 4, -, Tolon B, Yalçın S: Bone characteristic and body weight of broilers in different husbandry systems. Bri Poult Sci, 38, 32-35, Skinner T, Beasley JN, Waldroup PW: Effects of dietary aminoacide levels on bone development in broiler chickens. Poult Sci, 7, , Newberry RC, Shackleton DM: Use of visual cover by domestic fowl: A Venetian blind effect? Anim Behav Sci, 54, , Newberry RC: Environmental enrichment: Increasing the biologica relevance of captive environments. Appl Anim Behav Sci, 44, , Haye U, Simons PCM: Twisted legs in broilers. Bri Poult Sci, 9, , Kestin SC, Knowles TG, Tinch AE, Gegory NG: Prevalence of leg weakness in broiler chickens and its relationship with genotype. Vet Rec, 3, 9-94, Newberry RC, Hall JW: Use of pen space by broiler chickens: Effects of age and pen size. Appl Anim Behav Sci, 25, 25-36, 99.. Le Van NF, Estevez I, Stricklin WR: Use of horizontal and angled perches by broiler chickens. Appl Anim Behav Sci, 65, , 2.. Julian RJ: Rapid growth problems: Ascities and skeletal deformities in broiler. Poult Sci, 77, , Dieck HT, Doring F, Roth HP, Daniel H: Changes in rat hepatic gene expression in response to zinc deficiency as assessed by DNA arrays. J Nutr, 33, 4-, Aksu T, Özsoy B, Sarıpınar Aksu D, Yörük MA, Gül M: The effects of lower levels of organically complexed zinc, copper and manganese in broiler diets on performance, mineral concentration of tibia and mineral excretion. Kafkas Univ Vet Fak Derg, 7 (): 4-46, Riddell C: Selection of broiler chickens for a high and low incidence of tibial dyschondropalsia with observations on spondylosthesis and twisted legs (perosis). Poult Sci, 55, 45-5, Bond PL, Sullivian TW, Douglas JD, Robenson LG: Influence of age, sex and method of rearing on tibia lenght and mineral deposition in broilers. Poult Sci, 7, , Çalışkaner Ş: Hayvan Beslemede Laboratuar Teknikleri. Ankara Üniv Ziraat Fak. Yay. 942, Ofset Basım Ders notu: 2, Ankara, Bartels TH, Meyer W: Eine Schnelle und effektive methode zur mazeration von Wirbeltieren. Dtsch Tierarztl Wschr, 98, 47-49, SAS: SAS-STAT Software. Version 6.2. SAS Institute Inc, Cary, N.C., Applegatet TJ, Lilburn MS: Growth of the femur and tibia of a commercial broiler line. Poult Sci, 8, , Balog JM, Bayyari GR, Rath NC, Huff WE, Anthony NB: Effect of intermittent activity on broiler production parameters. Poult Sci, 76, 6-2, Güler HC, Yalçın S: Etlik piliçlerde aydınlatmanın ve hareketliliğin tibial dyschondroplasia (TD) oluşumu ve kemik özellikleri üzerine etkileri. 4. Ulusal Zootekni Bil Kong, -4 Eylül, Isparta, s, 2-9, Rath NC, Huff GR, Huff WE, Balog JM: Factors regulating bone maturity and strength in poultry. Poult Sci, 79, 24-32, Onyango EM, Hester PY, Stroshine R, Adelo O: Bone densitomery as an indicator of percentage tibia ash in broiler chicks fed varying dietary calcium and phosphorus levels. Poult Sci, 82, , Yalçın S, Özkan S, Çoşkuner E, Bilgen E, Delen Y, Kurtulmuş Y, Tanyalçın T: Effects of strain, maternal age and sex on morphological characteristics and composition of tibial bone in broilers. Bri Poult Sci, 42, 84-9, Tablante NL, Estevez I, Russek-Cohen E: Effect of perches and stocking density on tibial dyschondroplasia and bone mineralization as measured by bone ash in broiler chickens. J Appl Poult Res, 2, 53-59, 23.

96 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Pişmiş Döner Kebaplarda Mikrobiyolojik Kalite ve Mikrobiyel Gelişim Üzerine Bir Araştırma [] Kamil BOSTAN * Funda YILMAZ * Karlo MURATOĞLU * Ali AYDIN * [] Bu çalışma İstanbul Üniversitesi Bilimsel Araştırma Projeleri Kordinasyon Birimi tarafından desteklenmiştir (İÜBAP Proje No: 362) * İstanbul Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı, TR-3432 Avcılar, İstanbul - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışma piyasada hızlı yemek restaurantlarda satışa sunulan pişmiş haldeki dönerlerin mikrobiyolojik kalitesini ortaya koymak ve pişme sonrası bekleme sırasında mikroorganizma sayısındaki değişimleri incelemek amacıyla gerçekleştirilmiştir. Öncelikli olarak İstanbul da Avcılar bölgesindeki 2 farklı satış noktasından toplam 3 adet döner örneği toplanmış ve mikrobiyolojik analizleri yapılmıştır. Daha sonra üç ayrı işletmeden alınan dönerler oda sıcaklığında bekletilerek belli aralıklarla mikroorganizma sayılarındaki değişimler incelenmiştir. Ayrıca, tüketime hazır döner örnekleri Staphylococcus aureus ile deneysel olarak kontamine edilerek adı geçen mikroorganizmanın oda sıcaklığında bekletme sırasında gelişimi takip edilmiştir. Piyasadan toplanan örneklerde toplam mezofil aerobik bakteri, Enterobacteriaceae, Esherichia coli sayıları arasında önemli farklar görülmüş; hiçbir örnekte S. aureus ve termofilik anaerob sporlu bakteri varlığına rastlanmamıştır. Pişmiş dönerlerin bekletilmesi sırasında ise ilk 6 saat içinde mikroorganizma sayılarında dikkati çeken bir artış gözlenmemiştir. S. aureus ile kontamine edilen örneklerde ise bekletme sırasında benzer durum gözlenmiş ve adı geçen bakteri sayısında önemli bir artış kaydedilmemiştir. Elde edilen bulgulara göre dönerlerin mikrobiyolojik kalitesinin alındığı yere bağlı olarak farklılık gösterdiği; pişmiş dönerlerin mikrobiyel gelişim için uygun bir ortam oluşturmadığı sonucuna varılmıştır. Anahtar sözcükler: Döner kebap, Mikrobiyolojik kalite, Mikrobiyel gelişme, Staphylococcus aureus A Study on The Microbiological Growth and Microbiological Quality in The Cooked Doner Kebabs Summary This study is carried out to determine the microbiological quality of cooked ready to eat doner kebabs from fast food restaurants and to assess the changes in the number of microorganisms in doners during waiting at room temperature. Primarily, total 3 doner samples were collected in 2 different retail locations in Avcılar region, Istanbul, and analyzed in respect to microbial load. Afterwards, the doner samples were taken from three sale points were kept at ambient temperature and determined the microbial counts at hourly intervals. A similar trial was also performed with doner kebabs experimentally contaminated with Staphylococcus aureus. Significant differences were observed between the numbers of microorganisms (total mesophilic aerobic bacteria, Enterobacteriaceae, Esherichia coli) in samples collected from the sale points. However, no samples contained S. aureus and thermopilic spor forming anaerob bacteria at countable level. During the first six hours of storage, a significant increase in the numbers of microorganisms were not observed. Similar results were also observed in the samples experimentally contaminated with S. aureus. According to the result of this study, it was concluded that the microbiological quality of doner kebabs is quite variable, and cooked doner kebab is not suitable for microbial growth. Keywords: Doner kebab, Microbial quality, Microbial growth, Staphylococcus aureus GİRİŞ Döner ülkemize özgü geleneksel bir et yemeğidir. Başta Ortadoğu ve Avrupa olmak üzere diğer ülkelerde de yaygın olarak tüketilen döner fastfood (hızlı yemek) anlayışında önemli bir yer tutmaktadır. Dönerlik et, bıçaklarda istenilen formatta (yaprak) kesildikten veya kıyma haline getirildikten sonra tuz, baharat, soğan, domates, İletişim (Correspondence) /785

97 782 Pişmiş Döner Kebaplarda... yoğurt gibi diğer yardımcı maddelerle karıştırılarak marine edilmektedir. Bir süre dinlendirildikten sonra dikey bir şişe dizilerek pişirmeye hazır hale getirilmektedir. Daha sonra çiğ döner elektrik, gaz veya odun kömürü ile çalıştırılan ısıtıcı bir alet önünde yavaşça çevrilerek pişirilmekte ve pişme sonrası ince dilimler halinde kesilerek servis edilmektedir,2. Döner etkin bir sıcaklıkta yeterli sürede pişirildiğinde çiğ materyalde bulunan patojen bakteriler yıkımlandığından pişmiş döner mikrobiyolojik anlamda güvenli olarak kabul edilmektedir 3. Bununla birlikte uygulanan ısıl işlem sadece belli bir derinliğe kadar yüzey kısım için güvenlik sağlamaktadır. Döner dilimlerinin gereğinden fazla kalın kesilmesi ile özellikle talep yoğunluğunun fazla olduğu saatlerde pişirme süresinin kısa tutulması durumunda, dönerin iç kısımlarının yeterince pişmemiş olarak servis edilmesi söz konusu olmaktadır. Diğer taraftan, dönerin şiş kalınlığına bağlı olarak, döner matriksinin iç kısımlarındaki sıcaklık mevcut mikroorganizmaların çoğalmasını destekleyen seviyelerde uzun süre kalabilmektedir 4,5. Isı işleminin etkisi mikoorganizma sayısı ile ilişkili olduğundan çiğ dönerdeki sayısal olarak çoğalmış olası patojen mikroorganizmaları inaktive etmek için pratikte uygulanan pişirme süresi yetersiz olabilmektedir. Diğer taraftan, pişirme ile tüketim arasında geçen zaman içerisinde de rekontaminasyon mümkündür. Gerek ülkemizde gerekse diğer ülkelerde yapılan çalışmalar tüketime hazır döner kebapların zaman zaman mikrobiyolojik kalitesinin iyi olmadığını ve patojen mikroorganizmaları içerebildiğini göstermektedir. Küpeli Gençer ve Kaya 6 toplanan 4 pişmiş döner örneğinin 6 sında Clostridium perfringens (C. perfringens), 6 sında Staphylococcus aureus (S. aureus), unda Listeria spp. saptamışlardır. Diğer bir çalışmada, Elmalı ve ark. 7 satışa sunulan adet pişmiş döner örneğinin %4 ünde Salmonella spp., %32 sinde C. perfringens, %24 ünde Bacillus cereus, %27 sinde S. aureus tespit etmişlerdir. Kayışoğlu ve ark. 8 ise 6 pişmiş tavuk döner örneğinin 48 inde, 3 sığır eti döner örneğinin 2 sinde Salmonella spp.; tavuk dönerlerinin 6 sında ve sığır eti dönerlerinin 2 sinde C. perfringens varlığını bildirmişlerdir. Ulukanlı ve ark. 9 çeşitli lokantalardan temin edilen dönerlerden elde edilen bazı izolatları Esherichia coli O57:H7 olarak belirlemişlerdir. Topçu ise 25 adet pişmiş et döner örneğinden birisinde L. monocytogenes, beşinde S. aureus; 25 pişmiş tavuk döneri örneğinin üçünde L. monocytogenes, altısında S. aureus saptamıştır. Yaygın olmamakla birlikte, geçmiş yıllarda döner eti tüketimi sonucu meydana gelen gıda zehirlenmelerine dair rapor edilmiş vakalar vardır -3. Gıda maddelerindeki patojen mikroorganizmaların varlığının yanı sıra, çoğu kez aktüel sayıları da gıda zehirlenmeleri açısından belirleyici faktörler arasında yer almaktadır. Özellikle ısıl işlem görmüş ürünler mikrobiyel gelişim için uygun ortamlarda uzun süre bekletildiğinde, gerek hayatta kalan bakterilerin gerekse ileri işlemlerde çeşitli kaynaklardan kontaminasyon sonucu bakteri sayısında ürünü tüketici için riskli hale getirecek seviyede bir artış meydana gelebilmektedir 4. Her ne kadar dönerin sıcak olarak servis edilmesi gerekli ise de zaman zaman kesilmiş halde bekletilmekte, özellikle günümüzde artan bir trend haline gelen sipariş üzerine, motorize ekipler vasıtasıyla dönerlerin paketlenmiş olarak bizzat tüketiciye ulaştırılması aşamasında aradan belli bir süre geçmektedir. Bazı döner üreticileri ise gün içinde tüketilemeyen döneri ertesi gün tekrar müşteriye sunma eğilimindedir. Buna bağlı olarak, dönerin mikrobiyolojik kalitesi, tüketici sağlığı bakımından sakıncalı hale gelebilmektedir 4,6. Ülkemize özgü olan ve dünya çapında ün kazanan dönerin halk sağlığı açısından olası risklerinin belirlenmesi, bilimsel bir gerekliliktir. Hammaddesi et olması itibariyle mikrobiyolojik niteliklerinin hammadde aşamasından tüketiciye ulaşıncaya kadar geçirdiği sürecin araştırılması önem taşımaktadır. Bu çalışma piyasadan temin edilen dönerlerin mikrobiyolojik kalitesini ortaya koymak ve pişme sonrası bekleme sırasında mikroorganizma sayısındaki değişimleri incelemek amacıyla gerçekleştirilmiştir. MATERYAL ve METOT Döner Örnekleri: Piyasada satışa sunulan dönerlerin mikrobiyolojik kalitesini incelemek için İstanbul Avcılar ve yakın çevresindeki satış noktalarından Haziran 2 - Ağustos 2 döneminde pişmiş ve tüketime hazır 3 döner örneği (6 adet kırmızı et döner, 4 adet kanatlı eti döner) temin edilmiştir. Aseptik koşullarda steril numune alma poşetlerine alınan döner örnekleri (her biri yaklaşık g), en geç 3-6 dakika içerisinde ısı yalıtımlı kaplarda soğutulmuş olarak laboratuvara ulaştırılarak mikrobiyolojik özellikleri bakımından analiz edilmiştir. Pişmiş Dönerlerin Muhafazası: Tercihen tarama çalışmasında bakteri yükü yüksek çıkan dönerlerin şatış noktaları seçilmek üzere pişmiş olarak temin edilen üç farklı döner örneği (yaklaşık 5 er g) strafor tabaklar içinde üzeri polietilen filmle kaplanarak, oda sıcaklığında 8 saat süreyle muhafaza edilmiştir. Muhafaza periyodunun ilk altı saatinde birer saat aralıklarla ve muhafazanın sonunda (8. saat) mikrobiyolojik açıdan analiz edilmiştir. S. aureus İnokülasyonu: Pişmiş olarak temin edilen döner (kıyma döner, 5 g) laboratuvarda, gıdalardan izole ettiğimiz enterotoksijenik olduğu serolojik olarak kanıtlanmış S. aureus izolatının kültürü Mc Farland tüpleri yardımıyla.x 8 kob/g konsantrasyonuna ayarlanmış, buradan 5 kob/g düzeyinde olacak şekilde deneysel olarak kontamine edilmiştir. Steril bir poşet içinde iyice karıştırılmak suretiyle gerçekleştirilen bu işlemden sonra kontamine döner örneği strafor tabaklar içerisine alınmış; üzeri polietilen filmle kaplanarak oda sıcaklığında 8 saat süreyle muhafaza edilmiştir. Muhafaza periyodunun ilk altı saatinde birer saat aralıklarla ve muhafaza süresinin sonunda (8. saat) S. aureus sayısı bakımından analiz edilmiştir.

98 783 BOSTAN, YILMAZ MURATOĞLU, AYDIN Mikrobiyolojik Analizler: İyice karıştırılarak homojen hale getirilmiş döner örneklerinden ar g alınarak 9 ml (: dilüsyon oranı) steril %. peptonlu tuzlu su (Oxoid CM 733R) ile 2 dakika süre ile homojenize edilmiş (Seward Labblender 4, Worthing, İngiltere) ve steril %. peptonlu tuzlu su ile -8 basamağına kadar seri dilüsyonlar hazırlanmıştır 5. Daha sonra ilgili dilüsyonlardan toplam mezofilik aerob bakteri, Enterobacteriaceae, E. coli, S. aureus ve sülfit redükte eden anaerob bakterilerin sayımı için aşağıdaki genel ve selektif besiyerlerine ekim yapılmıştır. Toplam aerobik mezofil toplam bakteri sayımı için standard plate count agar (Oxoid CM 463) kullanılmıştır. Ekim yapılan plaklar 37 C de 48 saat inkübasyondan sonra değerlendirilmiştir 6. Enterobacteriaceae sayımı için Violet Red Bile Glucose Agar (Oxoid CM 485) kullanılmıştır. Ekim yapılan plakların üzerine bir kat daha besi yeri dökülüp katılaştırıldıktan sonra 37 C de 24 saat inkube edilmiştir. Süre sonunda kırmızı renkli çapı.5 mm ve daha büyük olan koloniler olarak değerlendirilmiştir 7. E. coli sayımı için Tryptone Bile X-Glucuronide Agar (Oxoid CM 945) kullanılmıştır. Dökme tekniği ile ekim yapılmış plaklar 37 C de 4 saat bekletildikten sonra 44 C de 8-24 saat süreyle inkübe edilmiş; opak mavimsi yeşil renkteki koloniler değerlendirilmiştir 8. Sülfit redükte eden anaerobların tespiti amacıyla Sulfite Polymyxin Sulfadiazine (SPS) agar (Merck,.235) kullanılmıştır. Uygun dilüsyonlar steril deney tüpü içerisine alınarak üzerine SPS agar konulmuştur. Daha sonra agarın sertleşmesini müteakip ikinci kez üzerine SPS agar ilave edilerek, tüpler 37 C de 48 saat süreyle inkübe edilmiş; siyah renkli misket şeklindeki koloniler değerlendirilmiştir 9. S. aureus un sayımı için Baird Parker Agar (Oxoid CM275) kullanlmıştır. Ekim yapılan plaklar 37 C de 48 saat inkübe edildiktan sonra çapı yaklaşık olarak 3 mm olan siyah-gri renkli ve etrafında şeffaf zonlar bulunan parlak koloniler sayılmıştır 2. Aynı besi ortamında gelişen ve zon oluşturmayan çok küçük kahverengi-siyah koloniler Staphylococcus-Micrococcus spp. olarak değerlendirilmiştir. İstatistiksel Analizler: Kırmızı et ve kanatlı etinden üretilen doner orneklerine ait mikroorganizma sayıları ortalama logaritmik değerlere çevrilmiştir. Gruplararası farklılıkların olup olmadığı bağımsız ornekleme T testi ile belirlenmiştir. İstatistiki analizlerin yapılmasında SPSS program paketinden yararlanılmıştır 2. BULGULAR Yapılan analizler neticesinde piyasadan toplanan örneklerin mikrobiyolojik kalitesinin birbirlerinden önemli derecede farklı olduğu gözlenmiştir. Örneklerdeki Top- lam Mezofilik Aerob Bakteri (TMAB) sayısı 5.x - 2.x 6 kob/g arasında saptanmıştır. Örneklerin adedinde (%36.6) Enterobacteriaceae üremesi kaydedilmemiş; diğerlerinde bu sayı 6.x -2.x 4 kob/g arasında saptanmıştır. Diğer taraftan, örneklerin 8 (%26.6) adedinde Enterobacteriaceae sayısı 3 kob/g dan yüksek bulunmuştur. Otuz örneğin 5 (%6.6) adedinde 2 kob/g dan yüksek olmak üzere 3 (%43.3) adedinde E. coli varlığı tespit edilmiştir. Hiçbir örnekte S. aureus ve sülfit redükte eden clostridia varlığına rastlanmamıştır (Tablo ). Ayrıca, kanatlı etinden üretilen dönerlerin mikrobiyel yükü ise kırmızı et dönerlerine göre nispeten yüksek bulunmuştur. Oda sıcaklığında bekletme sırasında yapılan mikrobiyolojik analizlerde, ilk altı saat içinde mevcut mikroorganizma sayılarında düşük düzeyde artış görülmüştür. Muhafazanın 8. saatinde ise mikroorganizma sayıları başlangıç seviyesinden oldukça yüksek (TMAB için 3.4 log kob/g; Enterobacteriaceae için. log kob/g; E. coli.7 log kob/g; Staphylococcus-Micrococcus spp. için 3.2 log kob/g) bulunmuştur (Şekil ). Aynı şekilde oda sıcaklığında bekletilen dönerlerde ilk altı saat içinde S. auerus üremesi kaydedilmemiş olmasına rağmen 8. saat yapılan analizlerde ortalama 2.3 log kob/g düzeyinde S. aureus gelişimi gözlenmiştir. Deneysel olarak S. aureus ile kontamine edilen döner örneklerinin bekletilmesi sırasındada benzer bir tablo ortaya çıkmıştır. Test bakterisinin sayısı başlangıçta ortalama 5.4 log kob/g düzeyinde iken muhafazanın altıncı saatinde ancak 5.5 log kob/g a ulaşmıştır. Onsekiz saatlik bekletme sonunda ise S. aureus sayısı başlangıca göre ortalama.38 log kob/g artış göstererek 6.83 log kob/ g a yükselmiştir. TARTIŞMA ve SONUÇ Piyasadan toplanan döner örneklerinden elde edilen mikrobiyolojik veriler incelendiğinde örnekten örneğe mikrobiyel yükün önemli derecede değiştiği görülmektedir. TMAB sayısı döner gibi pişirilmiş et ürünlerinde mikrobiyolojik kalitenin belirlenmesinde önemli bir kriter olarak değerlendirilmektedir 5. Çalışmamızda TMAB sayısı ağırlıklı olarak 3-4 kob/g düzeyinde saptanmış; bazı örneklerde ise 6 kob/g gibi yüksek bir düzeyde bulunmuştur. Döner ile ilgili yapılan diğer çalışmalarda, genel olarak TMAB sayısının yüksek bulunduğu bildirilmektedir. Vazgeçer ve ark. 22, pişmiş tavuk döner örneklerindeki TMAB sayısının çalışmamızdakine benzer şekilde 2 ile 5 kob/g arasında değiştiğini, örneklerin %5 sinde bu sayının 3-4 kob/g düzeyinde olduğunu bildirmişlerdir. Yine bulgularımızla uyumlu olarak, Hampikyan ve ark. 23 incelenen döner örneklerindeki TMAB sayısının - 6 kob/g arasında değiştiğini saptamışlardır. Almanya da yapılan diğer bir çalışmada da satışa sunulan pişmiş döner örneklerindeki ortalama TMAB sayısı 5 cfu/g olarak belirlenmiştir 5.

99 784 Pişmiş Döner Kebaplarda... Tablo. Piyasadan temin edilen döner örneklerindeki mikroorganizma sayıları (kob/g) Table. The microbial counts of doner samples offered for retail sale (cfu/g) Mikroorganizma Döner n Örnek Sayıları < -< 2 2 -< 3 3 -< 4 4 -< 5 5 -< 6 6 -< 7 (X±Sx) (log kob/g) Kırmızı Et (3.9±.23 a *) Toplam Mezofilik Aerob Bakteri Kanatlı Et (4.45±.27 a ) Toplam Kırmızı Et (.8±.39 a ) Enterobacteriaceae Kanatlı Et (.79±.43 a ) Toplam Kırmızı Et (.86±.26 a ) Esherichia coli Kanatlı Et (.9±.36 a ) Toplam Kırmızı Et Staphylococcus aureus Kanatlı Et Toplam Kırmızı Et Sülfit Redükte Eden Anaeroblar Kanatlı Et Toplam * Herbir bakteri grubu icin, aynı sütunda ve farklı satırlarda yer alan ortalama değerler arasındaki farklılık önemlidir (P<.5) eti dönerlerde (shawarma) ortalama toplam bakteri sayısını 5.28 log kob/g olarak saptamıştır. Dönerlerdeki TMAB sayısı hammadde kalitesi, üretim hijyeni, pişirme tekniği gibi birçok faktörden etkilenmektedir. Döner üretiminde et haricinde kullanılan ingredientlerin çeşitliliği ve miktarı da üreticiler arasında önemli farklılıklar göstermektedir. Bununla birlikte, birçok gıda maddesinin üretim aşamasında lezzet ve vermek amacıyla kullanılan baharatın sahip olduğu mikroorganizma düzeyi ve çeşidi de önem taşımaktadır 25. Marinasyon amacıyla laktik asit bakterilerinden zengin olan yoğurdun az veya çok kullanılmasının da çiğ dönerdeki mikrobiyel yük üzerine oldukça etkili olduğu ifade edilmektedir 4. Çiğ üründe ne kadar yüksek sayıda bakteri mevcut ise, ısıl işlem sonrası daha çok sayıda bakteri hayatta kalabilmektedir. Diğer taraftan ısıl işleminin gereğinden fazla olması veya yetersiz olması da son üründeki mikroorganizma sayısını etkilemektedir. Bu açıdan değerlendirildiğinde, çalışmamızda elde ettiğimiz bulgulardaki gibi TMAB sayısının geniş bir aralık arasında saptanması normal kabul edilebilir. Şekil. Oda sıcaklığında bekletilen döner örneklerinde mikroorganizma sayılarındaki değişimler. TMAB (Toplam mezofilik aerob bakteri), ENT (Enterobacteriaceae), EC (E. coli), SM (Staphylococcus-Micrococcus) Fig. Microbiological changes in doner samples during storage at room temperature. TMAB (Total mesophilic aerob bacteria), ENT (Enterobacteriaceae); EC (E. coli), SM (Staphylococcus-Micrococcus) Cebirbay 4 piyasadan temin edilen döner numunelerinde ortalama TMAB sayısını 4.97 log kob/g olarak; Kayışoğlu ve ark. 8 da 4.92 log kob/g olarak bildirmiştir. Diğer taraftan Easa 24, Suudi Arabistan da satışa sunulan tavuk Tüketime hazır ürünlerde Enterobacteriaceae sayısı-nın 4 kob/g; E. coli sayısının kob/g üzerinde olması uygunsuz olarak değerlendirilmektedir 26. Yaptığımız çalışmada, örneklerin önemli bir kısmında Enterobacteriaceae (%36.6) ve E. coli (%56.6) saptanmamış iken, bazı örneklerde adı geçen bakterilere sırasıyla 4 ve 3 kob/g seviyesinde rastlanmıştır. Mevcut durum, döner işletmelerindeki üretim, pişirme ve servis aşamalarındaki hijyen standartları ve gıda güvenliği uygulamalarındaki farklılıklara işaret etmektedir. Diğer araştırmalarda da pişmiş döner örneklerinde söz konusu bakteri sayıları ile ilgili benzer bulgular elde edilmiştir. Jöckel ve Stengel 27 piyasadan

100 785 BOSTAN, YILMAZ MURATOĞLU, AYDIN (Almanya) toplamış olduğu çiğ döner örneklerinin (n:43) 2/3 ündeki Enterobacteriaceae sayısının sayılabilir düzeyde olmadığını; bazı örneklerde ise bu sayının 5 kob/g dan fazla olduğunu bildirmiştir. Diğer bir çalışmada, 4 döner örneğinin 6 sında (%4) Enterobacteriaceae grubu bakteriler, 22 sinde (%55) koliform grubu bakteriler ve 3 ünde (%32.5) E. coli varlığı tespit edilmiştir 6. Vazgeçer ve ark. 22 pişmiş tavuk döner örneklerinin %39 unda koliform sayısının; %8 inde E. coli sayısının 2 kob/g dan yüksek olduğunu bildirmişlerdir. Cebirbay 4 piyasadan temin edilen döner numunelerinde ortalama koliform bakteri sayısını.46 log kob/g; Enterococcus sayısını 2.89 log kob/g olarak saptamıştır. Hampikyan ve ark. 23 incelenen 2 adet döner örneğinden 5 inde - 5 kob/g arasında koliform grubu mikroorganizma ve birisinde E. coli (4.5x 2 kob/g) bulunduğunu bildirmişlerdir. Harakeh ve ark. 28 Lübnan piyasasından temin ettiği pişmiş döner dönerlerdeki E. coli bulunma oranını %55 olarak tespit etmişlerdir. Elmalı ve ark. nın 7 çalışmasında ise örneklerin %54 ünde E. coli bulunmuştur. Jansson ve ark. 29 Avustralya da kebabçılardan temin ettiği 48 döner örneğinin 29 unda (%6.4) E. coli sayısının 3 kob/g dan az; sadece üçünde (%6.2) kob/g dan fazla (maksimum 5. log/kob g) olduğunu bildirmişlerdir. E. coli dahil Enterobacteriaceae grubu mikroorganizmalar standart pişirme uygulamalarında inaktive olmaktadır 4. Yetersiz pişirme sözkonusu olduğunda ise sayıları 5 kob/g ve üzerinde olabilmektedir 27. Çalışmamızda olduğu gibi adı geçen bakterilerin varlığı direkt olarak tüketime hazır dönerlerin güvenli olmadığını göstermemekle birlikte zayıf hijyen, yetersiz ısıl işlem ve rekontaminasyon gibi potansiyel problemlere işaret etmesi, aynı zamanda özellikle bağırsak kökenli patojenlerin de mevcut olabileceğini göstermesi açısından değerlendirildiğinde bazı örneklerin halk sağlığı açısından risk oluşturabileceği söylenebilir. Kanatlı hayvanların kesimindeki aşamalar kanatlı etlerinin yoğun mikrobiyel kontaminasyonuyla sonuçlanmaktadır. Dolayısıyla kanatlı etlerinin dayanıklılık süresi kısıtlı olduğu gibi kanatlı etlerinden yapılan ürünlerin de yüksek mikrobiyel yük nedeniyle raf ömrü kısalmaktadır 4. Diğer taraftan döner üretiminde olduğu gibi kanatlı etinden yapılan ürünlerde bazı üreticiler tarafından mikrobiyel yükün yoğun olduğu tavuk derisini de imalatta kullanma eğilimindedirler. Bu da mikrobiyel yükün daha da artmasıyla sonuçlanmaktadır. Dolayısıyla kanatlı eti dönerlerinin mikrobiyel yükünün kırmızı etten yapılanlara göre daha yüksek olması beklenen bir durum olarak değerlendirilebilir. Çalışmamızda da kanatlı etinden yapılan dönerlerin mikrobiyel yükü (TMAB) istatistik açıdan önemsiz (P>.5) bulunmakla birlikte kırmızı etten yapılanlara göre nispeten yüksek bulunmuştur. Diğer çalışmalarda da kanatlı etinden yapılan dönerlerin mikroorganizma sayısının kırmızı etten üretilen dönerlere göre daha yüksek bulunduğu bildirilmiştir 3,8,3. Türk Gıda Kodeksi Mikrobiyolojik Kriterler Tebliği nde ısıl işlem görmüş et ürünleri (sosis, salam, kavurma, döner, köfte, jöle işkembe vs.) için çalışmamızda varlığını araştırdığımız mikroorganizma ve mikroorganizma gruplarından sadece S. aureus ve C. perfringens için limit değerler verilmiştir 3. İncelediğimiz örneklerin hiçbirisinde S. aureus ve sülfit redükte eden anaeroblar tespit edilemediği için ilgili tebliğ açısından bir sorun bulunmamaktadır. Benzer şekilde, Hampikyan ve ark. 23 tarafından yapılan çalışmada da 2 döner örneğinin hiçbirisinde sayılabilir düzeyde S. aureus ve sülfit redükte eden anaerob varlığına rastlanmamıştır. Ayçiçek ve ark. 32 da askeri kafeteryalardan topladıkları 9 döner örneğinin hiçbirisinde S. aureus bulunmadığını rapor etmişlerdir. Jansson ve ark. 28 ise 48 döner örneğinin sadece inde S. aureus ve 2 sinde C. perfringens ( 2-3 kob/g) saptamışlardır. Yapılan diğer tarama çalışmalarında ise incelenen örneklerin önemli bir kısmında S. aureus, dikkate değer bir oranda ise C. perfringens varlığı bildirilmiştir. Küpeli Gençer ve Kaya 6 Erzurum ili merkezinde bulunan işletmelerden topladıkları döner örneklerinin %5 inde C. perfringens, %55 inde S. aureus saptamışlardır. Diğer bir çalışmada ise Kars ilindeki farklı restorantlardan alınan döner örneklerinin %32 sinde C. perfringens (en yüksek 5 kob/g), %27 sinde S. aureus (en yüksek 4 kob/g) bulunmuştur 7. Vazgeçer ve ark. 22 tarafından yürütülen bir çalışmada 72 pişmiş tavuk döner örneğinden 5 inde (%6.9) sülfit redükte eden bakterilere rastlanmış; örneklerin 36 sında (%5) stafilokok sayısı 2 kob/g dan yüksek bulunmuştur. Cebirbay 4 ise piyasadan temin edilen dönerlerde ortalama 2.7 log kob/g S. aureus,.2 log kob/g C. perfringens saptamıştır. S. aureus yüksek ısıya dayanıklı olmayan bir mikroorganizmadır 33. Bu mikroorganizmaların varlığı, hatalı ısıl işlemin yanı sıra, ısıl işlem sonrasında oluşan kontaminasyona işaret etmektedir 6,,34,35. C. perfringens dahil termofilik sporlu anaerob mikroorganizmalar ise hammadde orijinli olup uygulanan standart ısıl işlemden etkilenmemektedirler 33,36. Çalışmamızda diğer çalışmaların aksine S. aureus ve C. perfringens e rastlanmaması hammadde kalitesi (özellikle et ve baharat) ile ilişkilendirilebilir. Pişirilerek tüketime verilen gıda maddelerinde uygulanan ısıl işlemin etkinliği kadar pişirme sonrası yapılan muhafaza da gıda güvenliği açısından önemlidir. Isıl işlem sırasında hayatta kalan veya sonradan bulaşan patojen mikroorganizmalar uygun koşullar bulduğunda üreyip çoğalmaya devam edebilmektedir. Pişmiş dönerler için böyle bir risk olup olmadığı bu çalışmada ayrıca araştırılmıştır. Beklentinin aksine altı saat gibi uzun süre oda sıcaklığında bekletilmelerine rağmen TMAB, Enterobacteriaceae, E. coli ve S. aureus sayılarında önemli artış görülmemiştir. Benzer bulgu deneysel olarak S. aureus ile kontamine edilen örneklerde de gözlenmiştir. Todd ve ark. 37 da tüketimin az olduğu saatlerde ısı kaynağının kapatılarak dönerin şişte takılı olarak bekletilmesi durumunda bile S. aureus, E. coli, C. perfringens gibi bakterilerin sayısının 4 kob/g ı geçmediğini saptamışlardır. Bu durum pişmiş dönerlerin mikrobiyel gelişim için uygun ortam oluşturmadığı şeklinde açıklanabilir. Dönerin hammaddesi mikrobiyel geli-

101 786 Pişmiş Döner Kebaplarda... şim uygun bir ortam olan et olmasına rağmen döner diğer bileşenleri (tuz, yoğurt, sirke, limon suyu vs) birlikte ortamı mikrobiyel gelişim için uygun olmayan bir hale getirmiş olabilirler. Etin pişirilmesi sırasında etin su kaybederek su aktivitesini düşürmesi, pişme sırasında yağların eriyerek et parçalarının yüzeyini kaplaması ve mikroorganizmalar için gerekli oksijen temasını azaltması gibi faktörler de bu kapsamda değerlendirilebilir. Diğer taraftan pişirme sırasında açığa çıkan piroliz ürünlerinin antimikrobiyel etki gösterme potansiyellerininde olduğu ifade edilmektedir 38. Bununla birlikte daha uzun süreli (8 saat) muhafaza sonunda adı geçen mikroorganizmaların sayılarında dikkate değer bir artış olduğu da gözlenmiştir. Özellikle, ilk altı saatte sayılabilir düzeyde olmayan S. aureus 8. saat yapılan analizlerde ortalama 2.3 log kob/g düzeyinde saptanmıştır. Bu sonuç, özellikle gün içinde tüketilemeyen dönerlerin ertesi gün tüketilmek üzere şişte takılı olarak bekletilmesi durumunda, halk sağlığı açısından risk oluşturabileceğine de işaret etmesi açısından önem taşımaktadır. Elde edilen bulgulara göre piyasada satışa sunulan dönerlerin mikrobiyolojik kalitesinin önemli derecede değişkenlik gösterdiği; pişmiş dönerlerin mikrobiyel gelişim için uygun bir ortam oluşturmadığı sonucuna varılmıştır. KAYNAKLAR. Arslan A: Et Muayenesi ve Et Ürünleri Teknolojisi. s , Özkan Matbaacılık, Ankara, Öztan A: Et Bilimi ve Teknolojisi., s , Gıda Mühendisleri Odası Yayınları, Ankara, Acar MS: Kasaplık Hayvan Etleri ve Tavuk Etinden Yapılan Döner Kebapların Mikrobiyolojik Kalitesinin Karşılaştırmalı Araştırması. Doktora Tezi, İstanbul Üniversitesi, Sağlık Bilimleri Enstitüsü, İstanbul, Cebirbay MA: Dönerlerde Satış Süresi Boyunca Mikrobiyolojik Kalitede Meydana Gelen Değişmelerin Araştırılması. Yüksek Lisans Tezi, Selçuk Üniversitesi, Sağlık Bilimleri Enstitüsü, Konya, Stolle A, Eisgruber H, Kerschhofer D, Krauße G: Untersuchungen zur Verkehrsauffassung und Mikrobiologisch-Hygienishen Beschaffenheit im raum München. Fleischwirtschaft, 73 (9): , Küpeli Gençer V, Kaya M: Yaprak dönerin mikrobiyolojik kalitesi ve kimyasal bileşimi. Turk J Vet Anim Sci, 28, 97-3, Elmalı M, Ulukanlı Z, Tuzcu M, Yaman H, Çavlı P: Microbiological Quality of Beef Doner Kebabs in Turkey. Arch Lebensmittelhyg, 56, 25-48, Kayışoğlu S, Yılmaz İ, Demirci M, Yetim H: Chemical composition and microbiological quality of the doner kebabs sold in Tekirdağ Market. Food Control, 4, , Ulukanlı Z, Çavlı P, Tuzcu M: Detection of Escherichia coli O57:H7 from beef doner kebabs sold in Kars. Gazi Univ J Sci, 9 (2): 99-4, 26.. Topçu S: Ankara da satışa sunulan döner kebap çeşitlerinden Listeria monocytogenes, Staphylococcus aureus, Aeromonas hydrophila izolasyonu ve çeşitli antibiyotiklere dirençlilikleri. Yüksek Lisans Tezi, Gazi Üniversitesi, Fen Bilimleri Enstitüsü, Ankara, 26.. Anonymous: Salmonella poisoning and chicken shawarmas western Riyadh. Saudi Epidemiology Bulletin, 4, 8-9, Evans MR, Salmon RL, Nehaul L, Mably S, Wafford L, Nolan-Farrell MZ, Gardner D, Ribeiro CD: An outbreak of Salmonella typhimurium DT7 associated with kebab meat and yoghurt relish. Epidemiol Infect, 22 (3): , Synnott M, Morse DL, Maguire H, Cowden J: An outbreak of Salmonella mikawasima associated with doner kebabs. Epidemiol Infect,, , Uğur M, Nazlı B, Bostan K: Gıda Hijyeni. s , Teknik Yayınevi, İstanbul, Thaddeus F, Baryant M, Baryant RG: Sampling Plans, Sample collection, Shipment, and preparation for analysis. In, Downes FP, Ito K (Eds): Microbiological Examination of Foods. 4th ed., pp. 3-23, American Public Health Association, Washington DC, Maturin LJ, Peeler JT: Aerobic plate count. In, Bacteriological Analytical Manual, Chapter 3, 2. Accessed: ISO : Microbiology of food and animal feeding stuffs - Horizontal method for the detection and enumeration of Enterobacteriaceae. Part 2, Colony-count technique. Geneva, Switzerland, ISO : Microbiology of food and animal feeding stuffs - Horizontal method for the enumeration of ß-glucuronidase-positive Escherichia coli. Part 2, Colony-count technique a 44 C using 5-bromo-4-chloro-3-indoylbeta-D-glucuronide, Geneva, Switzerland, Speck MC: Compendium of Methods for the Microbiological Examination of Foods. American Public Health Association, Washington DC, Lancette GA, Bennett RW: Staphylococcus aureus and staphylococcal enterotoxins. In, Downes FP, Ito K (Eds): Microbiological Examination of Foods. 4th ed., pp , American Public Health Association, Washington DC, SPSS: SPSS Professional Statistics 7.5, SPSS Inc, Chicago, Vazgeçer B, Ulu H, Öztan A: Microbiological and chemical qualities of chicken doner kebab retailed on the turkish restaurants. Food Control, 5, , Hampikyan H, Ulusoy B, Bingöl EB, Çolak H, Akhan M: İstanbul da tüketime sunulan bazı ızgara tipi gıdalar ile salata ve mezelerin mikrobiyolojik kalitelerinin belirlenmesi. Türk Mikrobiyol Cemiy Derg, 38 (2): 87-94, Easa SMH: Microorganisms found in fast and traditional fast food. J Am Sci,, 55-53, Aydın A: Baharatlar ile ıtırlı bitkilerin mikrobiyel kontaminasyonu ve özellikleri. Gıda Yem Bil Teknol Derg, 3 (5): 46-5, FSANZ: Guidelines for the microbiological examination of readyto-eat foods. Food Standards Australia New Zealand, 2. guidelinesformicrobi36.cfm, Accessed: Jöckel J, Stengel G: Doner Kebab-Untersuchung und Beurteilung einer Turkischen Spezialitat. Fleischwirthschaft, 64 (5): , Harakeh S, Yassine H, Gharios M, Barbour E, Hajjar S, El-Fadel M, Toufeili I, Tannous R: Isolation, molecular characterization and antimicrobial resistance patterns of Salmonella and Escherichia coli isolates from meat-based fast food in Libanon. Sci Total Environ, 34 (-3): 33-44, Jansson E, Bird P, Saputra T, Arnold G: Food safety survey of retail doner kebabs in NSW. Food Aust, 6 (3): 95-98, Yüksek N, Evrensel SS, Temelli S, Anar S, Şen MKC: Microbiological evaluation on the ready-to-eat red meat and chicken donair kebabs from a local catering company in Bursa. J Biol Environ Sci, 3 (7): 7-, TGK (Türk Gıda Kodeksi): Mikrobiyolojik Kriterler Tebliği. Tebliğ no 29/6. Resmi Gazete /2733, Ankara, Ayçiçek H, Çakıroğlu S, Stevenson TH: Incidence of Staphylococcus aureus in ready-to-eat meals from military cafeterias in Ankara, Turkey. Food Control, 6 (6): , Erol İ: Gıda Hijyeni ve Mikrobiyolojisi. s. 54-6, Pozitif Matbaacılık, Ankara, Bostan K, Çetin Ö, Büyükünal SK, Ergün Ö: The presence of Staphylococcus aureus and staphylococcal enterotoxins in read to cook meatballs and white pickled cheese. İstanbul Üniv Vet Fak Derg, 32, 3-4, Jablonski LM, Bohach GA: Staphylococcus aureus. In, Doyle MP, Beuchat LR, Montville TJ (Eds): Food Microbiology, Fundamentals and Frontiers. 2nd ed., pp , ASM Press, Washington DC, Doyle MP, Beuchat LR, Montville TJ: Food Microbiology Fundamentals and Frontiers. 2nd ed., pp , ASM Press, Washington, Todd ECD, Szabo R, Spiring F: Donairs (Gyros)-potential hazards and control. J Food Protect, 49, , Lambert M, Kremer S, Anke H: Antimicrobial, phytotoxic, nematicidal, cytotoxic, and mutagenic activities of -hydroxypyrene, the initial metabolite in pyrene metabolism by the basidiomycete Crinipellis stipitaria. B Environ Contam Tox, 55, , 995.

102 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Chewing lice (Phthiraptera) Found on Wild Birds in Turkey Bilal DİK * Elif ERDOĞDU YAMAÇ ** Uğur USLU * * Selçuk University, Veterinary Faculty, Department of Parasitology, Alaeddin Keykubat Kampusü, TR-4275 Konya - TURKEY ** Anadolu University, Faculty of Science, Department of Biology, TR-2647 Eskişehir - TURKEY Makale Kodu (Article Code): KVFD Summary This study was performed to detect chewing lice on some birds investigated in Eskişehir and Konya provinces in Central Anatolian Region of Turkey between 28 and 2 years. For this aim, 3 bird specimens belonging to 23 bird species which were injured or died were examined for the louse infestation. Firstly, the feathers of each bird were inspected macroscopically, all observed louse specimens were collected and then the examined birds were treated with a synthetic pyrethroid spray (Biyo avispray-biyoteknik ). The collected lice were placed into the tubes with 7% alcohol and mounted on slides with Canada balsam after being cleared in KOH %. Then the collected chewing lice were identified under the light microscobe. Eleven out of totally 3 (35.48%) birds were found to be infested with at least one chewing louse species. Eighteen lice species were found belonging to 6 genera on infested birds. Thirteen of 8 lice species; Actornithophilus piceus piceus (Denny, 842); Anaticola phoenicopteri (Coincide, 859); Anatoecus pygaspis (Nitzsch, 866); Colpocephalum heterosoma Piaget, 88; C. polonum Eichler and Zlotorzycka, 97; Fulicoffula lurida (Nitzsch, 88); Incidifrons fulicia (Linnaeus, 758); Meromenopon meropis Clay ve Meinertzhagen, 94; Meropoecus meropis (Denny, 842); Pseudomenopon pilosum (Scopoli, 763); Rallicola fulicia (Denny, 842); Saemundssonia lari Fabricius, O, 78), and Trinoton femoratum Piaget, 889 have been recorded from Turkey for the first time. Keywords: Chewinglice, Anaticola, Fulicoffula, Incidifrons, Pseudomenopon, Meropoecus, Meromenopon, Rallicola, Colpocephalum, Actornithophilus, Saemundssonia, Trinoton, Turkey Özet Türkiye deki Yabani Kanatlılarda Bulunan Çiğneyici Bit (Phthiraptera) Türleri Bu çalışma 28-2 yılları arasında Türkiye nin İç Anadolu Bölgesinde yer alan Konya ve Eskişehir deki bazı yabani kanatlıların bitlerini belirlemek amacıyla yapılmıştır. Bu amaçla 23 kanatlı hayvan türüne ait 3 ölü veya yaralı kuş örneği bit yönünden incelenmiştir. Kuşların tüyleri makroskopik olarak dikkatli bir şekilde incelenmiş, daha sonra sentetik pretroidli (Biyo avispray-biyoteknik ) bir insektisitle ilaçlanmıştır. Toplanan bitler içinde %7 alkol bulunan tüplere konulup % KOH de saydamlaştırıldıktan sonra Kanada balsam ile lamlara yapıştırılarak ışık mikroskobunda teşhis edilmişlerdir. İncelenen 3 kuşun (35,48%) i en az bir bit türü ile enfeste bulunmuştur. Enfeste kuşlarda 6 cinse ait 8 bit türü tespit edilmiştir. Bu türlerden 3 ü; Actornithophilus piceus piceus (Denny, 842); Anaticola phoenicopteri (Coincide, 859); Anatoecus pygaspis (Nitzsch, 866); Colpocephalum heterosoma Piaget, 88; C. polonum Eichler and Zlotorzycka, 97; Fulicoffula lurida (Nitzsch, 88); Incidifrons fulicia (Linnaeus, 758); Meromenopon meropis Clay ve Meinertzhagen, 94; Meropoecus meropis (Denny, 842); Pseudomenopon pilosum (Scopoli, 763); Rallicola fulicia (Denny, 842); Saemundssonia lari Fabricius, O, 78) ve Trinoton femoratum Piaget, 889 Türkiye den ilk kez bu çalışmayla bildirilmiştir. Anahtar sözcükler: Çiğneyici bit, Anaticola, Fulicoffula, Incidifrons, Pseudomenopon, Meropoecus, Meromenopon, Rallicola, Colpocephalum, Actornithophilus, Saemundssonia, Trinoton, Türkiye INTRODUCTION Chewing lice (Ishnocera, Amblycera) are permanent obligate ectoparasites mostly parasitic on bird species and they feed on feathers and skin scales. Although they have mouthparts designed for chewing, some of the species of Ishnocera can cause skin irritations and suck blood. Chewing lice have harmful effects that lead to decrease in İletişim (Correspondence)

103 788 Chewing lice (Phthiraptera) Found... productivity on the host. About 4. lice species were recorded on birds in the world. The number of louse species recorded from birds in Turkey is limited 2. On the other hand, the studies on the identification of lice on bird species have been increasing over the last years in Turkey. Approximately 5 new records for the bird louse fauna of Turkey have been recorded in recent years. Up today 82 chewing lice were described from birds in the limeted studies in Turkey 2. In some of these studies, most chewing lice were collected from injured or died birds that were found accidentally 3-9. On the other hand, recent studies have focused on louse species of Songbirds (Passeriformes) and Shorebirds (Charadriiformes). In spite of the records on chewing lice on birds have already indicated limited number of louse species, the studies on the lice have a big potential for new discoveries. The objective of this study was to investigate and identify louse species on birds and provide data on the chewing lice list from Turkey. MATERIAL and METHODS This study was performed in Eskişehir and Konya provinces between 28 and 2 years. The collection of chewing lice was carried out from 3 birds (of 23 species in 9 genera, 6 families and 9 orders) that were found to be injured or died in the field (Table ). In order to collect the lice, the feathers of each bird were carefully examined and rubbed over a white piece of paper with a synthetic pyrethroid insecticide (Biyo avispray :.9 g tetramethrin and.45 g piperonyl butoxide g (w/w); Biyoteknik Chemistry, Turkey) harmless to vertebrates. Then the birds were placed in breathable paper bags for 5 min. All lice preserved in 7% alcohol, cleared in % KOH, then washed with distilled water, passed in alcohol series 7%, 8%, 9% and 99% in four consecutive days. They were mounted on slides in Canada balsam and examined by a light microscope. The identification of the louse species was carried out according to relevant literatures,2-28. RESULTS Eleven out of totally 3 (35.48%) examined birds were found to be infested with at least one chewing louse species and 8 lice species from 6 genera were identified. Although, no louse was found on 9 birds of 8 species belong to Passeriformes and Strigiformes, of 22 birds belong to 5 species in 7 orders were parasitized (Table 2). Ischnocera Anaticola phoenicopteri: Examined materials: 4, Table. Studied bird orders, families, genera and species Tablo. İncelenen kuş takım, aile, cins ve türleri Order Family Genus Species Number of Examined Bird Ciconiiformes Ciconiidae Ciconia C. ciconia 2 Phoenicopteriformes Phoenicopteridae Phoenicopterus P. ruber Accipiter A. gentilis Accipitridae Circaetus C. gallicus Falconiformes B. buteo Buteo B. rufinus 3 Falconidae Falco F. columbarius Gruiformes Rallidae Fulica F. atra 3 Laridae Larus L. genei Recurvirostridae Himantopus H. himantopus Charadriiformes Calidris C. alba Scolopacidae Tringa T. totanus Sternidae Chlidonias C. leucopterus Columbiformes Columbidae Columba C. livia 3 Strigiformes Strigidae Asio A. otus Coraciiformes Meropidae Merops M. apiaster Carduelis C. carduelis 2 Fringillidae Loxia L. curvirostra Serinus S. canaria Passeriformes Paridae Parus P. caeruleus Passeridae Passer P. domesticus Sylviidae Sylvia S. melanocephala Turdidae Luscinia L. megarhynchos Total 3

104 789 DİK, ERDOĞDU YAMAÇ, USLU, N, 3.7.2, Akşehir, Konya (Fig. ). Host: Greater Flamingo (Phoenicopterus ruber). It was reported for the first time in Turkey. Anatoecus pygaspis: Examined materials: 5, 3, 3.7.2, Akşehir, Konya (Fig. 2, 3). Host: Greater Flamingo (Phoenicopterus ruber). It was reported for the first time in Turkey. Ardeicola ciconiae: Examined materials: 2, N, , Konya Metropolitan Municipality Animal Shelter, Selçuklu-Konya; 2,, N,.4.2, Selçuk University, Clinics of Veterinary Faculty, Konya. Host: White Stork (Ciconia ciconia). Columbicola columbae: Examined materials:, N, ; 2, Konya. Host: Rock Pigeon (Columba livia). Fulicoffula lurida: Examined materials: 7, 3 N, , Akşehir, Konya, 9, 5 N , Akşehir, Konya (Fig. 4). Host: Eurasian Coot (Fulica atra). It was reported for the first time in Turkey. Incidifrons fulica: Examined materials:, , Akşehir, Konya (Fig. 5). Host: Eurasian Coot (Fulica atra). It was reported for the first time in Turkey. Meropoecus meropis: Examined materials: 2 N, 3.8.2, Eskişehir (Fig. 6). Host Bee-eater (Merops apiaster). It was reported for the first time in Turkey. Neophilopterus incompletus: Examined materials:,, , Konya;, N,.4.2, Konya. Host: Fig. Anaticola phoenicopteri, male, orig. Fig 2. Anatoecus pygaspis, female, orig. Fig 3. Anatoecus pygaspis, male, orig. Şekil. Anaticola phoenicopteri, erkek, orijinal Şekil 2. Anatoecus pygaspis, dişi, orijinal Şekil 3. Anatoecus pygaspis, erkek, orijinal Fig 4. Fulicoffula lurida, female, orig. Fig 5. Incidifrons fulicae, male, orig. Fig 6. Meropoecus meropis, nymph, orig. Şekil 4. Fulicoffula lurida, dişi, orijinal Şekil 5. Incidifrons fulicae, erkek, orijinal Şekil 6. Meropoecus meropis, nimf, orijinal

105 79 Chewing lice (Phthiraptera) Found... Table 2. Studied bird species, infestation rates and louse species on avian host Table 2. İncelenen kuş türleri, enfestasyon oranları ve saptanan bit türleri Bird Species Date/Locality Number of Examined Bird Number of Infested Bird Louse Species Nightingale (Luscinia megarhynchos).5.28 Beyyayla/Eskişehir (live) - - Sardinian Warbler (Sylvia melanocephala).5.28 Beyyayla/Eskişehir (live) - - Blue Tit (Parus caeruleus) Gürleyik/ Eskişehir (live) - - Bee-eater (Merops apiaster ) Eskişehir (died) Meromenopon meropis Meropoecus meropis Common Crosbill (Loxia curvirostra) Eskişehir (injured) - - Goldfinch (Carduelis carduelis) ; Eskişehir (live) White-winged Black Tern (Chlidonias leucopterus) Akşehir-Konya (died) Actornithophilus piceus piceus Buzzard (Buteo buteo).7.2 Eskişehir Zoo (injured) - - Long-legged Buzzard (Buteo rufinus).7.2 Eskişehir Zoo (injured) Konya (injured) Konya (injured) Goshawk (Accipiter gentilis) Kızılinler village-eskişehir (injured) Colpocephalum polonum Greater Flamingo (Phoenicopterus ruber) Akşehir-Konya (died) Trinoton femoratum Colpocephalum heterosoma Anaticola phoenicopteri Anatoecus pygaspis Eurasian Coot (Fulica atra) Akşehir-Konya (2 lives, died) 3 2 Fulicoffula lurida Rallicola fulica Incidifrons fulica Pseudomenopon pilosum Slender-billed Gull (Larus genei) Akşehir-Konya (died) Saemundssonia lari Merlin (Falco columbarius).2.2 Beyşehir-Konya (injured) - - House Sparrow (Passer domesticus) Konya (live) - - White Stork (Ciconia ciconia) ;.4.2 Konya (injured) 2 2 Colpocephalum zebra Ciconiphilus quadripustulosus Ardeicola ciconiae Neophilopterus incompletus Long-eared Owl (Asio otus) Karaman (died) - - Rock Pigeon (Columba livia) ; ; Konya (live) 3 2 Columbicola columbae Short-toed Eagle (Circaetus gallicus) Ürgüp-Nevşehir (died) - - Canary (Serinus canaria) Konya (live) - - Black-winged Stilt (Himantopus himantopus) Akşehir-Konya (died) - - Sanderling (Calidris alba) Akşehir-Konya (died) - - Redshank (Tringa totanus) Akşehir-Konya (died) - - White Stork (Ciconia ciconia). Rallicola fulica: Examined materials:,, 4 N, , Akşehir, Konya, 5, 3, 2 N, , Akşehir, Konya (Fig. 7, 8). Host: Eurasian Coot (Fulica atra). It was reported for the first time in Turkey. Saemundssonia lari: Examined materials:, 2, 3 N, 3.7.2, Akşehir, Konya (Fig. 9). Host: Slenderbilled Gull (Larus genei). It was reported for the first time in Turkey. Amblycera Actornithophilus piceus piceus: Examined materials: 2, Akşehir, Konya (Fig. ). Host: White-winged Black Tern (Chlidonias leucopterus). It was reported for the first time in Turkey. Ciconiphilus quadripustulosus: Examined materials: 29, 7, 6 N, , Konya; 2,,.4.2, Konya. Host: White Stork (Ciconia ciconia). Colpocephalum zebra: Examined materials:, , Konya. Host: White Stork (Ciconia ciconia). Colpocephalum heterosoma: Examined materials: 3, 9, Akşehir, Konya (Fig., 2). Host: Greater Flamingo (Phoenicopterus ruber). It was reported for the first time in Turkey. Colpocephalum polonum: Examined materials: 6, 6, 2 N, 8.8.2, Eskişehir (Fig. 3, 4). It was reported for the first time in Turkey. Host: Goshawk (Accipiter gentilis). Meromenopon meropis: Examined materials:, 3.8.2, Akşehir, Konya (Fig. 5). Host: Bee-eater (Merops

106 79 DİK, ERDOĞDU YAMAÇ, USLU Fig 7. Rallicola fulicia,female, orig. Fig 8. Rallicola fulicia, male, orig. Fig 9. Saemundssonia lari, male, orig. Şekil 7. Rallicola fulicia, dişi, orijinal Şekil 8. Rallicola fulicia, erkek, orijinal Şekil 9. Saemundssonia lari, erkek, orijinal Fig. Actornithophilus piceus piceus, female, orig. Fig. Colpocephalum heterosoma, female, orig. Fig 2. Colpocephalum heterosoma, male, orig. Şekil. Actornithophilus piceus piceus, dişi, orj. Şekil. Colpocephalum heterosoma, dişi, orj. Şekil 2. Colpocephalum heterosoma, erkek, orj. Fig 3. Colpocephalum polonum, female, orig. Fig 4. Colpocephalum polonum, male, orig. Fig 5. Meromenopon meropis, male, orig. Şekil 3. Colpocephalum polonum, dişi, orijinal Şekil 4. Colpocephalum polonum, erkek, orj. Şekil 5. Meromenopon meropis, erkek, orijinal

107 792 Chewing lice (Phthiraptera) Found... Fig 6. Pseudomenopon pilosum, male (at left), female (at right), orig. Şekil 6. Pseudomenopon pilosum, erkek (solda), dişi (sağda), orijinal Fig 7. Trinoton femoratum, female, orig. Şekil 7. Trinoton femoratum, dişi, orijinal apiaster). It was reported for the first time in Turkey. Pseudomenopon pilosum: Examined materials: 8, 8 2 N, , Akşehir, Konya, 2, 4, Akşehir, Konya (Fig. 6). It was reported for the first time in Turkey. Host: Eurasian Coot (Fulica atra). Trinoton femoratum: Examined materials:, 3 N, 3.7.2, Akşehir-Konya (Fig. 7). It was reported for the first time in Turkey. Host: Greater Flamingo (Phoenicopterus ruber). DISCUSSION Approximately 4 valid lice species have been found on the birds in the world. Until now, 465 bird species were recorded from Turkey,29. However, almost all of the louse fauna of these birds are still unknown. Until today approximately bird species were investigated for the louse infestation and 82 chewing lice species belonging to 37 genera were identified 2. Colpocephalum zebra, Ciconiphilus quadripustulosus, Ardeicola ciconiae and Neophilopterus incompletus on white storks (Ciconia ciconia) 7, Austromenopon atrofulvum, Quadraceps anagrapsus and Saemundssonia lobaticeps on white-winged black tern (Chlidonias leucopterus), Strigiphilus barbatus on longeared owl (Asio otus), Kurodaia fulvofasciata on buzzard (Buteo buteo), Laemobothrion maximum, Colpocephalum nanum, Colpocephalum sp, Degeeriella fulva and Craspedorrhynchus platystomus on long-legged buzzard (Buteo rufinus) were reported from Turkey in these studies. The presence of some louse species except C. columbae recorded from rock pigeons (Columba livia) was suspect and it has already been discussed by Dik 5 in a previous work. On the other hand, no louse specimen was found on sparrow (Passer domesticus) 5 and short-toed eagle (Circaetus gallicus) 9. It was investigated some specimens of the bird species which their names were mentioned above in the present study, and only one species; C.columbae was found on rock pigeon, while all of the lice species recorded from white storks were detected. Two female samples of Actornithophilus piceus piceus were collected on whitewinged black tern in this study, while Austromenopon atrofulvum, Quadraceps anagrapsus and Saemundssonia lobaticeps were recorded in a previous study. Clay 7 reported five lice species; Colpocephalum heterosoma Piaget, 88; Colpocephalum salimalii Clay, 95; Trinoton sp, Anaticola phoenicopteri (Coincide, 859) and Anatoecus keleri Clay, 962 from greater flamingo (Phoenicopterus ruber). In addition, Price et al. recorded eight species; Anaticola candidus (Rudow, 869); Anaticola phoenicopteri (Coincide, 859), Anatoecus keleri Clay, 962; Anatoecus pygaspis (Nitzsch, 866); Colpocephalum heterosoma Piaget, 88; Colpocephalum rosei Price and Emerson, 974; Colpocephalum salimalii Clay, 95 and Trinoton femoratum Piaget, 889 on greater flamingo. Morphological features of the genus Anatoecus and some species were found in this genus studied in detail by Keler 22. Clay 6 described A. keleri from greater flamingo and reported that morphologic characters of this species similar to A. pygaspis, however distinguish from A. pygaspis by the characters of the male genital sac, the sclerite being long and stout and lying in the centre. It was detected that the morphological characters of abdominal tergites, lateral sclerites and male genitalia of the all male specimens examined in this study were observed to be similar to those of A. pygaspis. Clay 3 described the morphological characters of Colpocephalum heterosoma Piaget, 88 and Colpocephalum salimalii Clay, 95 in detail, and reported that resemble of these species each other. This investigator 3 indicated

108 793 DİK, ERDOĞDU YAMAÇ, USLU that the characters of male genitalia of C. salimalii are quite different from C. heterosoma and there are some differences in the shape of the metathorax and abdomen and the protergal, mesotergal and abdominal chaetotaxy. In addition, Price and Beer 25 explained the morphological characters and identification key of the Colpocephalum species found on Ciconiiformes and reported that there were many short or medium long seta on abdominal tergites IV-VIII of male C. heterosoma while male specimens of C. salimalii had rare and short seta on the abdominal segments IV-VIII. Same authors 25 recorded that abdomen was rounded in C. heterosoma while attenuated in C. salimalii, in the females. In the present study, it was detected that the morphologic characters of all Colpocephalum specimens collected from greater flamingo resemble to C. heterosoma. Price et al. stated that six lice species; Colpocephalum nanum Piaget, 88; C. polonum Eichler and Zlotorzycka, 97; Craspedorrhynchus haematopus (Scopoli, 763); Degeeriella vagans (Giebel, 874); Laemobothrion maximum (Scopoli, 763) and Nosopon lucidum (Rudow, 869) were found on goshawk (Accipiter gentilis). Price and Beer 24 reported that Colpocephalum nanum was occurred on goshawk in addition to the other prey birds. Eichler and Zlotorzycka 28 identified that the lice specimens were collected from goshawks as C. polonum (=Neocolpocephalum polonum). The morphologic characters of C. polonum were not described by Eichler and Zlotozycka 28 in detail, however they were pointed out that this species resembles to C. turbinatum and C. germanum. Thus in this study, the all collected louse specimens from goshawk were identified as C. polonum. Some authors 5,3 recorded that Strigiphilus barbati was found on long-eared owl (Asio otus) in Turkey. Dik et al. stated that the louse infestations were occurred on songbirds (Passeriformes) very low rates, and five lice species were detected in their study in Turkey. Although, only one bird species (long-eared owl) belonging to the order Strigiformes was examined, no louse specimen was detected, in this study. Besides, eight bird specimens belonging to the order Passeriformes were examined but it was no louse obtained from these birds. Three lice specimens collected from bee-eater were identified as Meropoecus meropis (two nymphs), and Meromenopon meropis (male). Other species occurring on bee-eater, Brueelia apiastri was not detected in this study. In previous studies were performed to detect lice of beeeaters showed that the lice specimens on the bee-eaters were low numbers 2,3. Similarly, a few lice specimens were collected on the bee-eaters in this study. It was determined that relatively more lice specimens were obtained on great flamingo, goshawk and Eurasian coot while a little numbers of the lice on the other examined birds which examined in the study. Sixty-eight lice samples from greater flamingo, 34 from goshawk and 84 from Eurasian coot, while two lice specimens from whitewinged black tern, five from slender-billed gull, three from bee-eater, six from two white storks and four from two rock pigeon were collected in the present study. In conclusion, 3 lice species; C. polonum Eichler and Zlotorzycka, 97; Meromenopon meropis Clay and Meinertzhagen, 94; Meropoecus meropis (Denny, 842); Actornithophilus piceus piceus (Denny, 842); Trinoton femoratum Piaget, 889; Colpocephalum heterosoma Piaget, 88; Anaticola phoenicopteri (Coincide, 859); Anatoecus pygaspis (Nitzsch, 866); Fulicoffula lurida (Nitzsch, 88); Rallicola fulicia (Denny, 842); Incidifrons fulicia (Linnaeus, 758); Pseudomenopon pilosum (Scopoli, 763) and Saemundssonia lari Fabricius, O, 78) detected in this study were recorded for the first time in Turkey with this study. REFERENCES. Price RD, Hellenthal RA, Palma RL, Johnson KP, Clayton DH: The Chewing Lice: World checklist and biological overview. Illinois Natural History Survey Special Publication, 24. x + 5 pp, İnci A, Yıldırım A, Dik B, Düzlü O: Current knowledge of Turkey s louse fauna. Türkiye Parazitol Derg, 34 (4): 22-22, Aksin N: Elazığ yöresinde yabani kazlarda bit enfestasyonu. Turk J Vet Anim Sci, 28, 87-9, Dik B: Mallophaga species on long-legged buzzards (Buteo rufinus). New records from Turkey. Türkiye Parazitol Derg, 3, , Dik B: Türkiye deki evcil ve yabani kanatlılarda bulunan Çiğneyici bit (Phthiraptera) türler. Türkiye Parazitol Derg, 34, 55-6, Dik B, Aydenizöz Özkayhan M: Mallophaga species on long-legged buzzards (Buteo rufinus) in Turkey. Türkiye Parazitol Derg, 3, 298-3, Dik B, Uslu U: Beyaz Leyleklerde (Ciconia ciconia Linnaeus, 758) görülen Mallophaga (Insecta) türleri. Türkiye Parazitol Derg, 3, , Dik B, Uslu U: Türkiye de, Beyaz Pelikanlarda (Pelecanus onocrotalus, Linneaus) görülen Mallophaga türleri. Türkiye Parazitol Derg, 32, 7-76, Dik B, Uslu U: Konya Hayvanat Bahçesindeki kanatlı hayvanlarda görülen çiğneyici bit (Phthiraptera: Amblycera, Ischnocera) Türleri. Türkiye Parazitol Derg, 33 (): 43-49, 29.. Dik B, Kirpik MA, Şekercioglu ÇH, Şaşmaz Y: Chewing lice (Phthiraptera) found on Songbirds (Passeriformes) in Turkey, Turkiye Parazitol Derg, 35, 34-39, 2.. Dik B, Şekercioğlu ÇH, Kirpik MA, İnak S, Uslu U: Chewing Lice (Phthiraptera) Species found on Turkish Shorebirds (Charadriiformes). Kafkas Univ Vet Fak Derg, 6, , Adam C: Some morphological aspects of the species Meropoecus meropis (Denny, 842) (Phthiraptera: Ischnocera). Travaux du Muséum National d Histoire Naturelle Grigore Antipa.7, 29-37, Clay T: Systematic notes on the Piaget collections of Mallophaga.-Part III. Ann Mag Nat Hist, (Serie 2), 4, 59-69, Clay T: Revisionas of the genera of Mallophaga. I. The Rallicolacomplex. Proc Zool Soc Lond, 23, , Clay T: A key to the species of Actornithophilus Ferris with notes and descriptions of new species. Bull Brit Mus (Nat Hist), Entomology,, , Clay T: A new species of Anatoecus Cummings (Mallophaga) from Phoenicopterus ruber Linn. Ent Ber, 22, , Clay T: The Phthiraptera (Insecta) parasitic on flamingoes (Phoenicopteridae: Aves). J Zool Lond, 72, , 974.

109 794 Chewing lice (Phthiraptera) Found Clay T, Hopkins GHE 95. The early literature on Mallophaga. Part I ( ). Bulletin of the British Museum (Nat Hist) Entomology, , Clay T, Hopkins GHE: The early literature on Mallophaga. Part IV, Bulletin of the British Museum (Nat Hist) Entomology. 9, -6, Eichler W: Die Mallophagengattung Anaticola. Dtsch Ent Z, 27, , Emerson KC: A review of the genus Rallicola (Philopteridae, Mallophaga) found on Aramidae, Psophiidae and Rallidae. Ann Entomol Soc Am, 48, , Cicchino AC, Emerson KC: Contribucion al conocimiento de los Malofagos Argentinos. XIV. Philopteridae (Mallophaga Ischnocera) Nuevos o poco conocidos parasitos de Rallidae. Neotropica, 29, 57-72, Kéler SV: Über die dualistiche differenzierung der Gattung Anatoecus Cummings (Mallophaga). Z Parasitenkde, 2, 27-36, Price RD: A review of the genus Pseudomenopon (Mallophaga: Menoponidae). Ann Entomol Soc Am, 67, 73-84, Price RD, Beer J: The Colpocephalum (Mallophaga: Menoponidae) of the Ciconiiformes. Ann Entomol Soc Am, 58, -3, Price RD, Beer J: Species of Colpocephalum (Mallophaga: Menoponidae) Parasitic upon the Falconiformes. Can Entomol, 95, , Price RD, Emerson KC: The genus Meromenopon (Mallophaga: Menoponidae) from the Coraciiformes (Aves). J Kansas Ent Soc, 5, 25-22, Eichler W, Zlotorzycka J: Studien über Raubvogelfederlinge VII. Die Neocolpocephalum-Gruppe und ihre Wirt-Parasit-Beziehungen. Angew Parasitol, 2, 9-33, Sekercioglu CH: A birder s guide to Turkey. Living Bird, 26, 4-23, İnci A, Dik B, Kibar M, Yıldırım A, Düzlü O: Chewing lice (Phthiraptera) species on wild birds in the Cappadocia region. Türkiye Parazitol Derg, 34 (4): 74-78, Petrescu A, Adam C: Interspecific relations in the populations of Merops apiaster L. (Aves: Coraciiformes) of Southern Romania. Travaux du Muséum National d Histoire Grigore Antipa, 8, , 2.

110 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Localization of Estrogen Receptor Alpha and Progesterone Receptor B in the Bovine Ovary During the Follicular and Luteal Phase of the Sexual Cycle Mehmet Erdem AKBALIK * Hakan SAĞSÖZ * Berna GÜNEY SARUHAN * * Dicle University, Faculty of Veterinary Medicine, Department of Histology and Embryology, TR-228 Diyarbakır - TURKEY Makale Kodu (Article Code): KVFD Summary Ovarian steroid hormones, mainly estrogen and progesterone, play a central role in the regulation of ovarian functions. The biological effects of progesterone (PR) and estrogen (ER) are dependent on the activation of both PR and ER isoforms. In the present study, we studied the cellular distribution and localization of progesterone receptor B (PR-B) and estrogen receptor alpha (ERα) in the bovine ovaries during the follicular and luteal phases of the sexual cycle using immunohistochemical methods. The estrous cycle stage of 23 Holstein bovines was evaluated by gross and histological appearance of ovaries and blood steroid hormone values. Tissue samples from ovaries were fixed in % formaldehyde for routine histological processing. ERα immunoreactivity was observed in nuclei of granulosa cells of growing follicles at all stages from primary to mature follicles, epithelial cells of the germinal epithelium, stroma cells, theca cells, corpora lutea cells and cells of the corpora albicantia. Nuclear staining for PR-B was not detected in the granulosa cells in all sizes of follicles, but was positively stained in germinal epithelium cells, stroma cells, corpora albicantia cells and corpora lutea cells. In conclusion, ERα and PR-B immunoreactivity in bovine ovary were not indicate too much difference between the phases of the sexual cycle but have important differences in cell-spesific localization. Keywords: Bovine ovary, Estrogen receptor, Progesterone receptor, Immunohistochemistry İnek Ovaryumunda Seksüel Siklusun Foliküler ve Luteal Fazı Boyunca Östrojen Reseptör Alfa ve Progesteron Reseptör B nin Lokalizasyonu Özet Ovaryum steroid hormonları, özellikle östrojen ve progesteron, ovaryum fonksiyonlarının düzenlenmesinde merkezi bir rol oynar. Progesteron (PR) ve östrojen (ER) in biyolojik etkileri hem PR hem de ER izoformlarının aktivasyonuna bağlıdır. Bu çalışmada, seksüel siklusun foliküler ve luteal fazı boyunca inek ovaryumunda progesteron reseptör B (PR-B) ve östrojen reseptör alfa (ERα) nın lokalizasyonunu ve hücresel dağılımını immunohistokimyasal yöntemler kullanarak çalıştık. Yirmiüç Holstein ineğin östrus siklus dönemi, ovaryumun bütünü ve histolojik görünümü ve kan steroid hormon değerleri ile değerlendirildi. Ovaryumdan elde edilen doku örnekleri rutin histolojik işlemler için % luk formaldehit içinde tespit edildi. ERα immunoreaktivitesi, korpus albikans hücrelerinde, korpus luteum hücrelerinde, teka hücrelerinde, bağ doku hücrelerinde, germinal epitel hücrelerinde ve primer folikülden olgun foliküle her aşamada gelişen foliküllerin granuloza hücre çekirdeklerinde gözlendi. PR-B için çekirdek boyanma, tüm büyüklükteki foliküllerin granuloza hücrelerinde saptanamadı, ancak korpus luteum hücrelerinde, korpus albikans hücrelerinde, bağ doku hücrelerinde ve germinal epitel hücrelerinde pozitif boyanma görüldü. Sonuç olarak, inek ovaryumunda ERα ve PR-B immunoreaktivitesi açısından seksüel siklusun fazları arasında çok fazla fark olmadığı ancak hücre-spesifik lokalizasyonda önemli farklılıkların olduğu gösterildi. Anahtar sözcükler: İnek ovaryumu, Östrojen reseptör, Progesteron reseptör, İmmunohistokimya İletişim (Correspondence) /8639

111 796 Localization of Estrogen Receptor... INTRODUCTION The best-known and best-characterized secretory products of the ovary are the steroid hormones. They produced by follicles and corpus luteum cells and act locally with in the follicles or corpus lutea as paracrine/autocrine agents. Ovarian steroid hormones, mainly estrogen and progesterone, diffuse from the blood and binds to a specific receptor located in the nuclei. These hormones interplay the role of controlling the morphological and the functions of female reproductive organs 2,3. Estrogen stimulates the development and maturation of ovarian follicles, increases expression of FSH receptor and LH receptor by granulosa cells, modulates steroid production by granulosa and theca cells and induces the development of gap junctions between granulosa cells 4. Estrogen shows its effect by binding receptors that are members of the nuclear receptor family called estrogen receptors (ERs). These receptors are expressed as two related subtyped ER- alpha (α) and ER- beta (β), which are encoded by two genes. ERβ was mainly detected in granulosa cells, ERα was detected in theca cells, intersititial glands, stroma cells and germinal epithelium 5,6. In the ovary of domestic animals, ERα expression was demonstrated in monkeys 7, humans 8,9, rats, cattle 4, sheep,2, and pigs 3. Progesterone has a crucial role on the growth and differentiation of ovarian structures and makes the endometrium ready for the implantation of the embryo 4. Progesterone features its effects on target tissues by binding a receptor called progesterone receptors (PRs). Two different receptors have been identified (PR-A and PR-B) 5. The presence of PR has been demonstrated in the ovary of a number of species, e.g. human 6, monkey 7, bovine 7, pig 8, rabbit 9, dog 2 and mouse 2 but not PR-B in bovine ovary. Although the presence of estrogen and progesterone receptors have been studied in the bovine ovary 4,7, we have seen a different pattern of ERα distribution and cellular localization among ovarian tissues, for this reason we wanted to demonstrate the differences for ERα and the first time PR-B immunoreactivity in the bovine ovary. MATERIAL and METHODS Animals and Samples Bovine ovaries from 23 different animals were obtained from a local slaughterhouse where the tissues were removed immediately after sacrificing the animal. Blood samples from these animals also were taken before death to measure estrogen and progesterone levels. The blood serum concentrations of estradiol-7β (DRG Intl. Inc., DRG Aurica Elisa Estradiol Kit, cat. no. EIA-2693, Marburg/ Germany) and progesterone (DRG Intl Inc. Company, DRG Aurica Elisa Progesterone Kit, cat. no. EIA-56, Marburg/ Germany) were measured using Enzyme Immun Assay (EIA) to determine the sexual cycles. The stage of the sexual cycle was determined by the morphological appearance of the ovarian follicles and the blood serum hormone levels. The animals were classified into two groups as follicular (n = ) and luteal (n = 3) phases as reported by Saruhan et al. 22. For the immunohistochemical determination of ERα and PR-B, samples of ovaries were fixed in % neutral formaldehyde solution for 24 h at room temperature, washed in water, dehydrated, cleared, and embedded in Paraplast. Two slides were prepared from each sample and each slide contained a minimum of three serial sections cut at 5 µm thickness at least µm apart. One slide was immunostained for ERα and the following adjacent slide was immunostained PR-B, employing primary antibodies. Immunohistochemical Procedure Immunostaining was performed at room temperature according to the protocol reported by Thermo Scientific Lab Vision (Fremont, CA). Tissue sections (5 µm) were mounted on a coated glass slide (Superfrost plus, Menzel- Glaser, Germany). Briefly, sections were deparaffinized in xylene and rehydrated through a graded series of ethanols. Sections were heated for 2 min at 95 C in. M antigen retrieval citrate solution, (.2 M NaH 2 PO 4 2H 2 O;. M citric acid) ph 6.. After cooling at room temperature for 2 min, the sections were washed in phosphate buffered saline (PBS; ph 7.4) four times 23. To block endogenous peroxidase activity or nonspecific staining, the sections were treated with 3% (v/v) H 2 O 2 in methanol for 5 min. Slides were washed in PBS and incubated in a blocking reagent (Ultra V Block; Thermo Fisher Scientific, Waltham, MA) for min at room temperature to prevent nonspecific binding. The sections then were incubated with a rabbit polyclonal anti-erα antibody (Thermo Fisher Scientific; cat. no. RB-52-P) and a mouse monoclonal anti-pr-b (Thermo Fisher Scientific; cat. no. MS-92-P) for 3 min at :2 dilution. Sections then were washed in PBS, incubated with biotinylated anti-mouse antiserum (primary antibody recog nized PR-B) or biotinylated antirabbit antiserum (primary antibody recognized ERα) (Thermo Fisher Sci entific) for 2 min at room temperature and washed in PBS. Sections were incubated with streptavidin per oxidase for 2 min at room temperature and washed with PBS. The peroxidase activity was visualized with 3,3-diaminobenzidine (DAB) or 3-Amino- 9-ethylcarbazole (AEC) (Thermo Fisher Scientific) for ERα and PR-B, respectively. Sections were counterstained with Gill s hema toxylin and mounted in Entellan or aqueous mounting under a coverslip. The intensity of staining was evaluated three times indepently by an experienced microscopist. The intensity of positive staining was described as being + weak, ++

112 797 AKBALIK, SAĞSÖZ GÜNEY SARUHAN moderate, +++ strong, +/++ weak to moderate, ++/+++ moderate to strong. The stained slides were examined under microscope and photographed using a digital camera attached to the microscope (Nikon Eclipse e-4, Coolpix-45, Tokyo/ Japan). RESULTS The intensity of the reaction for ERα and PR-B were indicated by the intensity of the brown-positive and redpositive staining in the cell nuclei, respectively. Cytoplasmic staining was considered to be non-specific and no staining was determined in the negative controls (Fig. ). Localization of ERα in the Bovine Ovary No significant differences were found for intensity staining during the follicular and luteal phases. Nuclear ERα immunoreactivity was observed in granulosa cells of the primary, secondary, tertiary and preovulatory follicles during follicular and luteal phases (Fig. 2A-C). ERα immunostaining was determined in germinal epithelium and ovarian stroma cells (not all cells); endothelial and smooth muscle cells of the blood vessels (Fig. 2D-E). Furthermore corpora lutea cells had a moderate to strong intensity staining during the follicular and luteal phases. The immunopresence for ERα was obvious in cells of the corpora albicantia during the luteal phase (Fig. 2F) (Table ). ERα immunoreaction of some theca cells of secondary follicles were observed and theca interna cells had a lower staining intensity than theca externa cells of tertiary follicles during the follicular and luteal phases (Fig. 2A-C) (Table ). Localization of PR-B in the Bovine Ovary Positive staining of germinal epithelial cells had a significantly lower intensity in follicular phase than Fig. Negative control in which non-immune serum was used instead of primary antibody. Preovulatory follicle (PRF), theca folliculi (TF), granulosa cells (arrowheads), stroma (S), blood vessel (BV), Bar: 5 μm Şekil. Primer antikorun yerine non-immun serumun konduğu negatif kontrol. Preovulatuar folikül (PRF), teka foliküli (TF), granuloza hücreleri (ok başları), bağ doku (S), kan damarı (BV), Bar: 5 μm Fig 2A. Immunohistochemical localization of ERα in bovine ovary. Primary follicle (PF), granulosa cells (arrowheads), stroma (S), blood vessel (BV), Bar: 25 μm Şekil 2A. İnek ovaryumunda ERα nın immunohistokimyasal lokalizasyonu. Primer folikül (PF), granuloza hücreleri (ok başları), bağ doku (S), kan damarı (BV), Bar: 25 μm Table. Average staining intensity of ERα and PR-B in the ovary at different phase of the sexual cycle Tablo. Seksüel siklusun farklı fazlarındaki ovaryumda ERα ve PR-B nin ortalama boyanma yoğunluğu Sexual Cycle Follicular Phase Luteal Phase Primary Follicle Secondary Follicle Tertiary Follicle Preovulatory Follicle Granulosa cells/ Theca follicularis Granulosa cells/ Theca interna/ Theca externa Granulosa cells/ Theca interna/ Theca externa Germinal Epithelium Stroma Corpus Luteum Corpus Albicans ERα ++ (++/+++)/(+) (++/+++)/(+)/(+++) (++/+++)/(+)/(+++) ++/ /+++ ++/+++ PR-B No staining No staining No staining No staining + +/++ No staining No staining ERα ++ (++/+++)/(+) (++/+++)/(+)/(+++) (++/+++)/(+)/(+++) ++/ /+++ ++/+++ PR-B No staining No staining No staining No staining ++ +/ Staining intensity: + weak, ++ moderate, +++ strong, +/++ weak to moderate, ++/+++ moderate to strong

113 798 Localization of Estrogen Receptor... the luteal phase (Fig. 3A-B). PR-B immunostaining was determined ovarian stroma cells (not all cells) with similar intensity during the follicular and luteal phases (Fig. 3C). Besides a higher intensity staining was observed in corpora lutea cells during the luteal phase (Fig. 3D). No staining for PR-B was observed in cells of the corpora albicantia in follicular phase, but detected in luteal phase (Fig. 4A-B) (Table ). No staining was observed in the ovarian follicles, endothelial and smooth muscle cells of the blood vessels during the follicular and luteal phases (Fig. 3C- Fig. 5) ( Table ). DISCUSSION We demonstrated a nuclear immunoreactive expression of ERα in germinal epithelium with the follicular and luteal phases of the sexual cycle. This is in agree with previous studies for cat 24 and rat. It is supported the concept that epithelial in growth of the ovary was mediated by estrogen via ERα 25. We observed ERα immunoreactivity in granulosa cells of the primary, secondary, tertiary and preovulatory follicles during follicular and luteal phases. But the demonstration of ERα in granulosa cells is still not clear. Data obtained Fig 2B. Immunohistochemical localization of ERα in bovine ovary. Secondary follicle (SF), theca follicularis (arrowheads), granulosa cells (arrows), Bar: 25 μm Şekil 2B. İnek ovaryumunda ERα nın immunohistokimyasal lokalizasyonu. Sekonder folikül (SF), teka folikülaris (ok başları), granuloza hücreleri (oklar), Bar: 25 μm Fig 2D. Immunohistochemical localization of ERα in bovine ovary. Germinal epithelium (GE), stroma (S), germinal epithelium cells (arrowheads), stroma cells (arrows), Bar: 5 μm Şekil 2D. İnek ovaryumunda ERα nın immunohistokimyasal lokalizasyonu. Germinal epitel (GE), bağ doku (S), germinal epitel hücreleri (ok başları), bağ doku hücreleri (oklar), Bar: 5 μm Fig 2C. Immunohistochemical localization of ERα in bovine ovary. Preovulatory follicle (PRF), theca externa (TE), theca interna (TI), theca interna cells (arrowheads), theca externa cells (thin arrows), granulosa cells (thick arrows), Bar: 25 μm Şekil 2C. İnek ovaryumunda ERα nın immunohistokimyasal lokalizasyonu. Preovulatuar folikül (PRF), teka eksterna (TE), teka interna (TI), teka interna hücreleri (ok başları), teka eksterna hücreleri (ince oklar), granuloza hücreleri (kalın oklar), Bar: 25 μm Fig 2E. The endothelial (arrowheads) and smooth muscle cells (arrows) of the blood vessels showed positive ERα staining. Blood vessels (BV), lumen (L), Bar: 25 μm Şekil 2E. Kan damarlarının endotel (ok başları) ve düz kas hücrelerininde (oklar) ERα boyanması pozitif. Kan damarları (BV), lumen (L), Bar: 25 μm

114 799 AKBALIK, SAĞSÖZ GÜNEY SARUHAN Fig 2F. Nuclei of internal stroma cells (arrowheads) and capsular stroma cells (arrows) of a corpus albicans is stained. Capsular stroma (CS), internal stroma (IS), Bar: 25 μm Şekil 2F. Korpus albikans ın internal bağ doku hücreleri (ok başları) ve kapsular bağ doku hücreleri (oklar) boyalı. Kapsular bağ doku (CS), internal bağ doku (IS), Bar: 25 μm Fig 3B. Immunohistochemical localization of PR-B in bovine ovary during luteal phase. Germinal epithelium (GE), germinal epithelium cells (arrowheads), Bar: 5 μm Şekil 3B. İnek ovaryumunda PR-B nin luteal fazdaki immunohistokimyasal lokalizasyonu. Germinal epitel (GE), germinal epitel hücreleri (ok başları), Bar: 5 μm Fig 3A. Immunohistochemical localization of PR-B in bovine ovary during follicular phase. Germinal epithelium (GE), germinal epithelium cells (arrowheads), Bar: 5 μm Şekil 3A. İnek ovaryumunda PR-B nin foliküler fazdaki immunohistokimyasal lokalizasyonu. Germinal epitel (GE), germinal epitel hücreleri (ok başları), Bar: 5 μm from several immunohistochemistry laboratories have shown that the expression of ERα is localized only in the granulosa cells of tertiary follicles such as cattle 26,27, ice 28, baboons 29, rabbits 9. However, in agreement with our reports, in different animal studies such as cattle 6, bitch 3 and mice 3 demonstrated that ERα observed granulosa cells, different staining intensities, in growing follicles from primary to tertiary ones. Furthermore in human 32 and monkey 7, ERα were also expressed in granulosa cells of preovulatory follicles. In contrast Jefferson et al. 33, Sar and Welsch did not observe ERα immunoreactivity in mouse and rat granulosa cells, respectively. This shows that the amount of this proteinin Fig 3C. Immunohistochemical localization of PR-B in bovine ovary. Stroma (S), stroma cells (arrowheads), Bar: 25 μm Şekil 3C. İnek ovaryumunda PR-B nin immunohistokimyasal lokalizasyonu. Bağ doku (S), bağ doku hücreleri (ok başları), Bar: 25 μm ovary might be too different to detect using immunohistochemistry. In present study, contrary to previous studies including intensity staining for cattle 5,26,27 and rats, the expression of ERα was low in some theca cells of secondary follicles, strong in theca externa cells of tertiary follicles and in agreement with report concerning cattle 27, the expression of ERα was low in theca interna cells of tertiary follicles. On the other hand we found that the expression of ERα was localized in stroma cells. This finding agrees with the report for cattle 26. These indicates that high expression of ERα in theca and stroma cells in comparison with that in follicle cells suggests an indirect effect of estrogen on

115 8 Localization of Estrogen Receptor... Fig 3D. Immunohistochemical localization of PR-B in bovine ovary during luteal phase. Nuclei of corpora lutea cells (arrow-heads) of a corpus luteum is stained, Bar: 25 μm Şekil 3D. İnek ovaryumunda PR-B nin luteal fazdaki immunohistokimyasal lokalizasyonu. Korpus luteum hücrelerinin çekirdekleri (ok başları) boyalı, Bar: 25 μm Fig 4B. Immunohistochemical localization of PR-B in bovine ovary during luteal phase. Nuclei of internal stroma cells (arrowheads) and capsular stroma cells (arrows) of a corpus albicans is stained. Capsular stroma (CS), internal stroma (IS), Bar: 5 μm Şekil 4B. İnek ovaryumunda PR-B nin luteal fazdaki immuno-histokimyasal lokalizasyonu. Korpus albikans ın internal bağ doku hücreleri (ok başları) ve kapsular bağ doku hücreleri (oklar) boyalı. Kapsular bağ doku (CS), internal bağ doku (IS), Bar: 5 μm Fig 4A. In the corpus albicans (CA) no positive staining for PR-B during the follicular phase, Bar: 5 μm Şekil 4A. Foliküler fazda korpus albikans ın (CA) PR-B boyanması negatif, Bar: 5 μm the follicular development 27. Our results revealed that the endothelial cells and smooth muscle cells of blood vessels in the bovine ovary reacted positively for ERα during follicular and luteal phases of the sexual cycle. This finding may be interpreted as indicating that ERα is involved in the proliferation of the endothelial and smooth muscle cells of blood vessels 34. D Haeseleer et al. 26 reported that immunoreactivity of ERα was observed in low amounts in corpora albicantia and stronger in the capsular stroma than in the internal Fig 5. In the ovarian follicles no positive immunostaining for PR-B. Preovulatory follicle (PRF), theca externa (TE), theca interna (TI), blood vessel (BV), granulosa cells (arrowheads), Bar: 5 μm Şekil 5. Ovaryum folikülleri nin PR-B immun boyanması negatif. Preovulatuar folikül (PRF), teka eksterna (TE), teka interna (TI), kan damarı (BV), granuloza hücreleri (ok başları), Bar: 5 μm stroma. Author noted that the high scores for ERα in the superficial stroma cells which are in direct contact with the follicles and in the deep stroma cells which surround the corpora albicantia are suggestive of possible stromaepithelial interactions 35. Research conducted on various animal species has demonstrated that the number and staining intensity of ERα positive cells in the ovary vary with the animal species and different phases of the sexual cycle. But in most studies 26,27,3 corpora lutea cells has high ERα immuno-

116 8 AKBALIK, SAĞSÖZ GÜNEY SARUHAN staining as well as present study. This shows us the presence of ERα in corpus luteum is suggestive of their involvement in the process of maintenance and luteinization of the corpus luteum 36. In the current study PR-B immunoreactivity was detected in the cells of germinal epithelium with a low intensity. This finding agrees with the report for human 37 and porcine 38. It has been suggested that ovarian surface epithelial cells are enzymatically involved in the ovulation under the influence of progesterone and its receptors 39. In contrast Gava et al. 4 did not observe PR-B immunoreactivity in mouse epithelial cells. This finding that might be of interest is the localization of PR-B in the germinal epithelium among different species. We demonstrated that the expression of PR-B was detected in the stroma cells both follicular and luteal phases of the sexual cycle. This data indicate that the possibility of such a paracrine action of ovarian steroids on follicles mediated through stroma steroid receptors has been suggested by Revelli et al. 4. Expression of progesterone receptor in granulosa and theca cells are highly variable. In primates, follicles that developed beyond the primary stage no longer expressed progesterone receptors until after the surge of LH, when the luteinizing preovulatory follicles again stained positive for progesterone receptors 7. Similarly PR protein being observed granulosa cells in cattle 7, humans 4 and mice 42. However staining for PR-B protein was limited to granulosa layer of large antral follicles, where cells showed considerably weak intensity of immunohistochemical reaction 38. In contrast, in agreement with our reports, Juengel et al. 43 and Suzuki et al. 32 did not observe PR-B immunoreactivity in ovine and human granulosa cells, respectively. It has been reported that expression of PR has been observed in the theca cells of pre-antral and antral follicles 7,32. On the contrary, similar to our reports, theca layer of pig follicles of both sizes was devoid of the immunoreactivity for PR-B 38. Furthermore ovulation is unaffected in PRBKO (ablation of PR-B protein) mice indicating that PR-A expression is both necessary and sufficient to mediate the ovulatory response to progesterone 44. In addition within the porcine ovary predominantly PR-A was observed both in follicular and luteal cells 38. Taken together, the results of our study postulated that in bovine ovary the other PR isoform may be the regulatory of follicle development rather than PR-B. Progesterone acting through its receptors regulates development and functions of the corpus luteum 45. In our study we observed strong staining for PR-B in corpora lutea cells during the luteal phase. This finding agrees with the report for porcine 38. This finding might be explained by locally produced progesterone. In conclusion, we have demonstrated that ERα and PR-B in the bovine ovary between the follicular and luteal phases of the sexual cycle have not a significant differences, whereas it has differences in cell-spesific localization. ERα proteins have been immunostained in granulosa cells. This suggest that ERα may play an important role in granulosa cells proliferation and differentiation. In addition to this, PR-B is not localized both in granulosa and theca cells of the bovine ovary and we postulate that PR-A isoform may be of critical importance to provide suitable responses to progesterone. Therefore, alternative studies are needed and it should be investigated at the molecular study. REFERENCES. Schams D, Berisha B: Steroids as local regulators of ovarian activity in domestic animals. Domest Anim Endocrin, 23, 53-65, Srisuwatanasagul S, Tummaruk P, Kunavongkrit A: Studies of oestrogen and progesterone receptors in reproductive organs of prepubertal gilts with reproductive disturbance. Thai J Vet Med, 4 (): 5-24, Zelinski MB, Noel P, Weber DW, Stormshak F: Characterization of cytoplasmic progesterone receptors in the bovine endometrium during proestrus and diestrus. J Anim Sci, 55 (2): , Rosenfeld CS, Yuan X, Manikkam M, Calder MD, Garverick HA, Lubahn DB: Cloning, sequencing, and localization of bovine estrogen receptor-β within the ovarian follicle. Biol Reprod, 6, , Amrozi, Kamimura S, Ando T, Hamana K: Distribution of estrogen receptor α in the dominant follicles and corpus luteum at the three stages of estrous cycle in japanese black cows. J Vet Med Sci, 66, 83-88, Salvetti NR, Acosta JC, Gimeno EJ, Muller LA, Mazzini RA, Taboada AF, Ortega HH: Estrogen receptors α and β and progesterone receptors in normal bovine ovarian follicles and cystic ovarian disease. Vet Pathol, 44, , Hild-Petito S, Stouffer RL, Brenner RM: Immunocytochemical localization of estradiol and progesterone receptors in the monkey ovary throughout the menstrual cycle. Endocrinology, 23, , Chiang CH, Cheng KW, Igarashi S, Nathwani PS, Leung PC: Hormonal regulation of estrogen receptor alpha and beta gene expression in human granulosa-luteal cells in vitro. J Clin Endocrinol Metab, 85, , Taylor AH, Al-Azzawi F: Immunolocalisation of oestrogen receptor in human tissues. J Mol Endocrinol, 24, 45-55, 2.. Sar M, Welsch F: Differential expression of estrogen receptor-β and estrogen receptor-α in the rat. Endocrinology, 4, , Jansen HT, West C, Lehman MN, Padmanabhan V: Ovarian estrogen receptor-β (ERβ) regulation: I. Changes in ERβ messenger RNA expression prior to ovulation in the ewe. Biol Reprod, 65, , Tomanek M, Pisselet C, Monget P, Madigou T, Thieulant ML, Monniaux D: Estrogen receptor protein and mrna expression in the ovary of sheep. Mol Reprod Dev, 48, 53-62, Slomczynska M, Wozniak J: Differential distribution of estrogen receptor-beta and estrogen receptor-alpha in the porcine ovary. Exp Clin Endocr Diab, 9, , D Haeseleer M, Simoens P, Van den Broeck W: Cell-specific localization of progesterone receptors in the bovine ovary at different stages of the oestrous cycle. Anim Reprod Sci, 98, 27-28, Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O Malley BW, McDonnell DP: Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol, 7, , Iwai T, Nanbu Y, Iwai M, Taii S, Fujii S, Mori T: Immunohistochemical localization of oestrogen receptors and progesterone receptors in the

117 82 Localization of Estrogen Receptor... human ovary throughout the menstrual cycle. Virchows Arch, 47, , Van den Broeck W, D Haeseleer M, Corijn M, Simoens P: Cellspecific distribution of progesterone receptors in the bovine ovary. Reprod Domest Anim, 37, 64-7, Slomczynska M, Krok M, Pierscinski A: Localization of the progesterone receptor in the porcine ovary. Acta Histochem, 2, 83-9, Iwai T, Fujii S, Nanbu Y, Nonogaki H, Konishi I, Mori T, Okamura H: Effect of human chorionic gonadotropin on the expression of progesterone receptors and estrogen receptors in rabbit ovarian granulosa cells and the uterus. Endocrinology, 29, , Vermeirsch H, Simoens P, Corijn M, Van den BroeckW: Immunolocalization of progesterone receptors in the canine ovary and their relation to sex steroid hormone concentrations. Reproduction, 22, 73-83, Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery Jr CA, Shyamala G, Conneely OM, O Malley BW: Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Gene Dev, 9, , Saruhan BG, Sağsöz H, Ketani MA, Akbalık ME, Özyurtlu N: Immunohistochemical detection of estrogen and progesterone receptors in the bovine uterus and their relation to serum sex steroid hormone levels during the follicular and luteal phase. Kafkas Univ Vet Fak Derg, 5 (3): , Bancroft JD, Cook HC: Manual of Histological Techniques. pp. 26. New York: Churchill Livingstone, Darawiroj D, Srisuwatanasagul K, Pianchop S, Sukjumlong S: Immunohistochemical studies of the estrogen receptor alpha in the ovaries and uteri of the domestic cat at different stages of the oestrous cycle. Thai J Vet Med, 33 (4): 89-95, De Cock H, Ducatelle R, Logghe JP: Immunohistochemical localization of estrogen receptor in the normal canine female genital tract. Domest Anim Endocrinol, 4 (3): 33-47, D Haeseleer M, Cornillie P, Simoens P, Van Den Broeck W: Localization of oestrogen receptors within various bovine ovarian cell types at different stages of the oestrous cycle. Anat Histol Embryol, 35, , Van Den Broeck W, Coryn M, Simoens P, Lauwers H: Cell-specific distribution of oestrogen receptor-alpha in the bovine ovary. Reprod Dom Anim, 37, , Orimo A, Inoue S, Ikeda K, Noji S, Muramatsu M: Molecular cloning, structure, and expression of mouse estrogen- receptor finger protein Efp. J Biochem, 27, , Billiar RB, Loukides JA, Miller MM: Evidence for the presence of the estrogen receptor in the ovary of the baboon (Papio anubis). J Clin Endocrinol Metab, 75, 59-65, Dolezel R, Kyliankova R, Kummer V, Maskova J, Stara P, Vitasek R: Follicular population and oestrogen receptor alpha in ovary of the bitch. Acta Vet Brno, 73, 37-43, Hulas-Stasiak M, Gawron A: Immunohistochemical localization of estrogen receptors ERα and ERβ in the spiny mouse (Acomys cahirinus) ovary during postnatal development. J Mol Hist, 38, 25-32, Suzuki T, Sasano H, Kimura N, Tamura M, Fukaya: Immunohistochemical distribution of progesterone, androgen and oestrogen receptors in the human ovary during the menstrual cycle: Relationship to expression of steroidogenic enzymes. Hum Reprod, 9, , Jefferson WN, Couse JF, Banks EP, Korach KS, Newblod RR: Expression of estrogen receptor ß is developmentally regulated in reproductive tissues of male and female mice. Biol Reprod, 62, 3-37, Rider V, Carlone DL, Foster RT: Oestrogen and progesterone control basic fibroblast growth factor mrna in the rat uterus. J Endocrinol, 54, 75-84, Cunha GR, Cooke PS, Kurita T: Role of stromal-epithelial interactions in hormonal responses. Arch Histol Cytol, 67, , Rosenfeld CS, Wagner JS, Roberts RM, Lubahn DB: Intraovarian actions of oestrogen. Reproduction, 22, , Akahira J, Suzuki T, Ito K, Kaneko C, Darnel AD, Moriya T, Okamura K, Yaegashi N, Sasano H: Differential expression of progesterone receptor ısoforms A and B in the normal ovary, and in benign, borderline, and malignant ovarian tumors. Jpn J Cancer Res, 93, 87-85, Durlej M, Tabarowski Z, Slomczynska M: Immunohistochemical study on differential distribution of progesterone receptor A and progesterone receptor B within the porcine ovary. Anim Reprod Sci, 2, 67-73, Murdoch WJ: Perturbation of sheep ovarian surface epithelial cells by ovulation: Evidence for roles of progesterone and poly(adp-ribose) polymerase in the restoration of DNA integrity. J Endocrinol, 57, 53-58, Gava N, Clarke CL, Byth K, Arnett-Mansfield RL, DeFazio A: Expression of progesterone receptors A and B in the mouse ovary during the estrous cycle. Endocrinology, 45 (7): , Revelli A, Pacchioni D, Cassoni P, Bussolati G, Massobrio M: In situ hybridization study of messenger RNA for estrogen receptor and immunohistochemical detection of estrogen and progesterone receptor in the human ovary. Gynecol Endocrinol,, 77-86, Teilmann SC, Clement CA, Thorup J, Byskov AG, Christensen ST: Expression and localization of the progesterone receptor in mouse and human reproductive organs. J Endocrinol, 9, , Juengel JL, Heath DA, Quirke LD, McNatty KP: Oestrogen receptor α and β, androgen receptor and progesterone receptor mrna and protein localisation within the developing ovary and in small growing follicles of sheep. Reproduction, 3, 8-92, Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM: Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. PNAS,, , Sasano H, Suzuki T: Localization of steroidogenesis and steroid receptors in human corpus luteum. Semin Reprod Endocrinol, 5, , 997.

118 Kafkas Univ Vet Fak Derg 7 (5): 83-88, 2 DOI:.9775/kvfd RESEARCH ARTICLE Serological and Epidemiological Investigation of Bluetongue, Maedi-Visna and Caprine Arthritis-Encephalitis Viruses in Small Ruminant in Kirikkale District in Turkey [] Ahmet Kursat AZKUR * Serkal GAZYAGCI ** Muhammet Eren ASLAN * [] This research was supported by University of Kirikkale BAP grant number 29- and 29- * Department of Microbiology, Faculty of Veterinary Medicine, University of Kirikkale, TR-745 Kirikkale - TURKEY ** Department of Internal Medicine, Faculty of Veterinary Medicine, University of Kirikkale, TR-745 Kirikkale - TURKEY Makale Kodu (Article Code): KVFD Summary Viral infections cause important problems and significant economic loses in sheep and goats that can be protected by an investigation of infections. This study aimed to determine the sheep and goat viral infections including bluetongue virus (BTV), maedivisna virus (MVV) and caprine arthritis-encephalitis virus (CAEV) in Kirikkale city located in Central Anatolia region of Turkey. Blood samples collected from 279 sheep and 46 goats were tested by ELISA, RT-nested PCR and nested PCR. It was detected that antibody response to BTV (49.8%), CAEV (7.5%) and MVV (9.4%) were seropositivity values in all serum samples. BTV (2.87%) and MVV (9.25%) antigens were detected in seropositive whole blood samples via RT-nested PCR and nested PCR but not CAEV. It was found that double positive animals (4.6%) for MVV and BTV in sheep but not goat. As a conclusion sheep and goat were infected with naturally BTV, CAEV and MVV in Kirikkale region. This study showed that this the first report for BTV, MVV and CAEV infections from Kirikkale region. Therefore infections are needed to be further investigations to determine detailed survey studies. Keywords: Sheep, Goat, Bluetongue virus, Caprine arthritis-encephalitis virus, Maedi-visna virus Kırıkkale Yöresinde Bulunan Küçük Ruminantlarda Mavidil, Maedi-Visna ve Caprine Arthritis-Encephalitis Enfeksiyonlarının Serolojik ve Epidemiyolojik Araştırılması Özet Viral enfeksiyonlar, koyun ve keçilerde yapılan araştırmalar ile önlenebilen önemli sorunlara ve ekonomik kayıplara neden olur. Bu çalışmada mavidil virüsü (BTV), maedi-visna virüs (MVV), caprine arthritis-encephalitis virüs (CAEV) lerini içeren viral enfeksiyonların, İç Anadolu bölgesinde yer alan Kırıkkale ilinde bulunan koyun ve keçilerde belirlenmesi amaçlanmıştır. Kan örnekleri 279 koyun ve 46 keçiden toplandı ve ELISA, RT-nested PZR ve nested PZR ile test edildi. Serum örneklerinde antikor cevabı BTV (%49.8), CAEV (%7.5) ve MVV (%9.4) seropozitiflik oranı ile tespit edildi. Seropozitif tam kan örneklerinde RT-nested PZR ve nested PZR ile, BTV ve MVV antijenleri sırasıyla (%2.87) (%9.25) oranlarında belirlendi fakat CAEV belirlenemedi. Koyunlarda hem MV hem de BT ye karşı seropozitif hayvanların oranı %4.6 oranında saptandı. Sonuç olarak Kırıkkale yöresinde koyun ve keçilerde BTV, CAEV ve MVV enfeksiyonlarının doğal varlığının ortaya konulduğu bu çalışma, bu yörede sözü geçen enfeksiyonlarla ilgili yapılan ilk çalışmadır. Bu nedenle enfeksiyonların belirlenmesi için daha detaylı sürvey araştırmalarına ihtiyaç vardır. Anahtar sözcükler: Koyun, Keçi, Mavidil virüsü, Caprine arthritis-encephalitis virüs, Maedi-visna virüs INTRODUCTION Bluetongue (BT) is an arthropod-transmitted disease and bluetongue virus (BTV), the etiological agent of bluetongue disease of wild and domestic ruminants which results in significant economics loses. Etiological agent is a non-enveloped double-stranded RNA virus belonging to genus orbivirus of the family Reoviridae. Twenty-four İletişim (Correspondence) /358 &

119 84 Serological and Epidemiological... serotypes of BTV have been recognized world wide. The disease can cause up to % morbidity and with -5% case fatality rates in sheep 2. The vast majority of BT infections are clinically unapparent. The virus is known to be distributed around the world in countries located in the tropics and subtropics, where Culicoides species are present. Only around 5 of the.5 known Culicoides species have been shown to be capable of developing a fully disseminated transmissible BTV infection 3. BTV was first described in the Cape Colony of southern Africa after merino sheep were introduced into the region in the late 8 th century, and was subsequently recognized in other parts of Africa, Europe, the Middle East and Indian subcontinent, the Americas, and Asia 4. Bluetongue disease has been almost found all region of Turkey since the first outbreak seen in Turkey was in Syria border Survey studies are the important to epidemiology of BTV because it was hypothesized that Turkey could a possible the BT gateway through European countries 3,8. The distribution of Culicoides biting midges is known to be influenced by weather and climate conditions such as temperature, humidity, and rainfall 9. To date there is no evidence that any outbreak of BTV or any study BTV infection and scientific data about kind of Culicoides spp in the Kirikkale city where located near the Kizilirmak river that is the longest river in Turkey. Diagnosis of BTV disease is used many techniques such as virus isolation detection of viral RNA with PCR or RNA hybridization, antigen detection IFAT, ELISA, antibody detection ELISA,. Although there is a vaccine for preventing BTV infections, an animal vaccinated and protected from infection with one serotype of BTV is not protected from subsequent infections with other viral serotypes 2. Small ruminant lentiviruses (SRLV) cause two different diseases that are called maedi-visna virus (MVV) in sheep and in goat s caprine arthritis-encephalitis virus (CAEV) are considered genetically as a single pathogen causing a multisystemic inflammatory disease 3,4. MVV and CAEV are a single-stranded RNA virus of the genus lentivirus in the family Retroviridae 5. SRLVs include cause persistent infections in target organs for instance the mammary gland, the carpal joints, the central nervous system and the lungs 6. While MVV recognized in the Iceland in 933, CAEV first recognized in the United Sates in Infection is distributed almost worldwide and is responsible for economic losses related to the drop of milk production, lameness and interstitial pneumonia 8,9. In Turkey, the presence of a MVV infection was first revealed among sheep based on pathological observation conducted in 975. Following first observation numerous studies have demonstrated that infection is widespread in Turkey In Turkey, even though CAEV was firstly reported in 994 there have been documented a few case and seroepidemiological studies about CAEV To date, there is no evidence that any outbreak of MVV or any CAEV infection and scientific data in the Kirikkale, Central Anatolia Turkey. MATERIAL and METHODS Study Area and Sample Collection The present study was conducted on two hundred and seventy nine sheep and a hundred forty six goats during the period from April to December 2 at the Kirikkale, Turkey. Samples were collected from all sheep and goat within herds under investigation at the same time of clinical examination. However animals used in this study did not show any apparent clinical signs of BTV, MVV and/ or CAEV. Sera and whole blood samples were collected from sheep and goat in Kirikkale province. While whole blood samples were collected in EDTA coated tubes (Vacutest, K3 EDTA; Arzergrande, Italy), blood samples were collected into tubes (Vacutest, Arzergrande, Italy). Blood samples allowed to clot at room temperature and centrifuged at.2 rpm for min on the same day and sera were collected and kept at -2 C until ELISA work. Enzyme Linked Immunosorbent Assay (ELISA) A commercial ELISA kit (Pourquier ELISA Maedi-Visna/ CAEV serum Screening, France) was used for the detection of MVV antibody response according to the manufacturer s instructions. A commercial ELISA kit [Pourquier Bluetongue Competitive ELISA version: P45/6 (Institude Pourquier, France)] was used for the detection of BTV antibody response according to the manufacturer s instructions. Samples were analyzed and calculated with an automated ELISA reader at 45 nm (SIRIO S Elisa Reader, Indonesia). PCR Technique To detect MVV or CAEV antigen, firstly DNA was extracted from blood using a spin column system (DNAsy Blood and Tissue Kit, Qiagen, Germany) according to the manufacturer s instructions. To detect CAEV antigen, the first round PCR was run in reaction mixture contained 5 μl cdna, 25 mm Tris-HCl ph 8.9, 5 mm KC, 3 mm MgCl 2, 2 mm of dntp mix, pmol of each external primer 5 -CAAGCAGCAGGAGGGAGAAGCTG-3 and 5 -TCCTACCC CCATAATTTGATCCAC-3 and 3 U Taq DNA polymerase (MBI Fermentas) the expected PCR product size 296 bp. Ten microliters nested PCR reactions were performed in a reaction mixture with the same reagent composition using the internal primers 5 -GTTCCAGCA ACTGCAAACA GTAGCAATG-3 and 5 -ACCTTTCTGCTTCTTCATTTAATTT CCC-3 the expected PCR product size 96 bp 5. To detect MVV antigen, the first round PCR was run in reaction mixture contained 5 μl cdna, 25 mm Tris-HCl ph 8.9, 5 mm KCl, 2 mm of dntp mix, pmol of each external primer 5 -CAACARGGIGGIATMATAGAYTCIGG-3 and 5 -AR TGIGTRTARTCIACYTGCCA-3 and 3 U Taq DNA polymerase (MBI Fermentas) the expected PCR product size 42 bp. Ten microliters nested PCR reactions were performed in a reaction mixture with the same reagent

120 85 AZKUR GAZYAGCI, ASLAN composition using the internal primers 5 -GGG ATMATA GAYTCGGGRTATCARGG-3 and 5 -TGGGTRTARTCGACYTGC CARTG-3 the expected PCR product size 44 bp 28. MVV positive control was provided kindly by Dr. Dilek Muz that is worked in the Department of Virology Faculty of Veterinary Medicine University of Mustafa Kemal, Turkey. Reaction conditions for nested PCR were as follows; 95ºC for 2 min, followed by 32 cycles of 95ºC for min, 6ºC for min, 72ºC for min and finally a cycle of 72ºC for 5 min. To detect BTV antigen, firstly RNA was extracted from blood using a spin column system (QIAamp Viral RNA mini kit, Qiagen, Germany) according to the manufacturer s instructions. Random primer (.25 mm random primer; Promega, Madison, WI, USA) was used in the first step of cdna synthesis. For this purpose, μl viral RNA was combined with μl (.5 μg) random primer and preheated at 7 C for min to denature secondary structures. The mixture was cooled rapidly, and 2 μl ( mm) dntps, 5 μl 5X RT buffer, μl M-MLV RT (2 IU/μl Promega, USA), μl RNasin (MBI Fermentas) and 5 μl H 2 O were added reaching to the total volume of 25 μl. The RT mix was incubated at 37 C for 6 min and stopped by heating at 95 C for min. The yield of cdna was checked by PCR signal generated from the internal standard housekeeping gene, Ovies aries glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (GenBank accession number: DQ38689). The GAPDH forward primer was 5 - AGCTCGTCATCAATGGAAAGGC-3, and the GAPDH reverse primer was 5 -ATGGCGTGGACAGTGGTCATAA-3. The cdna stock was stored at -2 C until study. The first round PCR was run in reaction mixture contained 5 μl cdna, 25 mm Tris-HCl ph 8.9, 5 mm KC, 2 mm of dntp mix, pmol of each external primer 5 -GTTC TCTAGTTGGCAACCACC-3 and 5 -AAGCCAGACTGTTTCCC GAT-3 and 3 U Taq DNA polymerase (MBI Fermentas) the expected PCR product size 274 bp. μl nested PCR reactions were performed in a reaction mixture with the same reagent composition using the internal primers 5 -GCAGCATTTTGAGAGAGCGA-3 and 5 -CCCGA TCATACATTGCTTCCT-3 the expected PCR product size bp 29. Reaction conditions nested PCR reactions were as follows; 95ºC for 2 min, followed by 32 cycles of 95ºC for 4 s, 55ºC for min, 72ºC for 4 s and finally a cycle 5ºC 3 min and of 72ºC for 5 min. BTV vaccine strain was using as positive control provided kindly by Prof. Dr. Aykut Ozkul that is worked in the Department of Virology Faculty of Veterinary Medicine University of Ankara, Turkey. All nested-pcr reactions were carried out in BO-PCR-5 thermal cycler (Hamburg, Germany). The InGenius LHR (Syngene, Cambridge, UK) was used to see PCR amplicons by using ethidium bromide staining after.5% agarose gel electrophoresis. RESULTS It was collected samples from 425 sheep and goat in the Kirikkale city, Central Anatolia of Turkey. It was found that rate of antibody response to BTV were in sheep 39 out of 279 (49.8%) seropositivity value. It was found that rate of antibody response to CAEV were out of 46 (7.5%) seropositivity values in the goat. It was determined that rate of antibody response to MVV were 54 out of 279 (9.4%) seropositivity values in the sheep (Table ). Double seropositive animals 4 out of 279 (4.7%) for MVV and BTV were determined in sheep but not in goat. To determine BTV antigen, 39 whole blood samples (antibody positive for BTV) submitted for BTV diagnosis were tested by RT-nested PCR. Firstly, we checked whether RT- PCR assay was working or not. Therefore Ovies aries GAPDH gene was targeted as an internal control. All samples were shown GAPDH signal (Fig. A). After confirming RT reaction by using GAPDH primers, first round of nested- PCR was carried out by using external primers which could be amplificated at the NS of the BTV genome and are considered to amplify all BTV genome. PCR amplicon of NS of the BTV genome was not demonstrable in first round nested PCR including positive control for PCR (Fig. B). When second round of PCR was carried out internal primers for BTV, 4 out of 39 (2.9%) whole blood samples were detected as a positive (Table 2 and Fig. C). Detection of CAEV was carried out eleven samples that are seropositive for CAEV nested PCR. However PCR signal were not detected for CAEV in goat by using CAEV specific primers (Table 2). Detection of MVV was carried out fifty four samples that are MVV positive antibody response nested PCR. PCR amplicon for MVV was not demonstrable Table. Prevalence of BTV, MVV and CAEV in sheep and goat from Kirikkale city in Turkey by using ELISA Tablo. Kırıkkale de koyun ve keçilerde ELISA ile BTV, MVV ve CAEV prevalansı Number of Animals Used in This Study MVV-CAEV BTV Number of Goat 46 -* Number of Sheep Number of Seropositives Animals Number of Seropositives Goat - Number of Seropositives Sheep Number of Total Animals * Goat did not tested for BTV (Keçiler BTV için test edilmedi) Table 2. Number of RT- nested PCR or nested PCR positive samples from whole blood that were coincide with seropositive samples for BTV, CAEV, MVV Tablo 2. BTV, CAEV, MVV seropozitif tam kan örneklerinden, RT-PCR-nested PZR veya nested PZR pozitif örnek sayıları PCR Results CAEV MVV BTV Positive Goat - - -* Positive Sheep Number of Animals Used in for PCR * Goat did not tested for BTV (Keçiler BTV için test edilmedi)

121 86 Serological and Epidemiological... in first round nested PCR including positive control for PCR. When second round of PCR was carried out internal primers for MVV, 5 of 54 (9.3%) (Table 2) samples were shown expected PCR product size (Fig. D). Fig. RT-nested PCR with RNA extracted from clinical samples for BTV and nested-pcr with DNA extracted from clinical samples for MVV (whole blood). A. RT-PCR control, RT-PCR was carried out Ovies aries GAPDH primers. Whole blood samples lane (positive control for BTV), lane 2 (positive clinical sample), lane 3 (negative clinical sample) and lane 4 (dh 2 O), Lanes M: molecular length marker. B. First round RT-nested PCR for BTV was carried out BTV external primers. Whole blood samples lane (positive control for BTV), lane 2 (positive clinical sample), lane 3 (negative clinical sample) and lane 4 (dh 2 O), Lanes M: molecular length marker. C. Second round RT-nested PCR for BTV was carried out BTV internal primers. Whole blood samples lane (positive control for BTV), lane 2 (positive clinical sample), lane 3 (negative clinical sample) and lane 4 (dh 2 O), Lane M: molecular length marker. D. Second round nested PCR for MVV was carried out MVV internal primers. Sample lane (positive sample), lane 2 (negative clinical sample), lane 3 (dh 2 O) and lane 4 (positive control for MVV), Lane M: molecular length marker Şekil. Klinik örneklerden elde edilen RNA lar ile BTV için RT-nested PZR (tam kan) ve klinik örneklerden elde DNA ile MVV için nested-pzr. A. RT-PZR kontrol, RT-PCR Ovies aries GAPDH primer ile kuruldu. Tam kan örnekleri hat (BTV için pozitif kontrol), hat 2 (pozitif klinik örnekler), hat 3 (negatif klinik örnekler) ve hat 4 (dh 2 O), hat M: moleküler ağırlık markeri. B. BTV için ilk round nested RT-PZR, BTV dış primerleri ile kuruldu. Tam kan örnekleri hat (BTV için pozitif kontrol), hat 2 (pozitif klinik örnekler), hat 3 (negatif klinik örnekler) ve hat 4 (dh 2 O), hat M: moleküler ağırlık markeri. C. BTV için ikinci round nested RT-PZR, BTV iç primerleri ile kuruldu. Tam kan örnekleri hat (BTV için pozitif kontrol), hat 2 (pozitif klinik örnekler), hat 3 (negatif klinik örnekler) ve hat 4 (dh 2 O), hat M: moleküler ağırlık markeri. D. MVV için ikinci round nested PZR MVV iç primerleri ile kuruldu. Hat (pozitif klinik örnek), hat 2 (negatif klinik örnek), hat 3 (dh 2 O) ve hat 4 (MVV için pozitif kontrol), hat M: moleküler ağırlık markeri DISCUSSION Many disease problems can be solved by an investigation of animal populations rather than the individual. The measurement of the amount of infectious and non-infectious diseases in a population assists in determining their importance and efficacy of control campaign 3. This study was carried out to determine the BTV, MVV and CAEV infections in Kirikkale city of Turkey. Currently, most vaccines used are modified live vaccines, but a restricted number of inactivated vaccines are also available and new types of vaccines are being developed. The first epizootic of BT outside Africa was confirmed in sheep on Cyprus in 943 and a vaccine was successfully used to control outbreaks of BT on Cyprus in 946 and 947. At the same time, BT was reported in Israel, Turkey and probably Syria 3. Prior to 998, BTV only occurred sporadically in Europe and following 998 is known as the invasion of the Western and Eastern Mediterranean basin by Culicoides imicola, a tropical midge. In 28, one further step was reached in the invasion of the European continent 32. It was reported that 4.5% of sampled animals have BT virus specific antibodies in Eastern and South-eastern regions of Turkey 25. It was announced that BTV seroprevalence was 4.68% in sheep in Konya region of Turkey 33. Although BTV virus has different 24 serotypes, virus has already been determined on the worldwide with only type 4, 9, 6 recognized within Turkey 2. Another study showed that BTV seroprevalence was found 9.76% and the specific frequencies were 72.6%, 42.5% and 36.93% for serotypes 4, 9 and 6 in 352 cattle in north-eastern Anatolian cities 34. It was showed that the seroprevalance of bluetongue was determined as 3% (6/2) in sheep, % (22/2) in cattle 35. The present study was carried out in Kirikkale city that is situated in central the Anatolia region of Turkey in Asia. It lays 39º north of the equator and 33º meridians east of Greenwich. Kirikkale has a coastline with the majority lying along the Kizilirmak River. The northern part of the region is hilly and in many places at altitude ranges between 7 and 45 meter. Extreme recorded temperatures range from - C to 35 C at Kirikkale. Additionally there is no vaccination for BTV in this city in sheep or goat. In present study, 39 out of 279 (49.8%) sheep have shown BTV specific antibodies (Table ). Unfortunately goat samples did not incorporate in the study in order to limited fund. In this study was found that PCR positive for BTV samples was 4 out of 39 (2.9%) whole blood (Fig C and Table 2). It suggested that four sheep is viremic in the sampling time. It was suggested that vaccination of sheep or goat will help to take under control of BTV and Culicoides spp will be combated according this results. This is first report BTV infection for Kirikkale. BTV was found by South African, French, American, and Icelandic researchers. Extensive research into the pathology, etiology, and epidemiology of this slowly progressive and ultimately fatal disease was

122 87 AZKUR GAZYAGCI, ASLAN confirmed in several countries 3,36. BTV infection is need to further investigations to determine detailed seroepidemiological studies in goat and cattle and the circulated serotypes to found vaccine which should be contain serotype(s). CAEV and MVV are considered to be genetically distinct but antigenically related pathogens of goats and sheep. SRLV infections seen on farms develop after long incubation and a slow progression of disease to death but in nature they may also have short latency and cause acute leukoencephalitis and/or acute arthritis and pneumonia in young kids or lambs with exceptionally high mortality. SRLV is persistent infection a feature that share with immunodeficiency-causing lentiviruses such as MVV, CAEV 37. Animals can not be effectively vaccinated against SRLVs and MVV is prevalent in sheep populations worldwide. For this reason seropositive sheep or goat represent a marker of wild type infection. To date, MVV seroprevalence data obtained in Turkey have been found such as 23.9%, from 3.8% to 4.2%, and.2%. Recent study showed 5.3% prevalence observed in the Istanbul city Additionally studies with regard to MVV in Turkey that seropositivity was determined 26.7%, 23.9% and % respectively 2,38-4. It was announced that MVV seroprevalence during the study period ranged from 24% to 39% in Latxa sheep and from 77% to 8% in Assaf sheep 4. In the present study it was found that rate of antibody response to MVV were 54 out of 274 (9.4%) seropositivity values in the sheep (Table ). PCR finding for MVV showed 5 out of 54 (2.9%) animals were detected as a positive (Fig D and Table 2). CAEV infects mostly goats and has a global distribution in the world. Serological data was shown in Australia, USA and, UK prevalence rates of 82%, 73%, 4.3%, respectively 24. Perspective of in the neighbor of Turkey although there is no data with associated in the Iran, Iraq, Syria, Azerbaijan, Armenia, Bulgaria and Rumania, CAEV was just reported in Greece 42. To date it was suggested that there is no study in CAEV free countries of neighbor of Turkey. The serologic examination was carried out by AGID technique in 6 out of 88 (.9%) for CAEV in Turkey 26. Even though one reported that all of the sampled goats were negative for CAEV antibodies eastern and south-eastern Anatolia, another researchers was reported 7 out of 675 goats (.3%) sampled were positive for CAEV antibodies with celisa, but no seropositivity was detected with AGID in the same region 24,25. Researchers were carried out ELISA for detecting antibody against to CAEV both adult goat (n=75) and their kids (n=7). While adult goat did not show any clinical sign for CAEV and were serological positive for CAEV, their kids showing arthritis and encephalitis were confirmed serological positive for CAEV using ELISA in Nevsehir city that was very close to Kirikkale 23. In the present study it was found that rate of antibody response to CAEV were out of 46 (7.5%) in the goat (Table ). However serological finding did not supported by PCR. For diagnosing the infection, specific antibody detection methods as AGID, ELISA are most frequently used. Molecular biological techniques can be hampered by the low viral load in the blood and the pronounced heterogeneity of the viral genomes 43. In the present study it was suggested that virus could not be detected for low viral load and maybe real time PCR could be solve this problem. As a conclusion sheep and goat were infected with naturally BTV, CAEV and MVV in the Kirikkale region. Additionally some sheep were co infected with BTV and MVV. But there is no vaccination or prevent to these infection. This study showed that this is first report BTV, MVV and CAEV infection in the Kirikkale and these infections are still available in the Central Anatolia. Therefore infections are needed to be further investigations to determine detailed survey studies. REFERENCES. Matsuo E, Roy P: Bluetongue Virus VP6 Acts Early in the Replication Cycle and Can Form the Basis of Chimeric Virus Formation. J Virol, 83, , Ozkul A, Erturk A, Caliskan E, Sarac F, Ceylan C, Mertens P, Kabakli O, Dincer E, Cizmeci SG: Segment based molecular epidemiology of bluetongue virus (BTV) isolates from Turkey: Virus Res, 42, 34-39, Wilson AJ, Mellor PS: Bluetongue in Europe: Past, present and future. Philos Trans R Soc Lond B Biol Sci, 364, , Maclachlan NJ, Guthrie AJ: Re-emergence of bluetongue, African horse sickness, and other orbivirus diseases. Vet Res, 4, 35, Bolat Y: Elazig, Diyarbakir ve Sanliurfa illerinde koyunlarin mavidil hastaliginin yayilmasi üzerine serolojik arastirmalar. Selcuk Univ Vet Fak Derg,, 3-2, Burgu I, Urman HK, Akca Y, Yonguc A, Mellor PS, Hamblin DC: Serologic survey and vector surveillance for Bluetongue in Southern Turkey. In, Walton TE, Osburn BI (Eds): Bluetongue, African Horse Sickness and Related Orbiviruses. Osburn, Crs, Press Inc Fla, pp , Taylor WP, Mellor PS: Distribution of bluetongue virus in Turkey, Epidemiol Infect, 2, , Niedbalski W: Occurrence of bluetongue virus in the population of animals imported to Poland from eu member states. Bull Vet Inst Pulawy, 53, 9-2, Tsutsui T, Hayama Y, Yamakawa M, Shirafuji H, Yanase T: Flight behavior of adult Culicoides oxystoma and Culicoides maculatus under different temperatures in the laboratory. Parasitol Res, 8, , 2.. Bulut O, Yavru S, Yapkic O, Simsek A, Kale M, Avci O: Serological investigation of bluetongue virus infection by serum neutralization test and elisa in sheep and goats. Bull Vet Inst Pulawy, 5, 35-37, 26.. Calisher CH: Diagnostic prodedures for arboviruses. In, Walton TE, Osburn BI (Eds): Bluetongue, African Horse Sickness and Related Orbiviruses. pp , Osburn. Crs. Pres Inc Fla, Noad R, Roy P: Bluetongue vaccines. Review. Vaccine, 5, 86-9, Olech M, Croise B, Kuźmak J, Valas S: Evidence for interspecies transmission of small ruminant lentiviruses in sheep and goats in Poland. Bull Vet Inst Pulawy, 53, 65-68, Shah C, Huder JB, Boni J, Schonmann M, Muhlherr J, Lutz H, Schupbach J: Direct evidence for natural transmission of small-ruminant lentiviruses of subtype A4 from goats to sheep and vice versa. J Virol, 78, , Park JE, Son SY, Shin HJ: Sequence comparison on gag gene of caprine arthritis encephalitis virus from Korea. Virus Genes, 4, 99-, 2.

123 88 Serological and Epidemiological Milhau N, Renson P, Dreesen I, Greenland T, Bellaton C, Guiguen F, Mornex JF, Le Jan C: Viral expression and leukocyte adhesion after in vitro infection of goat mammary gland cells with caprine arthritisencephalitis virus. Vet Immunol Immunopathol, 3, 93-99, Horzinek MC, Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ: Retroviridae in Veterinary Virology. Academic Press, , Gogolewski RP, Adams DS, Mcguire TC, Banks KL, Cheevers WP: Antigenic cross-reactivity between caprine arthritis-encephalitis, visna and progressive pneumonia viruses involves all virion-associated proteins and glycoproteins. J Gen Virol, 66, , Grego E, Bertolotti L, Carrozza ML, Profiti M, Mazzei M, Tolari F, Rosati S: Genetic and antigenic characterization of the matrix protein of two genetically distinct ovine lentiviruses. Vet Microbiol, 6, 79-85, Preziuso S, Or ME, Giammarioli M, Kayar A, Feliziani F, Gonul R, Farneti S, Yaramis CP, Valente C, Cuteri V: Maedi-visna virus in Turkish sheep: A preliminary serological survey using ELISA tests. Turk J Vet Anim Sci, 34, , Tan MF, Alkan F: Seroepidemiological investigation of maedi-visna infeetion in Turkey and virus isolation attempts. Ankara Univ Vet Fak Derg, 49, 45-5, Yilmaz H, Gurel A, Turan N, Bilal T, Kuscu B, Dawson MM, Morgan KL: Abattoir study of maedi-visna virus infection in Turkey. Vet Rec, 5, , Acar A, Yavru S, Kale M, Bulut O, Avci O, Pehlivanoglu F: Caprine arthritis encephalitis virus infection in Kids with Arthritis. Indian Vet J, 85, , Aslantas O, Ozyoruk F, Pinar D, Gungor B: Serological survey for caprine arthritis-encephalitis virus in Damascus and Kilis goats in Hatay, Turkey. Rev Med Vet, 56, 42-44, Ataseven VS, Ataseven L, Tan T, Babur C, Oguzoglu TC: Seropositivity of agents causing abortion in local goat breeds in Eastern and South-eastern Anatolia, Turkey. Rev Med Vet, 57, , Burgu I, Akça Y, Alkan F, Ozkul A, Karaoglu T, Cabalar M: Antibody prevalence of caprine arthritis encephalitis virus in goats in Turkey. Dtsch tierarztl Wschr,, 38-42, Grego E, Bertolotti L, Quasso A, Profiti M, Lacerenza D, Muz D, Rosati S: Genetic characterization of small ruminant lentivirus in Italian mixed flocks: evidence for a novel genotype circulating in a local goat population. J Gen Virol, 88, , Eltahir YM, Dovas CI, Papanastassopoulou M, Koumbati M, Giadinis N, Verghese-Nikolakaki S, Koptopoulos G: Development of a semi-nested PCR using degenerate primer for thegeneric detection of small ruminant lentivirus proviral DNA. J Virol Methd, 35, , Katz JB, Alstad AD, Gustafson GA, Moser KM: Sensitive identification of bluetongue virus serogroup by a colorimetric dual oligonucleotide sorbent assay of amplified viral nucleic acid. J Clin Microbiol, 3, , Thrusfield M: The scope of epidemiology. In, Veterinary Epidemiology. Blackwell Publishing Company, Oxford, UK, 22-33, Vellema P: Bluetongue in sheep: Question marks on bluetongue virus serotype 8 in Europe. Small Rumin Res, 76, 4-48, Hendrickx G: The spread of bluetongue in Europe. Small Rumin Res, 86, 34-39, Duman R, Yavru S, Kale M: Virological and serological investigations of bluetongue virus (BTV) infection in sheep in Konya region. J Anim Vet Adv, 8, , Yildirim Y, Yilmaz V: Seroprevalence of bluetongue virus 4, 9 and 6 serotypes in cattle in various North-eastern provinces of Turkey. Rev Med Vet, 6, , Albayrak H, Ozkan E: Seroprevalence of some arboviral infections transported blood sucking insects in ruminants and equids in middle blacksea region in Turkey. Kafkas Univ Vet Fak Derg, 6, 33-36, Hofmann MA, Renzullo S, Mader M, Chaignat V, Worwa G, Thuer B: Genetic characterization of toggenburg orbivirus, a new bluetongue virus, from goats, Switzerland. Emerg Infect Dis, 4, , Leroux C, Mornex JF: Retroviral infections in sheep and the associated diseases. Small Rumin Res, 76, 68-76, Burgu I, Toker Y, Akca Y, Alkan F, Yazici Z, Ozkul A: Serological investigations on visna-maedi virus infections of sheep in Turkey. Ankara Univ Vet Fak Derg, 37, , Cimtay I, Keskin O, Sahin T: Investisgation on some lentivirus infections in sheep and goat in region of Sanliurfa. Uludag Univ J Fac Vet Med, 23, 33-38, Yildirim Y, Yilmaz V, Muz D, Oguzoglu TC: The investigation of presence of small ruminant Lentivirus in sheep belongs to public in Kars region. J Fac Vet Med Univ Erciyes, 8, 27-3, Leginagoikoa I, Minguijón E, Juste RA, Barandika J, Amorena B, De Andrés D, Badiola JJ, Luján L, Berriatua E: Effects of housing on the incidence of visna/maedi virus infection in sheep flocks. Res Vet Sci, 88, 45-42, Angelopoulou K, Brellou GD, Greenland T, Vlemmas I: A novel deletion in the LTR region of a Greek small ruminant lentivirus may be associated with low pathogenicity. Virus Res, 8, 78-84, Brinkhof JMA, Houwers DJ, Van Maanen C: Development of a sample pooling strategy for the serodiagnosis of small ruminant lentiviral infections using the ELITEST-MVV ELISA. Small Rumin Res, 7, , 27.

124 Kafkas Univ Vet Fak Derg 7 (5): 89-86, 2 DOI:.9775/kvfd RESEARCH ARTICLE Kars Yöresinde Atık Yapan İneklerin Çeşitli Örneklerinden Brucella Etkenlerinin Kültürel ve Moleküler Yöntemlerle Araştırılması ve Olguların Epidemiyolojik Analizi [] [] * Fatih BÜYÜK * Mitat ŞAHİN * Doktora tezinden özetlenen bu araştırma Kafkas Üniversitesi Bilimsel ve Teknolojik Araştırmalar Fonu tarafından 29-VF- nolu proje olarak desteklenmiştir Kafkas Üniversitesi, Veteriner Fakültesi, Mikrobiyoloji Anabilim Dalı, TR-36 Kars - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada, Kars yöresinde atık yapan ineklerden alınan çeşitli örneklerden Brucella etkenlerinin bakteriyolojik ve moleküler yöntemlerle araştırılması ve atık olgularının epidemiyolojik ve klinik özelliklerinin belirlenmesi amaçlandı. Bu amaçla brusellozise karşı aşılanmamış ve atık yapan 284 inekten alınan 265 süt ve 26 vajinal sıvap örneği ile 97 ineğe ait atık fötal doku örneği incelendi. Bakteriyolojik inceleme sonucunda 265 süt örneğinin 4 (%5.47) inden ve 26 vajinal sıvap örneğinin 25 (%9.57) inden ve 97 atık fötus örneğinin 4 (%4.23) ından olmak üzere toplam 6 (%7.) örnekten Brucella spp. izolasyonu yapıldı. İneklerin 8 (%3.3) inin hem süt hem de vajinal sıvap örneğinden Brucella spp. izole edildi. İzolatların 5 (%99.5) i Brucella abortus ve (%.94) i Brucella melitensis olarak identifiye edildi. İzolatların tümü saha suşu olarak saptandı. 5 B. abortus izolatının 92 (%87.6) si B. abortus biyotip 3, 2 (%.9) si B. abortus biyotip 6, 2 (%.9) si B. abortus biyotip 9 ve (%.95) i B. abortus biyotip olarak tiplendirildi. Atık fötus doku örneğinden izole edilen adet B. melitensis suşu B. melitensis biyotip 3 olarak tiplendirildi. B. abortus olarak identifiye edilen 8 suş klasik yöntemlerle biyotiplendirilemedi ve atipik B. abortus olarak belirlendi. Brucella cins spesifik PZR kiti ile tüm izolatlar Brucella spp. ve Brucella tür spesifik PZR kiti ile 5 izolat B. abortus ve izolat B. melitensis olarak teyit edildi. Çalışmada, hastalık için risk oluşturabilecek epidemiyolojik faktörler incelendi ve bu faktörlerin brusella pozitifliğine katkı sağladıkları belirlendi. Anahtar sözcükler: Brucella spp., İnek, İzolasyon ve biyotiplendirme, PZR, Epidemiyoloji Investigation of Brucella Species from Various Samples of Aborted Cattle in Kars Province (Turkey) by Cultural and Molecular Methods and Epidemiological Analysis of Cases Summary In this study, investigation of Brucella agents from various samples obtained from aborted cattle in Kars province by bacteriological and molecular methods and determination of epidemiological and clinical characteristics of cases were aimed. For this purpose 265 milk and 26 vaginal swab samples were obtained from 284 aborted cattle that were not vaccinated against brucellosis and 97 tissue samples of aborted foetuses were examined. As a result of bacteriological examination, Brucella spp. were isolated from total of 6 (7.%) samples, in 4 (5.47%) out of 265 milk, 25 (9.57%) out of 26 vaginal swab and 4 (4.23%) out of 97 aborted foetus samples. Brucella spp. were isolated from both milk and vaginal swab samples of 8 (3.3%) cattle. Among 6 isolates, 5 (99.5%) and (.94%) were identified as Brucella abortus and Brucella melitensis, respectively. All of the isolates were detected as field strains. Among 5 B. abortus isolates, 92 (87.6%), 2 (.9%), 2 (.9%), (.95%) were typed as B. abortus biotype 3, B. abortus biotype 6, B. abortus biotype 9 and B. abortus biotype, respectively. One B. melitensis strain isolated from aborted foetus tissue was typed as B. melitensis biotype 3. Eight B. abortus strains couldn t be biotyped by classical methods and they were determined as atypical B. abortus. All of the isolates were confirmed as Brucella spp. with Brucella genus-spesific PCR and 5 isolates were identified as B. abortus and one isolate was identified as B. melitensis with Brucella species-specific PCR. In the study, some epidemiological factors that pose a risk for the disease were also investigated and it was found that these factors contributed to brucella positivity. Keywords: Brucella spp., Cattle, Isolation and biotyping, PCR, Epidemiology İletişim (Correspondence) /7

125 8 KarsYöresinde AtıkYapan... GİRİŞ Brusellozis, hayvanlarda abort ve infertilite ile karakterize olan ve Brucella cinsi bakteriler tarafından oluşturulan, enfeksiyöz, bulaşıcı ve önemli bir zoonotik hastalıktır,2. Uluslararası Sistemik Bakteriyoloji Komitesi Brucella Taksonomisi Altkomitesi Brucella cinsi içerisinde; Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, B. neotomae, B. ceti, B. pinnipedialis, B. microti ve B. inopinata sp. nov. adlı farklı tür bildirmiştir 3,4. Sığırlarda enfeksiyondan B. abortus sorumlu tutulmuştur 5. Fakat B. melitensis ve nadiren B. suis in saptandığı sığır enfeksiyonları da mevcuttur 6. Brusellozis, dünyada en yaygın zoonoz olarak kabul edilmektedir. Akdeniz Bölgesi, Orta Doğu, Batı Asya nın gelişmekte olan ülkelerinde, Afrika ve Latin Amerika nın bir kısmında insan ve hayvanlarda yaygınlığını sürdürmektedir,7. Türkiye de ve Kars yöresinde brusellozis endemik seyreden bir hastalıktır ve epidemiyolojisi tam olarak bilinmemektedir 8. Kars ili ve çevresinde yapılan çalışmalarda sığır abortlarından %3-4 oranında Brucella spp. izole edilirken 9-, %3-7 oranında Brucella antikorları tespit edilmiştir 9,2. Bu çalışmada süt, vajinal sıvap ve atık fötuslardan Brucella cinsi mikroorganizmaların izolasyonu, identifikasyonu, biyotiplendirilmesi ve moleküler yöntemlerle araştırılması, Kars yöresinde süt sığırlarında brusellozisin coğrafi dağılımının belirlenmesi, atık olguları ile ilgili epidemiyolojik verilerin ve klinik özelliklerin ortaya konulması ve yorumlanması amaçlanmıştır. MATERYAL ve METOT Çalışmanın materyalini, Kars ili ve ilçelerine ait işletmelerde Mart 29 ile Mart 2 tarihleri arasında atık yapan ve aşısız olduğu bilinen ineklere ait süt ve vajinal sıvap örnekleri ile 25-2 yılları (ilk iki ay) arasında teşhis amaçlı Kafkas Üniversitesi Veteriner Fakültesi Mikrobiyoloji Laboratuarlarına getirilen atık fötus örnekleri oluşturdu. Örnekleme yapılan 86 farklı işletmedeki toplam inek sayısı 4.276, boğa sayısı 47 ve koyun odağı 4 olarak saptandı. Çalışmada 284 farklı ineğin 242 sinden hem süt hem de vajinal sıvap olmak üzere toplamda 265 süt ve 26 vajinal sıvap örneği ile 97 farklı ineğin fötal doku örneği Brucella etkenlerinin izolasyonu amacıyla incelendi (Tablo ). Süt ve vajinal sıvap örneklerinden direk ve Farrell Broth da ön zenginleştirme sonrası Brucella selektif supplement (Oxoid, SR83A) ilave edilmiş Farrell Agar ve Brucella Selektif Agar (Oxoid CM69) ile Kanlı agara (Oxoid CM27) ekim yapıldı. Atık fötusa ait organ ve doku örnekleri %5- koyun kanı ilave edilmiş kanlı agara ekildi. Tüm örnekler için ikili ekim yapılarak bir tanesi aerob diğeri ise %5- CO 2 li ortamda, 37 C de 5-7 gün süre ile inkübe edildi. Süt, vajinal sıvap ve atık fötus örneklerinin ekim ve inkübasyonunu takiben, besiyerleri Brucella cinsi bakterilerin oluşturdukları koloni morfolojisi yönünden incelenerek şüpheli kolonilerden preparat hazırlandı, Gram boyama yöntemi ile boyanarak mikroskopta incelendi. Gram negatif kokobasil olarak görülen etkenlerin katalaz, oksidaz ve üreaz aktiviteleri belirlendikten sonra izolatların identifikasyonu ile biyotiplendirilmesi Alton ve ark. 3 tarafından bildirilen yöntemlere göre yapıldı. Sonuçlar, Pendik Veteriner Kontrol ve Araştırma Enstitüsü nde yapılan çalışmalar ile doğrulandı. Bu çalışmada moleküler yöntemlerle 4 süt, 25 vajinal sıvap ve 4 fötus Brucella izolatı incelendi. Bu amaçla Brucella cins spesifik PZR kiti (FC BIOTEC, 33) ve Brucella tür spesifik (Multiplex) PZR kiti (FC BIOTEC, 3) kullanıldı. DNA ekstraksiyonu daha önce bildirilen 4 kloroform ekstraksiyon yöntemi kullanılarak yapıldı. Her bir örnek için.2 ml lik tüpler içerisinde hazır olan 45 µl lik reaksiyon karışımına 5 µl DNA ekstraktı eklendi ve amplifikasyon işlemi üretici firmanın talimatları doğrultusunda gerçekleştirildi. Atık olgularının epidemiyolojik ve klinik özelliklerin değerlendirilmesi amacıyla modifiye bir kesitsel çalışma Tablo. Yerleşim yerlerine göre incelenen örnek cinsi ve sayısı Table. Types and the number of samples examined according to locations Bölge İşletme Sayısı Süt Vajinal Sıvap Fötus Akyaka Arpaçay 8 3 Digor Kağızman Merkez Sarıkamış Selim Susuz Toplam

126 8 BÜYÜK, ŞAHİN şeklinde yürütülen bu araştırmada, örnekleme küme örnekleme yöntemi ile yapıldı. Araştırma verilerinin analizi bilgisayar ortamında Minitab paket programı (Minitab Release 2. for Windows, State College, PA) kullanılarak yapıldı. Verilerin analizinde yüzdelik oran ve Ki-kare testi kullanıldı. BULGULAR Bakteriyolojik inceleme sonucu 265 süt örneğinin 4 (%5.47) inden, 26 vajinal sıvap örneğinin 25 (%9.57) inden ve 97 fötus örneğinin 4 (%4.23) ından Brucella spp. izolasyonu yapıldı. Çalışmada 8 (%3.3) hayvana ait hem süt hem de vajinal sıvap örneğinden Brucella spp. izole edildi. Süt ve vajinal sıvap örneklerinden ön zenginleştirme öncesi ve sonrası en çok izolasyon Farrell Agarda bunu takiben Brucella Agar ve Kanlı Agarda yapıldı. Örneklerin 24 (%36.36) ü Farrell Broth da zenginleştirmeyi takiben katı besiyerlerinde kültür sonucu üretildi. Çalışmada en fazla izolasyon fötal atığı takiben 3 ile 3. gün arasında alınan örneklerden, en az izolasyon ise 9. günden sonra alınan örneklerden yapıldı (Tablo 2). Süt ve vajinal sıvap örneklerinin ekimi sonucunda 4-5. günlerde oluşan kolonilerin Brucella A ve M antiserumu ile yapılan aglütinasyon testinde adet süt izolatı hariç (A antiserumu ile negatif ve M antiserumu ile pozitif), tüm izolatlar A antiserumu ile pozitif ve M antiserumu ile negatif aglütinasyon reaksiyonu verdiler. Ayrıca nötral akriflavin solüsyonu ile yapılan aglütinasyonda tüm izolatlar smooth koloni yapısı gösterdiler. Süt ve vajinal sıvaplardan izole edilen ve Brucella spp. olarak tanımlanan 66 izolatın tümü Tbilisi Fajı nın rutin test dilüsyonu (RTD) ve 4 xrtd ile lizis oluşturmaları nedeniyle B. abortus olarak identifiye edildi. Ayrıca izolatların 63 ü ilk izolasyonlarında %5- CO 2 li ortamda üredi ve 64 ü H 2 S pozitif saptandı. Atık fötuslardan izole edilen 3 suş A antiserumu ile ve suş M antiserumu ile pozitif reaksiyon oluşturdu. İzolatların 25 inin smooth ve 7 sinin kısmı rough koloni yapısında olduğu saptandı. Atık fötus doku örneklerinden izole edilen ve Brucella spp. olarak tanımlanan bir izolat, ilk izolasyonda aerob ortamda üremesi, H 2 S testinin negatif olması ve Tbilisi Fajı nın RTD ve 4 xrtd ile lize olmaması nedeniyle B. melitensis olarak identifiye edildi. Biyotiplendirme çalışmaları sonucu süt izolatlarının 37 (%9.24) si B. abortus biyotip 3, 2 (%4.87) si B. abortus biyotip 6, (%2.43) i B. abortus biyotip ve (%2.43) i B. abortus biyotip 9; vajinal sıvap izolatlarının tümü B. abortus biyotip 3; atık fötus izolatlarının 3 (%96.77) u B. abortus biyotip 3 ve (%3.22) i B. abortus biyotip 9 olarak belirlendi. Atık fötustan izole edilen adet B. melitensis suşu ise B. melitensis biyotip 3 olarak tiplendirildi. Çalışmada fötuslardan izole edilen ve konvansiyonel yöntemlerle B. abortus olarak identifiye edilen 8 suşun tamamının monospesifik M antiserumu ile pozitif aglütinasyon vermesi ve bunların 7 sinin Tbilisi fajının değişik konsantrasyonlarıyla (RTD ve RTDx 4 ) ve R/C fajları ile lizis özelliklerinde farklılıkların olması nedeniyle bu 8 suş atipik B. abortus olarak tanımlandı (Tablo 3). Çalışmada 5 B. abortus izolatının tamamı ve adet B. melitensis izolatı saha suşu olarak belirlendi. Süt, vajinal sıvap ve atık fötus örneklerinden izole ve identifiye edilen 6 izolatın Brucella cins spesifik PZR kiti ile yapılan analizi sonucunda yaklaşık 25 bp lik bantların görülmesi ile tüm izolatlar Brucella spp. olarak belirlendi (Şekil a). Süt, vajinal sıvap ve atık fötus örneklerinden izole ve identifiye edilen ve atipik izolatlar da dahil konvansiyonel yöntemlerle ve Brucella cins spesifik PZR kiti Tablo 2. Atık sonrası örnek alma zamanı ve izolasyon oranları Table 2. The sampling time after the abortion and isolation rates Brucella spp. İzolasyon Durumu 3-3. Gün 3-6. Gün 6-9. Gün 9-2. Gün 2. Gün Sonrası Toplam İzole edilen İzole edilemeyen Toplam Tablo 3. Brucella izolatlarının biyotip dağılımı ve üreme özellikleri Table 3. Biotype distribution and growth characteristics of Brucella isolates Biyotip İzolat Sayısı Örnek Türü CO 2 H 2 S Tionin B. Füksin A Serum Agl. M Serum Agl. Tbilisi Fajı B. abortus biyotip Süt B. abortus biyotip 3 92 Süt (37) V. sıvap (25) Fötus (3) B. abortus biyotip 6 2 Süt B. abortus biyotip 9 2 Süt () Fötus () B. melitensis biyotip 3 Fötus Atipik B. abortus 8 Fötus + + -/+ + -/+ + -/+

127 82 KarsYöresinde AtıkYapan... ile Brucella spp. olduğu doğrulanan 5 adet Brucella spp. suşunun tümü Brucella tür spesifik PZR kiti ile 65, 45 ve 35 bp boyutunda bant profilleri göstererek B. abortus, klasik yöntemlerle B. melitensis olarak identifiye edilen adet suş ise 65 ve 36 bp boyutunda iki bant profili vererek B. melitensis olarak belirlendi (Şekil b). yol açan enfeksiyöz bir hastalık olarak güncelliğini korumaktadır 5,6. Dünyanın birçok ülkesinde ve Türkiye de ineklerde abortlara neden olan etkenlerin teşhisine yönelik birçok çalışma yapılmıştır,7,8. Peter 9, abort olgularının ancak %5-65 inin etiyolojisinin belirlenebildiğini ve bunların %5-65 inin bakteriyel, %5-25 inin viral ve %2 a Şekil. Brucella cins ve tür spesifik PZR sonuçları a: Brucella cins spesifik PZR sonuçları, nolu kolon; Moleküler ağırlık marker ( kb DNA ladder, Fermantas, Litvanya), 2 nolu kolon; pozitif kontrol (B. abortus 544), 3 nolu kolon; pozitif kontrol (B. melitensis 6M), 4 nolu kolon; izolat, 5 nolu kolon; negatif kontrol b: Brucella tür spesifik PZR sonuçları, nolu kolon; Moleküler ağırlık marker ( kb DNA ladder, Fermantas, Litvanya), 2 nolu kolon; pozitif kontrol (B. abortus 544), 3 nolu kolon; pozitif kontrol (B. melitensis 6M), 4 nolu kolon; B. abortus saha izolatı, 5 nolu kolon; B. melitensis saha izolatı, 6 nolu kolon; negatif kontrol Fig. The results of Brucella genus and species-specific PCR a: Results of Brucella genius-specific PCR, lane ; molecular weight stand ( kb DNA plus ladder, Fermentas, Lithuania), lane 2; positive control (B. abortus 544), lane 3; positive control (B. melitensis 6M), lane 4; isolate, lane 5; negative control b: Results of Brucella species-specific PCR, lane ; molecular weight stand ( kb DNA plus ladder, Fermentas, Lithuania), lane2; positive control (B. abortus 544), lane 3; positive control (B. melitensis 6M), lane 4; B. abortus field isolate, lane 5; B. melitensis field isolate, lane 6; negative control b Atık olgularının epidemiyolojik ve klinik özelliklerine bakıldığında en fazla örnek alınan ve Brucella spp. izolasyonu yapılan hayvanlar arasında Montofon melezi, 5 yaş, veya en fazla 3 defa gebelik geçiren, önceki yıllardaki gebelikleri normal sonuçlanan, boğa ile gebe kalan ve 7 ile 9. aylar arasında atık yapan ineklerin çoğunlukta olduğu belirlendi. İstatistiksel olarak değerlendirildiğinde hastalık yönünden sayılan bütün bu risk faktörleri ile brusellozis görülme sıklığı arasındaki ilişki önemli (P<.5) bulundu. Çalışmada ineklerde abort haricinde klinik belirti olarak metritis (%8.66), retensio sekundinarum (%6.29), infertilite (%.57) ve mastitis (%.57) saptandı. Çalışmada sadece 97 ineğe ait fötus örneğinin patolojik incelemesi yapıldı. Olguların çoğunda fötusta şişkinlik, deri altı ödem ve pnömoni tablosuna rastlandı. TARTIŞMA ve SONUÇ Brusellozis, gelişmekte olan ülkelerde insan ve hayvan sağlığını olumsuz etkileyen ve büyük ekonomik kayıplara -25 inin mantar enfeksiyonlarından kaynaklandığını bildirmiştir. Abort olgularında bakteriyel etken olarak sıklıkla Brucella spp., Campylobacter spp., Listeria spp., Chylamydia abortus, Salmonella spp., Leptosipira spp. gibi mikroorganizmalar izole edilmiştir,6,9-2 ve olguların çoğunda Brucella türlerinin ilk sırada yer aldığı bildirilmiştir 9,22. Ülkemizde yapılan araştırmalarda özellikle Kars ve yöresinde brusellozisin endemik olduğu ortaya konulmuştur 9,5,6,23. Bu çalışmada ineklerden %25.72 oranında Brucella izolasyonu yapıldı. Bu bulgular yörede yapılan ve brusellozisin endemik olduğunu vurgulayan çalışmaların 9,5,6,23 sonuçlarına benzer niteliktedir. Hayvanlarda brusellozisin teşhisine yönelik çalışmalar daha çok kan serumu 9,5 ve süt örneklerinin serolojik ve atık fötus materyallerinin 7,2,23 kültürel incelenmesi şeklindedir. İnsanlar için önemli bir bulaşma kaynağı olan süt ve süt ürünleri ile vajinal akıntıdan etken izolasyonuna yönelik çalışmalar oldukça sınırlıdır 26,27,29. Kültürel çalışmalarda seropozitif inek sütlerinden 24,28 %3-88 oranında Brucella spp. izole edilirken, sürü taramasının yapıldığı

128 83 BÜYÜK, ŞAHİN çalışmalarda 26,29 bu oran süt örnekleri için %4-8 ve vajinal sıvap örnekleri için %6- olarak saptanmıştır. Bu çalışmada süt örneklerinin 4 (%5.47) inden, vajinal sıvap örneklerinin 25 (%9.57) inden Brucella spp. izole edildi. Bu izolasyon oranları seropozitif inek sütlerinde yapılan çalışmaların 24,28 oranlarına göre düşüktür. Seropozitif ineklerden daha fazla Brucella spp. izolasyonunun beklenen bir durum olması bu çalışmadaki izolasyon oranlarının daha düşük olmasının sebebi olarak gösterilebilir. Bu çalışmadaki izolasyon oranları sürü taramasının yapıldığı çalışmalara 26,29 oranla daha fazladır. Bu durum çalışmada incelenen örneklerin tamamının yavru atan ineklerden alınması ve brusellozisin yörede endemik seyretmesi gerçeği ile açıklanabilir. Bu çalışmada 8 ineğe ait süt ve vajinal sıvap örneğinden eş zamanlı olarak B. abortus izole edildi. Bu bulgular ineklerin abort sonrası süt, fötal sıvılar, uterus ve vajinal akıntıları gibi çeşitli salgıları ile Brucella etkenlerini eş zamanlı olarak çıkarabileceğini göstermektedir. Brucella etkenleri atığı takiben fötusa ait doku ve organlarda yoğun bir şekilde bulunmaktadır. Bu tür örneklerin kültürünün yapılması izolasyon şansını artırmaktadır 3. Atık fötus doku örneklerinden Brucella etkenlerinin izolasyonuna yönelik birçok çalışma,,7,2,23 yapılmıştır. Sağlam ve ark. Kuzeydoğu Anadolu Bölgesi nden alınan 96 atık inek fötusunu etiyolojik ve patolojik olarak incelemişler ve örneklerin 4 (%4.6) ından Brucella spp. izole etmişlerdir. Şahin ve ark. Kars yöresinde 87 atık inek fötusunu bakteriyolojik olarak incelemişler ve 35 (%4.22) inden B. abortus izole ve identifiye etmişlerdir. Bu çalışmada 97 atık fötus örneği Brucella etkenlerinin izolasyonu amacıyla incelendi ve örneklerin 4 (%4.23) ından Brucella spp. izole edildi. Bu bulgular brusellozisin endemik seyrettiği Kars yöresinde daha önce yapılan çalışmaların, sonuçlarıyla benzerlik göstermektedir. Brucella etkenlerinin izolasyonunda örneklerin uygun bir katı besiyerine direk inokulasyonu en yaygın yöntemlerden birisidir. Brucella türlerinin çoğu kanlı agar, çikolata agar, triptik soya agar gibi standart katı besiyerinde ürerler. Fakat kontamine doku veya sekresyonlardan etken izolasyonunda Martin-Lewis, Farrell Besiyeri gibi selektif besiyerleri ve %5 at serumu ile zenginleştirilmiş genel besiyerleri kullanılabilir 3,32. Brucella mikroorganizmasının düşük sevide bulunduğu süt, kolostrum ve bazı doku örneklerinde etken izolasyonunda zenginleştirme önerilmektedir. Zenginleştirme, serum dekstroz broth, triptoz broth, soya broth veya Brucella broth gibi besiyerlerine birkaç antibiyotiğin ilavesi ile elde edilebilir 32. Brucella etkenlerinin üretilmesinde çeşitli besiyerlerinin etkinliklerinin değerlendirildiği birçok araştırma 24,25,28 mevcuttur. Bu çalışmada Brucella etkenlerinin izolasyonu amacıyla Farrell Agar, Brucella Agar ve Kanlı Agar kullanılmış ve en yüksek izolasyon Farrell Agarda elde edilmiştir. Bu sonuçlar, Brucella etkenlerinin üretilmesinde çeşitli besiyerlerinin etkinliklerinin değerlendirildiği araştırmaların 25,28 sonuçları ile benzer niteliktedir. Ayrıca çalışmada elde edilen izolat- ların 24 (%36.36) ünün Farrell Brothta zenginleştirmeyi takiben izole edilmiş olması Brucella etkenlerinin izolasyonunda ön zenginleştirmenin önemini vurgulayan araştırmalarla 24,28 uyum içerisindedir. Bruselloziste atığı takiben genellikle ilk haftalarda süt ve vajinal akıntı gibi sekretlerle Brucella türleri yoğun bir şekilde atılmakta ve ilk 6 haftalık sürede en yüksek seviyeye ulaşmaktadır. Bazı çalışmalarda etkenin sütle yıllarca (7-9 yıl) atıldığı bildirilmiştir 33,34. Bu çalışmada süt ve vajinal sıvap örneklerinin büyük bir kısmı (%59.5) atık sonrası 3 ile 6. günler arasında alındı. Atığı takiben Brucella etkenlerinin çeşitli sekretlerle ilk 6 haftalık dönemde yüksek oranda atıldığı gerçeğine uygun bir şekilde, bu dönemler içerisinde alınan örneklerde daha fazla Brucella spp. izole edildi. Atığı takiben örnek alma zamanı ile etken izolasyon oranı arasındaki ilişki istatistiksel olarak önemli (P<.5) bulundu. Çalışmada atığı takiben 9 gün sonra ve hatta birkaç olguda yıl sonra bile etkenin izole edilebilmesi, etkenin uzun yıllar süt ile atılabileceğini göstermektedir. Hayvanlardan izole edilen Brucella türleri ve biyovarları ülkeden ülkeye farklılık gösterebileceği gibi bir ülkenin değişik bölgeleri arasında da farklılık gösterebilir. Hastalığa neden olan baskın Brucella tür ve biyovarlarının belirlenmesi enfeksiyonun epidemiyolojisi ve kontrol çalışmaları açısından oldukça önemlidir. Türkiye de sığır ve koyun brusellozis etkenlerinin biyotiplendirilmesine yönelik çok sayıda çalışma mevcuttur 6,7,2,2,35. Çalışmaların sonucunda Türkiye de 7,2 ve Kars yöresinde 6,2 sığırlarda atıklara sebep olan baskın suşların B. abortus biyotip ve 3 olduğu ortaya konulmuştur. Bu çalışmada izole edilen 5 B. abortus suşunun 92 (%87.6) si B. abortus biyotip 3, 2 (%.9) si B. abortus biyotip 6, 2 (%.9) si B. abortus biyotip 9 ve (%.95) i B. abortus biyotip olarak tiplendirildi. Fötus doku örneğinden izole edilen bir adet B. melitensis suşu ise B. melitensis biyotip 3 olarak belirlendi. Bu sonuçlar Türkiye de yapılan identifikasyon ve biyotiplendirme çalışmalarının 7,2,26,35 sonuçlarıyla farklılık göstermektedir. Bunun nedeni olarak çalışılan bölgelerin ve materyallerin faklı olması gösterilebilir. Kars yöresinde sığırlarda görülen brusellozis olgularında diğer çalışmalara 6,2,29 benzer şekilde bu çalışmada da B. abortus biyotip 3 ün baskın olduğu fakat B. abortus biyotip in oranının giderek azaldığı belirlendi. Çalışmada ayrıca Türkiye de varlığı daha önce bildirilen 35,36 B. abortus biyotip 6 ve B. abortus biyotip 9, Kars yöresinde ilk kez saptandı. Araştırmaların yapıldığı zaman periyotlarının farklı olması ve yörede yoğun hayvan hareketleri nedeniyle değişik zamanlarda hastalığa neden olan tür ve biyotiplerin değişebilme potansiyeli bu farklılıkların nedenleri olarak düşünülmektedir. Brucella türlerinin geniş konak çeşitliliği vardır. Fakat enfeksiyonların patojenitesinde çok sıkı bir konak spesifitesi görülür ve türler arasında kros enfeksiyon oldukça nadirdir. Enfekte koyun ve keçilerle temas halinde olan,

129 84 KarsYöresinde AtıkYapan... aynı ortamlarda barındırılan ve aynı meralarda otlatılan ineklerin B. melitensis ile enfekte olabilecekleri bildirilmiştir 37. Bu çalışmada sığır kökenli süt, vajinal sıvap ve fötus doku örneklerinden izole edilen toplam 6 Brucella suşunun identifikasyon çalışmaları sonucu 5 i B. abortus ve bir izolat B. melitensis olarak belirlendi. B. melitensis in izole edildiği fötusun alındığı işletmedeki ineklerin 4-5 adet keçi ile birlikte barındırıldığı bildirildi. Kars yöresinde yapılan diğer çalışmaların 6,2,29 sonuçlarına benzer bir şekilde bu çalışmada da sığır brusellozisinden çoğunlukla B. abortus saptandı. Ayrıca yörede varlığından daha önce bahsedilmiş 22 olmasına rağmen sığır abort olgularından gerçek anlamda ilk B. melitensis izolasyonu yapıldı. Daha önce bildirilenlere 2,37 benzer şekilde bu çalışmada da B. melitensis in sorumlu olduğu sığır abort vakası saptanmıştır. Bu durumun işletmede farklı hayvan türlerinin bir arada beslenmesi ve yakın temasından kaynaklanabileceği ihtimalini akla getirmiştir. Odaktaki ineklerin keçiler ile beraber barındırılması, B. melitensis in keçilerden bulaşabileceği ihtimalini kuvvetlendirmiştir. Fakat keçilerde brusellozis yönünden herhangi bir mikrobiyolojik yoklama yapılmadığı için bu ihtimal kesinlik kazanmamıştır. Brucella türleri arasındaki genetik homojenite yüksek olmasına rağmen bazı metabolik ve biyokimyasal özelliklerinden yararlanılarak tür ve biyotip tayini yapılabilmektedir. Fakat konvansiyonel şemaya uymayan yeni ve atipik Brucella varyantlarının ortaya çıkması nedeniyle Uluslararası Sistemik Bakteriyoloji Komitesi Brucella Taksonomisi Altkomitesi halen Brucella için iyi bir klasifikasyon şeması oluşturamamıştır 38. Çeşitli araştırmalarda penisilin duyarlı ve bakteriyofaj dirençli smooth B. abortus kültürlerinin 39,4 yanı sıra boya duyarlı, M antijene sahip B. abortus izolatları da bildirilmiştir 4. Bu çalışmada yapılan biyotiplendirme sonucunda 5 B. abortus suşunun 8 (%7.6) i standart biyotiplendirme profiline uygun olarak tiplendirilemedi ve atipik B. abortus suşları olarak belirlendi. Bu bulgular yapılan diğer çalışmaların 39,4,42 sonuçları ile benzerlik göstermektedir. Bu sonuçlardan da anlaşılacağı üzere bir ülke ya da bölgede standart biyotiplendirme şemasına uymayan atipik izolatların görülmesi her zaman olasıdır. Bu tür izolatların tekrarlayan izolasyonlarının yapılması, ileride bu izolatlara yeni bir biyotip statüsü verilmesinin ilk aşamasıdır ve bunlar epidemiyolojik araştırmalarda değerli veriler oluştururlar. Brucella etkenlerinin konvansiyonel yöntemlerle tanımlanmasında karşılaşılan bazı güçlükler nedeniyle son yıllarda insan ve hayvanlardan brusellozisin tanısı ve cins, tür ve biyotip düzeyinde identifikasyonuna yönelik moleküler teknikler yaygın bir şekilde kullanılmaktadır 43,44. Bu tekniklerden in vitro DNA amplifikasyonunun yapıldığı PZR yaygın bir kullanım alanına sahiptir. Bu teknik, örneklerin kültürünü takiben izolatlar üzerine 45 uygulanabileceği gibi izolasyona gerek duyulmadan kan, süt, vajinal akıntı, atık fötus doku örneklerinden etkenin aranmasına yönelik direk PZR 8 şeklinde de yapılabilmektedir. Bu çalışmalar ile brusellozisin teşhisinde PZR nin daha hızlı, güvenli, yüksek sensitivite ve spesifiteye sahip olduğu bildirilmiştir. Bu çalışmada izole edilen 6 Brucella suşunun cins spesifik PZR kiti ile yapılan analizi sonucu tümü Brucella spp., multipleks PZR kiti ile yapılan analiz sonrası 5 i B. abortus ve i B. melitensis olarak belirlendi. Kültürel sonuçlarla Brucella cins ve tür spesifik PZR kitleri karşılaştırıldığında elde edilen sonuçlar aynı bulundu. Brusellozisin teşhisinde altın standart olarak kabul edilen bakteri izolasyonu ile moleküler teşhis amaçlı kullanılan bu PZR kitlerinin benzer sonuçlar vermesi, bu kitlerin spesifitelerinin yüksek olduğunu göstermektedir. Klasik identifikasyon yöntemlerine göre daha kolay ve kısa sürede sonuç vermesi nedeniyle tercih edilebilir niteliktedir. Bruselloziste olası enfeksiyon kaynaklarının ve risk faktörlerinin belirlenmesi sonraki epidemilerin önlenmesi açısından oldukça önemlidir ve buna yönelik birçok çalışma yapılmıştır 7,46,47. Bu çalışmalarda 7,46,47 daha çok sürü büyüklüğü, şekli, idaresi, hijyen ve biyogüvenlik açısından risk değerlendirmesi yapılmış ve sayılan tüm bu faktörler brusella seropozitifliği için birer risk olarak düşünülmüştür. Yaş, ırk, cinsiyet ve abort varlığı gibi faktörlerin ise bireysel seropozitiflik açısından farklı etkilerinin olabileceği ortaya konulmuştur. Bu çalışmada hastalık yönünden risk oluşturabilecek yaş, gebelik sayısı, geçen yıllara ait atık varlığı, tohumlama şekli ve atığın gerçekleştiği gebelik dönemi gibi faktörler değerlendirildi. İneklerin yaş dağılımına bakıldığında en fazla atık yapan ve izolasyon yapılan yaş 5 yaş olarak belirlendi ve yaş ile brusellozis görülme sıklığı arasında istatistiksel olarak anlamlı (P<.5) bir ilişki saptandı. Bunun nedeni olarak yaşlı hayvanların verim düşüklüğü ve tekrar atık yapma olasılıkları nedeniyle işletmelerde tutulmaması ve dolayısıyla örnekleme esnasında yaşlı hayvan bulma olasılığının az olması şeklinde açıklanabilir. Çalışmada veya en fazla 3 defa gebelik geçirenlerde brusellozis daha fazla saptandı ve brusellozis ile gebelik sayısı arasındaki ilişki istatistiksel olarak anlamlı (P<.5) bulundu. Bu durum hayvanların yaşları, döl verimi özellikleri ve dolayısıyla hayvanların üretime devam etmek için elde tutulabilirlikleri ile ilişkilendirilmiştir. Bruselloziste ilk atığı takiben genellikle sonraki gebelikler normal doğum ile sonuçlanır. Fakat bazen ilk atığı takiben 2 veya 3 yıl üst üste veya aralıklı olarak atıklar şekillenebilir 32. Bu çalışmada önceki yıllarda gebelikleri normal sonlanan 29 hayvan olmasına rağmen, atık yapan 23 ve çeşitli infertilite problemleri olan 7 hayvan belirlendi. Geçmiş yıllarda atık yapan ve infertilite problemleri olan hayvanlar hariç büyük bir çoğunluğunun ilk kez atık yaptığı tespit edildi. Çalışmada aynı zamanda 27 ineğin ilk gebeliklerinde atık yaptığı belirlendi. Bu bulgular ile yukarıda açıklanan hipotez doğrulanır niteliktedir. Çalışmada atık yapan ineklerin tohumlama şekilleri ile atık ve izolasyon oranları karşılaştırıldı ve aralarında

130 85 BÜYÜK, ŞAHİN istatistiksel olarak önemli (P<.5) bir ilişki saptandı. Doğal aşım ile gebe kalan 357 inek ve sun-i tohumlama yapılan 24 inek saptandı. Çalışmadaki tüm işletmelerde toplam 47 adet boğa ve bu boğaların çoğunun ortak kullanıldığı bildirildi. Bu bulgular brusellozis gibi veneral yolla bula-şabilecek hastalıklarda doğal aşım ile etkenlerin daha fazla bulaşabileceği gerçeğiyle uyum içerisindedir. Brusellozis genellikle ineklerde gebeliğin son üç aylık döneminde atıklara sebep olmaktadır. Bunun yanı sıra gebeliğin ilk dönemlerinde erken embriyonik ölümlere ve atıklara sebep olabileceği gibi gebeliğin sonlanmasına yakın ölü doğum veya cansız, yaşama gücü zayıf canlı buzağı doğumları da görülebilmektedir 6,32. Bu çalışmada atık ve izolasyon oranları ile ineklerin gebelik dönemleri arasındaki ilişki istatistiksel olarak önemli (P<.5) bulundu. En fazla izolasyon 7 ile 9. aylar arası, bunu takiben sırasıyla 4 ile 6. aylar arası ve ile 3. aylar arasındaki gebelik dönemlerinde yapıldı. Çalışmada ayrıca ölü doğum (2 inek) ve zayıf buzağı doğumu (3 inek) yapan ineklerden de örnekleme yapıldı ve Brucella izole edildi. Bu bulgular brusellozisin ineklerde özellikle gebeliklerinin son üç aylık döneminde daha fazla görüldüğü ve önemli derecede abortlara yol açtığı gerçeği ile uyum içerisindedir. Sonuç olarak bu çalışma ile Kars yöresindeki ineklerden %25.72 oranında Brucella izolasyonu yapılmış ve hastalığın yörede endemik olduğu bir kez daha ortaya konulmuştur. Sığır brusellozisinin bu yüksek prevalansı ve insan brusellozis vakalarının yıllar içerisinde giderek artması, yörede ve ülke genelinde brusellozise yönelik eradikasyon programları ve uygulamalarının yetersiz kaldığını düşündürmekte ve brusellozisin ülkemizde hem insan sağlığına hem de hayvancılık sektörüne olumsuz etkileri nedeniyle önemli bir sorun olmaya devam ettiğini göstermektedir. Bu sorunun bilincinde olarak, brusellozisin eradikasyonu konusunda çok sayıda disiplinin bir arada programlı bir şekilde çalışması gerekmektedir. Zoonotik hastalıkların insanlara bulaşmasının önlenmesinde temel görev veteriner hekimlerin olmasına rağmen insanlarda ve hayvanlarda brusellozisin kontrolü tıp ve veteriner doktorlarının öncelikli konularından birisi olmalı ve ortaklaşa çalışmalar yürütülmelidir. Bu tür kesit çalışmalarda zaman sıkıntısı olduğundan brusellozis ile ilgili risk faktörlerinin belirlenmesinde büyük öneme sahip kohort çalışmalarının sayılarının artırılması gerektiği düşünülmektedir. KAYNAKLAR. Corbel MJ: Brucellosis: An overview. Emerging Infect Dis, 3 (2): 23-22, Ray WC: Brucellosis (due to Brucella abortisand B. suis). In, Steele JH (Ed): Bacterial, Rickettsial and Mycotic Diseases. pp CRC Press, Boca Raton, Florida, USA, De BK, Stauffer L, Koylass MS, Sharp SE, Gee JE, Helsel LO, Steigerwalt AG, Vega R, Clark TA, Daneshvar MI, Wilkins PP, Whatmore AM: Novel Brucella strain (BO) associated with a prosthetic breast implant infection. J Clin Microbiol, 46, 43-49, Scholz HC, Nöckler K, Göllner C, Bahn P, Vergnaud G, Tomaso H, Al-Dahouk S, Kämpfer P, Cloeckaert A, Maquart M, Zygmunt MS, Whatmore AM, Pfeffer M, Huber B, Busse HJ, De BK: Brucella inopinata sp. nov., isolated from a breast implant infection. Int J Syst Evol Microbiol, 6, 8-88, Corbel MJ, Banai M: Genus I. Brucella Meyer and Shaw 92, 73AL. In, Brenner DJ, Krieg NR, Staley JT (Eds): Bergey s Manual of Systematic Bacteriology. 2nd ed., Vol. 2 (Part C). pp , Springer, New York, WHO: Brucellosis in human and animals resources/publications/brucellosis. pdf. Accessed: Tun TN: Prevalence survey of bovine Brucellosis (Brucella abortus) in dairy cattle in Yangon, Myanmar. Master of Veterinary Public Health, Chıang Mai University and Freie Universitat, Berlin, Erdenliğ S: Türkiye de Brucella kökenleri. XI. Türk Klinik Mikrobiyoloji ve İnfeksiyon Hastalıkları Kongresi. 3 Mart - 3 Nisan İstanbul, Genç O, Otlu S, Şahin M, Aydın F, Gökce Hİ: Seroprevalence of Brucellosis and Leptospirosis in aborted dairy cows. Turk J Vet Anim Sci, 29, , 25.. Sağlam YS, Türkütanıt S, Taştan R, Bozoğlu H, Otlu S: Kuzeydoğu Anadolu Bölgesinde görülen bakteriyel sığır ve koyun abortlarının etiyolojik ve patolojik yönden incelenmesi. Vet Bil Derg, 4 (2): 33-45, Şahin M, Atabay Hİ, Otlu S, Ünver A, Çelebi Ö: Kars ve çevresinde bulunan insan, sığır ve koyunlarda Brusellozisisin prevalansının serolojik ve kültürel metotlarla araştırılması. VI. Ulusal Veteriner Mikrobiyoloji Kongresi. 4-6 Eylül Elazığ, Güllüce M: Kars ve Çevresinde Sığırlarda Brucella abortus a karşı oluşan antikorların ELISA ve diğer serolojik yöntemlerle (RBPT, SAT, MRT) saptanması ve sonuçların karşılaştırılması. Doktora Tezi. Kafkas Üniversitesi Sağlık Bilimleri Enstitüsü Kars, Alton GG, Jones LM, Angus RD, Verger JM: Techniques for the brucellosis laboratory. pp Institut National de la Recherche Agronomique, Paris, France, Unver A, Atabay Hİ, Güneş V, Çitil M, Erdoğan HM: Kars Yöresinde sığır tüberkülozunun yaygınlığının PCR ile belirlenmesi. Kafkas Univ Vet Fak Derg, 3 (): 27-3, Otlu S, Sahin M, Atabay HI, Unver A: Serological investigation of brucellosis in cattle, farmers and veterinarians in the Kars district of Turkey. Acta Vet Brno, 77, 7-2, Şahin M, Genç O, Ünver A, Otlu S: Investigation of bovine brucellosis in the Northeastern Turkey. Trop Anim Health Prod, 4 (4): , Erdoğan I, Gurel A, Tekin C, Uyanık F, Bitgel A: Detection and distribution of bacterial abortion in sheep, goats and cattle in the Thrace region. J Pendik Vet Microbiol, 24, 23-35, Leal-Klevezas DS, Martinez-Vazquez IO, Lopez-Merino A, Martinez-Soriano JP: Single-step PCR for detection of Brucella spp. from blood and milk of infected animals. J Clin Microbiol, 33 (2): , Peter AT: Abortions in dairy cows: New insights and economic impact. Adv Dairy Technol, 2, , Buyukcangaz E, Sen A: The first isolation of Brucella melitensis from bovine aborted fetus in Turkey. J Biol Environ Sci, (3): 39-42, Genc O, Kamber U: Biotyping of Brucella strains isolated from abortions of cows in Kars province. Ind Vet J, 8, 64-65, Unver A, Erdoğan HM, Atabay Hİ, Şahin M, Güneş V, Çitil M, Gökçe Hİ: Sığır atıklarından izole edilen Brucella türlerinin RAPD-PCR ile genotiplendirilmesi. Kafkas Univ Vet Fak Derg, 2 (2): 2-27, Aydın F, Leloğlu N, Şahin M, Otlu S: Kars yöresinde sığır ve koyunlarda görülen abortların bakteriyolojik yönden araştırılması. I. Ulusal Veteriner Mikrobiyoloji Kongresi Eylül, Ankara, Türkiye, s Brodie J, Sinton GP: Fluid and solid media for isolation of Brucella abortus. J Hyg Comb, 74 (3): , Farrell ID, Robertson L: A comparison of various selective media,

131 86 KarsYöresinde AtıkYapan... including a new selective medium for the isolation of Brucellae from milk. J Appl Bact, 35, , İlhan Z, Keskin O, Sareyyüpoğlu B, Kökçü L, Akan M: Bir sığırcılık işletmesinde Brucella abortus epidemisi. Ankara Üniv Vet Fak Derg, 46, , Karasoy MH: Brucellosis li koyunlardan elde edilen sütlerden yapılan peynirlerde Brucella melitensis in dayanma süresi üzerinde araştırmalar. Ankara Üniv Vet Fak Derg, 8 (): 5-2, Langoni H, Ichihara SM, Silva AV, Pardo RB, Tonin FB, Mendonça LJP, Machado JAD: Isolation of Brucella spp. from milk of brucellosis positive cows in São Paulo and Minas Gerais states. Braz J Vet Res Anim Sci, 37 (6): , Çelebi Ö, Otlu S: Kars yöresinde atık yapmış inek sürülerinden alınan süt ve vajinal sıvap örneklerinden Brusella etkenlerinin bakteriyolojik ve moleküler tanımlanması. Kafkas Univ Vet Fak Derg, 7 (): 53-58, Aydın N: Brucella İnfeksiyonları. In, Aydın N, Paracıkoğlu N (Eds): Veteriner Mikrobiyoloji (Bakteriyel Hastalıklar). s , İlke-Emek Yayınları, Ankara, Al Dahouk S, Tomaso H, Nockler K, Neubauer H, Frangoulidis D: Laboratory based diagnosis of Brucellosis-A review of the literature. Part I: Techniques for direct detection and identification of Brucella spp. Clin Lab, 49, , OIE: Bovine Brucellosis. OIE Terrestrial Manual. normes/mmanual/28/pdf/2.4.3bovine_brucell.pdf, Accessed: Anonim: Brucellosis.www.kkgm.gov.tr/birim/hay_sagl/Hastaliklar/ brucella.htm. Erişim tarihi: Anonim: html#brucellozis. Erişim tarihi: Sarisayin F, Eroğlu M, Nadas UG: Yurdumuzda izole edilen brusella suşlarının tür ve biyotiplerini tayini ile dağılış durumu üzerine bir çalışma. Pendik Vet Kont Araşt Derg,, 24-35, Refai M: Incidence and control of brucellosis in the Near East region. Vet Microbiol, 9, 8-, Koneman E, Winn W, Alen S, Janda W, Procop G, Schreckenberger P, Woods G: Koneman s Atlas and Textbook of Diagnostic Microbiology. 8th ed., Lippincott Willams&Wilkins , Corbel MJ. Atypical Brucella melitensis strains. International Comitee on Sytematic Bacteriology Subcomitee on the Taxonomy of Brucella Prague. Czech Republic. Int J Syst Evol, 56, 69-7, Corbel MJ, Morris JA: Studies on a smooth phage-resistant variant of Brucella abortus. I. Immunological properties. Br J Exp Pathol, 55, 78-87, Harrington RJr, Bond DR, Brown GM: Smooth phage-resistant Brucella abortus from bovine tissue. J Clin Microbiol, 5, , Morgan WJB: The examination of brucella cultures for lysis by phage. J Gen Microbiol, 3, , Garcia MM, Brooks BW, Ruckerbauer GM, Rigby CE, Forbes LB: Characterization of an atypical biotype of Brucella abortus. Can J Vet Res, 52, , Bricker BJ: PCR as a diagnostic tool for brucellosis. Vet Microbiol, 9 (-4): , Fekete A, Bantle JA, Halling SM, Sanborn MR: Preliminary development of a diagnostic test for Brucella using polymerase chain reaction. J Appl Bacteriol, 69 (2): , Evangelista TBR, Santos HO De los, Navarro AFL, Basulto GEM, Nielsen K, Francisco M, Gomez M, Roseles JFM, Manriquez LCP: Evaluation of polymerase chain reaction test (PCR) for the diagnosis of bovine brucellosis. Tec Pecu Mex, 43, 7-26, Al-Majali AM, Talafha AO, Ababneh MM, Ababneh MM: Seroprevalence and risk factors for bovine brucellosis in Jordan. J Vet Sci, (): 6-65, Kassahun J: Seroepidemiological study of brucellosis in humans and dairy cattle in Addis Ababa. Master Thesis, Addis Ababa University, Addis Ababa, 23.

132 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Effects of Age and Sex on Meat Quality of Turkish Native Geese Raised Under A Free-Range System Turgut KIRMIZIBAYRAK * Kadir ÖNK ** Bülent EKİZ *** Hülya YALÇINTAN *** Alper YILMAZ *** Kemal YAZICI **** Ahmet ALTINEL *** * Kafkas University, Faculty of Veterinary Medicine, Department of Animal Breeding and Husbandry, TR-36 Kars - TÜRKİYE ** Kafkas University, Kars Vocational School, TR-36 Kars - TÜRKİYE *** İstanbul University, Faculty of Veterinary Medicine, Department of Animal Breeding and Husbandry, TR-3432 Avcılar, İstanbul - TÜRKİYE **** Ardahan University, Ardahan Vocational School, TR-75 Ardahan - TÜRKİYE Makale Kodu (Article Code): KVFD Summary This study was conducted to determine the effects of sex and age on meat quality characteristics of Turkish native geese raised under a free-range system. The range of least squares means for age and sex subgroups in terms of ultimate ph, water holding capacity (WHC), drip loss (DL), cooking loss (CL) and Warner-Bratzler shear force (SF) were , %, %, % and kg/cm2, respectively. Least squares means for colour characteristics of breast skin were for lightness (L*), for redness (a*) and for yellowness (b*) according to age and sex groups. Colour variables of breast meat were for L*, for a* and for b* parameters. While the effect of age on breast meat quality characteristics were not significant (P>.5), sex affected on ultimate ph and a* parameter significantly (P<.5). Least squares means for age and sex subgroups in terms of ultimate ph, WHC and DL of thigh meat were , % and %, respectively. L*, a* and b* values for thigh skin were , and , and also were , and for thigh meat. The effect of sex on yellowness of thigh skin was significant (P<.5), but both sex and age did not affect on meat quality characteristics of thigh meat (P>.5). Keywords: Geese, Free-range, Meat quality, Age, Sex Serbest Çiftlik Koşullarında Yetiştirilen Türk Yerli Kazlarında Cinsiyet ve Yaşın Et Kalitesi Üzerine Etkisi Özet Bu çalışma, serbest çiftlik koşullarında yetiştirilen kazların et kalitesi üzerine cinsiyet ve yaşın etkisini belirlemek amacıyla yapılmıştır. Et kalite özelliklerinden final ph, su tutma kapasitesi (WHC), pasif su kaybı (DL), pişirme kayıbı (CL) ve kesme gücü (SF) için minimum kareler ortalamaları farklı cinsiyet ve yaş alt gruplarında , % , % , % ve kg/cm2 düzeyinde belirlenmiştir. Göğüs derisi için renk özellikleri parlaklık (L*), kırmızılık koordinatı (a*) ve sarı koordinatı (b*) ortalamaları ise sırasıyla , ve olarak belirlenmiştir. Göğüs eti için L* parametresi , a* parametresi ve b* parametresi olarak belirlenmiştir. Göğüs etinin incelenen kalite özellikleri üzerine yaşın etkisi önemsiz bulunurken, cinsiyetin sadece ph ve a* üzerine etkisi önemli (P<.5) bulunmuştur. But eti için final ph, WHC ve DL ortalamaları farklı yaş ve cinsiyet alt gruplarında sırasıyla , % ve % aralığında belirlenmiştir. But derisi için L*, a* ve b* ortalamaları ise sırasıyla , ve düzeyinde ve aynı özellikler but eti için , ve düzeyinde belirlenmiştir. But derisi kalite özelliklerinden b* üzerine cinsiyetin etkisi önemli (P<.5) bulunmuş, ancak diğer özellikler üzerine cinsiyet ve yaşın önemli bir etkisi bulunmamıştır. Anahtar sözcükler: Kaz, Serbest çiftlik koşulları, Et kalitesi, Yaş, Cinsiyet İletişim (Correspondence) /32 Ext

133 88 Effects of Age and Sex on Meat... INTRODUCTION Geese are mainly kept for their meat, down and feathers, and fatty liver in various regions of the world. Geese are slow growing animals among the other poultry species. However, over the centuries geese have become accustomed to the special climatic conditions of their breeding areas. Geese are the most common poultry species for certain world regions. Geese production is widely free-range production system in Turkey. Intensity of geese production in Turkey has regional differences. Kars and Ardahan provinces which lie in northeastern part of Turkey and have a rate of 48.5% of Turkey s geese population 2. Geese meat production in this region is consumed by the regional people, but it has recently started a trading value 3-6. The rapid growth of human population in developing countries causes an increase in the need for foods of animal origin. The improvements in the educational level of society results with the changes in the consumption habbits. The beliefs that animal fats (particularly saturated fats) might increase the risk of coroner disorders, and the production costs being lower than cattle and sheep breeding, caused the fast growth of poultry meat consumption in developed countries 7. Moreover, parallel to the socio-economic improvements, consumer concerns have tended towards meat quality and safety control 8. Quality concept of consumers may have wide variety, since consumers define meat quality according to their own perceptions and preferences. But, consumers usually give particular importance to appearance and colour of meat and amount of fluid leakage to the pack at the point of sale. Skin colour also have a critical role, when poultry is marketed as a fresh whole bird. The meat texture is also taken into account by the consumers, but it can only be appreciated when the product is consumed 8. The quality of poultry meat may be affected by numerous factors associated with either the animal or its environment, such as age, sex, breed, species, rearing and feeding system, handling and slaughtering condition 9,. Although meat quality characteristics of several poultry species have been investigated extensively, reports on meat quality characteristics of geese and on environmental factors affecting meat quality characteristics of geese are limited. Furthermore, there is no available scientific report on meat quality characteristics of Turkish native geese. The aim of the current study was to determine the effects of age and sex of geese on meat quality characteristics of Turkish native geese raised under a free-range system. MATERIAL and METHODS Animals and Slaughtering The study was carried out with Turkish native geese in Kars province. The geese were grouped by sex (male=2 geese and female=2 geese) and age (6-8 months old=22 geese and 8-2 months old=2 geese). They were raised in free-range conditions and were grazed in the pasture. Birds were killed by exsanguination with a neck cut that severed the carotid artery and jugular vein. The whole carcasses were split along the vertebral column into left and right halves. Right side of each carcass was put into a special package in order to supply chilled condition of 4 o C during transport. Right sides of carcasses were transported to Istanbul by plane, and then delivered to Istanbul University Veterinary Faculty, Carcass and Meat Quality Measurement Laboratory of Department of Animal Breeding and Husbandry within the special package at the day of slaughter. Meat Quality Analyses In order to determine meat quality characteristics of Turkish native geese, M. pectoralis major (breast meat) and M. peroneus longus (thigh meat) were removed from the right side of each carcass, and these samples were kept at 4 o C for 24 h. Meat quality characteristics investigated in the current study were ultimate meat ph, water holding capacity (%), drip loss (%), cooking loss (%), Warner-Bratzler shear force (kg/cm 2 ) and meat colour variables (L*, a*, b*). Furthermore, colour variables of skin, which affect the preference of consumers, were also determined. Ultimate meat ph measurements were performed at 24 h post slaughter using a digital ph meter (Testo 25), equipped with a penetrating electrode and thermometer. The ph measurements were performed directly on Pectoralis major and Peroneus longus muscles. Drip loss measurement was applied at 72 h post mortem using the method described by Honikel. Briefly, initial weights of meat samples were recorded, and then meat samples were suspended in an inflated polyethylene bag without any contact with the bag. After a 48 h storage period at 4 o C in the refrigerator, the meat samples were gently dried with paper towels, and final weights of meat samples were measured. Drip loss (%) was estimated by the ratio of weight loss (initial weight - final weight) to initial sample weight. In order to measure water holding capacity (WHC), modified Grau and Hamm method described by Beriain et al. 2 was applied using 5 g meat samples at 72 h post mortem. WHC was expressed as percentage of weight loss of 5 g meat samples, immediately after being kept under a pressure of 225 g weight for 5 min 3. Cooking loss was measured at 72 h post mortem using the method described by Woelfel and Sams 4. In this method, meat samples taken from Pectoralis major muscle were firstly weighed, and then placed in aluminum trays and cooked in an electrical oven at 8 o C until the internal

134 89 KIRMIZIBAYRAK, ÖNK, EKİZ YALÇINTAN, YILMAZ, YAZICI, ALTINEL temperature reached 8 o C. Internal temperatures of samples were monitored with a Testo 77-T4 data logger equipped with thermocouples placed in the geometric centre of each sample. Cooked samples were cooled in room temperature for 2 h, and then samples were dried with paper towels, and reweighed. Cooking loss (%) was estimated by means of percentage of weight loss of the cooked sample to initial sample weight. Cooked meat samples of Pectoralis major muscle used for measurement of cooking loss were then used to determine shear force value. Four sub-samples (cut parallel to the muscle fibres with a cross section of x cm) were removed from each cooked sample. Shear force values of sub-samples were determined using an Instron Universal Testing Machine (Model 3343) equipped with a Warner Bratzler (WB) shear force apparatus. An average of four sub-samples was accepted to be WB shear force value of that sample. Skin and meat colour measurements were applied at 24 h post mortem. Nine colour measurements were performed from median surface of each sample, and colour coordinate value was determined by calculating average of these nine measurements. Colour was evaluated using the CIELAB colour space. L* (lightness), a* (redness) and b* (yellowness) values were obtained using Minolta CR 4 colorimeter (Minolta Camera Co., Osaka, Japan) with illuminant D65 as the light source. Statistical Analysis In order to determine the effects of age and sex on meat quality characteristics, least-squares procedures were performed using SPSS. statistical package 5. The mathematical model used in the analyses of these characteristics included fixed effects of age (6-8 months or 8-2 months), sex (male or female) and age sex interaction. RESULTS The effects of age and sex on breast skin colour and meat quality characteristics are presented in Table. Least squares means for breast meat quality characteristics were for ultimate ph, % for WHC, % for drip loss, % for cooking loss and kg/cm 2 for WB shear force depending on the age and sex subgroups. The range of least squares means for colour variables of breast meat were determined for lightness (L*), for redness coordinate (a*), and for yellowness coordinate (b*). Colour variables of breast skin were for L*, for a* and for b* parameter. The effect of age of geese on skin colour and meat quality characteristics of breast were not significant (P>.5). Sex of geese significantly influenced ultimate meat ph (P<.5) and redness coordinate value (P<.) for Pectoralis major muscle. Ultimate meat ph for breast muscle was lower in male geese compared with female ones. Breast meat samples obtained from male geese had higher redness means than those of female geese. On the other hand, the effect of sex on WHC, drip loss, cooking Table. Least square means and significance levels for meat quality characteristics of Pectoralis major muscle and breast skin colour variables in Turkish native geese Tablo. Türk yerli kazlarında Pectoralis major kasının et kalitesi özellikleri ile göğüs derisinin renk değişkenlerine ilişkin minimum kareler ortalamaları ve önem kontrolleri Variable 6-8 months (n= 22) Age (A) 8-2 months (n= 2) Male (n= 2) Sex (S) Female (n= 2) Pooled SEM Significance A S A S Ultimate ph NS * NS WHC, % NS NS NS Drip loss, % NS NS NS Cooking loss, % NS NS NS WB shear force, kg/cm NS NS NS Meat colour Lightness (L*) NS NS NS Redness (a*) NS ** * Yellowness (b*) NS NS NS Skin colour Lightness (L*) NS NS NS Redness (a*) NS NS NS Yellowness (b*) NS NS NS * P<.5, ** P<.; NS: not significant (P>.5)

135 82 Effects of Age and Sex on Meat... loss, WB shear force, skin colour variables and lightness and yellowness of breast were not significant. Mean ultimate ph of thigh meat found for age and sex subgroups varied from 5.96 to 6.4 (Table 2). The ranges of mean WHC and drip loss were % and %, respectively. The ranges of mean values for colour variables of thigh meat were for lightness, for redness and for yellowness. of non significant gender effect on ultimate ph for leg muscle was also reported by numerous authors 7. Ultimate ph results for breast muscle, which varied from 5.74 to 5.88, found in the current study were in accordance with previous findings of for broiler chicken 24,26-28, 5.77 for chicken raised in free-range conditions 29, 5.7 for turkeys 3, 5.95 for ducks 3, for native chicken species 32 and for Polish geese 33. Table 2. Least squares means and significance levels for meat quality characteristics of Peroneus longus muscle and thigh skin colour variables in Turkish native geese Tablo 2. Türk yerli kazlarında Peroneus longus kasının et kalitesi özellikleri ile but derisinin renk değişkenlerine ilişkin minimum kareler ortalamaları ve önem kontrolleri Variable 6-8 months (n= 22) Age (A) 8-2 months (n= 2) Male (n= 2) Sex (S) Female (n= 2) Pooled SEM Significance A S A S Ultimate ph NS NS NS WHC, % NS NS NS Drip loss, % NS NS NS Meat colour Lightness (L*) NS NS NS Redness (a*) NS NS NS Yellowness (b*) NS NS NS Skin colour Lightness (L*) NS NS NS Redness (a*) NS NS NS Yellowness (b*) NS * NS * P<.5, NS: not significant (P>.5) DISCUSSION The ultimate meat ph has great importance in evaluation of meat quality, since it may directly affect quality characteristics, such as water holding capacity, cooking loss, texture and colour 9. In the current study, the effect of geese age on ultimate meat ph was not significant for both breast and thigh meat. Similar to the current result, non-significant age effect on ultimate meat ph was also reported for chicken 6 and duck 7. Hovewer, Abdullah et al. 8 found higher ultimate ph in younger broilers than older ones, and they noted that ultimate meat ph in poultry tended to decrease with an increasing age at slaughter. In the current study, male geese had lower ultimate ph than those of female geese for breast muscle (P<.5), but such a difference was not observed for thigh muscle. In the previous studies, significant differences between poultry groups in terms of breast meat ultimate ph were explained by differences in glycogen reserves at slaughter 9,2, responses to preslaughter stress 2, and slaughter weight 22,23. In contrast to the current result, Musa et al. 24 and Kaynak et al. 25 found non significant difference between male and female chickens in terms of ultimate ph of breast muscle. On the other hand, the result However, Genchev et al. 34 reported higher ultimate ph (6.7) for Japanese quails compared with current study, which might be attributed to the difference in species of poultry. The ultimate ph results of geese thigh meat found in the current study (between 5.96 to 6.4 depending on age and sex) were similar to the reports of by Castellini et al. 35 for organic broilers and 6.4 by Debut et al. 23 for broiler chicken, but lower than the reported value of 6.2 for broilers 36. At the point of purchase of meat at market, a number of factors including price, sensory quality, product safety and nutritional quality are taken into consideration by consumer. Although appearance and colour are the most important quality characteristics at selection of product, consumer judgements may also be influenced by any negative quality attributes such as excessive leakage of fluid into the pack 8. In the current study, the effects of age and sex on WHC and drip loss were not significant for both breast and thigh muscles. Non significant age effects on WHC or drip loss were also reported for chicken meat 8,37. However, Anadón 38 reported linear decrease in breast WHC with increasing age. Supporting the current study, the differences in WHC between male and female birds were reported to be not significant for duck meat 39,4

136 82 KIRMIZIBAYRAK, ÖNK, EKİZ YALÇINTAN, YILMAZ, YAZICI, ALTINEL and for chicken meat 8,24. Mean WHC of breast meat, which varied from 5.97 to 6.68 depending on age and sex of geese, found in the current study were higher than those reported for duck 7,39 and for chicken 24, but lower than reports for broiler meat 8. The differences between current study and reports mentioned above in terms of WHC might be attributed to the differences in the methods used to determine WHC or differences in poultry species. In the current study, cooking loss value of breast meat was not influenced by age and sex of geese. Similar findings were also reported in previous studies for influence of age on cooking loss value of broiler breast 8, and effect of sex on cooking loss in broiler chicken 27,4. On the other hand, mean cooking loss values obtained in the current study (between %) were similar with previous reports for duck 4 and for chicken 4. However, current results for cooking loss value were higher than reports of Owens and Sams 42 for turkey breast meat and reports of De Marchi et al. 27 and Karlsson et al. 37 for chicken breast meat; and lower than reports of % by Castellini et al. 35 for chicken. According to Kadim et al. 43, the differences in cooking loss results between several researches might be attributed to differences in cooking temperature and duration, ultimate ph and muscle used. Tenderness level of meat samples influence the appreciation of consumer during the eating phase. In the current study, age and sex had no significant influence on Warner Bratzler shear force values. Various authors also reported non significant differences in instrumental meat tenderness due to sex in broiler chicken 25,27,44 and in duck 7,4 or due to age in chicken 27 and in duck 7. WB shear force values found for breast muscle (between 3.2 and 3.25) in the current study were in accordance with reports of Jassim et al. 7 and Omojola 4 for duck breast, reports of Castellini et al. 35 for broilers raised in organic system. However, most of WB shear force values reported for broiler chickens 25,27,4,44,45 were lower than current results. According to the reports of Shackelford et al. 46 meat samples having Warner Bratzler shear force values exceeding 5.5 kg would be evaluated as tough by a trained sensory panel and by consumers. Moreover, Bickerstaffe et al. 47 noted that shear force values of cooked meat samples accurately reflects the consumer perception of tenderness, and meat samples classified as very tender by consumers had mean shear force value of 5. kg. In the current study, WB shear force values found for geese breast muscles were quite lower than levels specified in above references. Hence, meat of Turkish native geese might be considered to be very tender meat. The colour of meat is used to judge the freshness and quality of meat by consumers at the point of purchase at market 8. In the current study, there were no significant differences in lightness (L*) values of breast and thigh meat due to sex and age at slaughter. Similar to the current study, non significant age effect on meat lightness values were also reported for broiler meat 27,35,37. However, Abdullah et al. 8 observed lower L* value in broiler chickens slaughtered at 32 days than those of chickens slaughtered at 42 days, and they explained this difference by lower ultimate ph of birds slaughtered at 42 days. Similar meat lightness levels in younger and older geese in the current study might be the consequence of similar ultimate ph in these groups. Supporting the current result, similar L* value in male and female birds were reported by numerous authors for chicken 27,4 and for quail 48. On the other hand, meat lightness values of the current study ( for breast meat, for thigh meat) were comparable with previous reports for geese meat 33,49. The effect of age had no significant influence on meat redness for both breast and thigh muscle. On the other hand, the effects of sex on meat redness were significant in breast muscle (P<.), but not in thigh muscle (P>.5). In the current study, a lower meat redness in breast meat of female geese may be attributed to their higher ultimate ph. Supporting this result, Saláková et al. 5 also reported significant influence of meat ultimate ph on meat redness. The redness values found in the current study ( for breast meat, for thigh meat) were lower than those reported by Okruszek et al. 33 for Polish geese and by Fernandez et al. 49 for French Landes grey breed. This difference indicate darker meat colour in Polish geese and French Landes grey breeds, and might be explained by difference in breed of geese, slaughter age and feeding system between studies. In the current study, yellowness coordinate values (b*) was not influenced by age and sex of geese. Similar findings were also found for broiler chicken 8,25,27. Current results for b* coordinate values were similar with previous reports for Polish geese 33. Colour of skin has a great importance in the acceptance of meat by consumers at the point of purchase at market when poultry is sold with skin 5. In the current study, effects of age and sex of geese on colour variables (L*, a* and b*) of breast and thigh skin were not significant (P>.5), except effect of sex on yellowness of thigh skin (P<.5). Thigh skin of female geese had more yellow colour than that of male geese. Supporting the current result, Sirri et al. 52 found significant difference between male and female chickens in thigh skin colour, which was higher in females than males. Totosaus et al. 5 noted that chicken breast meat could be divided into three colour cathegory according to their instrumental L* values: dark meat (L*<47), normal meat (L*=47 to 5) and pale (L*>5). In the previous studies conducted with broiler chickens, instrumental colour variables of normal coloured (not pale and not dark) meats were reported about 48-5 for lightness, 2-3 for redness and 3-7 for yellowness 26,27,4,44. Colour characteristics of normal coloured turkey breast meats in the literature were about for lightness, 4-5 for redness and 2-3

137 822 Effects of Age and Sex on Meat... for yellowness 42,53,54. Results of the current study indicate that colour characteristics of geese meat are apparently different from those of turkey and chicken meat, having more red colour compared with turkey and chicken. This could be attributed to higher red myofibre composition of geese meat (8% red and 2% white myofibres by Rémignon 55 ). On the other hand, meat colour characteristics (particularly redness value) of Turkish native geese were very similar to the results of suckling goat kids 56, goat kids fattened for 56 days after weaning 57,58 and Kıvırcık lambs slaughtered at 3 kg live weight 59. The Warner Bratzler shear force results of Turkish native geese (between kg/cm 2 ) shows that geese breast meat can be classified as very tender. The Warner Bratzler shear force results in the current study were lower than the results reported by several researchers for lamb meat 3,59,6 as kg/cm 2 and for goat kid meat 56,58 as kg/cm 2 in Turkey. These results indicate that geese meat, having similar meat colour to, and being more tender than lamb and goat kid meat, can be an alternative meat source for consumers avoiding consumption of red meat of ruminants. REFERENCES. Szalay IT: Old poultry breeds of the Carpathian basin: Traditional and alternative approaches to their consevation. hu/webset_downloads/526/szalay_paper_old%2hungarian%2 poultry.pdf, Accessed: TÜİK: Hayvancılık istatistikleri. Accessed: Kırmızıbayrak T: Kars ilindeki kaz yetiştiriciliği ve ekonomik önemi. Çiftlik Derg, 26, 62-64, Kırmızıbayrak T: Kars ilinde halk elinde yetiştirilen yerli ırk kazların kesim ve karkas özellikleri. Turk J Vet Anim Sci, 26, , Tilki M, Saatcı M, Kırmızıbayrak T, Aksoy AR: Kars ili Boğazköy de yetiştirilen kazların kesim ve karkas özellikleri. Kafkas Univ Vet Fak Derg, (2): 43-46, Tilki M, Şahin T, Sarı M, Işık S, Saatcı M: Effect of age and sex on fattening performance and carcass characteristics of native Turkish geese. Kafkas Univ Vet Fak Derg, 5 (2): , Warris PD: Meat science: An introductory text. pp. -4, CABI Publishing, New York, Mead GC: Meat quality and consumer requirements. In Mead GC (Ed): Poultry Meat Processing and Quality. pp.-8, CRC Press, Cambridge, Berri C: Breeding and quality of poultry. In, Mead GC (Ed): Poultry Meat Processing and Quality. pp. 2-33, CRC Press, Cambridge, 24.. McKee L: Poultry quality. In Nollet LML (Ed): Handbook of Meat, Poultry and Seafood Quality. pp , Blackwell Publishing, Oxford, 27.. Honikel KO: Reference methods for the assessment of physical characteristics of meat. Meat Sci, 49 (4): , Beriain MJ, Horcada A, Purroy A, Lizaso G, Chasco J, Mendizabal JA: Characteristics of Lacha and Rasa Aragonesa lambs slaughtered at three weights. J Anim Sci, 78, , Ekiz B, Yilmaz A, Ozcan M, Kaptan M, Hanoglu H, Erdogan I, Yalcintan H: Carcass measurements and meat quality characteristics of Turkish Merino, Ramlic, Kivircik, Chios and Imroz lambs raised under an intensive production system. Meat Sci, 82, 64-7, Woelfel RL, Sams AR: Marination performance of pale broiler breast meat. Poult Sci, 8, , SPSS: Statistical package for the social science, Release. SPSS Inc. II, USA, Chicago, Lichovníkova M, Jandasek J, Juzl M, Drackova E: The meat quality of layer males from free range in comparison with fast growing chickens. Czech J Anim Sci,, , Jassim JM, Riyad KM, Majid HA, Yanzhang G: Evaluation of physical and chemical characteristics of male and female ducks carcasses at different ages. Pak J Nut, (2):82-89, Abdullah YA, Marwan MM, Haitham OM, Sulaiman KM, Majdi AAI: Effects of strain on performance, and age at slaughter and duration of post-chilling aging on meat quality traits of broiler. Asian-Aust J Anim Sci, 23 (2): , Komiyama CM, Mendes AA, Takahashi SE, Moreira J, Garcia RG, Sanfelice C, Borba HS, Leonel FR, Almeida Pa ICL, Balog A: Chicken meat quality as a function of fasting period and water spray. Brazilian J Poult Sci, (3):79-83, Berri C, Debut M, Sante-Lhoutellier V, Arnould C, Boutten B, Sellier N, Baeaz E, Jehl N, Jego Y, Duclos MJ, Le Bihan-Duval E: Variation in chicken breast meat quality: Implications of struggle and muscle glycogen content at death. Br Poult Sci, 46 (5): , Debut M, Berri C, Baeza E, Sellier N, Arnould C, Guemene D, Jehl N, Boutten B, Jego Y, Beaumont C, Le Bihan-Duval E: Variation of chicken technological meat quality in relation to genotype and preslaughter stress conditions. Poult Sci, 82, , Abdullah AY, Matarneh SK: Broiler performance and the effects of carcass weight, broiler sex, and postchill carcass aging duration on breast filet quality characteristics. J Appl Poult Res, 9, 46-58, Bianchi M, Petracci M, Sirri F, Folegatti E, Franchini A, Meluzzi A: The influence of the season and market class of broiler chickens on breast meat quality traits. Poult Sci, 86, , Musa HH, Chen GH, Cheng JH, Shuiep, Bao WB: Breed and sex effect on meat quality of chicken. Int J Poult Sci, 5 (6): , Kaynak İ, Güneş H, Koçak Ö: Yerleşim sıklığının broiler performansına etkisi. İstanbul Üniv Vet Fak Derg, 36 (): 9-9, Fletcher DL: Broiler breast meat colour variation, ph, and texture. Poult Sci, 78, , De Marchi M, Cassandro M, Lunardi E, Baldan G, Siegel PB: Carcass characteristics and qualitative meat traits of the Padovana breed of chicken. Int J Poultry Sci, 4 (49): , Van Laack RIJM, Liu CH, Smith MO, Loveday HD: Characteristic of pale, soft, exudative broiler breast meat. Poult Sci, 79, 57-6, Brown SN, Nute GR, Baker A, Hughes SI, Warris PD: Aspects of meat and eating quality of broiler chickens reared under standard, maize-fed, free-range or organic systems. Br Poult Sci, 49, 8-24, Werner C, Janisch S, Kuembet U, Wicke M: Comparative study of the quality of broiler and turkey meat. Br Poult Sci, 5 (3): , Ali MS, Yang HS, Jeong JY, Moon SH, Hwang YH, Park GB, Joo ST: Quality of duck breast and leg meat after chilling carcasses in water at, or 2ºC. Asian-Aust J Anim Sci, 2 (2): 895-9, Jaturasitha S, Srikanchai T, Kreuzer M, Wicke M: Differences in carcass and meat characteristics between chicken indigenous to northern Thailand (Black-Boned and Thai Native) and imported extensive breeds (Bresse and Rhode Island Red). Poult Sci, 87, 6-69, Okruszek A, Ksiazkiewicz J, Woloszyn J, Haraf G, Orkusz A, Szukalski G: Changes in selected physicochemical parameters of breast muscles of geese from Polish conservation flocks depending on duration of the post slaughter period. Arch Tierz, 5 (3): , Genchev A, Mihaylova G, Ribarski S, Pavlov A, Kabakchiev M: Meat quality and composition in Japanese quails. Trakia J Sci, 6 (4): 72-82, Castellini C, Mugnai C, Dal Bosco A: Effect of organic production

138 823 KIRMIZIBAYRAK, ÖNK, EKİZ YALÇINTAN, YILMAZ, YAZICI, ALTINEL system on broiler carcass and meat quality. Meat Sci, 6, , Karakaya M, Parlat SS, Yılmaz MT, Yıldırım I, Ozalp B: Growth performance and quality properties of meat from broiler chickens reared under different monochromatic light sources. Br Poult Sci, 5 (): 76-82, Karlsson AH, Horsted K, Dufek A: Male chicken thigh meat quality from fast and slow growing breeds from an organic free-range system. Conference of Meat Science and Technology, Copenhagen, 29. [http:// orgprints.org/6342/], Accessed: Anadón HLS: Biological, nutritional, and processing factors affecting breast meat quality of broilers. PhD thesis, Faculty of Virginia Polytechnic Institute and State University, Blacksburg, Virginia, Wawro K, Wilkiewicz-Wawro E, Katarzyna K, Brzozowski W: Slaughter value and meat quality of Muscovy ducks, Pekin ducks and their crossbreeds, and evaluation of the heterozis effect. Arc Tierz Dummerstorf, 47 (3): , Omojola AB: Carcass and organoleptic characteristics of duck meat as influenced by breed and sex. Int J Poult Sci, 6 (5): , Fanatico AC, Cavitt LC, Pillai PB, Emmert JL, Owens CM: Evaluation of slower-growing broiler genotypes grown with and without outdoor access: Meat quality. Poult Sci, 84, , Owens CM, Sams AR: The influence of transportation on turkey meat quality. Poult Sci, 79 (8): 24-27, Kadim IT, Mahgoub O, Al-Ajmi DS, Al-Maqbaly RS, Al-Saqri NM, Ritchie A: An evaluation of the growth, carcass and meat quality characteristics of Omani goat breeds. Meat Sci, 66 (): 23-2, Cavitt LC, Meullenet JF, Gandhapuneni RK, Youm GW, Owens CM: Rigor development and meat quality of large and small broilers and the use of Allo-Kramer shear, needle puncture, and razor blade shear to measure texture. Poult Sci, 84 (): 3-8, Rizzi C, Marangon A, Chiericato GM: Effect of genotype on slaughtering performance and meat physical and sensory characteristics of organic laying hens. Poult Sci, 86, 28-35, Shackelford SD, Morgan JB, Cross HR, Savell JM: Identification of threshold levels for Warner-Bratzler shear force in beef top loin steaks. J Muscle Foods, 2, , Bickerstaffe R, Bekhit AED, Robertson LJ, Roberts N, Geesink GH: Impact of introducing specifications on the tenderness of retail meat. Meat Sci, 59, 33-35, Genchev A, Ribarski S, Zhelyazkov G: Physicochemical and technological properties of Japanese quail meat. Trakia J Sci, 8 (4): 86-94, Fernandez X, Lahirigoyen E, Auvergne A, Molette C, Bouillier- Oudet M: The effects of stunning methods on product qualities in forcefed ducks and geese.. Carcass downgrading and meat quality. Animal, 4, 28-38, Saláková A, Straková E, Válková V, Buchtová H, Steinhauserová I: Quality indicators of chicken broiler raw and cooked meat depending on their sex. Acta Vet Brno, 78, , Totosaus A, Pèrez-Chabela MI, Guerrero I: Color of fresh and frozen poultry. In, Nollet LML (Ed): Handbook of Meat, Poultry and Seafood Quality. pp , Blackwell Publishing, Oxford, Sirri F, Petracci M, Bianchi M, Meluzzi A: Survey of skin pigmentation of yellow-skinned broiler chickens. Poult Sci, 89, , Owens CM, Matthews NS, Sams AR: The use of halothane gas to identify turkeys prone to developing pale, exudative meat when transported before slaughter. Poult Sci, 79, , Northcutt JK, Buhr RJ, Young LL: Influence of preslaughter stunning on turkey breast muscle quality. Poult Sci, 77, , Rémignon H: Production of turkeys, geese, ducks and game birds. In, Mead GC (Ed): Poultry Meat Processing and Quality. pp. 2-23, CRC Press, Cambridge, Ekiz B, Özcan M, Yılmaz A, Tölü C, Savaş T: Carcass measurements and meat quality characteristics of dairy suckling kids compared to an indigenous genotype. Meat Sci, 85, , Yılmaz A, Ekiz B, Özcan M, Kaptan C, Hanoğlu H, Yıldırır M: Effects of crossbreeding indigenous Hair Goat with Saanen on carcass measurements and meat quality of kids under an intensive production system. Anim Sci J, 8, , Yalçıntan H, Ekiz B, Özcan M: Türk Saanen i, Gökçeada, Malta ve Kıl keçisi oğlakların besi, karkas ve et kalitesi özelliklerinin karşılaştırmalı olarak incelenmesi. Ulusal Keçicilik Kongresi, s , Çanakkale, Haziran, Ekiz B, Yılmaz A, Özcan M, Koçak Ö, Yalçıntan H, Altınel A: Carcass and Meat Quality Traits of Kivircik Lambs Raised in Different Lamb Production Systems, 6th Joint Scientific Symposium of the Veterinary Faculties of T.C. Istanbul Universitesi and Ludwig-Maximilians Universitat München, 86, - April, Munich, Germany, Ekiz B, Ergül Ekiz E, Koçak Ö, Yalçıntan H, Yılmaz A: Effect of preslaughter management regarding transportation and length of lairage duration on certain welfare parameters, carcass and meat quality characteristics in Kıvırcık lambs. Scientific Symposium Days of the Veterinary Faculties of Sarajevo University and Istanbul University, April 4-7, Sarajevo, Bosna-Hersek, 2.

139 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Fluoride Levels of Drinking Water in Bitlis Province (Turkey) [] Tahir KAHRAMAN * Süleyman ALEMDAR ** Mustafa ALİŞARLI *** Sema AĞAOĞLU ** [] * ** *** This study was supported by the Scientific Research Project Directory of the University of Yuzuncu Yil (Project No. 26-MYO-B32) Pendik Veterinary Control and Research Institute, Pharmacology and Veterinary Drug Residue Laboratories, TR-3489 Pendik/İstanbul - TÜRKİYE Faculty of Veterinary Medicine, Yuzuncu Yil University, Department of Food Hygiene and Technology, TR-6585 Van - TÜRKİYE Faculty of Veterinary Medicine, Ondokuz Mayis University, Department of Food Hygiene and Technology, TR-5539 Samsun - TÜRKİYE Makale Kodu (Article Code): KVFD Summary In the present study, fluoride levels of drinking water from the province of Bitlis and its towns (Adilcevaz, Ahlat, Güroymak, Hizan and Tatvan) were investigated. A total of 64 water samples, collected from tanks or tap in autumn (November 26) and spring (May 27) were used as material. The fluoride levels were measured by Orion model 72A potentiometer, using an ion-selective electrode. The fluoride values in drinking water samples obtained from tanks and tap were found to be.36±.5 and.35±.3 ppm respectively. These values were the highest in Ahlat (.75±.4 ppm), and the lowest in the center of Bitlis (.±. ppm). Fluoride levels were determined below.5 ppm in the 62% of water samples, and below.5 ppm in all water samples. The effect of season on the fluoride levels were found to be statistically insignificant (P>.5), while the effect of residential areas were significant (P<.5). As a result, it was demonstrated that the fluoride levels investigated in all water samples were within standard ranges, which poses no risk for fluoride toxication in the province of Bitlis. Keywords: Drinking water, Fluoride level, Public health, Bitlis Özet Bitlis İli İçme Sularında Florür Düzeyleri Bu çalışmada, Bitlis ve ilçeleri (Adilcevaz, Ahlat, Güroymak, Hizan ve Tatvan) içme sularında florür düzeyleri araştırıldı. Çalışma materyalini, sonbahar (Kasım 26) ve ilkbahar (Mayıs 27) mevsimlerinde depo ve musluk sularından alınan toplam 64 örnek oluşturdu. Örneklerde florür düzeyi Orion 72A model potansiyometrede flor seçici elektrot ile ölçüldü. İncelenen depo ve musluk suyu örneklerinde florür düzeyleri sırasıyla.36±.5 ve.35±.3 ppm olarak tespit edildi. Bu değerler Ahlat ilçesinde en yüksek (.75±.4 ppm), Bitlis merkezde en düşük (.±. ppm) seviyede belirlendi. Florür düzeyi örneklerin %62 sinde.5 ppm in, tümünde ise.5 ppm in altında saptandı. Florür düzeyi üzerine mevsimin etkisi önemsiz (P>.5), yerleşim yerlerinin etkisi ise istatistiksel olarak önemli (P<.5) bulundu. Sonuç olarak, örneklerde belirlenen florür düzeylerinin standart değerlere uygun bulunması, Bitlis bölgesi içme sularının florür toksikasyonu açısından risk oluşturmadığını gösterdi. Anahtar sözcükler: İçme suyu, Florür düzeyi, Halk sağlığı, Bitlis INTRODUCTION Fluoride can be found in small amounts as a compound in all natural waters. Even though it is generally found in higher amounts in underground waters than surface waters, its amount is quite variable. Geographical location, the structure of rocks and the presence of fluoride containing minerals are main factors contributing to this situation. Fluoride levels are quite high in water resources in volcanic and industrial regions. In these regions, the amount of fluoride can rise up to 3-5 mg/l 2,3. İletişim (Correspondence)

140 826 Fluoride Levels of Drinking... Drinking water is important fluoride resource for living beings. According to international and national standards the amount of fluoride in drinking water must be between.5-.5 mg/l. When the concentration of fluoride drops to less than.5 mg/l, it causes important disorders in teeth and bone metabolism. If it rises up to 2. mg/l and more, it causes fluorosis 3-5. Fluorosis is an important health problem for human and animals. Two forms of fluorosis occur; acute and chronic. In typical chronic fluorosis, loss of appetite, deformation of bones and joints, deformation in long bones, loss of teeth, permanent color changes in teeth (light yellow, greenbrown, black dots and horizontal lines) and deformations occur,6. Ruminants such as cattle, sheep, and goat are susceptible to fluorosis. Chronic fluorosis, beside its health risks, is especially important economically due to reduction in meat and milk production 7,8. In many countries including Turkey, endemic chronic fluorosis cases related to drinking water are seen 9. Ritle Valley in the Eastern Africa, Sudan, Etyopia, Uganda, Kenya, and Tanzania are the main geographical areas where endemic chronic fluorosis is an important health problem. In Turkey, it is seen frequently in Isparta (Kandak River and surroundings), Ağrı (Doğubeyazıt), Kırşehir (Kaman and Kırkpınar), Nevşehir (Ürgüp, Avanos and Hacıbektaş), Kayseri (İncesu), Eskişehir (Beylikahır), and Uşak (Eşme) regions 3,. Daily amount of fluoride required for human varies according to age; typically, it is about.5-4. mg for adults. This amount is supplied from resources such as food and tooth care products as well as drinking water. For this purpose, while water with low amounts of fluoride is suplemented with fluoride, water with high luoride is distilled by reverse osmosis and ion exchange processes 6. At present,.7-. ppm fluoride is added into drinking waters in many countries. About 5-7% reduction has been reported in tooth decay cases in societies consuming fluorinated water 2. According to the Centers for Disease Control and Prevention (CDC), about 45 million people in 6 countries and 2/3 of the population in the USA use fluorinated water in order to protect their tooth health 3. In this study, fluoride levels of drinking water were determined and evaluated in terms of public health in the province of Bitlis, which is located in a volcanic zone. MATERIAL and METHODS A total of 64 samples collected from tank and tap waters in and around the province of Bitlis were used as research material. Sample size and sampling strategies were determined according to population distribution and standard methods. Water samples were collected periodically from different locations shown as in Table during autumn (November 26) and spring (May 27). Samples were transferred to the laboratory in polyethylene bottles and kept at 4 C until analysis. Fluoride levels in the samples were measured with an Orion 72A model potentiometer using a fluoride selective electrode (Orion 96 9 BN) 4,5. Standard fluoride solutions of 9 ppm (x -2 mol/l), 9 ppm (x -3 mol/l),.9 ppm (x -4 mol/l),.9 ppm (x -5 mol/l) and.9 ppm (x -6 mol/l) were prepared from. molar sodium fluoride standard stock solution (Orion 9496), and.,.2,.3,.4,.5,.,.5, 2. and 5. ppm standard solutions were prepared by dilution ppm sodium solution was added an equal volume of TISAB II (Total Ionic Strength Adjustment Buffer, Orion 9499) and mixed using a magnetic stirrer. Values in mv were read with an ionometer. These values were used to draw calibration curve. The same procedure was repeated for the water samples with a combined fluoride electrode. Using a Minitab program, the mv values of samples were plotted on the calibration curves of standard solutions out of which fluoride levels (ppm) were calculated with a sensitivity of. ppm. The results were evaluated by three way variance analysis. The significance of the difference between means of groups was determined by Duncan test. Statistical analysis was performed using SAS version 6 6. Table. Numerical distribution of water samples collected in Bitlis district Tablo. Bitlis ili içme sularından alınan örneklerin sayısal dağılımı Season Source Bitlis Adilcevaz Ahlat Güroymak Hizan Tatvan Total Tank Spring Tap Total Tank Autumn Tap Total General Total

141 827 KAHRAMAN, ALEMDAR ALİŞARLI, AĞAOĞLU RESULTS Fluoride levels determined in drinking water in the province of Bitlis are given in Table 2. Seasonal distribution of fluoride levels is shown in Table 3 and numerical distribution is given in Table 4. Fig. shows seasonal distribution of mean fluoride levels. The mean fluoride level in analysed water samples were found to be.35±.3 ppm which was higher in autumn. The highest fluoride level was detected in Ahlat (.75±.4 ppm). Fluoride levels were below the limit of measurement in tank waters (autumn) in Hizan. Table 2. Fluoride levels in drinking waters in Bitlis district (ppm) Tablo 2. Bitlis ili içme sularında tespit edilen florür düzeyleri (ppm) Source Bitlis Adilcevaz Ahlat Güroymak Hizan Tatvan Total Tank X±Sx Min-Max.± ± ± ± ± ± ± Tap X±Sx Min-Max.2± ± ± ± ± ± ± Total X±Sx Min-Max.±.c.-.3.5±.2b ±.4a ±.2b ±.c ±.7b ± Differences between mean values with different letters are significant (P<.5) Table 3. Seasonal distribution of fluoride levels in drinking waters in Bitlis district (ppm) Tablo 3. Bitlis ili içme sularında tespit edilen florür düzeylerinin mevsimsel dağılımı (ppm) Season Source Bitlis Adilcevaz Ahlat Güroymak Hizan Tatvan Total Tank X±Sx Min-Max.± ± ± ± ± ± ± Spring Tap X±Sx Min-Max.2± ± ± ± ± ± ± Total X±Sx Min-Max.2± ± ± ± ± ± ± Tank X±Sx Min-Max.2± ± ± ± ND.7± ±..-.5 Autumn Tap X±Sx Min-Max.± ± ± ± ± ± ± Total X±Sx Min-Max.± ± ± ± Differences between seasons are insignificant (P>.5), ND: Not detected (below the level of measurement).± ± ± Table 4. Numerical distribution of fluoride levels in drinking waters in Bitlis district (%) Tablo 4. Bitlis ili içme sularında tespit edilen florür düzeylerinin sayısal dağılımı (%) ppm.5-. ppm.-<.5 ppm Source Tank Tap Tank Tap Tank Tap %(n /n) %(n /n) %(n /n) %(n /n) %(n /n) %(n /n) Bitlis (3/3) (29/29) Adilcevaz 4(7/7) (7/7) 59(/7) Ahlat 7(/6) 6(/6) 83(5/6) 94(5/6) Güroymak 5(4/8) 5(6/2) 5(4/8) 5(6/2) Hizan (6/6) (/) Tatvan 56(6/) 65(9/29) 8(2/) 4(4/29) 27(3/) 2(6/29) TOTAL 62%(2/64) 32%(53/64) 6% (9/64) n: number of samples, n : positive sample numbers among n

142 828 Fluoride Levels of Drinking... Fluoride (ppm),9,8,7,6,5,4,3,2, Tank Tap Total (Tank+Tap) Fig. Seasonal distribution of fluoride levels in drinking waters in Bitlis district (ppm) (Left: Spring, Right: Autumn) Şekil. Bitlis ili içme sularında tespit edilen florür düzeylerinin mevsimsel dağılımı (Sol: İlkbahar, Sağ: Sonbahar) Bitlis Adilcevaz Ahlât Guroymak Hizan Tatvan Bitlis Adilcevaz Ahlât Guroymak Hizan Tatvan DISCUSSION Drinking water is the most important source of fluoride which is an important biological element. Determining the levels of fluoride in drinking water is useful in terms of public health 7-9. In the former studies performed in Turkey, fluoride levels in drinking waters were reported as ppm 2, ppm 9,.254 ppm 2 and.74 ppm 22. Ağaoğlu et al. 23, reported.387 and.457 ppm fluoride in the tap water in the city centre and surroundings of the province Van,.25 and.66 ppm in tank waters, respectively. Şener et al. 24, determined between ppm fluoride in three spring water samples in Konya. Furthermore, in bottled waters fluoride levels reported to be lower than optimal values 25,26. In Turkey, natural fluorosis reported regions are either volcanic areas or locations close to fluoride reservoirs. In the studies performed in these regions, the effects of natural fluorosis on animals and public health have been shown Soil composition, volcanic structures, phosphate stones, fluoride reservoirs, fertilizers containing phosphate in agriculture, insecticides used in veterinary field, antihelmintic tablets containing fluoride, aluminium, glass, iron-steel, brick and concrete factories are the risk factors causing fluorosis in environment,28,3-32. In the studies done in the areas close to fluoride reservoirs, average fluoride levels were reported to be 4.8 ppm 28, ppm 33, and.-.23 ppm 34. In this study, fluoride levels were measured as.35±.3 ppm in all analysed samples (n=64). In tank (n=5) and tap (n=5) water, fluoride levels were determined as.36±.5 and.35±.3 ppm, respectively (Table 2). Considering seasonal variations, fluoride levels were.33±.4 ppm in spring and.38±.4 ppm in autumn (Table 3). The effect of seasons was insignificant (P>.5) while the effect of locations was found statistically significant (P<.5). The highest fluoride level was detected in Ahlat and the lowest level in Bitlis (Table 2). The results obtained in this study are higher compared to some other studies 2,22 and lower than some others 9,2. Our results were also partially similar to those reported by Ağaoğlu et al. 23. The difference between the results could be due to seasons, chemical structure of soil, rainfall and interlaboratory differences in method for analysis. According to Turkish Standards Institute 4 and The Ministry of Health 5, the recommended fluoride level is.5 ppm in drinking water. World Health Organization (WHO) suggests.5-.5 ppm fluoride in drinking water in terms of public health concerns 3. Environmental Protection Agency (EPA) stated maximum 4 mg/l fluoride in drinking waters 6. In this study, fluoride levels were less than.5 ppm in 62% of samples (Table 4). A fluoride level between.8-.2 ppm in drinking water has protective effect against tooth decay mg/kg fluoride per day has been indicated for children in terms of tooth health. Taking fluoride more than this amount ( mg/kg/day) poses a risk of fluorosis,2. Protective effect of fluoride is achieved by continuous consumption of this element. Water containing fluoride between.7-. ppm are defined as optimal fluoride water and it is stated that in case of consuming water containing fluoride lower than this amount requires fluoride supplementation,35. For this purpose, sodium fluoride (NaF) tablets, fluoride containing tooth pastes and jells as well as fluoride addition into water are suggested 2,3. In conclusion, the fluoride levels determined in analysed water samples were in the range of normal standards indicating that drinking water in the province of Bitlis does not pose a risk in terms of fluoride toxicosis. However, since it is a volcanic area, possibility of contamination should be taken into account and regular controls should be done in terms of public health. REFERENCES. WHO (World Health Organization): Fluorine and fluorides. IPCS International Programme on Chemical Safety, Environmental Health Criteria 36, World Health Organization, Geneva, 984.

143 829 KAHRAMAN, ALEMDAR ALİŞARLI, AĞAOĞLU 2. Manji F, Kapila S: Fluorides and fluorosis in Kenya. Part, The occurrence of fluorides. Odontostomatol Trop, 9, 5-2, Fawell J, Bailey K, Chilton J, Dahi E, Fewtrell L, Magara Y: Fluoride in Drinking Water. IWA Publishing, London, Türk Standartları Enstitüsü: Sular - İnsani Tüketim Amaçlı Sular. TS 266/Nisan Sağlık Bakanlığı: İnsani tüketim amaçlı sular hakkında yönetmelik. Resmi Gazete, Sayı: 2629, Tarih: EPA (Environmental Protection Agency): Fluoride in Drinking Water: A Scientific Review of EPA s Standards. The National Academies Press, Washington DC, Walton KC: Environmental fluoride and fluorosis in mammals. Mammal Rev, 8 (2): 77-9, Şanlı Y: Metaller ve diğer inorganic maddeler. In, Kaya S (Ed): Veteriner Klinik Toksikoloji. s. 6-28, Medisan, Ankara, Finkelman R, Centeno J, Selinus O: Medical geology: The emergene of a new dicipline. Terrae, 2 (-2): 3-8, 27.. Oruç N: Türkiye de yüksek düzeyde fluorür içeren kaynak suları ve sağlık açısında önemi. I. Tıbbi Jeoloji Sempozyumu, -3 Aralık, Ankara, s. 48-5, 25.. Baysal A: Beslenme. 8. Baskı, Hatiboğlu, Ankara, Ökte Z: Florozis ve diş sağlığı. Tıbbi Jeoloji Sempozyumu, 6-8 Şubat, Ankara, s. 6-8, ADA (American Dental Association): Nature s Way to Prevent Tooth Decay, Water Fluoridation. Accessed: Srinivasan K, Rechnitz AG: Activity measurements with a fluoride selective membrane electrode. Anal Chem, 4, 59-57, Horwitz W: Official Methods of Analysis of the Association of Official Analytical Chemistry. 3th ed., Academic Press, New York, SAS: SAS/STAT User s Guide. Version 6, 4th ed., SAS Institute Inc., Carry, North Carolina, Kashani H, Birkhed D, Petersson LG: Fluoride concentration in the approximal area after using toothpicks and other fluoride-containing products. Eur J Oral Sci, 6, , Kalaycıoğlu L, Serpek B, Nizamlıoğlu M, Başpınar N, Tiftik AM: Biyokimya. 2. Baskı, Nobel Yayın Dağıtım, Ankara, Kayar N, Çelik A: Manisa ili içme sularında florür düzeylerinin iyon seçici elektrod ile saptanması. Ekoloji, 4, 9-, Işıklı B.İ, Kalyoncu C, Metintaş S, Demir TA: Eskişehir yöresinde içme sularında florür düzeyleri. Ekoloji, 36, 28-3, Dodurga HT, Or ME, Kayar A: Kapadokya bölgesi içme suyu kaynaklarında fluor düzeyleri ve bu bölgenin koyunlarında fluorosis ile ilgili semptomların saptanması üzerine araştırmalar. Turk J Vet Anim Sci, 26, Erdoğan S: Hatay bölgesi içme suyu örneklerinde flor düzeyleri. Vet Bil Derg, 8 (-2): 73-76, Ağaoğlu S, Alişarlı M, Alemdar S: Van bölgesi su kaynaklarında flor düzeylerinin belirlenmesi. Yüzüncü Yıl Üniv Vet Fak Derg, 8 (): 59-65, Şener Y, Botsalı MS, Koyutürk AE, Gökalp A: Konya ili sınırlarındaki üç farklı kaynak suyunun florid düzeylerinin araştırılması. Selçuk Üniv Dişhek Fak Derg, 6, 5-7, Ataç A, Kayalıbay H, Altay N: Ankara ilindeki şişe ve musluk sularının flor seviyelerinin spesifik iyon elektrodu yöntemi ile saptanması. Tüm Diş Hek Bir Derg, 24, 2-3, Ertuğrul F, Koparal E: İzmir ilinde içme sularının flor düzeyleri ve ağız-diş sağlığı yönünden önemi. Ege Pediatri Bulteni, 6, -5, Şendil Ç, Bayşu N: İnsan ve hayvanlarda Ağrı ili Doğubeyazıt ilçesi köylerinde görülen flor zehirlenmesi ve bunu Van ili Muradiye ilçesi köylerinde de saptamamızla ilgili ilk tebliğ. Ankara Üniv Vet Fak Derg,, , Fidancı UR, Salmanoğlu B, Maraşlı Ş, Maraşlı N: İç Anadolu bölgesinde doğal ve endüstriyel florozis ve bunun hayvan sağlığı üzerindeki etkileri. Turk J Vet Anim Sci, 22, , Karagül H: Florozis ve hayvan sağlığı. Tıbbi Jeoloji Sempozyumu, 6-8 Şubat, Ankara, s. 9-, Nair KR, Manji F, Gitonga JN: The occurrence and distribution of fluoride in groundwaters of Kenya. East Afr Med J, 6 (7): 53-52, Altıntaş A, Fidancı UV, Sel T, Duru Ö, Başsatan A: Serum proteins electrophoresis and kidney function in sheep with natural and industrial fluorosis. Ankara Üniv Vet Fak Derg, 47 (2): 5-4, Fidancı UR, Sel T: The industrial fluorosis caused by a coal-burning power station and its effects on sheep. Turk J Vet Anim Sci, 25, , Oto G, Turel İ: Muradiye ve Çaldıran yöresinden alınan su ve koyunların kan örneklerindeki flor düzeyine mevsimsel değişimlerin etkisi. Yüzüncü Yıl Üniv Sağ Bil Derg, (-2): 7-22, Özdemir H, Keçeci H: Elazığ-Keban ilçesi Karamağra florit-molibdenit oluşukları çevresindeki su ve toprak örneklerinin flor düzeyleri. Fırat Üniv Sağ Bil Derg, 7 (3): 89-94, Murray JJ, Breckon JA, Reynolds PJ, Tabari ED, Nunn JH: The effect of residence and social class on dental caries experience in 5-6 year-old children living in three towns (natural fluoride, adjusted fluoride and low fluoride) in the North east of England. Br Dent J, 7, , 99.

144 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Yerli Türk Kazlarında Çıkım Ayı ve Cinsiyetin Kesim ve Karkas Özelliklerine Etkisi Muammer TİLKİ * Kemal YAZICI ** Mehmet SARI * Serpil IŞIK * Mustafa SAATCI *** * Kafkas Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı, TR-36 Kars -TÜRKİYE ** Ardahan Üniversitesi Meslek Yüksekokulu, TR-75 Ardahan - TÜRKİYE *** Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı, TR-5 Burdur - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışma, Ardahan da yetiştirilen yerli kazların bazı kesim ve karkas özellikleri ile bu özellikler üzerine yumurtadan çıkım ayının ve cinsiyetin etkisinin belirlenmesi amacıyla yapılmıştır. Araştırma Ardahan ın merkeze bağlı Su Göze (Cincilop) köyünde yapılmış, 52 erkek ve 6 dişi toplam 2 adet kaz kullanılmıştır. Kesimden önce tüm kazlara kanat numarası takılmış ve canlı ağırlıkları kaydedilmiştir. İncelenen tüm kesim ve karkas özelliklerine ait ağırlık değerlerine yumurtadan çıkım ayı ve cinsiyetin etkisi istatistiki olarak oldukça önemli bulunmuştur (P<.). Bütün özellikler için erkek kazlar dişi kazlardan, Nisan ayında çıkan kazlar Haziran ayında çıkan kazlardan daha yüksek bulunmuştur. Bu çalışma sonucunda elde edilen değerlerin, Türkiye de daha önce kazlar üzerinde yapılan birçok çalışma sonuçlarına ait değerlerden daha yüksek olduğu belirlenmiş olup, Ardahan ve çevresinde daha kapsamlı çalışmaların yapılması gerektiği sonucuna varılmıştır. Anahtar sözcükler: Ardahan, Kaz, Çıkım ayı, Cinsiyet, Kesim ve karkas özellikleri Summary Effects of Hatching Month and Sex on Slaughter and Carcass Traits in Native Turkish Geese The present study aimed to determine the properties of slaughter and some carcass traits and the effects of hatching month and sex on these properties. The study was performed in Su Göze (Cincilop) village affiliated to central province of Ardahan. The total of 2 geese consisting of 52 male and 6 female were used in the study. The birds with wing tags were individually weighed prior the study. The effects of hatching month and sex on all slaughter and carcass traits (weight) were found to be statistically significant (P<.). All the features of the male geese were higher than that of female geese. At the same time, all the features of the geese hatched in April were higher than that of hatched in June. The values of geese determined in Ardahan are higher than that of determined in other numerous early studies in Turkey and further detailed studies are necessary in Ardahan and surrounding region. Keywords: Ardahan, Goose, Hatching month, Sex, Slaughter and Carcass traits GİRİŞ Türkiye de kaz yetiştiriciliğine her bölgede rastlamak mümkündür. Bölgesel olarak en yaygın Kuzey Doğu Anadolu, Orta Anadolu, Güney Anadolu, Batı Karadeniz, il bazında ise Ardahan, Kars, Muş ve Erzurum sayılabilir. Türkiye genelinde kaz sayısı toplam adettir. Kars ve Ardahan illerinde toplam kaz sayısı ise adet olup, bu sayı Türkiye kaz varlığının yaklaşık %49.57 sini oluşturmaktadır. Ardahan ve Kars çevresinde halk, enerji ve protein gereksiniminin önemli bir kısmını kaz etinden ve yağından karşılamaktadır. Ardahan ve Kars ta kaz yetiştiriciliği, yerli ve melez kazlarla ve doğal kuluçka yöntemiyle sürdürülmektedir. Köylerde kış aylarında her aile yaklaşık 3-5 adet dişi ve adet erkek kazı damızlık olarak beslemektedir. Erkek kazlar birkaç yıl elde tutulurlar. Civcivler ilk birkaç gün şerbet ve sütle beslenmektedir. Dördüncü günden itibaren İletişim (Correspondence) /3

145 832 Yerli Türk Kazlarında Çıkım Ayı... ise genellikle civciv yemi, doğranmış taze yeşil ot veya ıslatılmış ekmek verilmektedir. Civcivler -2 gün kadar evde tutulmakta, daha sonra uygun havalarda meraya bırakılmaktadırlar. Genellikle Ekim-Aralık aylarında ilk kar yağışından kısa bir süre sonra, elde bulundurulan kazlar kesilir. İhtiyaç duyulan sayıda damızlık kaz bir sonraki yıl için saklanır. Yörede kesilen kazların eti, yağı, karaciğeri, tüyleri, baş, ayak ve bağırsakları değerlendirilmektedir. Kesilen kazlar kesimden sonra bir kısmı taze olarak tüketilirken bir kısmı da sonradan tüketilmek üzere tuzlanır ve kurutulur. Böylece daha uzun süre saklanabilir. Baş ve ayaklar haşlanarak gaga ve derileri soyulduktan, bağırsaklar da temizlendikten sonra pişirilerek tüketilmektedir. Kaz tüyü ise yöre halkı tarafından yastık ve yorgan yapımında kullanılmaktadır 2-7. Kazlarda büyüme, kesim ve karkas özelliklerini çeşitli faktörler etkilemektedir. Bu faktörler arasında ırk/orijin, yaş, cinsiyet, besi yöntemi, besi süresi ve sürü büyüklüğü sayılabilir 8-4. Kazlar üzerinde araştırmalar, Türkiye nin farklı bölgelerinde yapılmakla birlikte daha ziyade Kuzey Doğu Anadolu Bölgesinde, özellikle Kars ve çevresinde yoğunlaşmıştır. Çalışmaların büyük bir kısmı halk elinde yetiştirilen kazların bazı kesim ve karkas özelliklerini belirlemek için yapılmıştır. Sayı bakımından Türkiye de birinci sırada yer alan Ardahan ili ve çevresinde kaz ile ilgili henüz bir çalışmaya rastlanılamamıştır. Bu araştırma ile Ardahan da yetiştirilen yerli kazların bazı kesim ve karkas özellikleri ile bu özellikler üzerine yumurtadan çıkım ayı ve cinsiyetin etkisinin belirlenmesi amacıyla yapılmıştır. MATERYAL ve METOT Çalışma Ardahan ın merkeze bağlı Su Göze (Cincilop) köyünde yapılmıştır. Çalışmada 52 erkek, 6 dişi toplam 2 adet kaz kullanılmıştır. Çıkım ayına göre dağılım ise Nisan ayında çıkan 5 adet kaz, Haziran ayında çıkan 6 adet kaz şeklindedir. Bölgede kaz civcivleri yumurtadan genelde Nisan ayı ve bazen de Haziran ayında çıkmaktadır. Kaz civcivleri yumurtadan çıktıktan sonra meraya hava şartlarına bağlı olarak yaklaşık 2-3 hafta içerisinde çıkarılmaktadır. Çalışmada yetiştiricilerle önceden bağlantı kurulmuş ve kazların çıkım ayı belirlenmiştir. Kesimden önce tüm kazlara kanat numarası takılmış ve canlı ağırlıkları kaydedilmiştir. Kesimler 2-2 Kasım 2 tarihinde yapılmıştır. Karkas ağırlıkları; baş, ayak ve tüyler uzaklaştırıldıktan ve iç organlar çıkarıldıktan sonra tartılarak kaydedilmiştir. Bunun yanı sıra kan, tüy, baş, ayak, kalp, karaciğer, taşlık ve iç + abdominal yağ ağırlıkları da tartılarak kaydedilmiştir. Tartımlar. grama hassas teraziyle yapılmıştır. İncelenen özelliklere yumurtadan çıkım ayı ve cinsiyetin etkisini belirlemek amacıyla SPSS istatistik paket programı yardımıyla En Küçük Kareler Metodundan yararlanılmıştır (SPSS 6.). Bu metoda göre; Y ijk = µ + a i + b j +e ijk denklemi oluşturulmuştur. Modelde; Y ijk : Herhangi bir kazın incelenen verim özelliği değeri, µ: Beklenen ortalama, a i : Cinsiyetin etkisi (i:, 2; Erkek ve Dişi), b j : Çıkım ayının etkisi (j:, 2; Nisan ve Haziran), e ijk : Hata payı. BULGULAR Kesim, sıcak karkas, kan, tüy, baş, ayak, kalp, karaciğer, taşlık ve iç + abdominal yağ ağırlığına cinsiyet ve yumurtadan çıkım ayının etkisi Tablo de gösterilmiştir. İncelenen tüm özelliklere cinsiyet ve yumurtadan çıkım ayının etkisi istatistiki olarak oldukça önemli bulunmuştur (P<.). Bütün özellikler için erkekler dişilerden, Nisan ayında çıkan Tablo. Kazların kesim ve karkas özelliklerine (g) cinsiyet ve çıkım ayının etkisi Table. Effect of hatching month and sex on slaughter and carcass traits (g) of geese Özellikler Kesim Ağırlığı Sıcak Karkas Ağırlığı Kan Ağırlığı Tüy Ağırlığı Baş Ağırlığı Ayak Ağırlığı Kalp Ağırlığı Karaciğer Ağırlığı Taşlık Ağırlığı İç + Abdominal Yağ Ağırlığı X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x Genel Cinsiyet *** *** *** *** *** *** *** *** *** *** Erkek Dişi Ay *** *** *** *** *** *** *** *** *** *** Nisan Haziran *** P<.

146 833 TİLKİ, YAZICI SARI, IŞIK, SAATCI kazlar Haziran ayında çıkan kazlardan daha yüksek bulunmuştur. Ortalama 564 g olarak bulunan kesim ağırlığı erkek kazlar için 66 g, dişi kazlar için 5264 g; Nisan ayında yumurtadan çıkan kazlar için 5878 g, Haziran ayında yumurtadan çıkan kazlar için 542 g olarak belirlenmiştir. Ortalama kalp, karaciğer, taşlık ve iç + abdominal yağ ağırlığı sırasıyla 34.4, 75.5, 9.8 ve g olarak bulunmuştur. Karkas randımanı ile kan, tüy, baş, ayak, kalp, karaciğer, taşlık, iç ve abdominal yağ oranı Tablo 2 de gösterilmiştir. Cinsiyete göre taşlık oranı hariç (P>.5) incelenen diğer tüm özellikler arasındaki farklılıklar istatistiki olarak önemli bulunmuştur (P<.5-.). Çıkım ayına göre ise karkas randımanı ile tüy, baş, kalp ve iç + abdominal yağ oranı arasındaki farklılıklar istatistiki olarak önemli (P<.5-.), diğer özellikler arasındaki farklılıklar ise önemsiz belirlenmiştir (P>.5). Erkek kazlar için belirlenen karkas randımanı dişi kazlar için belirlenenden, Nisan ayında çıkan kazlardan elde edilen karkas randımanı da Haziran ayında çıkan kazlardan elde edilenden daha yüksek tespit edilmiştir. Tablo 2. Kazların kesim ve karkas özelliklerine (%) cinsiyet ve çıkım ayının etkisi Table 2. Effect of hatching month and sex on slaughter and carcass traits (%) of geese Özellikler Karkas Randımanı Kan Oranı Tüy Oranı Baş Oranı Ayak Oranı Kalp Oranı Karaciğer Oranı Taşlık Oranı İç + Abdominal Yağ Oranı X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x X ± S x Genel Cinsiyet *** * *** ** *** ** * - *** Erkek Dişi Ay *** - ** ** - * - - * Nisan Haziran : P>.5, * P<.5, ** P<., *** P<. TARTIŞMA ve SONUÇ Geleneksel aile tipi kaz yetiştiriciliğinde kazların kesim zamanı Ardahan ve Kars illerinde genelde kışın başlangıcında karın ilk yağdığı zamandır. Özellikle bu zamanın seçilmesinde kesilen kazların muhafaza edilmesinin kışın daha kolay olacağı düşüncesi yatmaktadır. Ancak son yıllarda yetiştiricilerin kesilen kaz karkaslarını derin dondurucular temin edip daha erken zamanda kesmeye başladıkları da görülmektedir. Ancak bu son derece sınırlıdır. Çalışma için bu köyün seçilmesinin en önemli nedeni, kaz yetiştiriciliğinin bu köyde oldukça yaygın bir şekilde yapılmasıdır. Çalışmada erkek ve dişi kazların kesim ağırlıkları 66 ve 5264 g, ortalama kesim ağırlığı ise 564 g olarak tespit edilmiştir. Kesim ağırlıkları için bulunan sonuçlar Türkiye de halk elinde yetiştiriciliği yapılan kaz araştırmalarında belirlenen kesim ağırlığı değerlerinden yüksek bulunmuştur 2-4,6,7,5. Ayrıca benzer yaşta kesilen ve entansif bir besi uygulanan Tilki ve İnal ın erkek ve dişi kazlar için 52 ve 4375 g olarak belirlediği kesim ağırlığından da yüksek bir kesim ağırlığı tespit edilmiştir. Yine çalışmada Nisan ayında yumurtadan çıkan kazların kesim ağırlıkları (5878 g), Haziran ayında yumurtadan çıkan kazların kesim ağırlığından (542 g) daha yüksek belirlenmiştir. Bunun nedeni erken yumurtadan çıkan kazların meradan daha iyi ve daha uzun süre faydalanmış olmasından kaynaklanmış olabilir. Çalışmada tespit edilen ortalama kesim ağırlığı değeri Szabone nin 6 Hungavis Combi kazlarında ortalama 6875 g, Cywa-Benko ve ark. nın 7 Koluda Beyazı kazlarında ortalama 6326 g, Lukaszewicz ve ark. nın 8 Koluda Beyazı erkek ve dişi kazlarında 79 ve 632 g olarak belirdikleri değerden düşük bulunmuştur. Ancak genelde ortalama kesim canlı ağırlığı değeri yapılmış olan birçok araştırma sonucundan yüksek belirlenmiştir 9,9,2. Araştırmalar arasındaki farklılıkların bakım, besleme, ırk ve yaş gibi faktörlerden kaynaklandığı düşünülmektedir. Çalışmada sıcak karkas ağırlığı ortalama 47 g olarak belirlenmiştir. Erkek kazların karkas ağırlıkları dişi kazlardan yaklaşık 65 g, Nisan ayında yumurtadan çıkan kazların karkas ağırlıkları da Haziran ayında yumurtadan çıkan kazlardan yaklaşık 5 g yüksek belirlenmiştir. Elde edilen ortalama sıcak karkas ağırlığı değeri bölgede yapılan diğer araştırma sonuçlarına göre daha yüksek bulunmuştur 2,3,6,7,4. Karkas randımanı ortalama %7.86, erkek ve dişi kazlarda %7.88 ve %69.85, Nisan ve Haziran ayında yumur-

147 834 Yerli Türk Kazlarında Çıkım Ayı... tadan çıkan kazlar için %72.3 ve %69.43 olarak belirlenmiştir. Hem erkek kazların karkas randımanının dişi kazlardan yüksek bulunması hem de Nisan ayında yumurtadan çıkan kazların Haziran ayında yumurtadan çıkan kazlardan yüksek bulunması birçok araştırma sonucu ile benzerlik göstermektedir 8,,8,2. Kazlardan elde edilen önemli ürünlerden birisi tüydür. Tüy yörede yetiştiriciler tarafından özellikle yorgan ve yastık yapımında kullanılmaktadır. Çalışmada ortalama tüy ağırlığı 283. g ve tüy oranı da %5.5 olarak belirlenmiştir. Tüy ağırlığı erkek ve Nisan ayında yumurtadan çıkan kazlar lehine önemli iken, oran bakımından dişi kazlar ve Haziran ayında yumurtadan çıkan kazlar lehine önemli bulunmuştur. Bunun nedeni dişi kazların ve Haziran ayında yumurtadan çıkan kazların kesim canlı ağırlıklarının düşük olmasından dolayıdır. Bu sonuçlar literatür bilgilerle benzerlik göstermektedir Ayrıca çalışmada elde edilen tüy ağırlığı ve oranı yapılan bazı araştırma sonuçlarından yüksek 3,7,24 bazılarından ise düşük belirlenmiştir 6,,25. Kazlardan sağlanan diğer önemli bir ürün ise karaciğerdir. Kaz karaciğeri bölgede ve Türkiye de ticari olarak genelde değerlendirilmemektedir. Daha ziyada bireysel yetiştiriciliklerde kesimden hemen sonra bekletilmeden kavrulmakta ve tüketilmektedir. Benzer şekilde taşlıklarda değerlendirilmektedir. Çalışmada ortalama karaciğer ağırlığı 75.5 g, oranı ise %.89 olarak tespit edilmiştir. Taşlık ağırlığı ortalama 9.8 g, oranı ise %4.8 olarak belirlenmiştir. Hem karaciğer ağırlığı hem de taşlık ağırlığı erkek kazlarda dişi kazlardan, Nisan ayında çıkan kazlarda Haziran ayında çıkan kazlardan daha yüksek belirlenmiştir (P<.). Karaciğer ağırlığı ve oranı Türkiye de yapılan birçok araştırma sonucu ile benzer 3,6,,,5, Cave ve ark nın 2 belirlediği orandan düşük, Fortin ve ark. nın 8 belirlediği orandan ise yüksek bulunmuştur. Ortalama iç + abdominal yağ ağırlıkları erkek ve dişi kazlar için 28.8 ve 29. g, Nisan ve Haziran ayında yumurtadan çıkan kazlar için 26.4 ve g olarak tespit edilmiştir. Ortalama iç + abdominal yağ oranı ise %6.24 olarak belirlenmiştir. Bu sonuçlar Aşkın ve İlaslan 2 ile Tilki ve İnal ın yerli kazlarda belirledikleri sonuçlardan düşük bulunmuştur. Bunun yanı sıra iç + abdominal yağ ağırlıkları; Kırmızıbayrak 4, Fortin ve ark. 8, Tilki ve ark., Çelebi 4 ve Saatcı ve ark. nın 26 bildirdikleri değerlerden yüksek, Lukaszewicz ve ark. nın 8 bildirdiği değere benzer, İlaslan ve Aşkın 3 ile Tilki ve ark. nın 5 bildirdikleri değerlerden ise düşük bulunmuştur. Elde edilen kesim ve karkas özelliklerine bakıldığında, Nisan ayında yumurtadan çıkan kazların verim özellikleri, Haziran ayında yumurtadan çıkan kazların verim özelliklerinden yüksek tespit edilmiştir. Buradan, Nisan ayında yumurtadan çıkan kazların merayı daha iyi değerlendirdikleri, Haziran ayında yumurtadan çıkan kazların ise meradan diğer grup kadar faydalanamadıkları anlaşılmaktadır. Ayrıca meranın kompozisyonunda özellikle Mayıs- Haziran aylarında, diğer aylara göre daha iyi olduğu ve Nisan ayında yumurtadan çıkan kazların meradan daha iyi faydalandığı da anlaşılmaktadır. Sonuç olarak, Ardahan da böyle bir çalışmanın ilk kez yapılmış olması ve elde edilen kesim ve karkas ağırlıkları ve diğer parametrelerin daha önce yapılmış araştırma sonuçlarından daha iyi gözükmesi araştırmayı önemli kılmaktadır. Ayrıca araştırma sonucunda Nisan ayında yumurtadan çıkan kazların incelenen verim özellikleri, Haziran ayında yumurtadan çıkan kazlardan yüksek bulunmuştur. Her iki özellikte yani araştırmanın Ardahan da yapılmış olması ve yetiştirici koşullarında çıkım ayının kesim ve karkas özelliklerine etkisinin belirlenmesi bir ilki teşkil etmektedir. Böyle bir araştırma, bundan sonra yapılacak çalışmalara bir temel teşkil edebilecektir. KAYNAKLAR. TUİK: Türkiye İstatistik Kurumu. Erişim tarihi: Aşkın Y, İlaslan M: Kars bölgesi kazlarında ekonomik önemi olan bazı karakterler üzerine araştırmalar. Ankara Üniv Ziraat Fak Yıllığı, 26, , İlaslan M, Aşkın Y: Kars yöresi kazlarında bazı karkas özellikleri üzerinde araştırmalar. Ankara Üniv Ziraat Fak Yıllığı, 27, , Kırmızıbayrak T: Kars ilinde halk elinde yetiştirilen yerli ırk kazların kesim ve karkas özellikleri. Turk J Vet Anim Sci, 26, , Tilki M, İnal Ş: Kaz Yetiştiriciliği. Hay Araşt Derg, 2, 58-62, Tilki M, Saatcı M, Kırmızıbayrak T, Aksoy AR: Kars ili Boğazköy de yetiştirilen kazların kesim ve karkas özellikleri. Kafkas Univ Vet Fak Derg, (2): 43-46, Kırmızıbayrak T, Önk K, Yazıcı K: Kars ilinde serbest çiftlik koşullarında yetiştirilmiş yerli ırk kazların kesim ve karkas özellikleri üzerine yaş ve cinsiyetin etkisi. Kafkas Univ Vet Fak Derg, 7 (): 4-45, Fortin A, Grunder AA, Chambers JR, Hamilton RMG: Live and carcass characteristics of four strains of male and female geese slaughtered at 73, 8, and 94 days of age. Poult Sci, 62, , Grunder AA, Cave NA, Pawluczuk B, Butler G, Poste LM: Influence of breed, finisher diet, age and sex on liveweight and carcass traits of broiler geese. Arch Geflügelk, 55, 48-52, 99.. Tilki M, İnal Ş: Türkiye de yetiştirilen değişik orijinli kazların verim özellikleri. III. Kesim ve karkas özellikleri. Turk J Vet Anim Sci, 28, 65-7, 24.. Tilki M, Saatcı M, Kırmızıbayrak T, Aksoy AR: Effect of age on growth and carcass composition of native Turkish geese. Arch Geflügelk, 69, 77-83, Shi SR, Wang ZY, Zou JM, Yang HM, Jiang N: Effects of dietary threonine on growth performance and carcass traits of Yangzhou geese. Czech J Anim Sci, 55, , Liu BY, Wang ZY, Yang HM, Wang JM, Xu D, Zhang R, Wang Q: Influence of rearing system on growth performance, carcass traits, and meat quality of Yangzhou geese. Poult Sci, 9, , Çelebi Ş: Erzurum da yetiştirilen yerli kazların bazı önemli kesim ve karkas özellikleri üzerine bir araştırma. Uluslararası Hayvancılık 99 Kongresi, İzmir, 58-52, Tilki M, Şahin T, Sarı M, Işık S, Saatcı M: Effect of initial age of fattening and sex on the fattening performance and carcass characteristics in native Turkish geese. Kafkas Univ Vet Fak Derg, 5(2): , Szabone WE: Growing characteristics in dual-purpose hybrid geese.

148 835 TİLKİ, YAZICI SARI, IŞIK, SAATCI The First Vietnamese-Hungarian Workshop on Small Animal Production for the Development of Sustainable Integrated Farming Systems, Chi Miny City, Vietnam, 84-88, Cywa-Benko K, Wezyk S, Krawczyk J, Knapik J, Bielinska H, Rosinski A: The possibility of using usg technique for muscle and fatness testing in geese. 2 th European Symposium on Waterfowl, Adana, Turkey, 9-98, Lukaszewicz E, Adamski M, Kowalczyk A: Correlations between body measurements and tissue composition of oat-fattened White Kołuda geese at 7 th week of age. Br Poult Sci, 49, 2-27, Knizetova H, Hyanek J, Veselsky A: Analysis of growth curves of fowl. III. Geese. Br Poult Sci, 35, , Kirchgeβner M, Jamroz D, Eder K, Pakulska E: Carcass quality and fatty acid composition in growing geese fed various ration. Arch Geflugelk, 6, 9-97, Cave NA, Grunder AA, Butler G, Fortin A, Pawluczuk B: Influence of age, sex and pre-slaughter holding conditions on live weight and carcass traits of broiler geese. Arch Geflugelk, 58, 6-, Kozak J, Monostori K, Acs I: Relations of bodyweight with the qualitative and quantitative characteristics of the feather in Hungarian geese. th European Symposium on Waterfowl, Halle, Germany, , Rosinski A, Tatsuma K, Korman K, Kawada T, Czechlowska T: Effect of genotype and sex on the amount of feather and down in the goose. 2 th European Symposium on Waterfowl, Adana, Turkey, 73-76, Saatcı M: Effects of age, sex, feather colour, body measurements, and body weight on down and feather yield in native Turkish geese. Turk J Vet Anim Sci, 32, , Ristic M, Klein FW, Smaus A: (995) Giblets and offal of geese in dependence of breed and fattening process. th European Symposium on Waterfowl, Halle, Germany, , Saatcı M, Tilki M, Kaya İ, Kırmızıbayrak T: Effects of fattening length, feather colour and sex on some traits in native Turkish geese. II. Carcass traits. Arch Geflügelk, 7, 6-66, 29.

149 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE [] * Etlik Piliç Ebeveynlerinde Kuluçkalık Yumurta Kabuk Renginin Kuluçka Sonuçları, Piliçlerin Performansı, Karkas Özellikleri, İç Organ Ağırlıkları ve Bazı Stres İndikatörlerine Etkisi [] Ahmet ŞEKEROĞLU * Mustafa DUMAN * Bu araştırma Gaziosmanpaşa Üniversitesi Bilimsel Araştırma Projeleri Komisyonu tarafından desteklenmiştir (Proje No: 29/38) Gaziosmanpaşa Üniversitesi Ziraat Fakültesi Zootekni Bölümü, TR-624 Tokat - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışma, etlik piliç ebeveynlerinde yumurta kabuk renginin kuluçka sonuçlarına, piliçlerin performansına, karkas özelliklerine, iç organ ağırlıklarına ve bazı kan parametrelerine etkisinin araştırılması amacıyla yürütülmüştür. Araştırmada kullanılan 8 adet yumurta, kuluçka özelliklerini incelemek için yumurta kabuk rengine göre üç gruba (E<8.; E: ve E>83.5) ayrılmıştır. Denemenin hayvan materyalini kuluçkaya konulan yumurtalardan elde edilen 675 adet etlik civciv oluşturmuştur. Araştırma, dokuz tekerrürlü olacak şekilde düzenlenmiştir. Yumurta kabuk rengi; döllülük oranını (P<.5), çıkış gücünü (P<.5), kuluçka randımanını (P<.5), 7 ve 35. gün (P<.), 4 ve 2. gün canlı ağırlıklarını (P<.5), yumurta kabuk kalınlığını (P<.) ve kan trigliserit düzeyini (P<.) önemli derecede etkilemiştir. Sonuç olarak; araştırmada ele alınan özellikler bakımından koyu kabuk rengine sahip yumurtaların daha iyi sonuç verdiği söylenebilir. Anahtar sözcükler: Etlik piliç, Yumurta kabuk rengi, Kuluçka sonuçları, Piliç performansı, Kan parametreleri Effect of Egg Shell Colour of Broiler Parent Stocks on Hatching Results, Chickens Performance, Carcass Characteristics, Internal Organ Weights and Some Stress Indicators Summary The present study was conducted to investigate the effect of egg shell colour of broiler parent stock on hatching results, chicken performance, carcass traits, internal organ weights and some blood parameters. In the experiment 8 eggs were grouped into 3 egg shell colour classes (E<8.: E: and E>83.5) for investigate of hatching results. The number of 675 animal provided from incubated eggs was used in experiment. The experiment was designed with nine replicates. Hatching egg shell colour was significantly effected that: fertility (P<.5), hatchability of fertile eggs (P<.5), hatchability (P<.5), 7 th and 35 th days chick live weight (P<.), 4 th and 2 st days chick live weight (P<.5), egg shell thickness (P<.) and blood triglyceride value (P<.). In conclusion; it can be mentioned that the dark shell colour eggs gave better results in term of hatching results and developing characteristics in the experiment. Keywords: Broiler, Egg shell colour, Hatching results, Chicken performance, Blood parameters GİRİŞ Tavukçuluk sektörü Türkiye de 96 lı yıllardan itibaren hızlı bir şekilde gelişmeye başlamıştır. Tavukların generasyon aralığının kısa olması ve yedikleri yemleri hızlı ve etkili bir biçimde hayvansal ürüne dönüştürmeleri bu alandaki gelişmeleri hızlandırmıştır. Tavukçuluk işletmelerinin kuruluşundaki hızlı artışa paralel olarak damızlık/kuluçkahane işletmeleri de benzer bir değişim geçirmiştir. İletişim (Correspondence)

150 838 Etlik Piliç Ebeveynlerinde... Bu gelişmelerin sonucunda üretimin ilk aşaması olan damızlık sürü oluşturulması ve kuluçkacılıkta etkili faktörlerin belirlenip geliştirilmesi önem kazanmıştır. Kuluçka sonuçlarına ve civciv performansı üzerine genetik ve çevresel faktörler etki etmektedir. Bu faktörler; genotip, depolanma süresi, yumurta iç ve dış kalite özellikleri, beslenme, damızlık hayvanların canlı ağırlığı, damızlık yaşı, mevsim, yetiştirme sistemi ve sağlık koşullarıdır 2. Yumurta kabuk rengi yumurta dış kalite özelliklerinden biri arasında olup kuluçka sonuçları ve civciv performansı üzerine etkili olan faktörlerdendir 3. Tavuğun üreme kanalında yumurta kabuğu oluşmaya başladığı andan itibaren kabuk bezlerinin salgıladığı biliverdin, çinko şelat ve porphyrin pigmentleri kabuğun yapısına katılmaya başlar 4. Kahverengi yumurtalarda bu üç pigment bulunmasına rağmen, protoporphyrin miktarının yüksek olduğu belirtilmektedir 5-7. Protoporphyrin pigmentinin yoğunluğuna göre yumurta rengi açık krem renginden koyu kahverengine kadar farklılık gösterir. Bilindiği gibi kahverengi yumurtalarda yumurta kabuk renginin açık veya koyu olması kuluçka sonuçları ile ilişkilidir. Aynı damızlık sürüden alınan yumurtalardan koyu renkli olanlar, açık renkli olanlara göre daha iyi kuluçka sonuçları vermektedir 8. Yumurta kabuk rengini oluşturan pigmentlerden biliverdinin antioksidan; porphyrin ve türevlerinin fotodinamik antibakteriyel ve protoporphyrinin yumurta kabuk kırılma direncini artırıcı etkileri vardır. Yumurta kabuğunda bulunan biliverdin miktarı annenin yumurta antioksidan kapasitesinin bir göstergesidir 9-. Ayrıca sağlıklı tavuklar koyu kabuk rengine sahip yumurta yumurtlar ve koyu yumurtaların yumurta sarısı antikor (IgY) seviyesi yüksektir. Yumurta kabuki rengi, yumurtadaki IgY seviyesini doğrudan etkilemektedir. Bu sayede koyu kabuk renkli yumurtalardan çıkan civcivlerin kalitesi yüksek olmaktadır 2. Bu çalışmada, etlik piliç damızlıklarında yumurta kabuk renginin kuluçka sonuçlarına, etlik piliçlerin performansına, karkas özelliklerine, iç organ ağırlıklarına ve bazı stres faktörlerine etkileri araştırılmıştır. MATERYAL ve METOT Denemenin hayvan materyalini, 32 haftalık yaşta Ross- 38 broiler damızlık sürü bulunduran ticari bir işletmeden alınan yumurtaların kuluçkaya konulmasından elde edilen etlik civcivler oluşturmuştur. Deney süresince hayvan hakları ile ilgili olarak NIH (National Institute of Health Guide for the Care and Use of Laboratory Animals) tarafından belirlenen kriterlere özenle uyuldu. Alınan yumurtalar yumurta kabuk rengine (E) göre üç gruba ayrılmıştır. Yumurta kabuk rengi L*a*b* renk sistemi kullanılarak Renk Ölçer (Konica Minolta Chromameter model CR-3) aleti ile yapılmıştır (L: parlaklık, a: kırmızılık ve b: sarılık derecesini simgeler). Tespit edilen L, a ve b değerlerinden E=(L 2 +a 2 +b 2 ) ½ formülü kullanılarak yumurta kabuk rengi (E) değeri hesaplanmıştır 3. Hesaplanan E değerine göre 8 den küçük olanlar koyu kabuk renkli, arasında olanlar orta açık kabuk renkli ve 83.5 den büyük olanlar açık kabuk renkli olarak belirlenmiştir. Denemede kullanılan yumurtalarda, koyu kabuk renkli yumurtalarda E değeri ortalama 77.48, orta açık kabuk renkli yumurtalarda 8.6 ve açık kabuk renkli yumurtalarda 85. dir. Denemede her yumurta kabuk rengi grubundan 36 yumurta, toplamda 8 yumurta işaretlenerek. g hassasiyetli tartı ile ağırlıkları saptanmıştır. Kuluçkaya yüklenmeden önce, yumurtalar 25 C ve %8 nemli bir odada 8 saat ön ısıtmaya tabii tutulmuştur. Daha sonra her birinde 2 yumurta bulunan 9 ayrı tablada 8 yumurta (Refarm, Smartset) kuluçka makinesine yerleştirilmiştir. Kuluçkanın giriş bölümünde sıcaklık F (37.6 C) ve bağıl nem 85 F yaş termometre sıcaklığı olarak uygulandı. Kuluçkanın 8. günü yumurtalar karanlık bir odada döllülük kontrolü yapılmış ve her gruptan rastgele 3 yumurta. g hassasiyetli tartı ile tartıldıktan sonra her grubun döllü yumurtaları ayrı bir tablada olacak şekilde bütün yumurtalar çıkış ünitesine aktarılmıştır. Çıkış ünitesinde sıcaklık F (36.6 C) ve bağıl nem 9 F yaş termometre sıcaklığı (Refarm, Smatrhatch) olarak uygulandı. Dölsüz ve ölü embriyolu yumurtalar ölümlerin zamanının belirlenmesi için laboratuara transfer edilmiştir. Yirmibirinci gün çıkımlar tamamlandıktan sonra her gruptan çıkım yapan sağlıklı civcivler ve ölü kabuk altı civcivlerin sayıları belirlenmiştir. Kuluçka sonuçlarının belirlenmesi için döllülük oranı (DO), çıkış gücü (ÇG), kuluçka randımanı (KR), 8. gün kuluçkada yumurta ağırlık kayıbı gram (g) ve yüzde (%) olarak, embriyo ölümleri (erken, orta ve geç) ve yumurta kabuk kalınlıkları belirlenmiştir. Kuluçkada yumurta ağırlık kaybı ortalaması belirlenirken 8. günkü transfer işlemi sırasında her gruptan rasgele alınana 3 yumurta. g hassasiyetindeki bir terazi ile tartılmıştır. Transfer işlemi (8. günde) sırasında dölsüz ve embriyo ölümü olduğu için alınan yumurtalar kırılarak Leica marka ışık mikroskobu altında görsel muayene ile embriyonun ölüm dönemi tespit edilmiştir. Yumurtalar dölsüz, erken dönem embriyo ölümü (-6 gün), orta dönem embriyo ölümü (7-7 gün) ve geç dönem embriyo ölümü (8-2) olarak isimlendirilmiştir. Yumurta kabuk kalınlıkları 8. günde dölsüz olduğu için kuluçkadan çıkarılan yumurtaların küt, orta ve sivri uçlardan alınan örnek yumurta kabuk parçalarının zarları ayrıldıktan sonra / mm duyarlı mikrometre ile ölçülmüştür. Okunan üç değerin ortalaması yumurtanın kabuk kalınlığı olarak verilmiştir. Denemede her yumurta kabuk rengine göre kuluçkadan elde edilen karışık cinsiyetteki etlik civcivlerden 9 bölme (2x m) oluşturulmuş ve her bölmeye 25 etlik civciv yerleştirilmiştir. Her muamelede 225, toplamda 675 adet etlik civciv kullanılmıştır. Deneme süresince 24

151 839 ŞEKEROĞLU, DUMAN saat aydınlatma uygulanmıştır. Altlık olarak odun talaşı kullanılmıştır. Çalışmada hayvanlara -. günler arası. dönem etlik civciv yemi (%23. HP, 3. Kcal/kg ME), 2-2. günler arası 2. dönem etlik civciv yemi (%22. HP, 3. Kcal/kg ME), günler arası 3. dönem etlik piliç yemi (%2. HP, 3. Kcal/kg ME) ve günler arası 4. dönem etlik piliç yemi (%8. HP, 3.2 Kcal/kg ME) serbest olarak verilmiştir. Denemedeki hayvanlar haftalık olarak g hassasiyetindeki terazi ile tek tek tartılarak ortalama canlı ağırlıkları (CA) saptanmıştır. Hayvanların haftalık toplam yem tüketimleri deneme sonuna kadar kaydedilerek hayvanların yem değerlendirme oranları (g Yem/g CAA) hesaplanmıştır. Ayrıca her gruptan ölen hayvanların sayısı kaydedilerek deneme sonunda yaşama gücü (%) hesaplanmıştır. Denemenin sonunda (39. gün) hayvanlar 8 saat aç bırakıldıktan sonra her tekerrürden ağırlık ortalamasına yakın 2 erkek 2 dişi, her gruptan 36 piliç, toplam olarak 8 etlik piliç seçilmiştir. Seçilen hayvanların V. cuteneae ulnaris lerinden vakumlu tüplere kan alınmıştır. Bu örnekler 3. rpm de dk. santrifüj işlemine tabii tutularak serum elde edilmiştir. Serum örnekleri -2 C muhafazaya alınmış ve analizlerin yapılacağı gün soğuk zincir ile laboratuara gönderilmiştir 4. Glikoz, trigliserit ve kolesterol ölçümleri için in vitro enzimatik kolorimetrik metot kullanılmıştır. Kanı alınan hayvanlar kesime sevk edilmiştir. Kesim sonrası sıcak karkas ağırlığı belirlenmiştir. Karkaslar soğuk suda 6 saat dinlendirildikten sonra +4 C 24 saat bekletilerek soğuk karkas ağırlıkları belirlenmiştir 5. Soğuk karkaslar TSE tavuk parçalama tekniğine uygun olarak parçalanmıştır 6. Parçaların ağırlıkları g hassasiyetindeki tartı ile belirlenmiştir. Kalp, karaciğer, dalak ve abdominal yağ ağırlığı oransal olarak (g/ g CA). g hassasiyetli tartı ile belirlenmiştir 7,8. PH metre kullanılarak göğüsün üç farklı bölgesinden ph ölçümü yapılmıştır. Bu üç farklı değerin ortalaması ph değeri olarak hesaplanmıştır. Göğüs eti rengi ise Konica Minolta Chromameter model CR-3 marka renk ölçer aleti ile derili göğsünün üç farklı bölgesinden alınan L-a-b değerleri kullanılarak bir E değeri hesaplanmıştır. Üç E ( E = (L 2 +a 2 +b 2 ) ½ ) değerinin ortalaması et rengi olarak kabul edilmiştir 3,9. Verilerin istatistik analizlerinde SPSS paket programı kullanılmıştır. Verilerden % olanlara açı transformasyonu uygulandıktan sonra analiz edilmiştir. Kuluçka embriyo ölümlerine kuluçkalık yumurta kabuk renginin etkisini belirlemek için Ki-Kare testi uygulanmıştır. Diğer veriler varyans analizi ile karşılaştırılmıştır. Muamele ortalamalarının karşılaştırılmasında Duncan çoklu karşılaştırma testi uygulanmıştır 2. BULGULAR Yumurta kabuk renginin kuluçka sonuçlarına etkisi Tablo de, performans özelliklerine etkisi ise Tablo 2 de ve kan parametreleri ve iç organ ağırlıklarına etkisi Tablo 3 te verilmiştir. Kuluçkalık yumurta kabuk renginin yumurta kabuk Tablo. Kuluçkalık yumurta kabuk renginin kuluçka sonuçlarına etkisi Table. The effect of egg shell colour on hatching results Özellikler Koyu (E:77.48) Kuluçkalık Yumurta Kabuk Rengi Orta Açık (E:8.6) Açık (E:85.) Yumurta ağırlık kaybı 8. gün, g gün, % Kabuk kalınlığı, mm.356 a.348 a.337 b.8 ** Embriyo ölümleri, adet Erken dönem (-6 gün) Orta dönem (7-7 gün) Geç dönem (8-2 gün) Toplam (-2 gün) Kuluçka özellikleri, % Döllülük oranı a a b.28 * Çıkış gücü 88.5 a b ab.5 * Kuluçka Randımanı a 8.27 b 8.39 b.4 * -: Önemsiz; * P<.5; ** P<.; ab Aynı satırda farklı harflerle gösterilen değerler arasındaki fark önemlidir; OSH: Ortalamanın standart hatası OSH P

152 84 Etlik Piliç Ebeveynlerinde... Tablo 2. Kuluçkalık yumurta kabuk renginin etlik piliçlerde performans üzerine etkisi Table 2. The effect of egg shell colour on broiler performance Özellikler Koyu (E:77.48) Kuluçkalık Yumurta Kabuk Rengi Orta Açık (E:8.6) Açık (E:85.) Canlı ağırlık (CA), g Başlangıç gün 75. a a 69.3 b.62 ** 4. gün a b b.66 * 2. gün 948. a b b 3.36 * 28. gün gün a b ab.5 ** 39. gün Yaşama gücü,% Yem değerlendirme oranı, g Yem tüketimi/g Canlı ağırlık artışı -2 gün gün gün Karkas özellikleri (%) Sıcak karkas randıman Soğuk karkas randımanı Göğüs eti ağırlığı oranı But ağırlığı oranı Kanat ağırlığı Sırt ağırlığı oranı Boyun ağırlığı oranı Göğüs eti renk (E) değeri Göğüs eti ph değeri : Önemsiz; * P<.5; ** P<.; ab Aynı satırda farklı harflerle gösterilen değerler arasındaki fark önemlidir; OSH: Ortalamanın standart hatası OSH P kalınlığına (P<.), döllülük oranına (P<.5), çıkış gücüne (P<.5) ve kuluçka randımanına (P<.5) etkisi istatistik olarak önemli bulunmuştur. Ancak yumurta kabuk renginin, kuluçkada 8. gün gram yumurta ağırlık kaybına, 8. gün % yumurta ağırlık kaybına, erken dönem (-6 gün) embriyo ölümlerine (adet), orta dönem (7-7 gün) embriyo ölümlerine (adet), geç dönem (8-2 gün) embriyo ölümlerine (adet) ve toplam (-2 gün) embriyo ölümlerine (adet) etkisinin istatistik olarak önemli olmadığı tespit edilmiştir (P>.5). Kuluçkalık yumurta kabuk renginin etlik piliçlerin 7. gün (P<.), 4.gün (P<.5), 2. gün (P<.5), 35 gün (P<.) canlı ağırlıkları üzerine etkisinin istatistikî olarak çok önemli olduğu tespit edilmiştir (P<.). Ancak kuluçkalık yumurta kabuk renginin etlik piliçlerin 28. gün ve 39. gün canlı ağırlığı üzerine etkisi istatistik olarak önemsiz bulunmuştur (P>.5). Kuluçkalık yumurta kabuk renginin etlik piliçlerin yaşama gücüne (%), yem değerlendirme oranlarına (-2, 2-39 ve -39 gün), sıcak ve soğuk karkas randımanına (%), karkas parçalarının (göğüs, but, kanat, sırt ve boyun) oranlarına (%), göğüs eti rengine (E) ve göğüs eti ph değerine etkisinin istatistikî olarak önemli olmadığı tespit edilmiştir (P>.5). Kuluçkalık yumurta kabuk renginin kan trigliserit düzeyi üzerine etkisinin istatistiki olarak önemli olduğu (P<.), ancak kan glikoz düzeyi, kan kolesterol düzeyi ve iç organ (karaciğer, kalp, dalak ve abdominal yağ) ağırlıklarına etkisinin istatistiki olarak önemli olmadığı tespit edilmiştir (P>.5). TARTIŞMA ve SONUÇ Etlik damızlık tavukların kuluçkalık yumurta kabuk rengi kuluçka sonuçlarına, etlik piliçlerin performansına, karkas özelliklerine ve bazı kan parametrelerine etkisinin araştırıldığı bu çalışmada; kuluçkalık yumurta kabuk rengi açıldıkça, kuluçkada yumurta ağırlık kayıplarının azaldığını belirten Shafey ve ark. dan 2 farklı olarak, kuluçkalık yumurta kabuk rengi açıldıkça yumurta ağırlık kaybı artmış, fakat istatistiksel farklılık tespit edilmemiştir. Kuluçkalık yumurta

153 84 ŞEKEROĞLU, DUMAN Tablo 3. Kuluçkalık yumurta kabuk renginin bazı kan parametrelerine ve iç organ ağırlıklarına etkisi Table 3. The effect of egg shell colour on some blood parameters and internal organ weights Özellikler Koyu (E:77.48) Kuluçkalık Yumurta Kabuk Rengi Orta Açık (E:8.6) Açık (E:85.) Kan parametreleri, mg/dl Kan glikoz düzeyi Kan kolesterol düzeyi Kan trigliserit düzeyi 2.23 a 2. a 5.4 b.69 ** İç organ ağırlıkları, g/ g CA Karaciğer ağırlığı Kalp ağırlığı Dalak ağırlığı Abdominal yağ ağırlığı : Önemsiz; * P<.5; ** P<.; ab Aynı satırda farklı harflerle gösterilen değerler arasındaki fark önemlidir; OSH: Ortalamanın standart hatası OSH P kabuk rengi açıldıkça toplam embriyo ölümü artmıştır. Ancak, kuluçkalık yumurta kabuk renk grupları arasında toplam embriyonik ölüm bakımından istatistik farklılık oluşmaması Shafey ve ark. nın 2 sonuçlarıyla benzerlik göstermektedir. Yumurta kabuk renginin yumurta kabuk kalınlığına etkisinin olmadığını belirten araştırmacılardan 2-23 farklı olarak bu çalışmada, kuluçkalık yumurta kabuk rengi açıldıkça yumurta kabuk kalınlığı azalmış ve kuluçkalık yumurta kabuk renginin yumurta kabuk kalınlığına etkisi önemli çıkmıştır. Kuluçkalık yumurta kabuk renginin açıktan koyuya doğru artıkça döllülük oranının arttığını, fakat istatistik farklılık olmadığını belirten Shafey ve ark. dan 22 farklı olarak, bu çalışmada farklılık istatistik olarak önemli bulunmuştur. Kuluçkalık yumurtalarda açık kabuk rengine sahip yumurtaların kuluçka randımanının orta kabuk renkli ve koyu kabuk rengine sahip yumurtalardan daha yüksek olduğunu belirten Shafey ve ark. nın 22 sonuçlarından farklı olarak, bu çalışmada kabuk rengi en koyu olan yumurtaların kuluçka randımanı en yüksek çıkmıştır. Kuluçkalık yumurta renginin etlik piliçlerin canlı ağırlık artışları üzerine etkisi birinci haftadan kesim yaşına kadar devam etmiştir. Koyu kabuk rengine sahip yumurtalardan elde edilen hayvanların canlı ağırlıkları deneme sonuna kadar yüksek çıkmıştır. Bunun muhtemel sebepleri, daha koyu yumurta kabuk rengine sahip hayvanların hastalık ve streslere daha dayanıklı olduğu ve koyu kabuk rengine sahip yumurta kabukları üzerinde bakteri gelişiminin daha az olmasıdır,24. Koyu kabuk rengine sahip yumurta yumurtlayan hayvanların daha fazla antioksidan kapasitesine sahip olması ve bu özellikleri kuluçkadan çıkan civcivlere aktarmalarından dolayı, daha sağlıklı ve strese dayanıklı hayvanlar elde edildiği belirtilmesine 9,,25 rağmen, bu çalışmada kuluçkalık yumurta kabuk renginin etlik piliçlerin yaşama gücüne etkisi önemsiz bulunmuştur. Bunun muhtemel sebebi daha koyu yumurta kabuk rengine sahip yumurtalardan çıkan civcivlerin denemenin ilk haftalarında daha hızlı canlı ağırlık artışı göstermeleridir. Kuluçkalık yumurta kabuk renginin etlik piliçlerin yem değerlendirme oranlarına etkisi de önemsiz bulunmuştur. Etlik piliçlerde göğüs etinin işlenmesinde açık et renginin daha iyi olduğu belirtilmektedir 26,27. Etlik piliçlerde et rengi ile et ph sı yakından ilişkilidir ve et ph sının düşük olması hayvan kesim öncesi refahının daha iyi olduğunun bir göstergesi olarak kabul edilmektedir 28. Ancak bu çalışmada kuluçkalık kabuk renginin etlik piliçlerin et ph sı ve et rengi üzerine istatistik bir etkisi saptanmamıştır. Aynı şekilde iç organ ağırlıkları refah göstergesi olarak alınabilir. Bu çalışmada yumurta kabuk renginin etlik piliçlerin iç organ (kalp, karaciğer, dalak ve abdominal yağ) ağırlıklarını etkilemediği gözlemlenmiştir. Kuluçkalık yumurta kabuk renginin kan parametrelerinden glikoz ve total kolesterol düzeyini etkilemediği, ancak kan trigiliserit düzeyini etkilediği gözlemlenmiştir. Sonuç olarak kuluçkalık yumurta kabuk rengi olarak koyu kabuk renkli yumurtaların döllülük oranına, çıkış gücüne, kuluçka randımanına, yumurta kabuk kalınlığına ve etlik piliç canlı ağırlık artışına olumlu etkileri saptanmıştır. Bu nedenle koyu yumurta kabuk rengi damızlık sürülerde bir seleksiyon ölçütü olarak ele alınabilir. KAYNAKLAR. Çelebi Ş: Yumurta tavuk rasyonlarına hayvansal ve bitkisel yağ ilavesinin performans, yumurta kalitesi ve yumurta sarısı yağ asidi kompozisyonu üzerine etkileri. Doktora Tezi. Atatürk Üniv. Fen Bilimleri Enst., Erzurum, Roberts JR, Nolan JV: Egg and eggshell quality in five strains of laying hen and the effect of calcium source and age. In, Kijowski J, Pikul J (Eds): Eggs and Egg Products Quality. p Proceedings of The VII European Symposium on The Quality of Eggs and Egg Products, 2-26 September, Poznan, Poland, Shanawany MM: Hatching weight in relation to egg weight in domestic birds. World Poult Sci J, 43 (2): 7-5, Butcher GD, Miles RD: Factors causing poor pigmentation of brownshelled eggs. Cooperative Extension Service Fact Sheet VM94. Inst. Food and Agriculture. Science, Univ Florida, Gainesville, 995.

154 842 Etlik Piliç Ebeveynlerinde Kennedy GY, Vevers HG: Eggshell pigments of the Araucano fowl. Comp Bioch Physiol B, 44 (): -35, Kennedy GY, Vevers HG: A survey of avian eggshell pigments. Comp Biochem Physiol Part B: Comp Biochem, 55 (): 7-23, Schwartz SW, Raux A, Schacter BA, Stephenson BD, Shoffner RN: Loss of hereditary uterine protoporphyria through chromosomal rearrangement in mutant Rhode Island Red hens. Int J Biochem, 2 (5-6): , Erensayın C: Tavukçuluk. Dizgi Baskı: 72, Cilt, Ankara, Kaur H, Hughes MN, Green CJ, Naughton P, Foresti R, Motterlini R: Interaction of bilirubin and biliverdin with reactive nitrogen species. FEBS Letters, 543 (): 3-9, 23.. Ishikawa S, Suzuki K, Fukuda E, Arihara K, Yamamoto Y, Mukai T, Itoh M: Photodynamic antimicrobial activity of avian eggshell pigments. FEBS Letters, 584 (4): , 2.. Solomon SE: Egg shell pigmentation. In, Wells RG, Belyavin CG (Eds): Egg Quality Current Problems and Recent Advances. pp London: Butterworths, Moreno J, Osorno JL, Morales J, Merino S, Toma s G: Egg colouration and male parental effort in the pied flycatcher Ficedula hypoleuca. J Avian Biol, 35 (4): 3-34, Ingram DR, Hatten III LF, Homan KD: A study on the relationship between eggshell color and eggshell quality in commercial broiler breeders. Int J Poult Sci, 7 (7): 7-73, Güneş N, Polat Ü, Petek M: Alternatif barındırma sistemlerinde yetiştirilen piliçlerin biyokimyasal kan parametrelerindeki değişikliklerin incelenmesi. Uludağ Üniv Vet Fak Derg, 2 (): 39-42, Bochno R, Murawska D, Brzostowska U: Age-related changes in the distribution of lean fat with skin and bones in goose carcasses. Poult Sci, 85 (): , TSE: Türk Standartları- Tavuk gövde eti parçalama kuralları, T.S.E., Ankara, Demir E. Şekeroğlu A: Ekstrüde tam yağlı soya, fermakto ve yucca ekstraktının etlik piliçlerdeki etkileri. Tavukçuluk Araşt Derg, 2 (2): 3-35, Yalçınkaya İ, Güngör T, Başalan M, Çınar M, Saçaklı P: Broyler rasyonlarında organik selenyum ve vitamin E kullanımının performans, iç organ ağırlıkları ve kan parametreleri üzerine etkisi. Kafkas Univ Vet Fak Derg, 6 (): 27-32, Altan A, Bayraktar H, Önenç A: Etlik Piliçlerde sıcak stresinin et rengi ve ph sı üzerine etkileri. Hay Üretim Derg, 42 (2): -8, Özdamar K: Paket Programlar İle İstatiksel Veri Analizi I. Kaan Kitabevi 2. Baskı, Shafey TM, Al-Batshan HA, Ghannam MM, Al-Ayed MS: Effect of intensity of eggshell pigment and illuminated incubation on hatchability of brown eggs. Br Poult Sci, 46 (2): 9-98, Shafey TM, Ghannam MM, Al-Batshan HA, Al.Ayed MS: Effect of pigment intensty and region of eggshell on the spectral transmision of light that passes the eggshell of chickens. Int J Poult Sci, 3 (3): , Zhang LC, Ning ZH, Xu GY, Hou ZC, Yang N: Heritability and genetic and phenotypic correlations of egg quality traits in brown-egg dwarf layers. Poult Sci, 84 (8): 29-23, Mertens K, Vaesen I, loffel J, Kemps B, Kamers B, Perianu C, Zoons J, Darius P, Decuypere E, De Baerdemaeker J, De Ketelaere B: The transmission color value: A novel egg quality measure for recording shell color used for monitoring the stress and health status of a brown layer flock. Poult Sci, 89 (3): 69-67, Morales J, Sanz JJ, Moreno J: Egg colour reflects the amount of yolk maternal antibodies and fledging success in a songbird. Biol Lett, 2 (3): , McCurdy RD, Barbut S, Qinton M: Seasonal effect on pale soft exudative (PSE) occurence in young turkey breast meat. Food Res Intern, 29 (3-4): , Owens CM, Hirscler EM, Mckee SR, Martinez-Dawson R, Sams RA: The characterization and incidence of pale, saft, exudative turkey meat in commercial plant. Poult Sci, 79 (4): , Castellini C, Mugnai C, Dal Bosco A: Effect of organic production systems on broiler carcass and meat quality. Meat Sci, 6 (3): , 22.

155 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Effects of Angiostatin on in vitro Embryonic Rat Development * ** *** **** Tolga ERTEKIN * Harun ULGER * Mehtap NISARI * Omur KARACA ** Erdogan UNUR * Ugur SAHIN *** Ferhan ELMALI **** Erciyes University, School of Medicine, Department of Anatomy, TR-3839 Kayseri - TURKEY Balıkesir University, School of Medicine, Department of Anatomy, TR-45 Balıkesir - TURKEY Erciyes University, Faculty of Science, Department of Chemistry, TR-3839 Kayseri - TURKEY Erciyes University, School of Medicine, Department of Biostatistic, TR-3839 Kayseri - TURKEY Summary The progression of angiogenesis is controlled by a delicate balance between the positive and negative regulators. Angiostatin has potent antiangiogenic effect on endothelial cells, influencing their proliferation, differentiation and other functions. In this study, in vitro effects of angiostatin on total embryonic growth were investigated in rat embryos. The rat embryos were explanted on day 9.5 and cultured in whole rat serum (WRS) (for control) and adding.5, 2.5 and 5 µg/ml angiostatin (for experimentals) in WRS. After 48 hours culture period, the embryos from each group were harvested and analysed morphologically. The results showed that the embryonic growth and development during organogenesis decreased in the presence of angiostatin when compared to embryos grown in WRS. Mean morphological scores for the embryos grown in WRS and in the presence of.5, 2.5 and 5 µg/ml angiostatin were 59.8±2.2, 34.8±8.52, 22.4±6.4 and 7.8±6.9, yolk sac diameters were 6.±.2, 4.8±.55, 4.5±57 and 4.2±.39 mm, crown-rump lengths were 5.4±.23, 4.4±.42, 4.±.87 and 3.7±.5 mm and mean protein contents of embryos were 4.76±2.2, 2.66±8.67, 89.85±.89 and 53.77±8.5 µg/ml respectively. Median value of the somite numbers was 24 (24-25) in control group and it was diminished 4 (2-4), 2 (-7) and 3 (8-7) respectively in experimental groups. As a result the angiostatin could cause developmental retardation of embryo because of its antiangiogenic effect. Keywords: Angiostatin, Culture, Embryo, in vitro, Rat Anjiostatinin in vitro Embriyonik Rat Gelişimi Üzerine Etkileri Özet Makale Kodu (Article Code): KVFD Anjiogenezis süreci anjiogenez inhibitör ve aktivatörleri arasındaki denge ile kontrol edilmektedir. Anjiostatin endotel hücrelerin çoğalmasını, farklılaşmasını ve diğer fonksiyonlarını etkileyerek endotel hücreleri üzerinde antianjiogenik etki gösterir. Bu çalışmada, anjiostatin in sıçan embriyolarında in vitro total embriyonik gelişim süreci üzerine etkileri araştırıldı. 9.5 günlük embriyolar normal sıçan serumunda (kontrol grubu) ve normal sıçan serumuna.5, 2.5 ve 5 µg/ml anjiostatin eklenerek (deney grupları) kültüre edildi. 48 saatlik kültür periyodu sonunda tüm gruplardaki embriyolar morfolojik olarak değerlendirildi. Deney grupları kontrol grubu ile karşılaştırıldığında organagenezis süresince embriyonik gelişim ve büyümede bir gerilemenin varlığı gözlemlendi. Sıçan serumu ve sıçan serumu+.5, 2.5 ve 5 µg/ml anjiostatin de kültür edilen embriyolarda ortalama morfolojik skor sırasıyla 59.8±2.2, 34.8±8.52, 22.4±6.4 ve 7.8±6.9, yolk sac çapı 6.±.2, 4.8±.55, 4.5±57 ve 4.2±.39 mm, baş-kıç uzunluğu 5.4±.23, 4.4±.42, 4.±.87 ve 3.7±.5 mm ve ortalama protein içeriği 4.76±2.2, 2.66±8.67, 89.85±.89 ve 53.77±8.5 µg/ml olarak belirlendi. Ortalama somit sayısı kontrol grubunda 24 (24-25) iken deney gruplarında azalmaktaydı ve sırasıyla 4 (2-4), 2 (-7) ve 3 (8-7) olarak hesaplandı. Sonuçlar, anjiostatin in antianjiojenik etkisine bağlı olarak embriyonik gelişimde bir gerilemenin olabileceğini ortaya koymaktadır. Anahtar sözcükler: Anjiostatin, Kültür, Embriyo, in vitro, Sıçan INTRODUCTION During embryogenesis, the formation of blood vessels proceeds by both vasculogenesis and angiogenesis. Both processes appear to be finely regulated. To date, factors and genes involved in the negative regulation of embryonic İletişim (Correspondence) /23225

156 844 Effects of Angiostatin on in vitro... vasculogenesis remain largely unknown. Angiostatin that acts as an inhibitor of angiogenesis was isolated from both serum and urine of mice bearing a transplantable murine Lewis Lung carcinoma (3LL) in syngeneic C57Bı6/J mice. Proteolytic fragments of human plasminogen comparable to the murine angiostatin, but not intact plasminogen, inhibit the neovascularization and growth of lung metastases in mice. Angiostatin can be generated in vitro by limited elastase proteolysis of plasminogen. Studies with protease inhibitors have demonstrated that a serine protease is essential for angiostatin generation. Studies of smaller fragments of human angiostatin on inhibition of endothelial proliferation have demonstrated that functional difference is present among individual kringle structures 2-4. Angiostatin with one less kringle molecule (kringle to 3) has recently been demonstrated to be an effective angiogenic inhibitor 5. The in vitro activity of angiostatin in endothelial cell proliferation assays resides in kringles -3, with kringle being the most potent inhibitor and kringle 4 being relatively in effective 3,4,6. However the mechanism underlying how angiostatin and its related kringle fragments specifically inhibit endothelial cell growth is unclear 5,7. It is not known whether the inhibition occurs directly at the cell surface or whether angiostatin is internalized by endothelial cells and subsequently inhibits cell proliferation. Both mechanisms could involve a receptor specifically expressed in proliferating endothelial cells 3. The in vitro culture of post-implantation rat embryos from 9.5 to.5 days is possible in homologous serum using the method described by New 8, such that the development of embryos in vitro is comparable to that in vivo 9. Despite numerous studies 2,3,6 have been carried out for explaining effects of angiostatin on cell culture there are no data about its embryotoxicity or teratogenicity. The aim of the present study was to investigate the in vitro effects of angiostatin (K-3) on embryonic development during the organogenesis period in the rat. MATERIAL and METHODS This study was approved by the Experimental Animals Ethics Committee of Erciyes University, Turkey. Wistar rats were obtained from the Clinical and Experimental Research Centre, Medical Faculty of Erciyes University. The female rats (approximately 8 weeks of age and weighing 5±75 g) were kept in cages in groups of five, and the males of the same strain were housed singly in mating cages. Male and female rats were placed together in the evening (one pair per cage), and the presence of a vaginal plug the following morning was taken to indicate mating had occurred. On the assumption that mating occurred around midnight, the female was considered to be.5 day pregnant at noon the following day. The pregnant rats were killed by ether overdose at 9.5 days of gestation and the embryos (approximately embryos from each pregnant rat) were removed from the mother by the explanation procedure described by New 8. In order to assess the effect of the angiostatin (K-3) (TechnoGene, Israel) on total embryonic growth, embryos were divided in total 4 groups ( embryos per one group) which were a control and 3 experimental. The control group embryos were cultured in whole rat serum (WRS). The administration dosages of angiostatin were determined according to the data gained from previus studies 3-6. For the experimental groups,.5, 2.5, 5 µg/ml angiostatin were added to WRS. After 48 h culture the embryos from each group were examined under the dissecting microscope and assessed according to the morphological scoring system which takes account of the growth and differentation of different embryological features, including the appearance of yolk sac circulation, allantois, body flexion, heart, caudal neural tube, hindbrain, midbrain, forebrain, otic system, optic system, olfactory system, branchial arches (bars), maxillary processes, mandibular processes, forelimbs, hindlimbs and somite number. For all groups, protein contents of embryos were also determined with Folin Phenol reagents. Data of the morphological score and somite number, yolk sac diameter, crown-rump length and protein contents statistically were analysed. All datasets were subjected to normality test using the Kolmogorov-Smirnov method and the data were reported as either mean ± standard deviation (X ± SD) (for normally distributed data) or as median with 25%-75% percentile (for skewed data). Comprasion of between the groups was made using the One Way Analysis of Variance (ANOVA; multiple comparasions were carried out with Tukey Test) or the Kruskal-Wallis Test (KW; Post-Hoc comprasions were carried out with Tukey Test). Statistical significance was set at P<.. All analyses were performed with the statistical package for scientist (SIGMASTAT) Windows version 3.. RESULTS The embryos cultured in angiostatin (K-3) showed severe growth retardation in all embryonic primordia when compared to embryos grown only in WRS (Fig. and 2). Angiostatin affected the embryos in dose dependent manner and higher doses of angiostatin increased retardations of embryonic growth and development according to morphological scoring system and embryo protein content (Table ). The lower morphological scores were accompanied by poor yolk sac vessel development according to the scoring system, some failure of fusion of the neural folds, incomplete embryonic flexion, and retarded development of otic, optic and olfactory systems, branchial bars, maxillary and mandibular processes and limbs. In addition to total morphological scores, yolk sac

157 845 ERTEKIN, ULGER, NISARI, KARACA UNUR, SAHIN, ELMALI Fig. Rat embryos enclosed in the yolk sac at.5 days of gestation following 48-h culture period in WRS (A) and in WRS+5 µg/ ml angiostatin (K-3) (B). ysv, yolk sac vessel; bi, blood island Şekil. WRS (A) ve WRS+5 µg/ml anjiostatin (K-3) de (B) 48 saatlik kültür periyodundan sonraki yolk kesesi içindeki.5 günlük rat embriyoları. ysv, yolk sac damarı; bi, kan adacığı Fig 2. Rat embryos outside of the yolk sac at.5 days of gestation following 48-h culture period in WRS (A) and in WRS + 5 µg/ml angiostatin (K-3) (B). f, forebrain; m, midbrain, h, hindbrain; o, optic vesicle; ot, otic vesicle; he, heart; s, somit; ocnt, open cranial neural tube Şekil 2. WRS (A) ve WRS + 5 µg/ml anjiostatin (K-3) de (B) 48 saatlik kültür periyodundan sonraki yolk kesesi dışına çıkarılmış.5 günlük rat embriyoları. f, ön beyin; m, orta beyin, h, arka beyin; o, optik vezikül; ot, otik vezikül; he, kalp; s, somit; ocnt, açık cranial neural tüp Table. The statistical analyses in vitro embryonic development in whole rat serum (WRS), and angiostatin (K -3) Tablo. Total sıçan serumu (WRS) ve anjiostatin (K -3) deki in vitro embriyonik gelişimin istatistiksel analizi Parameters Control.5 µg/embr. 2.5 µg/embr. 5 µg/embr. P Total morfological score X±SD 59.88±2.2 a 34.8±8.52 b 22.4±6.4 c 7.8±6.9 c <. Yolk sac diamater X±SD 6.±.2 a 4.88±.55 b 4.52±.57 bc 4.22±.39 c <. Crown-rump lenght X±SD 5.4±.23 a 4.46±.42 b 4.8±.87 bc 3.7±.5 c <. Somite Number Median (25%-75%) 24 a (24-25) 4 b (2-4) 2 b ( -7) 3 b (8-7) <. Embryo protein content X±SD 4.76±2.2 a 2.66±8.67 b 89.85±.89 c 53.77±8.5 d <. One Way Analysis of Variance is applied Kruskal-Wallis test is applied diameter, somite numbers and crown-rump length and embryo protein content of.5 days embryos grown in angiostatin were significantly decrease to normal embryonic development on day.5 in WRS. Statistical studies showed that there was a significant decrease (P<.) total morphological score, yolk sac diameter, crown-rump length, somite number and embryo protein content. Mean morphological scores for the

158 846 Effects of Angiostatin on in vitro... embryos grown in WRS, in the presence of.5, 2.5 and 5 µg/ml angiostatin were 59.8±2.2, 34.8±8.52, 22.4±6.4 and 7.8±6.9 respectively. Yolk sac diameter was 6.±.2 mm in control group, and 4.88±.55 mm, 4.52±.57 mm and 4.22±.39 mm in experimental groups respectively. While crown-rump length of control group was 5.4±.23 mm, in experimental groups it diminished gradually due to the dose of angiostatin (4.46±.42, 4.8±.87 mm and 3.7±.5 mm). Median value of the somite numbers was 24 (24-25) in control group and it was diminished 4 (2-4), 2 (-7) and 3 (8-7) respectively in experimental groups. The mean protein contents of embryos were also decreased in experimental groups (2.66±8.67 µg/ml, 89.85±.89 µg/ml, 53.77±8.5 µg/ml respectively) when compared to control group (4.76±2.2 µg/ml). While the yolk sac of embryos grown in WRS had a fully developed yolk sac plexus of vessels the yolk sac of embryos grown in WRS + 2.5µg angiostatin had just established vitelline circulation and had few yolk sac vessels and WRS + 5 µg angiostatin groups had no vessels they had only blood islands (Fig. A and B). Developmental retardations in neural tube formation were also found in all experimental groups when compared to control group. There was open neural tube both cranial and caudal region in the embryos that grown in the presence of angiostatin (Fig. 2A and B). Morphological analysis showed that all the embryos, grown in WRS + angiostatin, had open posterior neural tubes and less neural system development. In conclusion, angiostatin caused growth reterdation in all experimental groups. DISCUSSION Embryonic and adult growth processes are a prerequisite for the formation of a functional vascular system, which is essential for the proper development of vertebrate embryos, as well as for growth, regeneration and survival of adults 2. The migration of endothelial precursors is one of the key mechanisms in the process of vascular development. When no preexisting vessels exist, they are derived from endothelial precursors 3. The migration of endothelial precursor cells is regulated by various mechanisms and signals that initiate guide and stop the migration of endothelial precursors during formation of a vascular network. The vascular system originates from two fundamental processes: vasculogenesis and angiogenesis 4. Vasculogenesis, the de novo formation of blood vessels from mesoderm, is driven by the recruitment of undifferentiated mesodermal cells to the endothelial lineage and their assembly into a primitive vascular network 3. This process occurs mainly during fetal development, although recruitment into blood vessels of endothelial precursors, termed angioblasts, from bone marrow and peripheral blood have also been described in adults 5. The blood vascular system further extend by angiogenesis that corresponds to the generation of new blood vessels from endothelial cells of existing blood vessels, a process driven by endothelial cell proliferation and migration 3. Angiogenic process is a complex multistep cascade under the control of positive and negative soluble factors. The angiogenic switch is the result of the imbalance of positive and negative angiogenesis regulators as consequence of the up-regulation of endothelial growth factors or of the down regulation of natural angiogenesis inhibitors 4,6,7. Our previous studies indicate that vascular endothelial growth factor 8, platelet-derived growth factor 9 and basic fibroblast growth factor 2 could have important role on in vitro embryonic rat development because of their angiogenic effects. Up to now, because of the treatment of pathological angiogenesis, many physiologic angiogenic inhibitors have been characterized as angiostatin and endostatin 2,2. Angiostatin is a proteolytic fragment of plasminogen that acts as an inhibitor of angiogenesis,2. To evaluate the anti-angiogenic properties of angiostatin, many researches were made on in vitro angiogenesis models. In vitro endothelial cell culture models different concentrations of angiostatin (.5- μg/ml) were used 3,6, In additon to these studies, like above, different angiostatin concentrations (.- μg) were used on corneal neovascularization models by many researchers in vivo 2,4,5. Angiostatin treatment of endothelial cells in the absence of growth factors results in an increased apoptotic index whereas the proliferation index is unchanged. Angiostatin also inhibits migration and tube formation of endothelial cells 23. Angiostatin binds to the α/β-subunits of ATP synthase on the cell surface and this binding may mediate its antiangiogenic effects and the downregulation of endothelial cell proliferation and migration 25. In embryonic stem (ES) cell differentiation model system that angiostatin does not affect the steps of vasculogenesis involved in embryonic vascular development. The findings that angiostatin inhibits VEGF 65 -induced sprouting angiogenesis from embryoid body reflect that angiostatin may be a selective angiogenesis inhibitor. Elsewhere, in front of the early expression of its putative receptors, it remains to be established which cells are target cells of angiostatin during early developmental stages and whether angiostatin may affect cell compartment other than the endothelial one,26. Alternatively, angiostatin may interact with an endothelial cell adhesion receptor such as integrin α v b 3, thus blocking integrin-mediated angiogenesis 3. Indeed, several targets and various mechanisms of action have been proposed for the antiangiogenic action of angiostatin that remains to be fully elucidated. In the present study, in vitro effects of angiostatin were tested on embryo culture. The results showed that

159 847 ERTEKIN, ULGER, NISARI, KARACA UNUR, SAHIN, ELMALI total embryonic growth was normal in WRS as opposed to the experimental groups, which were angiostatin was added in WRS, this figure decreased depending on the dose of angiostatin. Embryonic retardations were seen in total embryonic growth especially yolk sac diameter and vascularisation, crown-rump length, somite number, embryo protein content, body flexion and neural tube development. When postimplation embryos were cultured in the presence of certain antiangiogenic molecules, similiar regression was seen in embryonic growth, e.g with anti-bfgf 27, interleukin Our results indicated that the addition of higher concentrations of angiostatin resulted in growth retardation and some malformations. Those findings may be caused by the reduction of yolk sac functions, because the yolk sac decreased in size and vascularisation in the presence of these higher concentrations. It is well known that the yolk sac is an especially important placental organ in the rodentia at this time of embryonic development. It has been shown to be primary source of exchange between the embryo and mother during early embryogenesis before the chorioallantoic placenta becomes functional 8. Together with a wide range of other in vitro studies about the teratogenicity of several different molecules, the present findings suggest that the rat post-implantation embryo culture system is a very useful method for teratological studies and also particularly suitable for the assessment of specific effects on the morphogenetic events occurring during early organogenesis in mammalian embryos. REFERENCES. Prandini MH, Desroches-Castan A, Feraud O, Vittet D: No evidence for vasculogenesis regulation by angiostatin during mouse embryonic stem cell differentiation. J Cell Physiol, 23 (): 27-35, O Reilly MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, Lane WS, Cao Y, Sage EH, Folkman J: Angiostatin: A novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell, 79 (2): , Cao Y, Ji RW, Davidson D, Schaller J, Marti D, Söhndel S, McCance SG, O Reilly MS, Llinás M, Folkman J: Kringle domains of human angiostatin. Characterization of the anti-proliferative activity on endothelial cells. J Biol Chem, 27 (46): , Cao Y: Therapeutic potentials of angiostatin in the treatment of cancer. Haematologica, 84 (7): 643-5, Kim JH, Kim JC, Shin SH, Chang SI, Lee HS, Chung SI: The inhibitory effects of recombinant plasminogen kringle -3 on the neovascularization of rabbit cornea induced by angiogenin, bfgf, VEGF. Exp Mol Med, 3 (4): 23-29, Lucas R, Holmgren L, Garcia I, Jimenez B, Mandriota SJ, Borlat F, Sim BK, Wu Z, Grau GE, Shing Y, Soff GA, Bouck N, Pepper MS: Multiple forms of angiostatin induce apoptosis in endothelial cells. Blood, 92 (2): , Yokoyama Y, Dhanabal M, Griffioen AW, Sukhatme VP, Ramakrishnan S: Synergy between angiostatin and endostatin: Inhibition of ovarian cancer growth. Cancer Res, 6 (8): , New DAT: Whole embryo culture and the study of mammalian embryos during organogenesis. Biol Rev Camb Philos Soc, 53 (): 8-22, New DAT, Coppola PT, Cockroft DL: Comparison of growth in vitro and in vivo of post-implantation rat embryos. J Embryol Exp Morphol, 36 (): 33-44, Van Maele-Fabry G, Delhaise F, Picard JJ: Morphogenesis and quantification of the development of post-implantation mouse embryos in vitro. Toxicol In Vitro, 4 (2): 49-56, 99.. Lowry DH, Rosebrough NJ, Farr AL, Randal RJ: Protein measurements with Folin Phenol reagents. J Biol Chem, 93 (): , Jin SW, Beis D, Mitchell T, Chen JN, Stainier DY: Cellular and molecular analyses of vascular tube and lumen formation in zebrafish. Development, 32 (23): , Patan S: Vasculogenesis and angiogenesis as mechanisms of vascular network formation, growth and remodeling. J Neurooncol, 5 (-2): -5, Schmidt A, Brixius K, Bloch W: Endothelial precursor cell migration during vasculogenesis. Circ Res, (2): 25-36, Urbich C, Dimmeler S: Endothelial progenitor cells: Characterization and role in vascular biology. Circ Res, 95 (4): , Ranieri G, Gasparini G: Angiogenesis and angiogenesis inhibitors: A new potential anticancer therapeutic strategy. Curr Drug Targets Immune Endocr Metabol Disord, (3): , Velasco P, Lange-Asschenfeldt B: Dermatological aspects of angiogenesis. Br J Dermatol, 47 (5): , Ulger H, Ozdamar S, Unur E, Pratten MK: The effect of vascular endothelial growth factor on in vitro embryonic heart development in rats. Anat Histol Embryol, 33 (6): , Ulger H, Karabulut AK, Pratten MK: The growth promoting effects of bfgf, PD-ECGF and VEGF on cultured postimplantation rat embryos deprived of serum fractions. J Anat, 97 (2): 27-29, Ulger H, Ozdamar S, Unur E, Pratten M: The effect of basic fibroblast growth factor (bfgf) on in vitro embryonic growth, heart and neural tube development in rat. Kafkas Univ Vet Fak Derg, 5 (5): , O Reilly MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, Flynn E, Birkhead JR, Olsen BR, Folkman J: Endostatin: An endogenous inhibitor of angiogenesis and tumor growth. Cell, 88 (2): , Sim BK, O Reilly MS, Liang H, Fortier AH, He W, Madsen JW, Lapcevich R, Nacy CA: A recombinant human angiostatin protein inhibits experimental primary and metastatic cancer. Cancer Res, 57 (7): , Claesson-Welsh L, Welsh M, Ito N: Angiostatin induces endothelial cell apoptosis and activation of focal adhesion kinase independently of the integrin-binding motif RGD. Proc Natl Acad Sci USA, 95 (): , Hermant B, Desroches-Castan A, Dubessay ML, Prandini MH, Huber P, Vittet D: Development of a one-step embryonic stem cellbased assay for the screening of sprouting angiogenesis. BMC Biotechnol, 6 (7): 2, Moser TL, Stack MS, Asplin I, Enghild JJ, Højrup P, Everitt L, Hubchak S, Schnaper HW, Pizzo SV: Angiostatin binds ATP synthase on the surface of human endothelial cells. Proc Natl Acad Sci USA, 96 (6): , Feraud O, Cao Y, Vittet D: Embryonic stem cell-derived embryoid bodies development in collagen gels recapitulates sprouting angiogenesis. Lab Invest, 8 (2): , Unur E, Ulger H, Ekinci N, Hacialiogullari M, Ertekin T, Kilic E: Effect of anti-basic fibroblast growth factor (Anti-bFGF) on in vitro embryonic development in rat. Anat Histol Embryol, 38 (4): , Hacıaliogulları M: Effect of interleukin 2 (Il-2) on embryonic yolk sac vascularisation. Yüksek Lisans Tezi, Erciyes Üniv Sağlık Bil Enst, 25.

160 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Amorozisli Buzağıların Kan Serumlarında β-karoten ve A Vitamini Düzeyleri Yusuf GÜL * Mustafa İSSİ * * Fırat Üniversitesi, Veteriner Fakültesi, İç Hastalıkları Anabilim Dalı, TR-239 Elazığ - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Çalışmada klinik olarak amorozis tanısı konan değişik ırk, yaş ve cinsiyette 4 buzağı kullanılmıştır. Buzağıların klinik muayeneleri yapıldıktan sonra alınan kan örneklerinde serum β-karoten ve A vitamini tayinleri spektrometrik olarak yapılmıştır. Kan serumu ortalama β-karoten değeri 6.36±4. µg/dlve A vitamini değeri ise 6.55±.9 µg /dl olarak bulunmuştur. Sonuç olarak, amorozisli buzağılarda özellikle hipovitaminozis A nın dikkate alınması gerektiği kanısına varılmıştır. Anahtar sözcükler: Amorozis, Buzağı, β-karoten, A Vitamini, Hipovitaminozis A Serum β-carotene and Vitamin A Levels in Calves with Amaurosis Summary In the present study, different breed, ages and sex 4 calves with clinically amaurosis was used. After clinical examination of the calves, were made analysis of sera β-carotene and vitamin A levels as spectrophotometric. The mean β-carotene and vitamin A levels were determined as 6.36±4. µg/dl and µg/dl, respectively. As a result, it should be considering of particularly hypovitaminosis A in calves with amaurosis. Keywords: Amaurosis, Calf, β-caroten, Vitamin A, Hypovitaminosis A GİRİŞ A vitamini görme için gerekli olan retinal purpuranın (rodopsin) rejenerasyonunda temel bir maddedir. Retinal purpuradaki rejenerasyonun azalması sonucu gözün karanlığa adaptasyonu bozulur,2. A vitamini yetersizliği, daha çok rasyonda yeşil yemlerin noksan oluşu ve A vitamininden yoksun rasyonlara ilave yapılmayışı sonucu primer olarak oluşur. Ayrıca rezorbsiyon bozuklukları (kronik karaciğer ve bağırsak hastalıkları) ve karotenden A vitamini sentezini olumsuz yönde etkileyen çeşitli faktörlerin (fosforun azlığı veya fazlalığı, kalsiyum fazlalığı, iyot eksikliği, nitrat ve nitritlerin fazlalığı, klorlu naftalen bileşikleri, yüksek çevre sıcaklığı, tabi yağlar, safra asitleri, mineral yağlar) etkisi sonucu sekunder olarak ortaya çıkmaktadır -3. A vitamini yetersizliğinde karanlığa uyumun azalması bütün türlerde görülen en belirgin semptom olmasına rağmen, en fazla etkilenen buzağılar ve gelişme çağındaki sığırlardır. Başlangıçta karanlıkta ve yarı karanlıkta yönü tayin etmenin bozulduğu (ncytalopie=gece körlüğü), hastalık biraz ilerlediğinde aydınlıkta göremez hale geldiği (hemoralopie=gündüz körlüğü), kısa süre sonra tamamen kaybolduğu ve kör oldukları ifade edilmiştir -5. Stöber 2 tarafından, buzağılarda kan plazmasında 2 µg/dl nin üzerindeki A vitamini değerlerinin normal, 7-2 µg/dl arasındaki değerlerin kritik, 7 µg/dl ve daha altındaki değerlerin patolojik, 3 µg/dl nin üzerindeki β-karoten değerlerinin normal, -3 µg/dl arasındaki değerlerin kritik, µg/dl ve altındaki değerlerin patolojik olduğu bildirilmiştir. Yetiştiricilerin küspe diye adlandırdığı şeker pancarı yan ürünü olan pancar posası, özellikle şeker fabrikalarının bulunduğu bölgelerde süt ve besi sığırlarında kuru ve İletişim (Correspondence)

161 85 Amorozisli Buzağıların Kan... yaş olarak yaygın şekilde kullanılan, hayvanların severek tükettiği, kolay sindirilebilir karbonhidrat içeren sindirim derecesi yüksek ucuz bir yem kaynağıdır 6. Fakat şeker pancarı posası protein ve selüloz yönünden yetersiz, karoten ve fosforca fakirdir,2,6. İçerdiği okzalik asit rasyondaki kalsiyumu kalsiyum okzalat halinde bağladığından kalsiyumdan yararlanmayı da azaltır 3. Ayrıca şeker pancarı çok fazla miktarda nitrat içermektedir. Şayet nitratlı gübre atılan topraklarda yetişirse içerdiği nitrat miktarı daha da artar 3. Bu nedenlerden dolayı pancar posası ağırlıklı bir rasyona özellikle karoten ve A vitamini açısından gerekli ilaveler yapılmadığında optik sinir dejenerasyonu sonucu körlük görülebileceği ifade edilmiştir. Alibaşoğlu ve ark. 7 tarafından, kesif pancar posası ile beslenen danalarda gelişen ensefalo-oküler sendromun kesin nedeni açıklanmamasına rağmen A vitamini eksikliğinin de rolü olabileceği ifade edilmiştir. Bu çalışmada, pancar posası ağırlıklı rasyon kullanan sığır işletmelerindeki klinik olarak amorozisli buzağılarda kan serumundaki A vitamini ve β-karoten düzeylerinin saptanması amaçlanmıştır. MATERYAL ve METOT Bu çalışma, klinik olarak amorozis tanısı konan değişik ırk (8 Montafon, 3 Holstein, 2 Simental, 6 Yerli Kara ve 2 melez), yaş ( gün - 6 ay) ve cinsiyette (22 dişi, 8 erkek) toplam 4 buzağı üzerinde yapılmıştır. Anamnezden, buzağı ve annelerine hiç A vitamini yapılmadığı, süt emen buzağılar hariç diğer buzağılara ve annelerine genel olarak yaş (bazıları kuru) şeker pancarı posası, karma yem, kepek, saman verildiği, hayvanların önünde kaya tuzu bulundurdukları, fakat rasyona herhangi bir yem katkısı ilave etmedikleri öğrenilmiştir. Hastalığın klinik tanısında özellikle görme bozuklukları ve oküler lezyonlara dikkat edilmiş, pupillası genişlemiş hastalarda oftalmoskop ile muayeneler yapılmıştır. İshal ve epilepsi gözlenen olgular başta olmak üzere hastaların tümünde gaita örnekleri parazitolojik açıdan incelenmiştir. Tüm hayvanların başta göz muayeneleri olmak üzere genel klinik muayeneleri yapıldıktan sonra 8 β-karoten ve A vitamini tayinleri için usulüne uygun olarak V. jugularis ten kan örnekleri alınmış ve serumları çıkarılmıştır. Örnekler analizler yapılıncaya kadar -2ºC de saklanmıştır. Kan serumu β-karoten ve A vitamini analizleri Suziki ve Katoh un 9 bildirdikleri şekilde Schimadzu UV-28, UV-VIS spektrofotometre ile yapılmıştır. Elde edilen verilerin istatistiksel değerlendirilmeleri SSPS MS Windows Release. bilgisayar programı ile yapılmıştır. BULGULAR Hastaların yapılan klinik muayenelerinde; buzağıların yerlerinden ayrılmaya istekli olmadıkları, yürüdüklerinde gidecekleri yeri ve yönü bulamadıkları; engellere çarparak, sendeleyerek ve sallantılı yürüdükleri dikkati çekmiştir. Gözlerin muayenesinde hastaların çoğunda görme refleksinin (palpebra refleksinin) kısmen veya tamamen kaybolduğu, ışığa cevabın (pupilla refleksinin) azaldığı veya tamamen kaybolduğu, bazı olgularda ekzoftalmus ve korneada konik bir şekilde bombeleşme olduğu saptanmıştır. Hastaların çoğunda pupillanın genişlediği, hatta bazı olgularda tamamen genişleyerek daire şeklini aldığı (mydriasis) belirlenmiştir. Böyle olgularda oftalmoskop ile gözlerin muayenesinde retina damarlarının genişlediği ve yer yer kanamaların olduğu görülmüştür. Yine pupillanın genişlediği olgularda hayvan karanlıkta iken göze gelen ışığın mavi-yeşilimsi renkte bir yansıma gösterdiği (Schönblindheit, güzel körlük) saptanmıştır. Hasta buzağıların 6 sının epileptoit nöbetler geçirdikleri belirlenmiştir. Hastaların anamnezden yaklaşık bir hafta öncesinden başlayan, önceleri günde -2 kez görülen nöbetlerin, son günlerde ise günde 5-6 kez meydana geldiği, bayılmaların birkaç dakika sürdüğü ve daha sonra titreyerek ayağa kalktıkları ve hiçbir şey olmamış gibi annelerini emdikleri anlaşılmıştır. Bu buzağılardan ikisinin klinik muayene esnasında epileptoit nöbet geçirdikleri (aniden yere düştüğü, çırpınma hareketleri yaptığı, şuurun kaybolduğu ve 3-5 dakika sonra düzelerek ayağa kalktığı) gözlenmiştir. Sekiz hastada ise ishal olduğu belirlenmiştir. Gaitaların parazitolojik muayenelerinde 3 hastada koksidia ookistlerine ve 2 hastada da askarit larvalarına rastlanmıştır. Hastaların kan plazmasında ortalama β-karoten ve A vitamini düzeyleri ile maksimum-minimum değerleri Tablo de verilmiştir. Tablo den, tüm buzağılarda kan serumu A vitamini değerlerinin 2 µg/dl nin altında, β-karoten değerlerinin 3 µg/dl nin altında olduğu anlaşılmaktadır Tablo. Amorozisli buzağılarda serumun A vitamini ve β-karoten ortalamaları ile maksimum-minimum değerleri Table. Arithmetic averages, minimum-maximum values of the serum vitamin A and β-carotene in calves with amaurosis Parametre A Vitamini (µg/dl) TARTIŞMA ve SONUÇ β -Karoten (µg/dl) X ± Sx 6.55± ±4.2 Minimum - Maksimum Amorozis, daha çok nedeni bilinmeyen körlükler için kullanılan, gözde makroskopik olarak patolojik değişiklik bulunmayan bir görme bozukluğudur 2,,. Tüm evcil

162 85 GÜL, İSSİ hayvanlarda, özellikle sığırda konjenital veya edinsel ortaya çıkabilir 2,,2. Buzağılarda amorozisin etiyolojisinde nutrisyonel, herediter ve enfeksiyöz faktörler söz konusu ise de A vitamini yetersizliği sığırlarda bilinen amorozis nedenlerinin başında gelir. Hipovitaminozis A tanısı klinik bulgular ve kan serumunda düşük A vitamini değerlerine dayanılarak yapıldığından 4, çalışmada amorozisli buzağılarda saptanan klinik bulgular, bilhassa görme bozuklukları ve oküler lezyonlar ile serum A vitamini düzeyi (ortalama 6.55 µg/dl) değerlendirildiğinde söz konusu hastaların ileri derecede bir A vitamini yetersizliğinden etkilendikleri anlaşılmaktadır 3. Çalışmaya alınan buzağılarda saptanan gözdeki değişiklikler, literatürde,2,4,5,7,2-5 ifade edilen karakteristik göz lezyonları şekillendikten sonra A vitamini yetersizliğinin klinik olarak teşhis edilebileceği görüşünü desteklemektedir 5. Ancak hastalarda oluşabileceği ifade edilen keratitis, kornea ülseri, kseroftalmi gibi belirtilerin,2,7,4-8 bulunmayışı, bu semptomların gelişimine zaman kalmadan hastaların erken dönemde kliniğe getirilmeleri ile açıklanabilir 5,9. Araştırma hayvanlarının bireysel serum A vitamini düzeylerinin çeşitli araştırıcılar 2,,2 tarafından, hipovitaminozis A ya karşı tam bir güvenlik için bildirilen 25 µg/ dl lik değerlerin oldukça altında olduğu saptanmıştır. Yine değişik araştırıcılar 2-23 tarafından, sağlıklı buzağılarda bildirilen ortalama A vitamini değerlerinin de altında olduğu belirlenmiştir. Hatta ortalama serum A vitamini düzeylerinin, Reddy ve Ganapathy 22 ve Stöber 2 tarafından, sığırlarda normal olarak ifade edilen 2 µg/dl lik değerlerin altında olduğu görülmüştür. Hastalarda saptanan serum A vitamini değerlerinin, Altıntaş ve ark. 2 (ortalama 6.2±.49 µg/dl), Anteplioğlu ve ark. 5 (3.6-2 µg/dl, ortalama 6.6 µg/dl), Vasudevan ve Dutt 4 (ortalama 3.36 µg /dl), Reddy ve Ganapathy 22 (4-23 µg /dl, ortalama µg/dl), Şanlı ve ark. 3 ( µg/dl, ortalama 7.35 µg/dl) nın amorozisli sığırlardaki bildirimleriyle uyum içerisinde olduğu anlaşılmaktadır. Araştırma hayvanlarının 3 unda serum β-karoten değerlerinin buzağılar için yetersizlik kabul edilen µg/ dl nin altında, unda ise kritik kabul edilen -3 µg/ dl arasında olduğu gözlenmiştir 2. Çalışma hayvanlarında saptanan ortalama β-karoten değerlerinin Reddy ve Ganapathy 22 ve Surynek ve ark. 23 tarafından, sağlıklı buzağılar için bildirilen sırasıyla 43 µg/dl ve 88 µg/dl lik ortalama değerlerin oldukça altında olduğu belirlenmiştir. Altıntaş ve ark. 2, bakarkör buzağılarda (-6 aylık) ortalama β karoten düzeylerini 4.4±. µg/dl olarak bildirmişlerdir. Reddy ve Ganapathy 22, doğuştan kör olan 7 buzağının kan plazmasında ortalama 42 µg/dl (-6 µg/dl) β-karoten saptadıklarını ifade etmişlerdir. Çalışmada saptanan ortalama β-karoten değerlerinin Altıntaş ve ark. nın 2 bildirimleri ile uyum içerisinde olduğu görülmüştür. Ancak Reddy ve Ganapathy 22 tarafından bildirilen yüksek değerlerin değişik beslenme şartları ve farklı metottan kaynaklandığı düşünülmektedir. Hipovitaminozis A lı buzağılarda serebrospinal sıvı basıncındaki artışa bağlı olarak sıkça rastlanabilecek bir semptom olan epileptoit nöbetler 7,,5,9,22 olguların bir kısmında gözlenmiştir. İssi ve Gül 9, epileptoit nöbet gösteren dört buzağıda A vitamini düzeylerini µg/dl arasında, β-karotenin µg/dl arasında olduğunu saptamışlardır. Reddy ve Ganapathy 22, konvulüsyon gösteren buzağılarda kan plazmasında A vitamini düzeylerinin 9 µg/dl veya daha düşük olduğunu bildirmiştir. Vasudevan ve Dutt 4, sık sık konvulsiyon görülen gece körlüğü bulunan bir buzağıda kan plazması A vitamini düzeyini 3.36 µg/dl olarak bildirmiştir. Çalışmadaki buzağılarda saptanan β-karoten ve A vitamini düzeyleri bu bildirimlerle 4,9,22 uyum içerisindedir. A vitamini yetersizliğine bağlı olarak kataral ve hemorajik tabiatta barsak yangıları ile karşılaşılabileceğine dair litaretür bildirimlerine 7,6 uygun olarak sekiz olguda ishal gözlenmiştir. Olguların bir kısmında gözlenen bu ishallerin serum A vitamini düzeylerinin çok düşük olmasına rağmen, β-karoten yetersizliğine bağlı olarak şekillendiği düşünülmektedir. Zira düşük β-karoten düzeyinin bağırsak epitelleri direncinin kırılmasına ve bağırsak enfeksiyonlarının oluşmasına yardımcı bir faktör olduğu bildirilmektedir 5,6. Ayrıca klasik görüşlerin aksine kolibasillozisin oluşumunda A vitamini yetersizliğinin değil de β-karoten yetersizliğinin hazırlayıcı faktör olduğu ifade edilmektedir 24. Singh ve ark. 7, hipovitaminozis A lı 68 buzağıda ishal gözlemediklerini bildirmiştir. Tıknazoğlu 6 tarafından, iyi saklanmamış yaş pancar posası ile beslenen hayvanlarda şiddetli bir ishal görülebileceği ifade edilmiştir. Lotthammer 25, β-karoten yetersizliğinin buzağı sağlığı üzerindeki etkilerini araştırmış, yeterli A vitamini verilmesine rağmen β-karotence yetersiz beslenen ineklerin buzağılarında daha fazla diyare gözlendiğini ve doğumlarını izleyen ilk haftalarda öldüklerini bildirmiştir. Gazioğlu ve Gül 2 tarafından, yeni doğan ishalli buzağılarda ortalama A vitamini 7.25 µg/dl ve β-karoten değerleri ise 2.95 µg/dl olarak belirlenmiştir. Çalışma buzağılarında saptanan A vitamini ve β-karoten değerleri araştırıcıların 2 bildirimleri ile benzerlik göstermektedir. Şeker fabrikalarının bulunduğu bölgelerde olduğu gibi Elazığ yöresinde de şeker pancarı posası ağırlıklı sığır yetiştirciliği oldukça yaygın yapılmaktadır. Yetiştiricilerin ekonomik olması nedeniyle bu yem maddesini bol miktar-

163 852 Amorozisli Buzağıların Kan... da kullanmaları halinde gerekli ilaveler yapılmadığı zaman posa ağırlıklı rasyon uygulaması ekonomik olmaktan çıkar ve zararlı olabilir 26,27. Aytuğ ve ark. 5 tarafından, İskilip yöresinde genç sığırlarda saptanan hipovitaminozis A olgularında pancar posası ile beslemenin önemli rolü olduğu ifade edilmiştir. Çalışmada buzağılarda saptanan amorozis olgularının, bölgede şeker pancarı posası ile yoğun beslenen sığırların rasyonlarına uygun ve yeterli ilavelerin yapılmamasından kaynaklandığı 4,5,8,26,27, bu nedenle ahırda beslenen hayvanlara β-karotence zengin yemlerin (kuru ot, iyi kalitede silaj ve sarı mısır) verilmesinin 2,2,5,6,24 yanında gebeliğin son dönemlerinde ineklere A vitamini preparatları uygulanmasının buzağı sağlığı açısından faydalı olacağı 2,3,6,24 ve amorozisi önlenebileceği 3,5,6 düşünülmektedir. Sonuç olarak; hastalarda saptanan klinik semptomlar, özellikle görme bozuklukları ve oküler lezyonlar yanında serum A vitamini ve β-karoten düzeylerinde düşüşlerin belirlenmesi olgularda A vitamini yetersizliğinin olduğunu göstermektedir. Bu nedenle amorozisli buzağılarda hipovitaminozis A nın dikkate alınması gerektiği kanısına varılmıştır. KAYNAKLAR. Radostits OM, Gay CC, Hinchcliff KW, Constable PL: Veterinary Medicine. th ed., Saunders Elsevier, Edinburg, London, New York, Oxford, Philadelphia, St Louis, Sydnay, Toronto, Stöber M: Vitaminmangel. In, Rosenberger G (Ed): Krankheiten des Rindes. 3. Auflage. pp. 99-9, Blackwell Wissenchafts-Verlag, Berlin, Gül Y: Geviş Getiren Hayvanların İç Hastalıkları (Sığır, Koyun-Keçi). II. Baskı, Medipres Matbaacılık Ltd. Şti, Malatya, Abrams JT, Bridge PS, Palmer AC, Spatling FR, Sharman IM: Apparent hipovitaminozis A in young cattle in east Anglis. Vet Rec, 73, , Anteplioğlu H, Samsar E, Akın F, Güzel N, Tınar N: Sığırlarda görülen amaurosis olguları ve bunların sağıtımları üzerinde denemeler. Ankara Univ Vet Fak Derg, 24 (2): , Tıknazoğlu B: Sığır beslemede yaş pancar posası kullanımı. Samsun Valiliği İl Tarım Müdürlüğü. No: H/7, Alibaşoğlu M, Ertürk E, Meriç İ: Kesif pancar posasıyla beslenen danalarda görülen encephalo-oculer syndrome. Ankara Univ Vet Fak Derg, 2 (2-3): , Rosenberger G: Die Klinische Untersuchung des Rindes. 3. Auflage, Verlag Paul Parey, Berlin und Hamburg, Suziki J, Katoh N: A Simple and cheap methods for measuring serum vitamin A in cattle using only a spectrophotometer. Jpn J Vet Sci, 42 (6): , 99..Akın F, Samsar E: Göz Hastalıkları. pp , Medipres Matbaacılık Ltd. Şti, Malatya, 2.. Divers TJ, Blackmon DM, Martin CL, Worrel DE: Blindness and convalsions associated with vitamin A deficiency in feedlot steers. JAVMA, 89, , Altıntaş A, Maraşlı Ş, Varol HH: Kapadokya bölgesindeki buzağılarda görülen amaurosis de kanda vitamin A, β-karotin, T-3 ve T-4 düzeyleri. Tr J Vet Anim Sci, 9, 43-5, Şanlı Y, İmren H Y, Kaya S, Koç B, Kahraman M: Isparta yöresinde doğmuş buzağılarda görülen amorozis olguları ile gebe ineklerde karşılaşılan kronik nitrat zehirlenmeleri arasındaki ilişkilerin incelenmesi. Ankara Univ Vet Fak Derg, 3 (4): , Vasudevan B, Dutt B: Eye lesions in vitamin A deficient calves. Ceylon Vet J, 7, 89-94, Aytuğ CN, Ertürk E, Özdöl İ: Çorum-İskilip yöresi süt sığırlarında hypovitaminosis-a olayları ve tedavi denemelerinden alınan sonuçlar. Ankara Univ Vet Fak Derg, 2 (4): , Gaffar MA, Iyer GR: Avitaminosis A in calves. Indian Vet J, 52 (8): 667, Singh RN, Sinha KP, Singh B, Thakur DK: Therapeutic response of vitamin A deficient neonatal calves. Liverstock Adviser Bangalore, India, 6 (2): 53-54, Spratling FR: Complex nutritional deficiency in A group of calves. Br Vet J, 32, , İssi M, Gül Y: Case report: Hypovitaminosis A coupled to epilepsy in four calves. 6 (8-9): , Kohlmeier RH, Burroughs W: Estimation of critical plasma and liver vitamin A levels in feedlot cattle with observations upon influences of body stores and daily dietary requirements. J Anim Sci, 3, 2-8, Gazioğlu A, Gül Y: Sağlıklı ve ishalli neonatal buzağılarda karaciğer dokusu ve kan serumu beta karoten ve vitamin A miktarları ile serum protein fraksiyonları üzerine araştırmalar: I. Kan serumu ve karaciğer dokusu vitamin A ve β-karoten düzeyleri, Fırat Univ Sağlık Bil Derg, 6 (2): 45-48, Reddy JS, Ganapathy MS: Vitamin A deficiency in calves. Indian Vet J, 44, , Surynek J, Kucera A, Brandejs P: Niveau des Beta-Karotins und des A-vitamins im Blut von Saugkaelbern und deren Mütter. Vet Med (Praha), 2 (9): , Gül Y: Elazığ çevresinde halka ait sığırların kan plazmasında vitamin A ve karoten miktarlarının döl verimi ve buzağıların sağlıkları üzerine etkilerinin araştırılması. Fırat Univ Derg (Sağlık Bil), (2/A): 3-2, Lotthammer KH: Importance of β-carotene for the fertility of dairy cattle. Reprinted from Feedstuffs, 5 (43): 6-5, Yılmaz K, Can R, Gül Y: Besi sığırlarının bazı kan parametreleri ile klinik bulguları arasında karşılaştırmalı bir araştırma. Doğa Bil Derg, D9 (): -8, Yılmaz K, Gül Y, Karakılçık AZ: Şeker pancarı posası ile beslenen iki düvede klinik gözlemler. Fırat Univ Sağ Bil Derg, 7 (2): 8-23, 993.

164 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Inhibition of Corneal Neovascularization by Ranibizumab (Lucentis): An Experimental Study in Rabbit Cornea Metin EKİNCİ * Fadime Ulviye YİĞİT ** Mehmet Ersin OBA *** Halil Hüseyin ÇAĞATAY * Ülfettin HÜSEYİNOĞLU **** Selvinaz YAKAN ***** Banu ARSLAN ****** * ** *** **** ***** ****** Kafkas Üniversitesi, Tıp Fakültesi, Göz Hastalıkları Anabilim Dalı, TR-36 Kars - TÜRKİYE Bakırköy Dr. Sadi Konuk Eğitim ve Araştırma Hastanesi, Göz Hastalıkları Kliniği, TR-3447 İstanbul - TÜRKİYE Şişli Etfal Eğitim ve Araştırma Hastanesi, Göz Hastalıkları Kliniği, TR-3437 İstanbul - TÜRKİYE Kafkas Üniversitesi, Tıp Fakültesi, Anesteziyoloji ve Reanimasyon Anabilim Dalı, TR-36 Kars - TÜRKİYE Kafkas Üniversitesi Sağlık Bilimleri Enstitüsü, Cerrahi Anabilim Dalı, TR-36 Kars - TÜRKİYE Elazığ Eğitim ve Araştırma Hastanesi, Göz Hastalıkları Kliniği, TR-23 Elazığ - TÜRKİYE Makale Kodu (Article Code): KVFD Summary The purpose of this study was to evaluate the effects of the use of the subconjunctival injection of ranibizumab (Lucentis) on angiogenesis in the rabbit cornea. Corneas of 2 New Zealand Rabbits were cauterized with silver nitrate crystal. Animals were divided in two groups: control group (GC) that received.2 ml of.9% saline solution; group ranibizumab (GR) that received.5 mg of ranibizumab subconjunctivally at the 24th h after the lesion was formed. Animals corneas were extracted on the 4th day under general anesthesia. The newly formed vessels digital photographs were obtained and analyzed in a computerized system (google sketch-up program). In the control group, neovascularization covered 64.66%±2.8 (mean±standard deviation [SD]) of the corneal surface, compared with 34.7%±4.53 (mean±sd) in the GR group. When vascular density is compared between treated groups, statistical differences were observed (P<.2). The results showed an inhibition of angiogenesis when the control group was compared with ranibizumab treated groups. These results suggest that subconjunctival injection of ranibizumab is able to inhibit corneal angiogenesis. Keywords: Ranibizumab, Rabbit cornea, Neovascularization, Angiogenesis Kornea Neovaskülarizasyonunun Ranibizumab (Lucentis) ile Baskılanması: Tavşan Korneasında Deneysel Çalışma Özet Bu çalışma, tavşan kornea anjiogenezisi üzerine ranibizumab ın (Lucentis) subkonjonktival enjeksiyon kullanımının etkilerini değerlendirmek amacıyla yapıldı. Araştırmada 2 Yeni Zelanda tavşanı kullanılarak korneaları gümüş nitrat kristal ile koterize edildi. Hayvanlar iki gruba ayrıldı. Lezyon oluşturulduktan sonraki 24. saatte kontrol grubuna (GK).2 ml %.9 tuz solüsyonu, ranibizumab grubuna (GR) ise.5 mg ranibizumab subkonjonktival olarak enjekte edildi. Hayvanlar 4. günde korneaları genel anestezi altında alındı. Yeni oluşan damarların dijital fotoğrafları alınarak bilgisayar sistemi ile (google sketch-up programı) incelenmesi yapıldı. Kontrol grubunda neovaskülarizasyonun 64.66%±2.8 (ortalama±standart sapma [SD]) korneal yüzeyi kaplaması, GR grubundaki 34.7%±4.53 (ortalama±standart sapma [SD]) neovaskülarizasyonun korneal yüzeyi kaplaması ile kıyaslandı. Damar yoğunluğu tedavi grupları arasında karşılaştırıldığında, istatistiksel olarak farklılık (P<.2) belirlendi. Sonuç olarak, kontrol grubu ve ranibizumab ile tedavi edilen grup karşılaştırıldığında anjiyogenezin inhibe edildiği saptandı. Bu sonuçlar ranibizumabın subkonjonktival enjeksiyonu ile kornea anjiogenezisinin inhibe edilmesinin mümkün olduğunu göstermektedir. Anahtar sözcükler: Ranibizumab, Tavşan korneası, Neovaskülarizasyon, Anjiogenezis İletişim (Correspondence)

165 854 Inhibition of Corneal Neovascularization... INTRODUCTION Corneal neovascularization represents an important cause of diminished corneal clarity and subsequent reduction of vision. Various models have been proposed to explain corneal clarity and avascularity and also to elucidate corneal neovascularization processes, which may be associated with various inflammatory, infectious, degenerative and traumatic corneal disorders, reaction to corneal transplantation and extended lens wear -3. In addition, corneal neovascularization represents a major reason for corneal graft rejection 4,5. Various risk factors that are associated with an increased likelihood of corneal neovascularization after penetrating keratoplasty have been proposed 4,6. Corneal neovascularization leads to scar formation, lipid deposition, immune rejection of corneal grafts and, therefore, significant visual impairment 7. It represents a major public health concern worldwide, it is the common pathway to blindness from diseases such as trachoma and oncocerciasis, whereas in the US, 4% of the population has corneal neovascularization,5. Various chemical compounds and drugs, such as steroids 8, methotrexate 9, heparin and thalidomide have been proposed as inhibitors of corneal neovascularization. Steroids remain the first choice in clinical practice, because neovascularization is assumed to be secondary to some degree of inflammation. If this is correct, inhibition of inflammation by steroids should also inhibit subsequent neovascularization. However, when inflammation is not the cause of angiogenesis, such as in diseases associated with deficiency of limbal cells or corneal neovascularization secondary to corneal hypoxia, anti-inflammatory corticosteroids have little or no effect on capillary growth. The side effects of steroids, such as glaucoma and cataract formation, should not be underestimated. For the above reasons, effective alternatives are required. Vascular endothelial growth factor (VEGF) has been proven to be a major inducer of corneal neovascularization, both in experimental models and in the human cornea 2-4. VEGF and its tyrosine kinase receptors, flt- and flk-/kdr are key mediators in a variety of angiogenesis models. Adamis and Shima have emphasized that VEGF is both necessary and sufficient for the occurrence of pathologic ocular neovascularization in multiple ocular tissues 5. Corneal epithelial and endothelial cells, vascular endothelial cells of limbal vessels, and fibroblasts and macrophages in scar tissue have all been found to excrete VEGF, especially in inflamed and vascularized corneas 6-8. Therefore, VEGF antagonists that act to inhibit its expression 9 may reduce or even prevent neovascularization. This would be of great clinical usefulness, for example, in minimizing corneal graft failure 2 or improving rehabilitation after alkali burns. It also may benefit diseases that involve deficiency of limbal stem cells and even contact lens-associated corneal neovascularization. Ranibizumab is the Fab fraction of the whole antibody and it also neutralizes all the forms of VEGF-A, it is a nonglycosilated molecule, which makes it 4 times more specific than other anti-vegf s 2,22. Ranibizumab was developed for local ocular anti-angiogenic therapy, to assure better penetration through the retina than obtained with a larger full-sized antibody after an intravitreal injection. In animal models, ranibizumab has been demonstrated to penetrate the retina and reach the subretinal space following intravitreal injection 23. It has been shown to reduce retinal and choroidal neovascularization as well as leakage from established vessels effectively 24. It was found that ranibizumab had a high affinity toward rabbit VEGF but lower by 4-fold compared with its affinity to human VEGF 25. The aim of this study was to evaluate the effects of the use of the subconjunctival injection of ranibizumab.5 mg on angiogenesis in the rabbit cornea that cauterized with silver nitrate crystal. MATERIAL and METHODS This study involved 2 healthy New Zealand albinos white male rabbits, aged -2 months, weighing around kg and were obtained from the Experimental Animal Care Center, Faculty of Veterinary Medicine, Kafkas University (Kars, Turkey). The study was conducted in accordance with the Animal Ethical Guidelines for Investigations in Laboratory Animals and was approved by the Ethical Committee for Medical Experimental Research and Application Centre of Kafkas University (KAÜ-HADYEK/ 2-2). Rabbits were kept under standard conditions (2± C, 2-h light/2-h dark cycles) and were randomly divided into 2 equal groups as control group (GC) and Ranibizumab group (GR) (n=6) respectively. General anesthesia was induced by intramuscular injection of ketamine HCl (Ketalar, Pfizer) (5 mg/kg body weight) and xylazine HCl (Rampun, Bayer) (2 mg/kg body weight), as previously described 26. In addition to the general anesthesia, topical anesthesia was performed into the eyes of all animals with.5% propocaine HCl (Alcaine, Alcon) min after the topical anesthesia was performed, (75% silver nitrate 25% potassium nitrate) alkalic burn was formed by steeping the silver nitrate sticks over cornea during 2 min. No complications as necrosis or perforation was seen. Alcali-induced corneal neovascularization model was performed as decscribed by Roberta et al. 27 with some modifications. The eyes were then carefully rinsed with approximately ml of saline solution. At the first day of the application, by starting treatment a single dose of topical antimicrobial pomade (Tobrased, Bilim İlaç, İstanbul - Türkiye) and drops (Tobrased, Bilim

166 855 EKİNCİ, YİĞİT, OBA, ÇAĞATAY HÜSEYİNOĞLU, YAKAN, ARSLAN İlaç, İstanbul-Türkiye) during a week subconjunctivally anti VEGF agents ranibizumab.5 mg (Lucentis, Genentech/ Novartis) was performed as single dose into the eyes of the rabbits in GR group. Subconjunctival serum was inoculated into the eyes of the rabbits that form the control group. At the 4 th day of the study, by performing sevoflurane (Sevorane Likit, Abbott) anesthesia with mask induction to the subjects under general anesthesia 2.5% (.5 MAC), their corneas were were extracted with 36 degree incision. After their corneas were taken, the operation was finished by being tapped with sclera and conjunctiva 6/ polyglactin 9 suture (Vicryl Ethicon, Johnson&Johnson) and performed antimicrobial pomade. During a week after the operation, 3x antimicrobial drops was used. By being photographed their corneas at digital media, the ratio of neovascularizational zone to all corneal zones was calculated via google sketch-up program. Statistical analyses of the data was performed by t-test. RESULTS In the ranibizumab - treated eyes, the vascular density of new blood vessels was lower than in control eyes. In the control group, neovascularization covered 64.66%±2.8 (mean±standard deviation [SD]) of the corneal surface, compared with 34.7%±4.53 (mean±sd) in the GR group (Fig., 2 and 3). When vascular density is Fig. Corneal neovascularization rate (%) in ranibizumab treated and control groups Şekil. Ranibizumab uygulanan ve Kontrol gruplarında korneal neovaskülarizasyon oranı (%) Fig 2. A rabbit cornea s macroscopic view at 4th day in control group Şekil 2. Kontrol grubunda ki bir tavşanın korneasının 4. gündeki makroskobik görünüşü Fig 3. A rabbit cornea s macroscopic view 4th day in ranibizumab group Şekil 3. Ranibizumab grubundan bir tavşanın korneasının 4. gündeki makroskobik görünüşü

167 856 Inhibition of Corneal Neovascularization... compared between treated groups, statistical differences were observed (P<.2). No adverse effects related to Ranibizumab injection were observed in all treated animals. DISCUSSION Although there are lots of studies upon the control of the corneal neovascularization about bevacizumab, no sufficient number of studies about ranibizumab were noticed. The aim of our study was to evaluate the effects of the use of the subconjunctival injection of ranibizumab on angiogenesis in the rabbit cornea that cauterized with silver nitrate crystal. To maintain the transparency of the cornea, it is very important to maintain vascularity, and for this, the appropriate homeostasis of vascular growth factors should be maintained. When the balance of angiogenic factors such as fibroblast growth factor (FGF) and VEGF, and anjiogenic supressors such as angiostatin, endostatin and pigment epithelium derived factor (PEDF) are disrupted by diseases, neovascularization develops. For the treatment of corneal neovasculature, various drug therapies, laser photocoagulation and surgical therapy have been attempted but established therapeutic methods are not currently available. Recently, photodynamic treatment using verteporfin also has been used for the treatment of corneal neovascularization. Its short term effect has been reported to be very positive, but its long term effect has not been proven 28,29. As surgical therapy on reconstruction of damaged corneas, transplantation of autologous limbal epithelial cells cultured on amniotic membrane has been attempted and positive effects were reported 3. As drug terapy, various drugs have been identified as inhibitors in experimental and clinical corneal neovascularization, including steroids 8,3, non-steroidal antiinflammatory drugs 32, heparin, cyclosporın A 33, methotrexate 9 and thalidomide. Steroids have been the mainstay of treatment for corneal neovascularization and corneal graft rejection in clinical practice. Steroids, however, are not always effective and chronic use may cause glaucoma, as well as precipitate infection or cataract formation. The prominent role of VEGF in the pathophysiology of corneal neovascularization has been demonstrated in experimental models of corneal neovascularization 2,34, in experimental herpes simplex keratitis 35 and in studies from human corneal buttons 4,36. Additionally, VEGF antagonism, whether at the protein or mrna level, has been shown to reduce corneal neovascularization and improve corneal graft survival in experimental animals 2,37. It was demonstrated that a single subconjuctival injection of a VEGF trap can promote a dose-dependent regression of newly formed vessels in a suture-induced model of corneal neovascularization 38. In the initial clinical phase study with neovascular AMD patients,.5 mg of ranibizumab was identified as the maximum tolerated single intravitreal dose, with intraocular inflammation the dose-limiting toxicity 23. The rabbits corneas were extracted at the 4 th day of the study. To achieve detectable accumulation of bevacizumab in the vitreous of the injected rabbit, the dosing interval should be shorter than four half-lives 39. Because the half-life of bevacizumab in the rabbit vitreous is 4.32 days 4, reinjection is needed in the rabbits every 4 th day. The reported vitreous halflife of ranibizumab in monkeys is 3 days 4 and is yet to be determined in rabbits. We tried to do the dosing interval similar to the bevacizumab. In the ranibizumab-treated eyes the vascular density of new blood vessels was lower than in control eyes. In the control group (GC), neovascularization covered 64.66%±2.8 (mean±sd) of the corneal surface, compared with 34.7%±4.53 (mean±sd) in the ranibizumab group (GR). When vascular density is compared between treated groups statistical differences were observed (P<.2). Although our results were highly significant, inhibition of corneal neovascularization was far from complete. There are several possible reasons for this. Firstly, as insufficient dose and/or diffusion and absorption of ranibizumab through the conjunctiva with partial inhibition of VEGF activity. Secondly, it is clear that cytokines other than VEGF (eg, transforming growth factor α and β, and fibroblast growth factor) can induce corneal neovascularization,36. The subconjuctival injection seems to be a good option to inhibit corneal neovascularization. This delivery method is easy and simple to be performed and has minimal related complications. The possible systemic absorption and extra ocular side effects need to be thought and addressed adequately to avoid potential complications. In conclusion, this study showed that subconjuntival injection of Ranibizumab is effective in limiting corneal neovascularization in this rabbit experimental model (Fig. 2 and 3). No adverse effects on the cornea were noted in our study. More research is needed to define the ideal concentration and time of administration to achieve the best clinical outcome. REFERENCES. Chang JH, Gabison EE, Kato T, Azar DT: Corneal neovascularization. Curr Opin Ophthalmol, 2 (4): , Cursiefen C, Kuchle M, Naumann GO: Angiogenesis in corneal diseases: Histopathologic evaluation of 254 human corneal buttons with neovascularization. Cornea, 7 (6): 6-63, Hosseini H, Nejabat MA: Potential therapeutic strategy for inhibition of corneal neovascularization with new anti-vegf agents. Med Hypotheses, 68, 799-8, 27.

168 857 EKİNCİ, YİĞİT, OBA, ÇAĞATAY HÜSEYİNOĞLU, YAKAN, ARSLAN 4. Dana MR, Schaumberg DA, Kowal VO, Goren MB, Rapuano CJ, Laibson PR, Cohen EJ: Corneal neovascularization after penetrating keratoplasty. Cornea, 4 (6): 64-69, Lee P, Wang CC, Adamis AP: Ocular neovascularization: Epidemiologic review. Surv Ophthalmol, 43 (3): , Koay PY, Lee WH, Figueiredo FC: Opinions on risk factors and management of corneal graft rejection in the United Kingdom. Cornea, 24 (3): , Epstein RJ, Stulting RD, Hendricks RL, Harris DM: Corneal neovascularization: Pathogenesis and inhibition. Cornea, 6 (4): , Crum R, Szabo S, Folkman J: A new class of steroids inhibits angiogenesis in the presence of heparin or a heparin fragment. Science, 23 (4732): , Joussen AM, Kruse FE, Völcker HE, Kirchhof B: Topical application of methotrexate for inhibition of corneal angiogenesis. Graefes Arch Clin Exp Ophthalmol, 237 (): , Benelli U, Bocci G, Danesi R, Lepri A, Bernardini N, Bianchi F, Lupetti M, Dolfi A, Campagni A, Agen C, Nardi M, Del Tacca M: The heparan sulfate suleparoide inhibits rat corneal angiogenesis and in vitro neovascularization. Exp Eye Res, 67 (2): 33-42, D Amato RJ, Loughnan MS, Flynn E, Folkman J: Thalidomide is an inhibitor of angiogenesis. Proc Natl Acad Sci USA, 9 (9): , Phillips GD, Stone AM, Jones BD, Schultz JC, Whitehead RA, Knighton DR: Vascular endothelial growth factor (rhvegf65) stimulates direct angiogenesis in the rabbit cornea. In Vivo, 8 (6): , Gan L, Fagerholm P, Palmblad J: Vascular endothelium growth factor (VEGF) and its receptor VEGFR-2 in the regulation of corneal neovascularization and wound healing. Acta Ophthalmol Scand, 82 (5): , Philipp W, Speicher L, Humpel C: Expression of vascular endothelial growth factor and its receptors in inflamed and vascularized human corneas. Invest Ophthalmol Vis Sci, 4 (9): , Adamis AP, Shima DT: The role of vascular endothelial growth factor in ocular health and disease. Retina, 25 (2): -8, Azar DT: Corneal angiogenic privilege: Angiogenic and antiangiogenic factors in corneal avascularity, vasculogenesis, and wound healing (an American Ophthalmological Society thesis). Trans Am Ophthalmol Soc, 4, , Zheng M, Deshpande S, Lee S, Ferrara N, Rouse BT: Contribution of vascular endothelial growth factor in the neovascularization process during the pathogenesis of herpetic stromal keratitis. J Virol, 75 (2): , Mastyugin V, Mosaed S, Bonazzi A, Dunn MW, Schwartzman ML: Corneal epithelial VEGF and cytochrome P45 4B expression in a rabbit model of closed eye contact lens wear. Curr Eye Res, 23 (): -, Zheng M, Schwarz MA, Lee S, Kumaraguru U, Rouse BT: Control of stromal keratitis by inhibition of neovascularization. Am J Pathol, 59 (3): 2-29, Cursiefen C, Cao J, Chen L, Liu Y, Maruyama K, Jackson D, Kruse FE, Wiegand SJ, Dana MR, Streilein JW: Inhibition of lymphagiogenesis and hemangiogenesis after normal-risk corneal transplantation by neutralizing VEGF promotes graft survival. Invest Ophthalmol Vis Sci, 45 (8): , Rodrigues EB, Farah ME, Maia M, Penha FM, Regatieri C, Melo GB: Therapeutic monoclonal antibodies in ophthalmology. Prog Retin Eye Res, 28 (2): 7-44, Lien S, Lowman HB: Therapeutic anti-vegf antibodies. Handb Exp Pharmacol, 8, 3-5, Rosenfeld PJ, Schwartz SD, Blumenkranz MS, Miller JW, Haller JA, Reimann JD, Greene WL, Shams N: Maximum tolerated dose of a humanized anti-vascular endothelial growth factor antibody fragment for treating neovascular age-related macular degeneration. Ophthalmology, 2 (6): 48-53, Aiello LP, Pierce EA, Foley ED, Takagi H, Chen H, Riddle L, Ferrara N, King GL, Smith LE: Suppression of retinal neovascularization in vivo by inhibition of vascular endothelial growth factor (VEGF) using soluble VEGF-receptor chimeric proteins. Proc Natl Acad Sci USA, 92 (23): , Lucentis: Scientific Discussion. Available at: humandocs/humans/epar/lucentis/lucentis.htm. Accessed: February 2, Masatoshi M, Shinji S, Saburo H, Masayuki T: Inhibitory effect of triamcinolone acetonide on corneal neovascularization. Graefes Arch Clin Exp Ophthalmol, 244, Roberta P A Manzano, Gholam A Peyman, Palwasha Khan, Petros E Carvounis, Muhamet Kivilcim, Min Ren, Jonathan C Lake, Patricia Che vez-barrios: Inhibition of experimental corneal neovascularisation by bevacizumab (Avastin). Br J Ophthalmol, 9 (6): 84-87, Primbs GB, Casey R, Wamser K, Snyder WJ, Crean DH: Photodynamic therapy for corneal neovasculaization. Ophthalmic Surg Lasers, 29 (): , Nah HJ, Yoon KC, Im WB, Ahn KY, Seo MS: Animal study of photodynamic therapy with verteporfin in corneal neovascularization. J Korean Opthalmol Soc, 46 (4): 77-75, Tsai RJ, Li LM,Chen JK: Reconstruction of demaged corneas by transplantation of autologous limbal epithelial cells. N Engl J Med, 343 (2): 86-93, Phillips K, Arffa R, Cintron C, Rose J, Miller D, Kublin CL, Kenyon KR: Effects of prednisolone and medroxyprogesterone on corneal wound healing, ulceration and neovascularization. Arch Ophthalmol, (4): , Haynes WL, Proia AD, Klintworth GK: Effects of inhibitors of arachidonic acid metabolism on corneal neovascularization in the rat. Invest Ophthalmol Vis Sci, 3 (7): , Lipman RM, Epstein RJ, Hendricks RL: Suppression of corneal neovascularization with cyclosporine. Arch Ophthalmol, (3): 45-47, Edelman JL, Castro MR, Wen Y: Correlation of VEGF expression by leukocytes with the growth and regression of blood vessels in the rat cornea. Invest Ophthalmol Vis Sci, 4 (6): 2-23, Zheng M, Deshpande S, Lee S, Ferrara N, Rouse BT: Contribution of vascular endothelial growth factor in the neovascularization process during the pathogenesis of herpetic stromal keratitis. J Virol, 75 (2): , Cursiefen C, Rummelt C, Kuchle M: Immunohistochemical localization of vascular endothelial growth factor, transforming growth factor a, and transforming growth factor b in human corneas with neovascularization. Cornea, 9 (4): , Binétruy-Tournaire R, Demangel C, Malavaud B, Vassy R, Rouyre S, Kraemer M, Plouët J, Derbin C, Perret G, Mazié JC: Identification of a peptide blocking vascular endothelial growth factor (VEGF)-mediated angiogenesis. EMBO J, 9 (7): , Liu Y, Cao J, Renard RA, Song H, Hylton H, Rudge JS, Papadopoulos N, Yancopoulos GD, Wiegand SJ: Low dose, subconjuntival administration of VEGF trap inhibits suture-induced corneal neovascularization and inflammation. In, ARVO Annual Meeting, 26, Fortlauderdale. Procedings of the Arvo Annual Meeting, Rockville: Association for Research on Vision and Ophthalmology, Res. 626, Holford NHG, Benet LZ. Pharamacokinetics and pharmacodynamics: rationale dose selection and the time course of drug action. In, Katzung BG (Ed): Basic and Clinical Pharmacology. pp , Norwalk, CT: Lange; Bakri SJ, Snyder MR, Reid JM, Pulido JS, Singh RJ. Pharmacokinetics of intravitreal bevacizumab (Avastin). Ophthalmology, 4 (5): , Gaudreault J, Fei D, Rusit J, Suboc P, Shiu V: Preclinical pharmacokinetics of ranibizumab (rhufabv2) after a single intravitreal administration. Invest Ophthalmol Vis Sci, 46 (2): , 25.

169 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd RESEARCH ARTICLE Esmer Irkı Sığırlarda Süt Verimi Üzerine Etkili Faktörlerin Path Analizi İle Belirlenmesi Yalçın TAHTALI * Aziz ŞAHİN * Zafer ULUTAŞ * Emre ŞİRİN * Samet Hasan ABACI ** * Gaziosmanpaşa Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR-624 Taşlıçiftlik, Tokat - TÜRKİYE ** Eskişehir Osmangazi Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR-266 Bağlar Yerleşkesi, Eskişehir - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada; laktasyon süresi, 35 gün süt verimi, buzağılama yaşı ve buzağılama aralığının gerçek süt verimi üzerine yapmış oldukları etkilere ait path katsayıları hesaplanmıştır. Bu amaçla Konuklar Tarım İşletmesinde yılları arasında yetiştirilen 8 baş Esmer ineğin bazı süt ve döl verim kayıtları kullanılmıştır. Gerçek süt verimi ile 35 gün süt verimi ve laktasyon süresi arasındaki korelasyon katsayıları sırası ile,.75 ve.65 olarak tespit edilmiştir. Faktörlerin gerçek süt verimi üzerine doğrudan etki yüzdeleri; laktasyon süresi ve 35 gün süt verimi için sırası ile, %7.3 ve %. olarak bulunmuştur. Laktasyon süresi ve 35 gün süt veriminin, gerçek süt verimi üzerine olan dolaylı etkileri sırasıyla ve. olarak tespit edilmiştir. Bunun yanında buzağılama aralığı ve buzağılama yaşı için doğrudan etki ve dolaylı etki düşük bulunmuştur. Anahtar sözcükler: Korelasyon, Path analizi, Path katsayısı, Kısmi regresyon katsayısı Determination of Effective Factors for Milk Yield of Brown Swiss Cattle Using by Path Analysis Summary This study was carried out to calculate path coefficients of the effects of lactation length, 35 day milk yield, calving age and calving interval. For this purpose, some milk yields and fertility traits of 8 Brown swiss cows that were raised between years in Konuklar State Farm are used. Coefficient of correlation is between 35 day milk yields and lactation length were estimated as.75 and.65, respectively. Percentages of direct effects of factors on actual milk yield were 7.3% for lactation length,.% for 35 day milk yield. Indirect effect of lactation length and 35 day milk yield on actual milk yield were calculated as and. respectively. In that case, direct and indirect effect for calving interval and calving age were low. Keywords: Correlation, Path analysis, Path coefficient, Partial regression coefficient GİRİŞ Hayvan ıslahı çalışmalarının amacı, populasyonun üzerinde çalışılan özellik bakımından fenotipik değerini iyileştirmektir. Islah çalışmalarında üzerinde durulan özellikler kantitatif karakterli olduğu için, bu özelliklerin ortaya çıkmasında çevre faktörlerinin etkisi büyüktür. Bu nedenle, ekonomik öneme sahip olan bu özelliklere etki eden çevre faktörlerinin ve bu faktörlerin etki düzeylerinin belirlen- mesi gerekmektedir. Bu amaçla korelasyon analizi yaygın olarak kullanılmaktadır. Üzerinde durulan verim ya da verimleri etkileyen faktörler arasındaki ilişkilerin her zaman basit korelasyon katsayıları ile açıklanabilmesi olanaksızdır 2. Çünkü iki değişken arasındaki ilişki, üçüncü bir değişkene ya da değişkenlere bağlı olabilir 3. Çevre faktörlerinin incelenen özelliklere etkisi, doğrudan ya da dolaylı İletişim (Correspondence)

170 86 Esmer Irkı Sığırlarda Süt Verimi... olabilmektedir ve bu nedenle özellikler üzerinde doğrudan veya dolaylı etki oluşturan çevre faktörlerinin ayrıntılı bir şekilde ortaya konulması gerekmektedir. Verim ve verime etkili faktörler arasındaki doğrudan ve dolaylı etkilerin birbirinden ayrılarak incelenmesini sağlayan yöntem path (iz) analizi olarak tanımlanmaktadır 4. Path analizi ile çoklu regresyon analizi birbirine oldukça benzemektedirler 5. Path analizini çoklu regresyondan ayıran temel fark, çoklu regresyon analizinde dikkate alınan varsayımlar altında bir bağımlı değişkenin tek bir analizde tüm bağımsız değişkenler üzerinden analiz edilmesidir. Path analizinde ise birden fazla regresyon analizi yapılabilir. Populasyonda, üzerinde çalışılan kantitatif bir özelliğin gösterdiği varyasyonun, sadece sürekli varyasyon gösteren belli bir faktörden ileri gelen kısmının nispi miktarına path katsayısı denir. Wright 6 tarafından bulunan ve aynı zamanda bir path katsayısı olan standardize edilmiş kısmi regresyon katsayısı, korelasyon katsayısının doğrudan ve dolaylı etkilerini hesaplamak için kullanılmıştır. Daha sonra bu yöntem Li 7 tarafından geliştirilmiştir 2,4,6. Bu araştırmada, Konuklar Tarım İşletmesinde yetiştirilen Esmer ineklerin gerçek süt verimine etki eden bazı faktörlerin (laktasyon süresi, 35 gün süt verimi, buzağılama yaşı ve buzağılama aralığı) doğrudan ve dolaylı etkileri incelenmiştir. Yapılan path analizi ile elde edilen sonuçlar, korelasyon ve kısmi regresyon analizine göre elde edilen sonuçlarla karşılaştırılıp, gerçek süt verimine etki eden faktörlerin tespit edilmesi ve kullanılan metotlarının hangisinin daha uygun olduğunun belirlenmesi amaçlanmıştır. MATERYAL ve METOT Bu araştırmada, Konuklar Tarım İşletmesinde yılları arasında doğan ve yılları arasında yetiştirilen 8 baş Esmer ineğin, gerçek süt verimi (Y), laktasyon süresi (X ), 35 günlük süt verimi (X 2 ), buzağılama yaşı (X 3 ) ve buzağılama aralığına (X 4 ) ait kayıtlar kullanılmıştır. Araştırmada, öncelikle belirlenen özellikler arasındaki korelasyon katsayıları tespit edilmiştir. Gerçek süt verimi (GSV) bağımlı, diğer değişkenler bağımsız olmak üzere regresyon analizi ile değişkenler standardize edilmiştir. İncelenen değişkenlerde ağırlık birimleri kg ve süreler ise gün olarak ifade edilmiş olup, süt verimi ile diğer değişkenler arası doğrudan ve dolaylı etkiler path analizi ile hesaplanmıştır. Verilerin analizinde, SPSS 7. 8 istatistik paket programı kullanılmıştır. Standardize edilmiş değişkenler arasındaki ilişki sistemlerini inceleyen bir analiz tekniği olarak da bilinen path analizi; birbirleriyle sebep-sonuç ilişkisi içinde olduğu düşünülen değişkenler arasındaki ilişkileri gösteren path diyagramlarının oluşturulması, değişkenler arasındaki doğrusal ilişkilerin derecesini gösteren korelasyon katsayıları- nın direkt etkiler, dolaylı etkiler ve bileşik path katsayılarına ayrılarak analiz edilmesi ve analiz sonuçlarının doğru bir şekilde yorumlanması işlemlerini kapsar. Path katsayıları ve bu katsayıların matematiksel olarak belirlenebilmesi, değişkenler arasındaki sebep-sonuç ilişkiler sistemini, bir matematiksel model ile belirlemeyi gerekli kılmaktadır. Path analizinde incelenen kantitatif özelliğin gösterdiği değişimin standart sapma cinsinden sadece belirli bir etkenden ileri gelen kısmı, o etkene ait path katsayısı olarak tanımlanır ve P harfiyle gösterilir 4. Herhangi bir X bağımsız değişkenindeki bir standart sapma değişimine karşılık Y bağımlı değişkeni üzerinde yapmış olduğu etkiyi gösteren path katsayısı aşağıdaki eşitlik ile hesaplanmaktadır. Sx Pyxk b S y k P yx : X bağımsız değişkeninin Y bağımlı değişken üzerinde yapmış olduğu doğrudan etkiyi gösteren path katsayısıdır. S X : X özelliğine ait standart sapma S xkj xk 2 ( ). x 2 kj 2 xkj X. S k xx k n S Y : Y özelliğine ait bütün faktörlerin etkisi ile meydana gelen standart sapma S b: Kısmi regresyon katsayısını göstermektedir. 2 Y Y Y 2 Y Path analizi uygulanan değişkenler arasında; doğrudan, dolaylı, U ve S olmak üzere dört değişik ilişki bulunmaktadır. Söz konusu ilişkiler path katsayıları kullanılarak bir path diyagramı ile gösterilir 9. Path diyagramlarında tek yönlü oklar kullanılmakta ve bu oklar her bağımsız değişkenden kendisine bağımlı olan değişkene doğru çizilmektedir. Sistem içerisinde diğerlerine bağımlı olmayan değişkenler arasındaki korelasyonlar ise iki yönlü oklar tarafından gösterilip, birleştirici eğri biçiminde çizilmektedir. Diyagram üzerinde path katsayılarının sembolik veya sayısal değerleri yazılmaktadır. Ayrıca iki yönlü eğri biçimindeki ok durumunda ise basit korelasyon katsayılarının sembolik veya sayısal değerleri verilebilmektedir. Bir değişkenin diğer bir değişkene yapmış olduğu etki doğrudan etki olarak ifade edilmektedir. Şekil de birinci değişkenin ikinci değişken üzerinde yapmış olduğu doğrudan etki verilmiştir. Doğrudan etkiyi gösteren path katsayısı (P 2 ) ile iki değişken arasındaki korelasyon katsayısının eşit olduğu aşağıdaki eşitlik ile açıklanmaktadır. n n. n y S yy n n 2 () (2) (3)

171 86 TAHTALI, ŞAHİN ULUTAŞ, ŞİRİN, ABACI X X 2 P 2 Şekil. Doğrudan etki gösteren değişkenlere ait path diyagramı Fig. Path diagram for variables of direct effect r 2 = P 2 (4) Şekil 2 incelendiğinde, birinci değişkenin üçüncü değişken üzerinde yapmış olduğu doğrudan etkinin (P 3 ), [4] numaralı eşitlikte gösterildiği gibi değişkenler arasındaki korelasyona eşit olmadığı görülmektedir. P 3 P 2 P 32 X X 2 X 3 Şekil 2. Dolaylı etki gösteren değişkenlere ait path diyagramı Fig 2. Path diagram for variables of indirect effect Bunun nedeni değişkenler arasında Şekil de olduğu gibi sadece doğrudan etki (DE) değil, bunun yanında dolaylı etkinin (IE) de bulunmasıdır. Bu nedenle birinci ve üçüncü değişkenler arasındaki korelasyon katsayısı, doğrudan ve dolaylı etkilerin toplanması ile elde edilmektedir ve aşağıdaki eşitlikle açıklanmaktadır. r 3 = DE + IE= P 3 + P 2.P 32 (5) Diyagramlar vasıtasıyla path ve korelasyon katsayılarından oluşan aşağıdaki denklem serisi oluşturulmaktadır 7. Oluşturulan bu denklemlerin çözümü ile doğrudan ve dolaylı etkiler tahmin edilmektedir. r Y = P Y + r 2 P Y2 + r 3 P Y3 + r 4 P Y4 r Y2 = P Y2 + r 2 P Y + r 23 P Y3 + r 24 P Y4 (6) r Y3 = P Y3 + r 3 P Y + r 23 P Y2 + r 34 P Y4 r Y4 = P Y4 + r 4 P Y + r 24 P Y2 + r 34 P Y3 Eşitliklerde görüldüğü gibi toplam korelasyon doğrudan ve dolaylı etkilere parçalanmış olup, P Yi ; i inci bağımsız değişkenle Y bağımlı değişkeni arasındaki path katsayısını (doğrudan etkiyi), r ij P Yi ; i nci bağımsız değişkenin j nci bağımsız değişken üzerinden bağımlı Y değişkenine etkisini (dolaylı etkiyi) göstermektedir. r Yi ; Y ile i nci bağımsız değişken arasındaki korelasyon katsayısını, r ij ; bağımsız değişkenler arasındaki korelasyon katsayısını ifade etmektedir. Doğrudan ve dolaylı etkilerin toplamı Y ile X i arasındaki korelasyon katsayısını vermektedir. Her doğrusal eşitlikte bir tane doğrudan etki ve bağımsız değişken sayısının bir eksiği kadar dolaylı etki bulunmaktadır. Etki payları, Y ile X i arasındaki doğrudan ve dolaylı etkilerin toplam korelasyon içindeki paylarıdır. Değişkenler arasındaki basit korelasyon katsayıları bulunup, eşitlik [6] da yerlerine konulduğunda dört bilinmeyenli eşitlik sistemi çözülmüş ve sonrasında eşitlik [7] kullanılarak path katsayıları elde edilmiştir. r r r r X Y r2 r3 r4 PY X 2Y r2 r23 r24 PY 2 X 3Y r3 r32 r34 PY 3 X Y r4 r42 r43 PY 4 4 C = A*B - (7) Eşitlik [7] de, sebep ve sonuç değişkenleri arasındaki korelasyonlardan oluşan sütun vektörü (A), sebep değişkenleri arasındaki korelasyon matrisinin (B) inversi ile çarpılarak sebep değişkenlerine ait doğrudan etki miktarları olan path katsayıları vektörü (C) elde edilmiştir. Doğrudan ve dolaylı etkilerden oluşan matrisi elde etmek için C matrisi ile B matrisi çarpılmaktadır. BULGULAR Esmer sığırların gerçek süt verimi (Y), laktasyon süresi (X ), 35 günlük süt verimi (X 2 ), buzağılama yaşı (X 3 ), buzağılama aralığı (X 4 ) ile ilgili tanımlayıcı değerler Tablo de verilmiştir. Araştırmada üzerinde durulan değişkenlere ait basit ve kısmi korelasyon katsayıları ve önem seviyeleri Tablo 2 de verilmiştir. Gerçek süt verimi (Y) ile laktasyon süresi (X ), 35 günlük süt verimi (X 2 ), ve buzağılama aralığı (X 4 ), arasındaki basit korelasyon katsayısı pozitif olarak bulunmuştur (P<.). Gerçek süt verimi (Y) ile 35 günlük süt verimi (X 2 ) arasındaki ilişki.753 ile en yüksek, buzağılama aralığı (X 4 ) ile arasındaki ilişki ise.87 ile en düşük bulunmuştur. 35 gün süt verimi (X 2 ) ile buzağılama yaşı (X 3 ) arasındaki korelasyon pozitif (.9) bulunmasına rağmen Tablo. Verilere ait tanımlayıcı istatistikler Table. Descriptive statistics of data Özellikler N X Sx Gerçek süt verimi (kg) gün süt verimi (kg) Laktasyon Süresi (gün) Buzağılama aralığı (gün) Buzağılama yaşı (gün) N: Birey Sayısı, X: Aritmetik Ortalama, Sx: Standart Hata

172 862 Esmer Irkı Sığırlarda Süt Verimi... Tablo 2. Değişkenler arasındaki basit ve kısmi korelasyon katsayıları ve önem seviyeleri Table 2. Partial and simple correlation coefficients among variables and statistical significance Değişkenler Gerçek Süt Verimi (Y) Laktasyon Süresi (X ) 35 Günlük Süt Verimi (X 2 ) Buzağılama Yaşı (X 3 ) Buzağılama Aralığı (X 4 ) Gerçek Süt Verimi (Y)..99**.99** Laktasyon Süresi (X ).657** **.23** 35 Günlük Süt Verimi (X 2 ).753** ** -.** Buzağılama Yaşı (X 3 ) **.9**. -.49** Buzağılama Aralığı (X 4 ).87**.342** -.46* -.76**. Tablo 3. Standardize edilmiş kısmi regresyon katsayıları ve önem seviyeleri Table 3. Standardized partial regression coefficients and statistical significance Parametre b b 2 b 3 b 4 Katsayı P (P<.), gerçek süt verimi (Y) ile buzağılama yaşı arasındaki fenotipik ilişkinin negatif (-.3) olduğu tespit edilmiştir (P>.5). Buzağılama aralığı ile gerçek süt verimi ve laktasyon süresi arasındaki ilişki pozitif (P<.), laktasyon süresi (X ), ile buzağılama yaşı (X 3 ) arasındaki ilişki negatif olarak saptanmıştır. Esmer ırkı ineklere ait gerçek süt verimi (Y) laktasyon süresi (X ), 35 günlük süt verimi (X 2 ), buzağılama yaşı (X 3 ) ve buzağılama aralığına (X 4 ) ait standardize edilmiş çoklu regresyon denklemi; Y =7.3X + X 2 +.X X 4 olarak bulunmuştur. Bu eşitlikte katsayılar standardize edildiği için a sabiti sıfır olmuştur. Eşitlikteki kısmi regresyon katsayıları, her bir değişkenin sonuç değişkenleri üzerine doğrudan etkilerini ifade eder. Standardize edilmiş kısmi regresyon katsayıları ve önem seviyeleri Tablo 3 te verilmiştir. Esmer sığırlara ait Y bağımlı ve X, X 2, X 3, X 4 bağımsız değişkenleri için path diyagramı Şekil 3 te gösterilmiş olup değişkenlerin birbirleri ile olan ilişkilerinin daha kolay anlaşılabilmesi için eğriler ve oklar üzerinde path katsayıları ve korelasyon katsayıları birlikte verilmiştir. Doğrudan etki paylarına ait path (P) katsayıları ve gerçek süt verimi (Y), laktasyon süresi (X ), 35 gün süt verimi (X 2 ), buzağılama yaşı (X 3 ), buzağılama aralığı (X 4 ) arasındaki doğrudan ve dolaylı etkilere ait path katsayıları ve etki payları Tablo 4 te verilmiştir. Araştırmada path katsayıları için tespit edilen Doğrudan Belirleme Katsayıları path katsayılarının kareleri alınarak elde edilmiştir. r 4,342 r r X r 2 X 2 r 23 X 3 r 34 X Şekil 3. Y bağımlı ve X, X 2, X 3, X 4 bağımsız değişkenleri için path diyagramı PX Y 7.3 PX 2Y. PX 3Y. PX 4Y.22 Fig 3. Y dependent and X, X 2, X 3, X 4 independent variables for path diagram İ Gerçek süt verimi (Y) X e (Hata)

173 863 TAHTALI, ŞAHİN ULUTAŞ, ŞİRİN, ABACI Tablo 4. Gerçek süt verimi (Y), laktasyon süresi (X ), 35 gün süt verimi (X 2), buzağılama yaşı (X 3), buzağılama aralığı (X 4) arasındaki doğrudan ve dolaylı etkilere ait path katsayıları ve etki payları Table 4. Path coefficient for direct and indirect effect among actual milk yield (Y), lactation length (X ), 35 day milk yield (X 2), calving age (X 3), calving interval (X 4) Doğrudan Etki Dolaylı Etki r DBK P Etki Payı (%) X X X X X 2 X X X X 3 X X X E X 4 X X X ** P<.; DBK Doğrudan Belirleme Katsayıları r; korelasyon katsayısı P; path katsayısı TARTIŞMA ve SONUÇ Bir sürünün verimliliği, birden fazla karakterin o sürüdeki düzeyi ile ilgilidir. Bu karakterler ne kadar gelişmiş ise sürüden sağlanacak kazanç o oranda fazla olacaktır. Birden fazla verim dikkate alınarak yapılacak seleksiyonda, söz konusu verimler arasındaki ilişkilerin bilinmesi gerekir. Seleksiyonda tek verim dikkate alınması halinde dahi, bu verimin diğer verimlerde değişme meydana getirip getirmeyeceğinin bilinmesi yararlı olacaktır. Dolayısı ile hayvan ıslahı çalışmalarında, verimler arasındaki ilişkilerin göz önünde bulundurulması gerekmektedir 4. Bu çalışmada, gerçek süt verimi ile laktasyon süresi ve 35 gün süt verimi arasında ki basit korelasyonlar sırasıyla.65 ve.75 olarak belirlenmiştir (Tablo 2). Gerçek süt verimi ile laktasyon süresi arasındaki korelasyon (.65), bazı çalışmalar da,2 belirlenen değerlerden (.78 ve.7) düşük bulunmasına rağmen, bazı araştırmalarda bu iki özellik arasındaki ilişkinin arasında olduğu bildirilmiştir 3-6. Buzağılama aralığı ile gerçek süt verimi arasında tespit edilen ilişki (.8), bazı araştırmacıların 7,8 belirttiği.5-.8 değerlerinden yüksek, Ahmad ve Sivarajasingam 8 ile Muir ve ark. 9, bulgularına yakın bulunmuştur. Gerçek süt verimi ve 35 gün süt verimi arasındaki ilişkiyi.75, Duru ve Tuncel 6.94, Tüzemen ve ark. 2.86, Atay ve ark..87, Amimo ve ark olarak belirlemişlerdir. Bu çalışmada gerçek süt verimi, laktasyon süresi, 35 gün süt verimi, buzağılama yaşı ve buzağılama aralığı için tespit edilen korelasyon katsayıları, genel olarak literatürler ile uyumlu bulunmuştur. Basit korelasyon analizinde buzağılama yaşı (X 3 ) ile gerçek süt verimi (Y) arasında negatif ve önemsiz bulunan ilişki, laktasyon süresi (X ), 35 gün süt verimi (X 2 ) ve buzağılama aralığı (X 4 ) etkisi ortadan kaldırıldığında, pozitif ve önemsiz bulunmuştur. Diğer değişkenlerin etkisi sabit tutulduğunda, gerçek süt verimi (Y) ile laktasyon süresi (X ) ve 35 günlük süt verimi (X 2 ) arasındaki kısmi ve basit korelasyon katsayıları pozitif olarak saptanmıştır. Yapılan path katsayıları analizinde, gerçek süt verimi üzerine (Y), en yüksek ve pozitif yönde doğrudan etkilere sırası ile laktasyon süresi (X ), 35 günlük süt verimi (X 2 ), buzağılama yaşı (X 3 ) ve buzağılama aralığının (X 4 ) sahip olduğu belirlenmiş, bu etkiler sırası ile 7.3,.,. ve.22 olarak tespit edilmiştir. Buzağılama aralığı (X 4 ), laktasyon süresi (X ) üzerinden gerçek süt verimi (Y) üzerine en yüksek ve pozitif yönde dolaylı bir etkiye sahip olurken, buzağılama yaşının (X 3 ) ve 35 gün süt verimi (X 2 ) üzerinden dolaylı etkisi negatif yönde bulunmuştur. Laktasyon süresi (X ), gerçek süt verimi (Y) üzerine, en yüksek ve pozitif yönde doğrudan etkili olmasına rağmen, 35 gün süt verimi (X 2 ) ve buzağılama yaşı (X 3 ) üzerinden gerçek süt verimi üzerine (Y) dolaylı etkilerin düşük ve negatif olduğu belirlenmiştir. Laktasyon süresinin (X ), buzağılama aralığı (X 4 ), 35 günlük

174 864 Esmer Irkı Sığırlarda Süt Verimi... süt veriminin (X 2 ) buzağılama yaşı (X 3 ) üzerinden gerçek süt verimi (Y) üzerine dolaylı etkileri pozitif yönde ve çok küçük olurken, 35 günlük süt veriminin (X 2 ) buzağılama aralığı (X 4 ) ve laktasyon süresi (X ) üzerinden dolaylı etkisi negatif olarak elde edilmiştir. Gerçek süt verimi (Y) üzerine doğrudan etkiler ile dolaylı etkilerde tespit edildiği için, genel olarak bu tür verilerin analizinde path analizi tercih edilmektedir. Diğer değişkenler sabit tutulduğunda, laktasyon süresi (X 2 ) ile gerçek süt verimi (Y) arasındaki standardize edilmiş kısmi regresyon katsayısının yüksek ve pozitif yönde bulunmuş olması, istatistiki değerlendirmelerde bunun iyi bir kriter olacağı anlamına gelmez. Çünkü, path katsayıları analizinde laktasyon süresi (X ) ile gerçek süt verimi (Y) arasındaki doğrudan etki yüksek ve pozitif olarak tespit edilmesine rağmen, buzağılama aralığı (X 4 ) dışında diğer faktörlerin laktasyon süresi (X 2 ) üzerinden dolaylı etkilerinin küçük ve negatif olduğu belirlenmiştir. Bu nedenle bu tür çalışmalarda kısmi regresyon katsayıları yerine, path katsayılarının tercih edilmesi daha uygundur. Path katsayıları analizinde, gerçek süt verimi (Y) üzerine en fazla doğrudan etkide bulunan laktasyon süresi (X 2 ) ve 35 gün süt veriminin (X 2 ) gerçek süt verimi (Y) ile olan kısmi korelasyon ve standardize edilmiş kısmi regresyon katsayılarının da önemli olduğu belirlenmiştir. Gerçek süt verimi (Y) üzerine en az doğrudan etkide bulunan buzağılama aralığı (X 4 ) ile gerçek süt verimi (Y) arasındaki standardize edilmiş kısmi regresyon katsayıları ve kısmi korelasyon katsayılarının önemsiz olduğu tespit edilmiştir. Bu durum, path katsayıları ile standardize edilmiş regresyon katsayıları arasında doğrudan bir ilişkinin olduğunu göstermektedir. Sonuç olarak, Konuklar Tarım İşletmesinde yetiştirilen Esmer ineklere ait verim kayıtlarının değerlendirildiği bu çalışmada, incelenen özellikler içerisinde özellikle laktasyon süresi ve 35 günlük süt veriminin gerçek süt verimi üzerine doğrudan ve dolaylı etki paylarının yüksek olması, gerçek süt verimi ile laktasyon süresi ve 35 günlük süt verimi arasındaki kısmi korelasyon ve standardize edilmiş regresyon katsayıları önemli bulunmuş olması sebebiyle, bu özelliklerin yapılacak seleksiyon çalışmalarında önemli bir kriter olarak göz önünde bulundurulmalarının, yapılacak seleksiyonun etkinliğini arttıracağı söylenebilir. KAYNAKLAR. Keskin İ, Dağ B, Şahin Ö: Anadolu merinosu erkek kuzularında besi başı vücut ölçüleri ile sıcak karkas ağırlığı arasındaki ilişkilerin path analizi ile incelenmesi. Hay Araş Derg, 5 (2): 6-, Topal M, Esenbuğa N: İvesi kuzularının sütten kesim ağırlığına etki eden bazı faktörlerin doğrudan ve dolaylı etkilerinin incelenmesi. Turk J Vet Anim Sci, 25, , Shabana R, Sherref SA, İbrahim AF, Geisler G: Correlation and path coefficient analysis for some new released spring rape seed cultivars under different competetive systems. J Agron Crop Sci, 65, 38-43, Düzgüneş O, Eliçin A, Akman N: Hayvan Islahı. s. 298, Ankara Üniversitesi Ziraat Fakültesi, Ders Kitabı No:437, Ankara, Carey G: Multiple Regression and Path Analysis. edu/~carey/courses/psyc729/handouts/pathanal2.pdf, -5, 998: Accessed: Wright S: Correlation and causation. J Agric Res, 2, , Li C: Path analysis a primer. The Boxwood Press, California/USA, 346, SPSS: SPSS for windows release 7., SPSS Inc., Pedhazur E J: Multiple regression in behavioral research. Harcourt Brace College, Publishers, Forth Worth, 57,997.. İşçi Ö, Takma Ç, Akbaş Y: Siyah Alaca sığırlarda 35 günlük süt verimi üzerine etkili faktörlerin path analizi ile incelenmesi. 4. Ulusal Zootekni Bilim Kongresi, Süleyman Demirel Üniversitesi Ziraat Fakültesi Zootekni Bölümü, Isparta, -4 Eylül, 24.. Atay O, Yener SM, Bakır G, Kaygısız A: Atatürk Orman Çiftliği nde yetiştirilen Siyah-Alaca sığırların süt verim özelliklerine ilişkin genetik ve fenotipik parametre tahminleri. Turk J Vet Anim Sci, 9 (6): , Ahmad M, Van Der Werf JHJ, Javed K: Genetic and phenotypic correlations for some economic traits in dairy cattle. Pak Vet J, 2 (2): 8-86, Ahmad M, Sivarajasingam S: Analysis on the production and reproductive tarits in Sahiwal cows. Proceedings of the 6th World Congress of Genetics Applied to Livestock Production, Armidale, Australia, 25, , Khattab AS, Atıl H: Genetic study of fertility traits and productive in a local born Friesian cattle in Egypt. Pakistan J Biol Sci, 2 (4): Atil H, Khattab SA, Yakupoğlu Ç: Genetic analysis for milk traits in different herds of Holstein-Freisian cattle in Turkey. OnLine J Biol Sci, (8): , Duru S, Tuncel E: Siyah Alaca sığırlarda kuruda kalma süresi, servis periyodu ve ilkine buzağılama yaşı ile bazı süt verim özellikleri arasındaki ilişkiler. Uludağ Üniv Zir Fak Derg, 8 (): 69-79, Chongkasikit N: The impact of adaptive performance on Holstein Breeding in Nothern Thailand. PhD Thesis, Georg-August-University, Göttingen, Germany, Wall E, Brotherstone S, Woolliams JA, Banos G, Coffey MP: Genetic evaluation of fertility using direct and correlated traits. J Dairy Sci, 86, , Muir BL, Fatehi J, Schaeffer LR: Genetic relationships between persistency and reproductive performance in first-lactation Canadian holsteins. J Dairy Sci, 87, , Tüzemen N, Yanar M, Aydin R, Akbulut Ö, Yüksel S, Turgut L, Bayram B, Güler O: Atatürk Üniversitesi Ziraat Fakültesi Çiftliği nde yetiştirilen Siyah Alaca sığırların süt verim özelliklerine ilişkin genetik ve fenotipik parametre tahminleri. Uluslararası Hayvancılık Kongresi, 2-24 Eylül, İzmir, Amimo JO, Wakhungu JW, Inyangala BO, Mosi RO: The effects of non-genetic factors and estimation of genetic and phenotypic parameters and trends for milk yield in Ayrshire cattle in Kenya. Livestock Research For Rural Development 9, 2. htm, Accessed:.2.2.

175 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd.2.38 SHORT COMMUNICATION Polymorphism in Melatonin Receptor A (MTRNA) Gene in Chios, White Karaman and Awassi Sheep Breeds [] İbrahim ŞEKER * Özge ÖZMEN * Bengi ÇINAR KUL ** Okan ERTUĞRUL ** [] The project was supported by Scientific Research Projects Council of Firat University (Project code: FUBAP- 689) * Firat University, Faculty of Veterinary Medicine, Department of Animal Breeding, TR-239 Elazig - TURKEY ** Ankara University, Faculty of Veterinary Medicine, Department of Genetic, TR-6 Ankara - TURKEY Makale Kodu (Article Code): KVFD-2-38 Summary The aim of this study was to investigate polymorphism of the melatonin receptor A gene (MTNRA) in Chios, White Karaman and Awassi sheep breed. A large fragment of the exon II of the MTNRA gene was amplified and uniform fragment of 824 bp was obtained in 38 ewes (48 Chios, 4 White Karaman and 5 Awassi) of three breeds. The PCR products was digested with restriction endonuclease MnlI and RsaI, and genetic polymorphism was detected by PCR-RFLP. Biallelic polymorphism was found with restriction endonuclease MnlI and two genotypes were detected Mm (33bp, 236bp/67bp) and MM (236bp/67bp, 236bp/67bp). Allelic frequency for Chios, White Karaman and Awassi breeds was.9,.8 and.84 respectively for M allele;.,.2 and.6 respectively for m allele, while genotypic frequency was.8,.6 and.68 for MM and.2,.4 and.32 for Mm respectively. No polymorphism at the RsaI cleavage sites was detected in three sheep breeds. Keywords: Turkish sheep breeds, Melatonin receptor A gene, Polymorphism Sakız, Akkaraman ve İvesi Koyun Irklarında Melatonin Reseptör A (MTRNA) Gen Polimorfizmi Özet Bu çalışma Sakız, Akkaraman ve İvesi ırkı koyunlarda melatonin reseptör A (MTNRA) gen polimorfizminin incelenmesi amacıyla yapılmıştır. Çalışmada MTNRA geni ekzon II bölgesi çoğaltılmış ve toplam 38 örnekte (48 adet Sakız, 4 adet Akkaraman ve 5 adet İvesi) 824 bç lik tek PZR ürün elde edilmiştir. Elde edilen PCR ürünleri MnlI ve RsaI enzimleri ile kesilmiştir. MnlI enzim kesimi sonucu iki allel belirlenmiştir. İncelenen ırklarda Mm (33bp, 236bp/67bp) ve MM (236bp/67bp, 236bp/67bp) olmak üzere iki genotip saptanmıştır. Sakız, Akkaraman ve İvesi ırkları için allel frekansları; M alleli için sırasıyla.9,.8 ve.84; m alleli için sırasıyla.,.2 ve.6 bulunmuştur. Genotipik frekanslar ise MM genotipi için sırasıyla.8,.6 ve.68 bulunurken Mm genotipi için.2,.4 ve.32 bulunmuştur. RsaI enzim kesimi için her üç ırkta da polimorfizm saptanmamıştır. Anahtar sözcükler: Yerli koyun ırkları, Melatonin reseptör A geni, Polimorfizm INTRODUCTION The reproductive activity of ovine species in temperate latitude follows a seasonal pattern, influenced by annual variation in day length. In sheep, this mechanism is thought to be due to melatonin, which acts in hypothalamus. Melatonin is an important hormone in animal physiology both for its role in the regulates circadian rhythms and seasonal reproduction. Other actions of the hormone are the inhibition of dopamine release from retina, vaso- regulator activity, immune modulatory roles, and effects on cell growth. Melatonin secretion is rhythmic, with peak levels occurring during night in all vertebrates examined, independent of whether the animal is diurnally or nocturnally active 2. Photoperiod varies in its regulatory effect on the reproductive activity, depending on the species. Sheep and İletişim (Correspondence) /3942

176 866 Polymorphism in Melatonin... goats, maintained at temperate latitudes naturally show increased seasonal breeding activity in autumn, to give birth in spring 3. Photoperiod is the principal environment factor which affects the succession of reproductive periods. Light signal perceived by the retina is translated into hormonal message by pineal gland through melatonin secretion 4. Melatonin shows a low blood-concentration during daylight and high concentration during darkness 5. High melatonin levels, typical during autumn, have a positive influence on reproduction in small ruminants 3. Melatonin functions through specific receptors located in different areas of the central nervous system (CNS), including nuclei which regulate reproduction 3,6. In the ovine species, ovulatory activity of ewes is generally inhibited for several consecutive months of the year, referred to as the anestrous season, which occurs in spring. In Mediterranean latitudes, great variability exists between breeds and within breeds in terms of the presence and duration of anestrous. Some ewes completely cease ovulatory activity, whereas others show isolated ovulations during anoestrus or continue to cycle throughout the year 7. In the Turkish sheep breeds, presence of spontaneous sexual activity during autumn. Investigation of major genes or quantitative trait loci affecting the control of seasonal reproduction in sheep and goat may be an important factor in understanding those neurophysiological processes. One of the those genes is melatonin receptor A (MTNRA) gene 8. The melatonin receptor A (MTNRA) gene has been maped to ovine chromosome 26 and represents two RFLP polymorphic sites, one for MnlI enzyme and one for RsaI enzyme 9. There are eight sites identified by the MnlI enzyme within the amplified sequence 9-. Some studies on meat sheep breeds point out that the presence of the cleavage sites for MnlI and RsaI enzyme in position 66 and 62 respectively and investigated the effects of these genotypes on the reproductive activity 7,. Notter et al. reported that by means of the implied relationship between allelic versions of the gene and reproductive performance of sheep, the genotype at the MTNRA gene locus might become one of the markers used in studying the sexual activity of sheep. The Chios sheep breed has a high milk yield and an outstanding prolificacy. The average litter size is 2.3. The Awassi is principally a milk breed, but meat production from this breed is also important and the twinning rate is -2%. The White Karaman is a breed native to Turkey with a twinning rate of 2-3% 2. It is well known that Chios sheep are highly prolific in comparison with many other breeds. The aim of the present study was to reveal the genetic polymorphism of MTNRA gene in high prolificacy Chios and White Karaman and Awassi sheep breeds. MATERIAL and METHODS Animal Resources and DNA Isolation Jugular blood samples (2 ml per ewe) were collected from 48 Chios sheep, 4 White Karaman sheep, 5 Awassi sheep using EDTA as an anticoagulant. These ewes were chosen at random. Genomic DNA was extracted from the whole blood using the phenol-chloroform method and then it was dissolved in mm Tris-HCl (ph 8.) buffer. The study was approved by the Ethical Committee of Faculty of Medicine, Firat University. 9/2, DNA Amplification and Genotyping Primers for PCR of Messer et al. 9 were employed corresponding to positions (sense primer 5 - TGTGTTTGTGGTGAGCCTGG-3 ) and 8-89 (antisense primer 5 - ATGGAGAGGGTTTGCGTTTA-3 ) of the sequence (GeneBank U49) of exon II of the ovine MTNRA gene from Reppert et al. 3. The expected amplification fragment size was 824 bp. PCR reaction was carried out in 5 µl of total volume, containing X PCR Buffer (5 mm/l KCl, mm/l Tris-HCl (ph 8.),.% Triton X-),.5 mm MgCl 2,.2 mm of each dntp, pm/l of each primer, 5 ng genomic DNA and U Taq DNA polymerase (Eppendorf AG, Hamburg Germany). PCR conditions were as follows: denaturation at 94 C for 5 min, followed by 34 cycles of denaturation at 94 C for min, annealing at 62 C for min, extension at 72 C for min and final extension at 72 C for min, on Mastercycler (Eppendorf AG, Hamburg, Germany). The PCR products were separated by electrophoresis on 2% agarose gel (Promega, Madison,WI,USA) in paralel with a bp DNA marker. PCR product of 5 µl were digested separately with 2U Mnll and (Fermentas GmbH, St. Leon-Rot, Germany) and 2U Rsal (Takara Bio Inc, Shiga, Japan) at 37 C overnight. PCR products of digestion were resolved by electrophoresis on a 4% agarose gel (Promega, Madison,WI,USA). Statistical Analysis Direct counting was used to estimate phenotype and allele frequencies of MTNRA gene Mnll genetic variants. The Chi-Square Test (χ 2 ) was used to evaluate whether the populations were Hardy-Weinberg equilibrium. All calculations and χ 2 analyses were carried out using PopGene32 software 4. RESULT In the present study, the primers for the exon 2 of ovine MTNRA gene were used for amplification genomic DNA three Turkish sheep breeds and uniform fragment was obtained after 2% agarose gel electrophoresis. The results showed that amplification fragment size 824 bp was

177 867 SEKER, OZMEN CINAR KUL, ERTUGRUL consistent with the target one and had good specificity, which could be directly analyzed by RFLP. The results of this study indicated the presence of seven MnlI cleavage sites (22, 254, 324, 56, 582, 6 and 693) within the exon II sequence, but only one (324) was shown to be polymorphic. Allele M contained the restriction site for MnlI and resulted in 236 and 67 bp fragments, whereas the absence of the restriction site in the m allele resulted in a single 33 bp fragment. Allelic and genotypic frequencies of MTNRA gene for MnlI site in three Turkish sheep breeds were presented in Table. As a result, a biallelic polymorphism was found with restriction endonuclease MnlI and two genotypes were detected Mm (33bp, 236bp/67bp) and MM (236bp/67bp, 236bp/67bp). Allelic frequency for Chios, White Karaman and Awassi breeds was.9,.8 and.84 respectively for allele M;.,.2 and.6 respectively for allele m, while genotypic frequency was.8,.6 and.68 for MM and.2,.4 and.32 respectively for Mm. and. respectively). The occurrence of MTNRA gene MnlI variants in this study is similar to other sheep breeds studied previously, but there is a difference with respect to gene frequencies. In this study show that the frequency of the M allele in the breeds used in this study was higher than in the other sheep breeds (Dorset, German Mutton Merino, Hampshire, Sarda, Small Tail Han, Suffolk, Soay, Ile-de France, Texel), 6-8. The results revealed the presence of four RsaI cleavage sites within exon II sequence, but none of these was shown to be polymorphic. The reason for these results may be that the sheep breeds detected were different. Samples from three sheep breeds were found to be in Hardy-Weinberg equilibrium both the MnlI and RsaI. In this study, the 824 bp product of exon 2 of the MTNRA gene was digested with restriction endonuclease MnlI and RsaI in studied populations. For MnlI site, Messer Table.Gene and genotype frequency of the exon II of MTNRA gene for MnlI site in three Turkish sheep breeds Tablo.Türkiye deki üç yerli koyun ırkında MTNRA geninin MnlI enzim kesimi sonucu elde edilen allel ve genotip frekansları Breed n Genotype Frequency Allele Frequency (χ 2 ) a Mm MM mm M m Awassi Ns W. Karaman Ns Chios Ns a Test of Hardy-Weinberg equilibrium; Ns, not significant The results of this study indicated the presence of four RsaI cleavage sites (56, 323, 346 and 757) within exon II sequence, but none of these was shown to be polymorphic. Allele T, in which the polymorphic restriction sites at position 66 is absent, is characterized by the presence of the largest fragment of 29 bp length. Consequently, only one genotype detected in investigated sheep breeds, which is TT (29bp, 29bp). DISCUSSION The 824 bp product of exon 2 of the MTNRA gene was digested with restriction endonucleas MnlI and RsaI in three Turkish native sheep breeds. For MnlI site two allele were found and two genotypes were detected Mm and MM. The results showed that there was a big difference between frequency of alleles M and m. While the most common genotype was Mm, no mm homozygotes were detected in all three populations. The reason may be allele m could be rare; frequency of genotype mm could be so low that mm could not be detected or homozygote mm did not exist. This result was found the similar by Chu et al. 5. Also, Chu et al. 6 reported that in Hu and Small Tail Han sheep breeds, mm genotype is very low frequencies (.4 et al. 9 and Notter et al. find that the 286 bp and 236 bp fragments were polymorphic, in spite of this Pelletier et al. 7, Chu et al. 5, Chu et al. 6 and Carcangiu et al. showed that the 33 bp and 236 bp fragments were polymorphic. The results of this study were consistent with those of Pelletier et al. 7, Chu et al. 5, Chu et al. 6 and Carcangiu et al.. In conclusion, the present study showed that there was a genetic polymorphism at MTNRA gene in Chios, White Karaman and Awassi sheep breeds for the first time. We can state that a biallelic polymorphism was found with restriction endonuclease MnlI, whereas no polymorphism was found RsaI. However future investigation is required to confirm the link with reproductive activity. Any future research should investigate genotypes and its influence on reproductive seasonality. REFERENCE. Carcangui V, Mura MC, Vacca GM, Pazzola M, Dettori ML, Luridiana S, Bini PP: Polymorphism of the melatonin receptor MT gene and its relationship with seasonal reproductive activity in the Sarda sheep breed. Anim Reprod Sci, 6, 65-72, von Gall C, Stehle JH, Weaver DR: Mammalian melatonin receptors: Molecular biology and signal transduction. Cell Tissue Res, 39, 5-62, 22.

178 868 Polymorphism in Melatonin Carcangui V, Vacca GM, Parmeggiani A, Mura MC, Bini PP: Blood melatonin levels relating to the reproductive activity of Sarda does. Small Ruminant Res, 59, 7-3, Goldman BD: Mammalian photoperiodic system: Formal properties and neuroendocrine mechanisms of photoperiodic time measurement. J Biol Rhythms Aug, 6(4): 283-3, Lincoln GA, Johnston JD, Andersson H, Wagner G, Hazlerigg DG: Photorefractoriness in Mammals: dissociating a seasonal timer from the circadian-based photoperiod response. Endocrinology, 46 (9): , Sliwowska JH, Heather BJ, Goodman RL, Coolen LM, Lehman MN: The premammillary hypothalamic area of the ewe: Anatomical characterization of a melatonin target area mediating seasonal reproduction. Biol Reprod, 7, , Pelletier JL, Bodin L, Hanocq E, Malpaux B, Teyssier J, Thimonier J, Chemineau P: Association between expression of reproductive seasonality and alleles of the gene for Mel a receptor in the ewe. Biol Reprod, 62, 96-, Hernandez X, Bodin L, Chesneau D, Guillaume D, Chemineau P, Malpaux B, Migaud M: Relationship between MT melatonin receptor gene polymorphism and seasonal physiological responses in Ile de France ewes. Reprod Nutr Dev, 45, 5-62, Messer LA, Wang L, Tuggle CK, Yerle M, Chardon P, Pomp D, Womack JE, Barendse W, Crawford AM, Notter DR, Rothschild MF: Mapping of the melatonin receptor a (MTNRA) gene in pigs, sheep, and cattle. Mamm Genome, 8(5): , Notter DR, Cockett NE, Hadfield TS: Evaluation of melatonin receptor A as a candidate gene influencing reproduction in autumnlambing sheep flock. J Anim Sci, 8, 92-97, 23.. Barett P, Conway S, Jockers R, Strosberg AD, Guardiola-Lemaitre B, Delagrange P, Morgan PJ: Cloning and functional analysis of a polymorphic variant of the ovine Mel a melatonin receptor. Biochim Biophys Acta, 356 (3): , Akçapınar H: Sheep Breeding, 2nd ed., pp. 9-, 5, Ismat Press, Ankara, Reppert SM, Weaver DR, Ebisawa T: Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses. Neuron, 3, 77-85, Yeh F, Yang RC, Boyle T: Popgene (v..32), Microsoft Windows-based freeware for Population Genetic Analysis, 2. Retrieved from 5. Chu MX, Ji C L, Chen G H: Association betwen PCR RFLP of Melatonin Receptor A Gene and High Prolificacy in Small Tail Han Sheep. Asian Aust J Anim Sci, 6 (2): 7-74, Chu MX, Cheng DX, Liu W Z, Fang L, Ye SC: Association between melatonin receptor A gene and expression of reproductive seasonality in sheep. Asian Aust J Anim Sci, 8, 79-84, Mateescu RG, Lunsford AK, Thonney ML: Association between melatonin receptor A gene polymorphism and reproduction performance in Dorset ewes. J Anim Sci, 87, , Notter DR and Cockett NE: Opportunities for detection and use of QTL influencing seasonal reproduction in sheep: A review. Gent Sel Evol, 37, 39-53, 25.

179 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd SHORT COMMUNICATION Investigation of Toxin Genes of Staphylococcus aureus Strains Isolated from Gangrenous Mastitis in Ewes Osman Yaşar TEL * Özkan ASLANTAŞ ** Oktay KESKİN * Ebru Şebnem YILMAZ *** Cemil DEMİR **** * Harran University, Faculty of Veterinary, Department of Microbiology, TR-632 Sanliurfa - TURKEY ** Mustafa Kemal University, Faculty of Veterinary, Department of Microbiology, TR-34 Hatay - TURKEY *** Mustafa Kemal University, Faculty of Arts and Sciences, Department of Biology, TR-34 Hatay - TURKEY **** Mustafa Kemal University, Faculty of Medicine, Department of Microbiology, TR-34 Hatay - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, it was aimed to determine staphylococcal enterotoxin (SE) genes, toxic shock syndrome toxin (TSST) gene and exfoliative toxin (ET) genes in Staphylococcus aureus strains from gangrenous mastitis cases in seven ewe flocks in Sanliurfa, Turkey. Among investigated isolates, only sec and tst toxin genes were detected. The results of this study showed that the rates of enterotoxin production were high (%) in S. aureus strains isolated from ovine gangrenous mastitis. Moreover, it was demonstrated that S. aureus causing gangrenous mastitis harboured sec and tst genes suggesting that these genes may have a role in ovine mastitis pathogenesis. Keywords: Gangrenous mastitis, Ewe, Staphylococcus aureus, Toxin genes Koyunlarda Gangrenli Mastitislerden İzole Edilen Staphylococcus aureus Suşlarının Toksin Genlerinin Araştırılması Özet Bu çalışmada, Şanlıurfa yöresinde, yedi koyun sürüsündeki gangrenli mastitis vakalarından izole edilen Staphylococcus aureus suşlarında stafilakokal enterotoksin, toksik şok sendrom toksin ve eksfoliatif toksin genleri bakımından araştırılması amaçlandı. İncelenen suşlarda yalnızca sec ve tst toksin genleri saptandı. Bu çalışmanın sonucunda koyunlarda gangrenöz mastitislerden izole edilen S. aureus suşlarında enterotoksin üretiminin yüksek (%) olduğu, izole edilen S. aureus suşlarının sec ve tst genlerini içerdiği ve bu genlerinde koyunlarda mastitisin patogenezisinde rol oynayabileceği kanısına varıldı. Anahtar sözcükler: Gangrenöz mastitis, Koyun, Staphylococcus aureus, Toksin genleri INTRODUCTION Mastitis is an important disease with serious economic consequences, such as reduced milk yield leading to decreased growth of lambs, cost of treatment associated with clinical mastitis and culling due to permanent udder damage in ewes. In severe cases, when gangrene developed in the mammary gland, infection may result in death of ewe. Therefore, mastitis has a major impact on both economy and animal welfare in sheep industry 2. Infectious mastitis outbreaks of small ruminants are usually caused by Gram positive bacteria, mostly Staphylococcus spp.,3. S. aureus is frequently isolated from clinical mastitis cases. S. aureus can produce several virulence factors contributing to its pathogenicity 4. Staphylococcal enterotoxins (SEs) play an important role in staphylococcal diseases, also pose risk for public health due to their ability to cause food poisoning. Toxic shock syndrome toxin- (TSST-) is another toxin produced by S. aureus, which cause toxic shock syndrome in humans 5. Also, some S. aureus strains that produce one or both of two immunologically distinct exfoliative toxins (ETs), ETA and ETB, have been associated with a series of İletişim (Correspondence)

180 87 Investigation of Toxin Genes... impetiginous staphylococcal diseases in humans, referred to as staphylococcal scalded skin syndrome 6. In Turkey, there is no study investigating toxin genes in S. aureus isolated from ewe gangrenous mastitis cases. Thus, we aimed to determine the presence of the SAg genes by polymerase chain reaction (PCR) in S. aureus strains isolated from gangrenous mastitis cases in ewes. MATERIAL and METHODS The study was carried out in 29 and 2. Udder secretions were collected from 63 ewes with gangrenous mastitis, belonging to 7 flocks in Sanliurfa, Turkey. Each flocks located at a distance of 5-5 km from each other and consisted of about 4. dairy Awassi sheep. All flocks were grazed, with some additional concentrate during spring, summer and fall. Ewes were mostly housed during winter and fed wheat straw, barley grain and wheat bran. The ages of the ewes ranged from three to four years and mean milk yield of the ewes were kg per lactation period of 5 days. All ewes lambed between December and January, and the lambs were kept with their dams for 6-8 weeks. Clinical examinations were performed during full lactation between December and April. Gangrenous mastitis was diagnosed with clinical examination by observation of cold and blue skin of udder and teat as well as presence of blood in the milk sample. A minimum of 5 ml milk from one udder lobe was collected in a sterile container, after cleaning the teat with denatured 9% ethanol and discarding the first drops of the secretion. Samples were refrigerated and subjected to microbiological examination within 24 h after sample collection. For microbiological examination, µl of sample were inoculated in 5% sheep blood agar and incubated at 37ºC for h. Identification of S. aureus was performed by inspection of colonies for presence of haemolysis in 5% blood agar, growth and fermentation in Mannitol Salt Agar (MSA), production of free coagulase (BBL Coagulase Plasma Rabbit with EDTA, Becton Dickinson, Heidelberg, Germany) and presence of clumping factor (Staphylase Test, Oxoid, Cambridge, UK) 7. Isolates of S. aureus were examined for toxin genes. DNA Isolation and PCR Amplification of Toxin Genes Bacterial DNA was extracted from S. aureus isolates as reported previously by Sambrook et al. 8. Amplification of toxin genes sea-see and eta-etb, tst were performed by using primers reported by Johnson et al. 6, and those of seg-sei reported by Monday and Bohach 9. The strains for which specific PCR products of expected size were obtained were considered positive. The PCR products were separated by electrophoresis on 2% agarose gel, visualized under ultraviolet light after staining with ethidium bromide. RESULTS Of the toxin genes investigated, sec was detected in all S. aureus isolates, while 97.3% of the isolates harboured tst (Fig. ). None of the isolates harboured other toxin genes DISCUSSION SEC and TSST- belong to the SAg family, and are responsible for a variety of human and animal diseases. Although many types of toxin genes have been reported in S. aureus isolated from ewe mastitis cases, sec was the most encountered one in those studies,. In agreement with the findings of those authors, sec was detected in all isolates in this study. tst gene was detected together with sec gene in 7 (97.3%) isolates in this study. A positive correlation between sec-tst genes has been reported in previous studies,2. Co-existence of these genes could be explained by presence of sec gene on a pathogenicity island together with tst 3. In current study, all S. aureus strains isolated from ovine gangrenous mastitis harboured both sec and tst genes. Approximately 7% of the isolates from milk of mastitic cows in Japan possessed these toxin genes 4. Therefore the results indicated that surperantigenic toxins of S. aureus might play an important role in ovine gangrenous mastitis. The role of these toxins in the udder pathogenicity remains unclear. However Ferens et al. 5 have reported that the superantigens of S. aureus possibly inhibit the immune response in cows. The pathogens can escape or efficiently inhibit the immune response during the infection and continue to survive in the host. Many authors studied the presence of exfoliative toxin genes among S. aureus isolates from bovine mastitis and have reported a rare prevalence of these toxins 6,7. Abcense of these genes in the S. aureus isolates in the tst sec Fig. Agarose gel electrophoresis of sec and tst genes Lane : bp DNA ladder, Lane 2-3: tst (35 bp); Lane 4-5: sec (257 bp); Lane 6: Negative control Şekil. sec ve tst genlerinin agaroz jel elektroforezi Sütun : bp DNA ladder, Sütun 2-3: tst (35 bp), Sütun 4-5: sec (257 bp). Sütun 6: negatif kontrol

181 87 TEL, ASLANTAŞ KESKİN, YILMAZ, DEMİR present study confirms that these genes are rare in S. aureus isolates from ewe mastitis cases. In conclusion, this study indicated that S. aureus strains isolated from ovine gangrenous mastitis carried sec and, to large extent, tst toxin genes. Further studies are needed to clarify possible role of these toxin genes in the pathogenesis of gangrenous mastitis in ewes. REFERENCES. Contreras A, Sierra D, Corrales JC, Marco JC, Paape MJ, Gonzalo C: Mastitis in small ruminants. Small Rumin Res, 68, 45-53, Watkins GH, Jones JET: Mastitis and contagious agalactia. In, Aitken ID (Ed): Diseases of Sheep, 4th ed., 99-5, Blackwell Publishing Ltd, Oxford, UK. 3. Bergonier D, De Cremoux R, Rupp R, Lagriffoul G, Berthelot X: Mastitis of dairy small ruminants. Vet Res, 34, , Bohach GA and Foster TJ: Staphylococcus aureus exotoxins. In, Fischetti V, Novick R, Portnoy D, Rood J (Eds): Gram Positive Pathogens. pp , Washington, USA, Dinges MM, Orwin PM, Schlievert PM: Enterotoxins of Staphylococcus aureus. Clin Microbiol Rev, 3, 6-34, Johnson WM, Tyler SD, Ewan EP, Ashton FE, Pollard DR, Rozee KR: Detection of genes for enterotoxins, exfoliative toxins, and toxic shock syndrome toxin in Staphylococcus aureus by the polymerase chain reaction. J Clin Microbiol, 29, , Quinn PJ, Carter ME, Markey BK, Carter GR: Clinical Veterinary Microbiology. 5th ed., Harcourt Publishers Limited, Spain, Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., Monday SR, Bohach GA: Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in staphylococcal isolates. J Clin Microbiol, 37, , Vasil M: Aetiology of mastitis and enterotoxin production by Staphylococcus sp. isolated from milk of two sheep herds. Slovak J Anim Sci, 4, 89-95, 27.. Orden JA, Goyache J, Hernandez J, Domenech A, Suarez G, Gomez-Lucia E: Detection of enterotoxins and TSST- secreted by Staphylococcus aureus isolated from ruminant mastitis. Comparison of ELISA and immunoblot. J Appl Microbiol, 72, , Zschock M, Risse K, Sommerhauser J: Occurrence and clonal relatedness of sec/tst-gene positive Staphylococcus aureus isolates of quartermilk samples of cows suffering from mastitis. Lett Appl Microbiol, 38, , Fitzgerald JR, Monday SR, Foster TJ, Bohach GA, Hartigan PJ, Meaney WJ, Smyth CJ: Characterization of a putative pathogenicity island from bovine Staphylococcus aureus encoding multiple superantigens. J Bacteriol, 83, 63-7, Katsuda K, Hata E, Kobayashi H, Kohmoto M, Kawashima K, Tsunemitsu H, Eguchi M: Molecular typing of Staphylococcus aureus isolated from bovine mastitic milk on the basis of toxin genes and coagulase gene polymorphisms. Vet Microbiol, 5, 3-35, Ferens WA, Davis WC, Hamilton MJ, Park YH, Deobald CF, Fox L, Bohach G: Activation of bovine lymphocyte subpopulations by staphylococcal enterotoxin C. Infect Immun, 66, , Akineden O, Annemuller C, Hassan AA, Lammler C, Wolter W, Zschock M: Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis. Clin Diagn Lab Immunol, 8, , Larsen HD, Aarestrup FM, Jensen NE: Geographical variation in the presence of genes encoding superantigenic exotoxins and betahemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA. Vet Microbiol, 85, 6-67, 22.

182 Kafkas Univ Vet Fak Derg 7 (5): , 2 DOI:.9775/kvfd CASE REPORT * ** Tatlı Su Istakozlarından (Astacus leptodactylus) Saprolegnia sp. ve Aeromonas hydrophila İzolasyonu Meriç Lütfi AVSEVER * Süleyha HİLMİOĞLU POLAT ** Necla TÜRK * Dilek Yeşim METİN ** Bornova Veteriner Kontrol ve Araştırma Enstitüsü, Ulusal Balık Hastalıkları Referans Laboratuarı, Bakteriyoloji Bölümü, Erzene Mahallesi, Ankara Caddesi, No: 72/55, TR 35 Bornova/İzmir - TÜRKİYE Ege Üniversitesi Tıp Fakültesi, Klinik Mikrobiyoloji Anabilim Dalı, Mikoloji Laboratuarı, TR 35 Bornova/İzmir - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bornova Veteriner Kontrol ve Araştırma Enstitüsü nün İznik gölü kerevitleri üzerinde yaptığı sağlık taraması sırasında altı kerevitin karın bölgelerinde kahverengi melanizasyon saptanmıştır. Lezyonlu bölgelerden alınan doku örneklerinin kültürlerinden Saprolegnia sp, aynı kerevitlerin haemolenflerinden ise Aeromonas hydrophila izole edilmiş olup, bu olgular sunulmuştur. Anahtar sözcükler: Aeromonas hydrophila, Astacus leptodactylus, Saprolegnia sp. Saprolegnia sp. and Aeromonas hydrophila Isolation from Freshwater-Crayfish (Astacus leptodactylus) Summary Brown melanisation was determined in six crayfish abdomen during health surveillance on İznik lake s freshwater-crayfish by Bornova Veterinary Control and Research Institute. While Saprolegnia sp. was isolated from these melanisated tissues of the crayfish, Aeromonas hydrophila was isolated from same crayfish haemolenf. So this case report was offered. Keywords: Aeromonas hydrophila, Astacus leptodactylus, Saprolegnia sp. GİRİŞ Karın ve kıskaçları gıda olarak tüketilen ve düşük kalorili bir protein kaynağı olan kerevitin ülkemizdeki doğal türü Astacus leptodactylus tur. 98 sonlarına kadar çok yüksek olan kerevit stoklarımız 986 yılında ilk kez Çivril gölünde çıkan ve sonra pek çok tatlı su kaynağımıza bulaşan, Aphanomyces astaci isimli bir oomysetin sebep olduğu kerevit vebasının ardından büyük ölçüde tahrip olmuştur 2. Kerevit vebasının dışında ülkemizdeki kerevit stoklarını tahrip eden başka fungal ve bakteriyel enfeksiyonlar ve etken izolasyonları da bildirilmiştir 3,4. Bu durum ülkemizdeki kerevit populasyonunun farklı biyolojik ajanların da tehdidi altında olabileceğini göstermektedir. Bu makalenin amacı, kerevit populasyonumuzu baskı altında tutan kerevit vebası etkeni dışındaki diğer bazı biyolojik ajanlara dikkat çekmektir. OLGULARIN TANIMI Karın bölgesinde kahverengi melanizasyon bulunan altı kerevite İznik Gölü nde Ağustos ayındaki (2) kontrol sırasında rastlandı. Phenoxyethanol (Merc) ile sedasyona alınan 5 kerevitlerin pericardial sinüslerinden haemolenf, lezyonlu karın bölgelerinden ise aseptik koşullarda doku parçaları alındı. Haemolenf örnekleri klasik bakteriyolojik yöntemler 6,7, lezyonlu doku parçaları ise klasik İletişim (Correspondence) /45

183 874 Tatlı Su Istakozlarından... mikolojik yöntemlerle 8-2 muayene edildi. Bakteriyolojik identifikasyon için ayrıca VITEK-2 Compact (bio- Merieux) cihazından yararlanıldı. Lezyon gösteren altı kerevitin tamamının lezyonlu dokularından Saprolegnia sp., haemolenfinden ise A. hydrophila izole edilirken; kontrol sırasında sağlanan diğer lezyonsuz kerevitlerden (6 adet) herhangi bir bakteriyel ya da fungal izolasyon gerçekleştirilmedi. Bakteriyolojik çalışmayla ilgili resimler Şekil (A, B) de, fungal etkenin izolasyonu ve besi yerindeki morfolojisine dair resimler Şekil 2 (A, B, C, D) de, fungal etkenin steril çeşme suyunda zoospor oluşturması ve germinasyonunu gösteren resimler ise Şekil 3 (A, B, C, D ) te gösterilmiştir. TARTIŞMA ve SONUÇ Ülkemizde kerevitlerden Saprolegnia sp. ve A. hydrophila izolasyonunun birlikte yapıldığına dair bir literatür bilgisine rastlanmamıştır. Söderhall ve ark. 3, A. leptodactylus tan Saprolegnia mantar türünün izolasyonunu yapmışlardır. Aynı araştırmacılar etkenin zayıf patojeniteye sahip olduğunu ve genellikle kerevitte hücresel savunma reaksiyonu uyararak melanizasyona neden olduğunu bildirmişlerdir. Melanizasyonla ilgili benzer bilgi A. hydrophila için de belirtilmiştir 4. Noonin ve ark. 4, A. hydrophila nın kerevit haemolenfinin florasında bulunduğu ve fırsatçı patojen olduğunu belirtmesine rağmen, Jiravanichpaisal ve ark. 5, Şekil. A- Kerevitin pericardial sinüsünden haemolenf alınması. B- Haemolenften kanlı agar ortamına yapılan bakteriyel kültür. 25 C, inkubasyonun 2. günü Fig. A- Taking haemolenf from freshwater crayfish pericardial sinus. B- Bacterial culture from haemolenf to blood agar. 25 C, day incubated Şekil 2. A- Kerevitte fungal ekimlerin yapıldığı melanize bölgeler. B- Fungal izolata ait koloni morfolojisi: Koyugri renkte (zaman ilerledikçe kahverengine çalan), seyrek örgülü, bol hifli, hızlı ve her yöne üreme gösteren özellikte. 22 C, İnkubasyonun 4. günü. C- Etkenin kültürden Laktofenol pamuk mavisi ile yapılan boyaması (4 x). Enleri farklı boyutta, nadir septalı, hiyalen hifler ve sporangiumlar. D- Sporongial yapılar içinde spor oluşumu ve spor boşalması Fig 2. A- Melanise regions that fungal culture was done. B- Colony morphology of the fungal isolate: Dark grey colour (Making brown that passed days), rarely plaited, plentiful hiphae, fast and spread to every direction featured. 22 C, 4 days incubated. C- Lactophenol Strain from the culture. The hyphaes that have different wide, seldom septa, hyaline hiphae structer. And that s the sporangiums. D- Be formed spores in sporangial structures and pumping spore

184 875 AVSEVER, HİLMİOĞLU-POLAT TÜRK, METİN Şekil 3. A- Steril musluk suyunda üreme. 22 C, İnkubasyonun. günü. B- Musluk suyundan natif muayene (4 x). Mantar miçhellerinde zoospor yapısının oluşmaya başlaması. C- Musluk suyu ortamında oluşmuş değişik büyüklüklerde zoosporlar. D- Zoosporlarda germinasyonun başlaması Fig 3. A- Fungal cultered in sterile tap water. 22 C, st day incubated. B- Native examination (x 4) from tap water that was fungal cultered. Starting be forming zoospores in fungal micelle. C- Different sizes zoospores that formed in tap water. D- Starting germinating in zoospores kerevitlerde % mortalite ile seyreden A. hydrophila enfeksiyonu saptadıklarını bildirmişlerdir. Aynı çalışmada yüksek virulanslı A. haydrophila ile enfekte edilen tatlı su kerevitlerinin (Pacifastacus leniusculus) 4 C de canlı kaldığı, sıcaklığın 2 C nin üzerine çıkmasıyla ölümlerin hızla başladığı belirtilmiştir. Durmaz ve Türk 6, alabalık ve su örnekleri üzerinde yaptıkları araştırmada su örneklerinden ve balıkların solungaçlarından Aeromonas türlerini izole etmişler, ancak internal organlardan herhangibir izolasyon olmadığını bildirmişlerdir. Bu durum etkenin virulansının düşük olması ve sucul canlılarda sepsise neden olmaması olarak yorumlanabilir. Sonuç olarak, yapılan çalışma tatlı su kereviti (A. leptodactylus) yle ilgili fungal ve bakteriyel çalışmalarla 8-,3,4 uyumlu olmakla birlikte, her iki etkenin aynı kerevitler üzerinde izole edilmesi, lezyonsuz kerevitlerden etken izolasyonu yapılamaması ve özellikle bakteriyel izolasyonun haemolenften ve saf kültür şeklinde gerçekleştirilmiş olması, İznik gölü kerevitlerinde sporadik seyirli bir miks enfeksiyon tablosu olabileceğini akla getirmektedir. Ancak bunun söylenebilmesi için etkenlere dair ileri patojenite çalışmalarına ihtiyaç vardır. KAYNAKLAR. Harlıoğlu MM: Comparative biology of the signal crayfish, Pacifastacus leniusculus (Dana), and thenarrow-clawed crayfish, Astacus leptodactylus Eschscholtz. Unpublished PhD Thesis, University of Nottingham, UK, Baran I, Soylu E: Crayfish plague in Turkey. J Fish Dis, 2 (2): 93-97, Diler Ö, Bolat Y: Isolation of Acremonium species from crayfish, Astacus leptodactylus in Eğirdir Lake. Bull Eur Fish Pathol, 2 (4): 64-68, Patır B, Dinçoğlu AH, İnanlı AG: Keban Baraj Gölü tatlı su ıstakozlarının (Astacus leptodactylus Escholtz, 823) mikrobiyolojik kalitesi ile mikrobiyal florası üzerine araştırmalar. Ege Üniv Su Ürün Derg, 9 (-2): 9-28, Tsantilas H, Galatos AD, Athanassopoulou F, Prassinos N, Kousoulaki K: Efficacy of 2-phenoxyethanol as an anaesthetic for two size classes of white sea bream, Diplodus sargus L., and sharp snout sea bream, Diplodus puntazzo C. Aquaculture, 253 (-4): 64-7, Austin B, Austin DA: Bacterial Fish Pathogens: Disease in Farmed and Wild Fish. Third (Revised) ed., pp.457, Praxis Publishing Ltd, Chichester, UK, Koneman EW, Allen SD, Janda WM, Schreckenber PC, Winn WC: Jr. Color Atlas and Texbook of Diagnostic Microbiology. 5th ed., pp 2-62, Lippincott- Raven Publishers, Philadelphia, USA, Diéguez-Uribeondo J, Cerenius L, Söderhall K: Saprolegnia parasitica and its virulence on three different species of freshwater crayfish, Aquacultere, 2 (3-4): , Hulvey JP, Padgett DE, Bailey JC: Species boundaries within Saprolegnia (Saprolegniales, Oomycota) based on morphological and DNA sequence data. Mycologia, 99 (3): , 27.. Ke XL, Wang JG, Gu ZM, LI M, Gong XN: saprolegnia identification based on their morphological characteristics and its rdna region. Acta Hydrobiologica Sinica, 34 (2): 293-3, 2.. Leclerc MC, Guillot J, Deville M: Taxonomic and phylogenetic analysis of Saprolegniaceae (Oomycetes) inferred from LSU rdna and ITS sequence comparisons. Antonie van Leeuwenhoek International Journal of General and Molecular Micr, 77 (4): , Unestam T: Fungal diseases of crustacea. Rev Med Vet Mycol, 8 (): -2, Söderhall K, Dick MW, Clark G, Fürst M, Constantinescu O: Isolation of Saprolegnia parasitica from the crayfish Astacus leptodactylus. Aquaculture, 92, 2-25, Noonin C, Jiravanichpaisal P, Söderhäll I, Merino S, Tomás JM, Söderhäll K: Melanization and Pathogenicity in the Insect, Tenebrio molitor, and the Crustacean, Pacifastacus leniusculus, by Aeromonas hydrophila AH- 3. PLoS One, 5 (2): Jiravanichpaisal P, Roos S, Edsman L, Liu H, Söderhäll K: A highly virulent p athogen, Aeromonas hydrophila, from the freshwater crayfish Pacifastacus leniusculus. J Invertebr Pathol, (): 56-66, Durmaz Y, Türk N: Alabalık işletmelerinden motil Aeromonasların izolasyonu ve antibiyotiklere duyarlılığının saptanması. Kafkas Univ Vet Fak Derg, 5 (3): , 29.

185 Kafkas Univ Vet Fak Derg 7 (5): 877, 2 DOI:.9775/kvfd LETTER TO EDITOR Generalized Tetanus in A Dog After Ovariohysterectomy (Bir Köpekte Ovariohisterektomi Sonrası Generalize Tetanoz) Mehmet SAHAL * A. Evren HAYDARDEDEOGLU * C. Cagri CINGI ** * Department of Internal Medicine, Faculty of Veterinary Medicine, Ankara University, TR-6 Ankara - TURKEY ** Department of Internal Medicine, Faculty of Veterinary Medicine, Afyon Kocatepe University, TR-32 Afyon - TURKEY Dear Editor, Makale Kodu (Article Code): KVFD We would like to report a rare case of tetanus infection following ovariohysterectomy operation in a dog. Tetanus toxemia is caused by a specific neurotoxin produced by Clostridium tetani in necrotic tissue. Almost all mammals are susceptible to tetanus, although dogs are relatively resistant. C. tetani, an anaerobe microrganism is found in soil and intestinal tracts of mammals. Previously, localised tetanus was diagnosed in two cats 4 and 2 days after ovariohysterectomy by a left flank surgical approach. The diagnosis in each case was based on their history, clinical signs and diagnostic investigations which excluded other possible diagnoses. Both cats showed scoliosis of the lumbar spine and left hind limb spasticity 2. And also ovariohysterectomy related tetanus was reported in dogs 3,4. Fig. Before treatment Şekil. Sağaltım öncesi A five-year old mix breed dog was referred to the Internal Medicine Clinic, with anorexia and unexpected and frequent muscular spasms in entire body. According to the owner s information, the spasms were seen two days after ovariohysterectomy operation. On clinical examination; generalized tonic spasms at both front and hind limb s muscles, photophobia and voice hypersensitivity and chin and pharynx spasms were also observed (Fig.). Abscessation and pus leakage was not detected from the wound. In haematological examination; AST, ALT and ALP levels were mildly increased, whereas CPK level was significantly increased. WBC count was found to be 7.4 x 3 mm 3. Then, it was decided that the condition was patognomonic for the signs of tetanus originating from the surgical site. For treatment, crystallize penicillin (5. IU/kg, QID, IV), tetanus antitoxin (. IU/kg, IV), Lactated Ringer s solution + 5% dextrose solution (IV), spasmolytics and neuroleptics (IV) were administered. Clinical signs were regressed two days after the initial therapy and the appetite improved after six days, all clinical signs were disappeared within days (Fig. 2). We strongly suggest that in all surgical interventions necessary aseptical cautions should be taken into account despite the successful treatment of tetanus infection. Fig 2. After treatment Şekil 2. Sağaltım sonrası REFERENCES. Aiello SE: The Merck Veterinary Manual National Publishing, Inc., Philadelphia, Pennsylvania, USA, Lee EA, Jones BR: Localised tetanus in two cats after ovariohysterectomy. New Zeal Vet J, 44, 5-8, Rubin S, Faulkner RT, Ward GE: Tetanus following ovariohysterectomy in a dog: A case report and review. J Am Anim Hosp Assoc, 9 (3): , Bagley RS, Dougherty SA, Randolph JF: Tetanus subsequent to ovariohysterectomy in a dog. Prog Vet Neurol, 5 (2): 63-65, 994. İletişim (Correspondence)





























































Japon bıldırcınlarında yumurta ak indeksinin ridge regresyon yöntemiyle tahmin edilmesi *

Japon bıldırcınlarında yumurta ak indeksinin ridge regresyon yöntemiyle tahmin edilmesi * Akademik Ziraat Dergisi (): -20 (202) ISSN: 247-6403 http://azd.odu.edu.tr Araştırma (Research) Japon bıldırcınlarında yumurta ak indeksinin ridge regresyon yöntemiyle tahmin edilmesi * Fatih ÜÇKARDEŞ,


Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız.

Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız. TABLO ÜNİVERSİTE Tür ŞEHİR FAKÜLTE/YÜKSOKUL PROGRAM ADI AÇIKLAMA DİL 4 ÇUKUROVA ÜNİVERSİTESİ Devlet ADANA Ziraat Fak. Bahçe Bitkileri MF-2 280,446 255,689 47 192.000 4 ANKARA ÜNİVERSİTESİ Devlet ANKARA



TARIM MAKİNALARI BİLİMİ DERGİSİ ISSN 1306-0007 TARIM MAKİNALARI BİLİMİ DERGİSİ (Journal of Agricultural Machinery Science) 2013 CİLT (VOLUME) 9 SAYI (NUMBER) 3 Sahibi (President) Tarım Makinaları Derneği Adına (On Behalf of Agricultural





ESERLER LİSTESİ. Kuzu rasyonlarına katılan organik selenyumun besi performansı, karkas

ESERLER LİSTESİ. Kuzu rasyonlarına katılan organik selenyumun besi performansı, karkas ESERLER LİSTESİ Doktora Tez Çalışması Kuzu rasyonlarına katılan organik selenyumun besi performansı, karkas kalitesi ve GSH-Px aktivitesi üzerine etkisi Projelerde Yaptığı Görevler 1. Bıldırcınlarda galeopsis





ARAŞTIRMA. Anahtar Kelimeler: Saanen, Kıl keçisi, Melezleme, Büyüme, Yaşama Gücü

ARAŞTIRMA. Anahtar Kelimeler: Saanen, Kıl keçisi, Melezleme, Büyüme, Yaşama Gücü ARAŞTIRMA 2007: 21 (1): 21-26 http://www.fusabil.org Saanen X Kıl Keçisi F1 ve G1 Melezlerinde Büyüme ve Yaşama Gücü Özelliklerinin Araştırılması Ü. Gülcihan ŞİMŞEK Metin BAYRAKTAR Murad GÜRSES Fırat Üniversitesi


Ezgi KARA*, Murat ÇİMEN**, Servet KAYA*, Ümit GARİP*, Mehmet ŞAHİNSOY*

Ezgi KARA*, Murat ÇİMEN**, Servet KAYA*, Ümit GARİP*, Mehmet ŞAHİNSOY* ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Hakkari İlinde Yetiştirilen Yerli Kıl Keçilerden Elde Edilen Sütlerde Toplam Yağ ve Protein Seviyelerinin Türk Standartlarına Uygunluklarının



20. ENSTİTÜLERE GÖRE LİSANSÜSTÜ ÖĞRENCİ SAYILARI NUMBER OF GRADUATE STUDENTS IN THE VARIOUS GRADUATE SCHOOLS 124 TÜRKİYE TOPLAMI T 20971 16738 4233 71398 50986 20412 10693 8329 2364 TOTAL FOR TURKEY K 6856 5444 1412 24797 17661 7136 3981 3173 808 E 14115 11294 2821 46601 33325 13276 6712 5156 1556 ÜNİVERSİTELER















TASARI AKADEMİ YAYINLARI HACETTEPE ÜNİVERSİTESİ (ANKARA) Aile ve Tüketici Bilimleri 4 EA 2 4 249412 DÜZCE ÜNİVERSİTESİ Akçakoca Turizm İşletmeciliği ve Otelcilik Yüksekokulu 4 EA 5 15 220 228166 MARMARA ÜNİVERSİTESİ (İSTANBUL)





1 Kafkas Üniversitesi Kars 02.11.2007/3 17.04.2014. Gıda, Tarım ve Hayvancılık Bakanlığı Erzurum Veteriner Kontrol ve Araştırma Enstitüsü

1 Kafkas Üniversitesi Kars 02.11.2007/3 17.04.2014. Gıda, Tarım ve Hayvancılık Bakanlığı Erzurum Veteriner Kontrol ve Araştırma Enstitüsü Onay ve karar no 1 Kafkas Üniversitesi Kars 02.11.2007/3 17.04.2014 2 3 4 Erzurum Veteriner Kontrol ve Araştırma Enstitüsü Sağlık Bakanlığı Türkiye İlaç ve Tıbbi Cihaz Kurumu Necmettin Erbakan Üniversitesi


First Stage of an Automated Content-Based Citation Analysis Study: Detection of Citation Sentences

First Stage of an Automated Content-Based Citation Analysis Study: Detection of Citation Sentences First Stage of an Automated Content-Based Citation Analysis Study: Detection of Citation Sentences Zehra Taşkın, Umut Al & Umut Sezen {ztaskin, umutal, u.sezen}@hacettepe.edu.tr - 1 Plan Need for content-based


Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi

Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi Muhammet



Doç.Dr. HAYRİYE DEĞER ORAL TOPLU Doç.Dr. HAYRİYE DEĞER ORAL TOPLU Veteriner Fakültesi Zootekni Ve Hayvan Besleme Bölümü Eğitim Bilgileri 1992-1997 Lisans Selçuk Üniversitesi Veteriner Fakültesi Veteriner Pr. 2000-2005 Doktora İstanbul


Japon Bıldırcınlarında Kuluçkalık Yumurta Ağırlığı ve Depolama Süresinin Kuluçka Özellikleri ve Civciv Çıkış Ağırlığı Üzerine Etkileri

Japon Bıldırcınlarında Kuluçkalık Yumurta Ağırlığı ve Depolama Süresinin Kuluçka Özellikleri ve Civciv Çıkış Ağırlığı Üzerine Etkileri Erciyes Üniv Vet Fak Derg 4() -6, 7 J Fac Vet Med Univ Erciyes 4() -6, 7 H.D. ORAL TOPLU, E. DERELİ FİDAN, Araştırma A. NAZLIGÜL Makalesi Research Article Japon Bıldırcınlarında Kuluçkalık Ağırlığı ve









AİLE EKONOMİSİ VE BESLENME ÖĞRETMENLİĞİ GAZİ ÜNİVERSİTESİ AİLE EKONOMİSİ VE BESLENME ÖĞRETMENLİĞİ 386 1399 385 388 19 1250 385 218............................................................ GAZİ ÜNİVERSİTESİ 32.06 1 33.16 1 6.86 2 83.06 1............................................................


Japon Bıldırcınlarında Çeşitli Ağırlık Ölçüleri Arasındaki İlişkinin İncelenmesi

Japon Bıldırcınlarında Çeşitli Ağırlık Ölçüleri Arasındaki İlişkinin İncelenmesi Tr. Doğa ve Fen Derg. Tr. J. Nature Sci. 2014 Vol. 3 No. 1 Japon Bıldırcınlarında Çeşitli Ağırlık Ölçüleri Arasındaki İlişkinin İncelenmesi Şenol ÇELİK *1, Hakan İNCİ 1, Bünyamin SÖĞÜT 1, M. Reşit TAYSI



Prof.Dr. MEHMET KENAN TÜRKYILMAZ Prof.Dr. MEHMET KENAN TÜRKYILMAZ Veteriner Fakültesi Zootekni Ve Hayvan Besleme Bölümü Eğitim Bilgileri 1989-1994 Lisans Ankara ÜniversitesiAnkara Veteriner Fakültesi 1995-1999 Doktora Ve Hayvan Besleme





Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız.

Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız. TABLO ÜNİVERSİTE Tür ŞEHİR FAKÜLTE/YÜKSOKUL PROGRAM ADI AÇIKLAMA DİL 4 GÜLHANE ASKERİ TIP AKADEMİSİ Devlet ANKARA Askeri Tıp Fak. Askeri Tıp Fakültesi Sivil Lise-Erkek MF-3 491,589 470,441 221 17.400 4


T.C. Hitit Üniversitesi. Sosyal Bilimler Enstitüsü. İşletme Anabilim Dalı

T.C. Hitit Üniversitesi. Sosyal Bilimler Enstitüsü. İşletme Anabilim Dalı T.C. Hitit Üniversitesi Sosyal Bilimler Enstitüsü İşletme Anabilim Dalı X, Y, Z KUŞAĞI TÜKETİCİLERİNİN YENİDEN SATIN ALMA KARARI ÜZERİNDE ALGILANAN MARKA DENKLİĞİ ÖĞELERİNİN ETKİ DÜZEYİ FARKLILIKLARININ


Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız.

Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız. 4 HACETTEPE ÜNİVERSİTESİ Devlet ANKARA Fen Fak. Aktüerya Bilimleri MF-1 411,216 337,320 72 66.100 4 ANKARA ÜNİVERSİTESİ Devlet ANKARA Fen Fak. Astronomi ve Uzay Bilimleri MF-1 241,591 197,251 72 315.000



2012 ÖSYS TAVAN VE TABAN PUANLARI 1 ABANT İZZET BAYSAL ÜNİVERSİTESİ (BOLU) Tıp Fakültesi MF-3 103 103 490,69 504,86 483,72 485,47 ACIBADEM ÜNİVERSİTESİ (İSTANBUL) Fizyoterapi ve Rehabilitasyon MF-3 36 36 397,16 444,53 ACIBADEM ÜNİVERSİTESİ



2012 ÖSYS TAVAN VE TABAN PUANLARI ABANT İZZET BAYSAL ÜNİVERSİTESİ(BOLU) İlköğretim Matematik Öğretmenliği MF-1 62 62 382,96 457,21 259,14 305,59 ABANT İZZET BAYSAL ÜNİVERSİTESİ(BOLU) Matematik (İngilizce) MF-1 72 72 279,93 372,86 ABANT



T.C. FIRAT ÜNİVERSİTESİ ÜNİVERSİTE YÖNETİM KURULU KARARLARI 28/11/2012 2012-2013/3 Üniversitemiz Yönetim Kurulu, 28.11.2012 Çarşamba Günü saat 10.00 da Rektör Prof. Dr. Kutbeddin DEMİRDAĞ ın başkanlığında, aşağıda imzaları bulunan üyelerin katılmalarıyla toplanarak gündemdeki konuları





Eser Kemal GÜRCAN 1*, Özden ÇOBANOĞLU 2

Eser Kemal GÜRCAN 1*, Özden ÇOBANOĞLU 2 YYÜ TAR BİL DERG (YYU J AGR SCI) 2012, 22(2): 85-90 Geliş Tarihi(Received): 13.03.2012 Kabul Tarihi (Accepted): 21.05.2012 Araştırma Makalesi/Research Article (Original Paper) Japon Bıldırcınlarında (Coturnix





Sarıkamış Yöresinde Yetiştirici Bilgilerine Dayanarak Büyükbaş Hayvan Beslenme Durumunun Değerlendirilmesi*

Sarıkamış Yöresinde Yetiştirici Bilgilerine Dayanarak Büyükbaş Hayvan Beslenme Durumunun Değerlendirilmesi* Atatürk Üniversitesi Vet. Bil. Derg. 2015; 10(3): 165-170 Araştırma Makalesi/Research Article DOI:10.17094/avbd.70566 Sarıkamış Yöresinde Yetiştirici Bilgilerine Dayanarak Büyükbaş Hayvan Beslenme Durumunun


2013 ÖSYS - LİSANS PROGRAMLARI BOŞ KALAN KONTENJANLAR www.saugundem.com www.facebook.com/saugundem

2013 ÖSYS - LİSANS PROGRAMLARI BOŞ KALAN KONTENJANLAR www.saugundem.com www.facebook.com/saugundem 2013 ÖSYS - LİSANS PROGRAMLARI BOŞ KALAN KONTENJANLAR Programın Kodu Programın Adı Puan Türü ABANT İZZET BAYSAL ÜNİVERSİTESİ (BOLU) Genel Kontenjan Yerleşen Aday Sayısı Boş Kontenjan Min Puan Max Puan



HUKUK GNL GRUP ÜNV ADAY ORT SAP GNL GRUP ÜNV ADAY ORT SAP GNL GRUP ÜNV ADAY ORT SAP LARIN MEZUN OLDUĞU/OLACAĞI ACİL YARDIM VE AFET 71 1208 71 3167 ---- ---- 66 1936 ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ---- ÇANAKKALE ONSEKİZ MART


İstatistiki Bölge Birimleri Sınıflamasına Göre Düzey 2 (TRA1 ve TRA2) Bölgelerinde Büyükbaş Hayvan Varlığı ve Süt Üretiminin Karşılaştırılması

İstatistiki Bölge Birimleri Sınıflamasına Göre Düzey 2 (TRA1 ve TRA2) Bölgelerinde Büyükbaş Hayvan Varlığı ve Süt Üretiminin Karşılaştırılması İstatistiki Bölge Birimleri Sınıflamasına Göre Düzey 2 (TRA1 ve TRA2) Bölgelerinde Büyükbaş Hayvan Varlığı ve Süt Üretiminin Karşılaştırılması Rıdvan KOÇYİĞİT Atatürk Üniversitesi, Ziraat Fakültesi Zootekni



YGS SINAV SONUCUNA GÖRE ÖĞRENCİ ALAN 4 YILLIK ÜNİVERSİTELER YGS SINAV SONUCUNA GÖRE ÖĞRENCİ ALAN 4 YILLIK ÜNİVERSİTELER 2012 Konte Taban Program Adı Açıklama Üniversite Şehir Üniversite Puan Türü Türü njan Puan Bilgisayar ve Öğretim Teknolojileri Öğretmenliği Abant


ZOOTEKNİ BÖLÜMÜ. Araş. Gör. Ertuğrul KUL

ZOOTEKNİ BÖLÜMÜ. Araş. Gör. Ertuğrul KUL ZOOTEKNİ BÖLÜMÜ Araş. Gör. Ertuğrul KUL İletişim Ondokuz Mayıs Üniversitesi Ziraat Fakültesi Zootekni Bölümü 55139 Kurupelit-Samsun Tel: +90 (362) 3121919/1167 Fax: +90 (362) 4576034 E-mail: ekul@omu.edu.tr


Temel Tıp Bilimleri En Küçük/En Büyük ÖYP Puanları Tüm İlanlar (Alan Sınav Puanı Dahil)

Temel Tıp Bilimleri En Küçük/En Büyük ÖYP Puanları Tüm İlanlar (Alan Sınav Puanı Dahil) Temel Tıp Bilimleri En Küçük/En Büyük ÖYP Puanları Tüm İlanlar (Alan Sınav Puanı Dahil) Satır Etiketleri En Küçük Büyük OYP/ASP En Büyük OYP/ASP2 34143 61,904 61,904 PAMUKKALE ÜNİVERSİTESİ 61,904 61,904





daha çok göz önünde bulundurulabilir. Öğrencilerin dile karşı daha olumlu bir tutum geliştirmeleri ve daha homojen gruplar ile dersler yürütülebilir.

daha çok göz önünde bulundurulabilir. Öğrencilerin dile karşı daha olumlu bir tutum geliştirmeleri ve daha homojen gruplar ile dersler yürütülebilir. ÖZET Üniversite Öğrencilerinin Yabancı Dil Seviyelerinin ve Yabancı Dil Eğitim Programına Karşı Tutumlarının İncelenmesi (Aksaray Üniversitesi Örneği) Çağan YILDIRAN Niğde Üniversitesi, Sosyal Bilimler



FARABİ KURUM KODLARI FARABİ KURUM KODLARI İstanbul 1. Boğaziçi D34-FARABİ-01 2. Galatasaray D34-FARABİ-02 3. İstanbul Teknik D34-FARABİ-03 Eskişehir 1. Anadolu D26-FARABİ-01 2. Eskişehir Osmangazi D26-FARABİ-02 Konya 1. Selçuk


2010-2011 Öğretim Yılı Yükseköğretim Kurumlarının Yurt Dışından Öğrenci Kabul Ücretleri

2010-2011 Öğretim Yılı Yükseköğretim Kurumlarının Yurt Dışından Öğrenci Kabul Ücretleri 1 Abant İzzet Baysal 2 Adıyaman 3 Adnan Menderes 4 (dört) katı 4 Afyon Kocatepe Fen-Edebiyat Fakültesi Faculty of Sciences and Arts 1.022.40 TL 5 Afyon Kocatepe İktisadi ve İdari Bilimler Fakültesi 1.126.80


Tuj Kuzularında Farklı Konsantre Yemlerle Yapılan Besinin Maliyet-Fayda Analizi

Tuj Kuzularında Farklı Konsantre Yemlerle Yapılan Besinin Maliyet-Fayda Analizi Kafkas Univ Vet Fak Derg 16 (5): 771-775, 2010 DOI:10.9775/kvfd.2010.1250 RESEARCH ARTICLE Tuj Kuzularında Farklı Konsantre Yemlerle Yapılan Besinin Maliyet-Fayda Analizi Dilek AKSU ELMALI * Pınar DEMİR





2014 Nisan TUS Kadroları (bölüm ismine göre alfabetik sıralı liste)

2014 Nisan TUS Kadroları (bölüm ismine göre alfabetik sıralı liste) 2014 Nisan TUS Kadroları (bölüm ismine göre alfabetik sıralı liste) Abant İzzet Baysal Üniversitesi Acil Tıp 4 K 2 - - Adıyaman Üniversitesi Acil Tıp 4 K 1 - - Adnan Menderes Üniversitesi Acil Tıp 4 K


101110581 Ankara Üniversitesi Mühendislik Fakültesi Bilgisayar Mühendisliği MF-4 2 347,463 359,586 101411037 Atatürk Üniversitesi

101110581 Ankara Üniversitesi Mühendislik Fakültesi Bilgisayar Mühendisliği MF-4 2 347,463 359,586 101411037 Atatürk Üniversitesi Lisans_KODU UniversiteAdi FakulteYuksekOkulAdi ProgramAdi PuanTuru OkulBirincisiKontenjani OBKTabanPuan OBKTavanPuan 102710387 Çanakkale Onsekiz Mart Üniversitesi Çanakkale Sağlık Yüksekokulu Acil Yardım





The Growth Traits of Bafra Sheep (Chios x Karayaka B1) at Kazım Karabekir Agriculture Centre

The Growth Traits of Bafra Sheep (Chios x Karayaka B1) at Kazım Karabekir Agriculture Centre Van Vet J, 2015, 26 (2) 93-99 Van Veterinary Journal http://vfdergi.yyu.edu.tr ISSN: 2149-3359 Original Article e-issn: 2149-8644 The Growth Traits of Bafra Sheep (Chios x Karayaka B1) at Kazım Karabekir


Kınalı Kekliklerin (Alectoris chukar) Canlı Ağırlığına Ait Genetik ve Fenotipik Parametrelerin Şansa Bağlı Regresyon Modeli Kullanarak Tahmini

Kınalı Kekliklerin (Alectoris chukar) Canlı Ağırlığına Ait Genetik ve Fenotipik Parametrelerin Şansa Bağlı Regresyon Modeli Kullanarak Tahmini Süleyman Demirel Üniversitesi Ziraat Fakültesi Dergisi 9 (1):127-131, 2014 ISSN 1304-9984, Araştırma Makalesi A.N. ÖZSOY Kınalı Kekliklerin (Alectoris chukar) Canlı Ağırlığına Ait Genetik ve Fenotipik


TELİF HAKKI DEVİR SÖZLEŞMESİ Bornova Veteriner Kontrol ve Araştırma Enstitüsü Dergisi Makalenin Başlığı:......... Yazar/Yazarlar ve tam isimleri:............ Yayından sorumlu yazarın adı-soyadı, adresi





Cilt:7 Sayı: 1 Volume:7 Issue:1 ISSN: ISPARTA

Cilt:7 Sayı: 1 Volume:7 Issue:1 ISSN: ISPARTA Cilt:7 Sayı: 1 Volume:7 Issue:1 ISSN: 2146-2119 2 0 1 7 ISPARTA SÜLEYMAN DEMİREL ÜNİVERSİTESİ Teknik Bilimler Dergisi Cilt:7 Sayı: 1 Yıl: 2017 SÜLEYMAN DEMİREL UNIVERSITY Journal of Technical Science Volume:7








İlk Tohumlama Döneminde Hamdani Koyunlarının Döl Verimi ve Kuzularının Süt Emme Dönemindeki Yaşama Gücü İle Büyüme Performanslarının Araştırılması

İlk Tohumlama Döneminde Hamdani Koyunlarının Döl Verimi ve Kuzularının Süt Emme Dönemindeki Yaşama Gücü İle Büyüme Performanslarının Araştırılması 13 Uludag Univ. J. Fac. Vet. Med. 25 (2006), 12: 1317 İlk Tohumlama Döneminde Hamdani Koyunlarının Döl Verimi ve Kuzularının Süt Emme Dönemindeki Yaşama Gücü İle Büyüme Performanslarının Araştırılması


TIP FAKÜLTESİ - Tıp Lisans Programı Sıra No Üniversite Program Puan T. Kont. Taban Tavan 1 İstanbul Üniversitesi Tıp (İngilizce) Cerrahpaşa MF-3 77

TIP FAKÜLTESİ - Tıp Lisans Programı Sıra No Üniversite Program Puan T. Kont. Taban Tavan 1 İstanbul Üniversitesi Tıp (İngilizce) Cerrahpaşa MF-3 77 TIP FAKÜLTESİ - Tıp Lisans Programı Sıra No Üniversite Program Puan T. Kont. Taban Tavan 1 İstanbul Üniversitesi Tıp (İngilizce) Cerrahpaşa MF-3 77 526,60898 572,2366 2 Hacettepe Üniversitesi (Ankara)


2015.1 Nisan TUS Kadroları (bölüm ismine göre alfabetik sıralı liste)

2015.1 Nisan TUS Kadroları (bölüm ismine göre alfabetik sıralı liste) 2015.1 Nisan TUS Kadroları (bölüm ismine göre alfabetik sıralı liste) Kadrolar Adıyaman Üni. Tıp F. Acil 4 K 2 - - Adnan Menderes Üni. Tıp F. Acil 4 K 2 - - Afyon Kocatepe Üni. Tıp F. Acil 4 K 1 - - Akdeniz


Mezuniye t Notu 100'lük. Mezuniye t Notu 100'lük. Kamu Yönetimi 77,13 15,426 68, , Mezuniye t Notu 100'lük

Mezuniye t Notu 100'lük. Mezuniye t Notu 100'lük. Kamu Yönetimi 77,13 15,426 68, , Mezuniye t Notu 100'lük T.C. Ad Soyad Fakülte Bölümü 1 Ahmet GÜNDÜZ 79,46 15,892 60,46898 30,234 61 18,3 64,42649 ASIL 2 68,03 13,606 63,50815 31,754 51 15,3 60,660075 ASIL 3 Gürkan AKSOY Gazi Üniversitesi 67,8 13,56 63,49614





Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu

Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu Fırat TOK*, Murat ÇİMEN**,


Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız.

Tercih yaparken mutlaka ÖSYM Kılavuzunu esas alınız. TABLO ÜNİVERSİTE Tür ŞEHİR FAKÜLTE/YÜKSOKUL PROGRAM ADI AÇIKLAMA DİL 4 BAKÜ DEVLET ÜNİVERSİTESİ YDevlet BAKU Filoloji Fak. Azerbaycan Dili ve Edebiyatı TS-2 273,082 232,896 10 301.000 4 BAKÜ SLAVYAN ÜNİVERSİTESİ


İnönü Üniversitesi Farabi Değişim Programı Anlaşmalı Üniversite ve Bölümleri

İnönü Üniversitesi Farabi Değişim Programı Anlaşmalı Üniversite ve Bölümleri İnönü Farabi Değişim Programı Anlaşmalı Üniversite ve Bölümleri Üniversite Bölüm Ö.L L Y.L D Dicle Adalet 2 Süleyman Demirel Adalet 3 Bülent Ecevit Ağırlama Hizmetleri 2 Kırıkkale Ağız Diş Çene Hastalıkları





Tablo 6. Toplam Akademik Performans Puan

Tablo 6. Toplam Akademik Performans Puan Tablo 6. Toplam Akademik Performans Puan ÜNİVERSİTE Makale Atıf Toplam Yayın Doktora Ogretim Uyesi/Ogrenci TOPLAM PUAN 1 HACETTEPE ÜNİVERSİTESİ 156.44 184.57 195.39 155.32 46.65 738.39 2 ORTA DOĞU TEKNİK


Okul Öncesi (5-6 Yaş) Cimnastik Çalışmasının Esneklik, Denge Ve Koordinasyon Üzerine Etkisi

Okul Öncesi (5-6 Yaş) Cimnastik Çalışmasının Esneklik, Denge Ve Koordinasyon Üzerine Etkisi Okul Öncesi (5-6 Yaş) Cimnastik Çalışmasının Esneklik, Denge Ve Koordinasyon Üzerine Etkisi Kadir KOYUNCUOĞLU, Onsekiz Mart Üniversitesi, Beden Eğitimi ve Spor Yüksek Okulu, Çanakkale, Türkiye. koyuncuoglu45@gmail.com



A UNIFIED APPROACH IN GPS ACCURACY DETERMINATION STUDIES A UNIFIED APPROACH IN GPS ACCURACY DETERMINATION STUDIES by Didem Öztürk B.S., Geodesy and Photogrammetry Department Yildiz Technical University, 2005 Submitted to the Kandilli Observatory and Earthquake


28 Kasım 2016 Fırat Üniversitesi 26 Akademik Personel Alacak 11 Ocak Aralık 2016 Abant İzzet Baysal Üniversitesi 23 Akademik Personel Alacak

28 Kasım 2016 Fırat Üniversitesi 26 Akademik Personel Alacak 11 Ocak Aralık 2016 Abant İzzet Baysal Üniversitesi 23 Akademik Personel Alacak 28 Kasım 2016 Fırat Üniversitesi 26 Akademik Personel Alacak 11 Ocak 29 Aralık 2016 Abant İzzet Baysal Üniversitesi 23 Akademik Personel Alacak 12 Ocak 29 Aralık 2016 Abdullah Gül Üniversitesi 2 Akademik





Ege Üniversitesi Elektrik Elektronik Mühendisliği Bölümü Kontrol Sistemleri II Dersi Grup Adı: Sıvı Seviye Kontrol Deneyi.../..

Ege Üniversitesi Elektrik Elektronik Mühendisliği Bölümü Kontrol Sistemleri II Dersi Grup Adı: Sıvı Seviye Kontrol Deneyi.../.. Ege Üniversitesi Elektrik Elektronik Mühendisliği Bölümü Kontrol Sistemleri II Dersi Grup Adı: Sıvı Seviye Kontrol Deneyi.../../2015 KP Pompa akış sabiti 3.3 cm3/s/v DO1 Çıkış-1 in ağız çapı 0.635 cm DO2


Üniversitelerin Elektrik, Elektronik, Bilgisayar, Biyomedikal Mühendislikleri Bölümlerinin. Alfabetik Sıralaması (2005 ÖSYM Puanlarına Göre)

Üniversitelerin Elektrik, Elektronik, Bilgisayar, Biyomedikal Mühendislikleri Bölümlerinin. Alfabetik Sıralaması (2005 ÖSYM Puanlarına Göre) Sıra No Üniversitelerin Elektrik, Elektronik, Bilgisayar, Biyomedikal Mühendislikleri Bölümlerinin Üniversite 1 Sabancı Üniversitesi (İSTANBUL) Vakıf Alfabetik Sıralaması (2005 ÖSYM Puanlarına Göre) Bölüm



2011 - TABLO 7: TÜM ÜNİVERSİTELERİN GENEL PUAN TABLOSU 2011 - TABLO 7: TÜM ÜNİVERSİTELERİN GENEL PUAN TABLOSU Puanlarla ilgili açıklamalar tablonun sonunda verilmektedir. SIRA ÜNİVERSİTE 1 2 3 HACETTEPE ORTA DOĞU TEKNİK İSTANBUL 2010 Yılı Makale Puanı 1 Toplam



YÜKSEKÖĞRETİM KURULU YÜKSEKÖĞRETİM BİLGİ YÖNETİM SİSTEMİ. 17 Mart 2014 Afyon YÜKSEKÖĞRETİM KURULU YÜKSEKÖĞRETİM BİLGİ YÖNETİM SİSTEMİ (Temel İstatistikler) 17 Mart 2014 Afyon Tablo 1. Yükseköğretim Temel Göstergeler Temel Göstergeler Devlet Vakıf Vakıf TOPLAM/OR Üniversiteleri






EN BÜYÜK PUAN PUAN TÜRÜ EN KÜÇÜK PUAN KAMU YÖNETİMİ YEDİTEPE ÜNİV. (İST.) Kamu Yönetimi (Tam Burs) TM- 2 399.70925 405.83489 İSTANBUL ÜNİV. (İST.) Kamu Yönetimi TM- 2 393.22890 433.71128 GAZİ ÜNİV. (ANKARA) Kamu Yönetimi TM- 2 383.63500 429.91429


barajı geçen üniversiteye yerleşiyor (mf)

barajı geçen üniversiteye yerleşiyor (mf) barajı geçen üniversiteye yerleşiyor (mf) www.dogrutercihler.com Üniversite Bölüm Puan T. 1 KAFKAS Ünv. (KARS) Fen Bilgisi Öğretmenliği MF-2 209,5382 230,9985 256000 259000 2 EGE Ünv. (İZMİR) Fizik MF-2



2015-2017 YATIRIMLARI VİZE TABLOSU KURULUŞ: ABANT İZZET BAYSAL ÜNİVERSİTESİ (BİN TL) KURULUŞ: ABANT İZZET BAYSAL ÜNİVERSİTESİ (BİN TL) 2015 2016 2017 800 0 800 884 0 884 975 0 975 A) DEVAM EDEN PROJELER I 800 0 800 a) 2015'den Sonraya Kalanlar 800 0 800 1998H050080 Açık ve Kapalı Spor
