T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ"

Transkript

1 T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN: Dilek SADAK DANIŞMAN : Yrd. Doç. Dr. Dilek TURGUT-BALIK

2 1. GİRİŞ

3 DNA nın üç boyutlu çift sarmal yapısının James Watson, Francis Crick ve onlar kadar tanınmamış iki bilim adamı Rosalind Franklin ve Maurice Wilkins ile çalışma arkadaşlarınca keşfinin üzerinden yarım yüzyılı aşan bir süre geçmiştir.

4 2003 de DNA nın keşfinin 50. yılı kutlanmıştır.

5 "Deoksiribonükleikasit (D.N.A) tuzu için bir yapı önermek isteriz. Bu yapının biyolojik önemde yeni özellikleri vardır". Watson ve Crick Nature'daki makalelerine böyle başlamışlardır. "Kendini kopyalayabilmek" kalıtsal malzemede "bilgi depolamak" gibi olmazsa olmaz özelliklerden birisidir.

6 Genetik malzemenin yapısı bir kez bulunduktan sonra bilim adamları üzerinde çalışabilecekleri bir modelde hızla ilerlemişlerdir. Bilim adamları genetik mekanizmanın temellerini çözdükten sonra ilgilerini onun üzerinde oynayabilecekleri yöntemlere çevirmişlerdir: Gen aktarımı, gen mühendisliği, genetik kopyalama, genom projesi son on yıl içinde zihinlere yerleşen terimler olmuştur.

7 Dr. Martin Kemp "Tarih bazı süper görüntüleri gerçek kullanım alanlarından başka alanlarda da hayatımıza sokmuştur. Bu görüntülerden ilki 1503 yılında Leonardo da Vinci tarafından yapılan Mona Lisa tablosudur demiştir. Tarihte hiçbir molekül yapısı DNA molekülünün ulaştığı üne ulaşamamıştır.

8 1950 sonlarından itibaren DNA molekül yapısı sembol olarak Salvador Dali'ye ilham kaynağı olmuş ve sanatçı "Kelebekler Vadisi" adlı tablosunu yapmıştır.

9 Mark Curtis DNA molekül yapısı için alternatif yeni bir yapı şekli ortaya atmış ve bu yapıyı "Milenyum Koleksiyonu" olarak pul üzerine bastırmıştır.

10 26 Şubat-2 Mart 2003 tarihleri arasında "Cold Spring Horbour Laboratory" da "The Biology of DNA" adlı bir toplantı düzenlenmiş ve katılımcılardan hatıra defterine DNA molekül yapısından esinlenerek imza atmaları istenmiştir.

11 2. GENOMİK İN TARİHÇESİ

12

13

14

15

16

17

18 Rat ve tavuk genomları tamamlandı projeler devam etmektedir

19 3. GENOMİK İN GELİŞİMİNDEKİ MAJOR VE MİNOR TEMALAR

20 Genomik çalışmalar sonrası ortaya çıkan ve ileriki dönemlerde incelenmesi gerektiği düşünülen bilgiler 3 major ve bunları kesen 6 minor temaya ayrılmıştır.

21

22 MAJOR TEMALAR

23 Biyolojiye Yönelik Genomik Bu alandaki çalışmalar kısaca genomun yapısının ve fonksiyonunun tespiti olarak açıklanabilir. İnsan ve seçilen bazı organizmaların genom dizisinin belirlenmesi biyoloji ve biyolojik ilaçlar için temel bilgiyi teşkil eder.

24 Organizma (genel isim) Ekmek Mayası Organizma (özel isim) Saccharomyces cerevisiae Taksonomi Fungus Projenin Durumu Tamamlandı Pirinç Oryza sativa Bitki Tamamlandı Rat Rattus norvegicus Memeli Tamamlandı Şempanze Pan troglodytes Memeli Devam ediyor Fare Mus musculus Memeli Devam ediyor İnsan Homo sapiens Memeli Tamamlandı Plasmodium Plasmodium Plasmodium falciparum Plasmodium vivax Parazit Parazit Tamamlandı Tamamlandı Plasmodium P. yoelii yoelii Parazit Tamamlandı

25 Plasmodium Genom Projeleri Dünya Sağlık Örgütü (WHO) tarafından açıklanan rakamlara göre dünya nüfusunun yüzde 40'ını tehdit eden sıtmaya her yıl dünyada milyon kişi yakalanmakta ve yaklaşık 3 milyon insan bu hastalıktan ölmektedir. Plasmodium ların var olan ilaçlara karşı direnç göstermeye başlaması bilim adamlarını alternatif mücadele yöntemleri geliştirmeye zorlamaktadır.

26 İnsanı infekte eden P. falciparum un en ölümcül tür olması bu organizmanın önemini artırmaktadır. P. falciparum, genom dizisi açıklanan ilk ökaryotik parazittir ve genom dizisinin tamamı 2002 de yayınlanmıştır. İnsanı infekte eden ve hem dünyada hem de Türkiye de en yaygın Plasmodium türü olan P. vivax 'ın genom projesi 2004 de bitirilmiştir.

27 Şempanze Genom Projesi İnsan şempanze DNA karşılaştırması iki canlı arasındaki farklılıkların beklenenden daha karmaşık olduğunu ortaya çıkarmıştır. Şempanzenin 22. kromozomu ile bunun insanda karşılığı olan 21. kromozomun dizilimi karşılaştırılmış, önemli farklılıkları ortaya koymuştur.

28 Şempanzenin 22. kromozomunun %1.44'ünün, SNP (Single nucleotide polymorphisms) den meydana geldiği; 'e yakın bölgede de indels (insersiyon ve delesyon) lere sahip olduğu anlaşılmıştır.

29 Sağlığa Yönelik Genomik Sağlığa yönelik genomik genom bazlı bilgilerin sağlığa uygulanması olarak nitelendirilebilir.

30 Genetik olan ve olmayan etkilerin tam olarak anlaşılması sonucu hastalıklara uygulanan tedavi yöntemleri değişecek, korunma yolları geliştirilebilecektir. Genomik bilginin tedavi alanında kullanılabilmesi amaçlı mekanizmalar geliştirilmesine imkan tanıyacaktır. Bu mekanizmalarla bireysel gengen ve gen-çevre etkileşimi açıklanıp vücut ilaç direnci anlaşılabilecek ve bireye özgü ilaç teknolojisi olarak bilinen farmakogenetik bilimlerinin gelişmesine neden olacaktır.

31 Genetik yapının bilinmesi sağlıklı yaşamı şu yollarla etkileyebilir: Birey sahip olduğu genetik riskleri bileceğinden çevresel faktörlerden ne derece etkileneceğini tahmin edebilir. Kişiye özgü tedaviden yararlanılabilir. Sağlık harcamaları düşer.

32 Fare ve Sıçan Genom Projeleri İnsanlar ve şempanzelerden sonra fareler ve sıçanlar gen haritası tamamlanan diğer memelilerdir. İlaç araştırmalarında fare ve sıçanlar, insanlar üzerinde yapılacak klinik deneyler öncesinde ilaçların etkinliğini ve yan etkilerini belirlemede kullanılmaktadırlar.

33 Fare genom haritasının taslağı 2002 yılında açıklanmıştır. 2,75 milyar baz çiftine sahip sıçan genomu, yaklaşık 3 milyar baz çiftine sahip insan genomundan daha küçük 2,6 milyar baz çiftinden oluşan fare genomundan ise daha büyüktür.

34 Topluma Yönelik Genomik Toplum açısından bu çalışmalar; ırk ve etnik grupların tespiti, toplum kökenlerinin araştırılması, kriminal davaların çözümlenmesinin kolaylaşması, sahip olunan genetik kodun davranışlara etkisinin çözümlenmesi amaçlı kullanılacaktır.

35 Genomik çalışmalar olabildiğince topluma yararlı yönde olmalı, toplum sağlığını ve varlığını tehdit edecek yönde kullanılmamalıdır.

36 İnsan Genom Projesi

37

38 Projenin temel amacı; İnsan kromozomlarının fiziksel haritasını çıkarmak, İnsan DNA sında bulunan yaklaşık üç milyar baz çiftinin dizilimini ve bunları oluşturan genlerin yerini tespit etmek, Genlerin daha ileri biyolojik araştırmalar için ulaşılabilir kılınmasını sağlamak,

39 Diğer organizmaların da genom dizilerini belirleyerek insanınki ile karşılaştırmak, Bunun gerçekleştirilmesi için yeni teknikler geliştirmek, Elde edilecek bilgileri tarım, sağlık, çevre, enerji gibi alanlarda değerlendirmek, Proje sonucunda ortaya çıkabilecek ahlaki, sosyal ve yasal unsurları belirlemektir.

40 İnsan Genom Projesi nin ilk çalışmalarında iki yol izlenmiştir: İnsan ve fare genomları haritalanarak genetik hastalıklar üzerinde çalışılmış ve genom taslağı oluşturulurken bu bilgiler kullanılmıştır. Küçük ve basit organizmaların genomu kullanılarak yeni metodlar geliştirilmiş ve insan genomunun açıklanmasında yardımcı bilgi olarak kullanılmıştır.

41 Resmi olarak 1990 yılında başlayan projenin gelişim sürecinde; Kasım 1990 da bir milyarıncı baza ulaşılması kutlanmıştır. Haziran 2000 de İnsan Genom Haritası nın %90 nından fazlasının tamamlandığını açıklamıştır.

42 Şubat 2001 de International Human Genome Sequencing Corsortium (IHGSC) ve Celera Genomics Şirketi nin her birinin ayrı ayrı yayınladığı raporlar insan genomunun ilk ayrıntılı taslak dizisini ortaya koymuştur: Celera Genomics insan genlerinin toplamının bin civarında olduğunu rapor etmiştir. Konsorsiyum insan genomunda bin protein kodlayan genin bulunduğunu, geçerli genom dizisinin nükleotid kapsadığını rapor etmiştir.

43 Raporda ökromatik genomu %99 oranında doğru ve bazda 1 hata oranı içerebileceği belirtilmiştir. Ökromatik genom yaklaşık 2.88 Gb tır. İnsan genomunun tamamı yaklaşık olarak 3.08 Gb tır. Geriye kalan 0.20 Gb lık kısım heterokromatik genomdur ve henüz tespit edilmemiştir.

44 İnsan genom katalogunda i bilinen gen, i ise tahmin edilen gen olmak üzere gen lokusu bulunmaktadır. Gen lokusları, lokus başına yaklaşık 10.4 ekson, transkript başına ise yaklaşık 9.1 ekson olmak üzere toplam eksona sahiptir.

45 Bu dizilerin tespitinden sonra; İnsan genomunun sistematik olarak çalışması, Genlerin tanımlanması, Proteinlerin yapılarının tanımlanması, Yer değiştirebilen elementlerin araştırılması Polimorfizmin dağılımının belirlenmesi, Genetik rekombinasyon ve fiziksel mesafe arasındaki ilişkinin anlaşılması mümkün olmuştur.

46 İnsan Genom Projesi nin sağlayacağı düşünülen faydalar; İnsan genomundaki bireysel farklılıkların bulunması, Genetik hastalıkların erken safhada tespiti, Farklı canlı gurupları arasında genomun nükleotid diziliminin karşılaştırılması,

47 Farmakolojide yararlanılması Mikrobiyal genomikte yararlanılması, Biyoarkeoloji ve insan göçleri konusunda yapılan çalışmalara faydası, Hayvancılık, ziraat ve bio-endüstri sahasında yapacağı katkılar,

48 İnsan Genom Projesi nin ortaya çıkaracağı muhtemel zararlar; Genetik bilgilerin kişiye kalması ve gizliliği konusunda tehlike beklentisi, Genetik üstünlükler kazandırılmasına yönelik kaygılar, Gen tedavisi ile ilgili kaygılar, Genetik testlerle ilgili moral kaygıları, Ticari konularla ilgili kaygılar vardır.

49 İnsan Genom Projesi ile ilgili cevap bekleyen sorular: Bir kişiye ait özel bilgilere kimler sahip olacak ve kimler kontrol edebilecek? Genetik programımızın gizliliği ne ölçüde korunabilecek? Ferdi genetik farklılıkların deşifre edilmesinin fert ve aile üzerindeki psikolojik tesirleri nasıl azaltılabilecek?

50 Hiçbir tedavi imkanının olmadığı hastalıklar için de genetik test yapılması ve kişinin önceden bu hastalığını bilmesi doğru bir yaklaşım olacak mı? Gelecekte genetik hastalıkları tedavide ve önlemede kullanılabilecek gen tedavisinin uygulama kriterleri neler olacak? Gen tedavisini kullanarak genetik bakımdan iyileşme sağlandığını söylemek (yaşı uzatmak, zekayı, güzelliği geliştirmek gibi) etik açıdan kabul edilebilir mi? Bu işi yaparken çok daha kötü neticeler ortaya çıkarsa bunun sorumluluğunu kim taşıyacak?

51 MİNOR TEMALAR

52 Kaynaklar Genomik çalışmaların en temel kaynağı öncellikle insan, diğer memeliler ve insan çalışmaları öncesi üzerinde durulan omurgasız canlıların genom dizisidir. Vektörler, protein çipleri, oluşturulan veri tabanları genomik çalışmalara kaynak olmuştur.

53 Kullanılan Teknoloji Gelişimi Tüm genomik çalışma ve gelişmeler önceleri Sanger dizileme tekniği, sonra otomatik dizileme ve PCR teknolojisinin gelişimiyle hız kazanmıştır.

54 Tahmin ve Hipotez Oluşturulması Tahmin ve hipotez oluşturulması, problemlerin çözümü, problemlere yeni yaklaşımlar getirilmesi ve çevre-genetik etkileşimlerinin çözülmesi amaçlı olacaktır.

55 Bilim İnsanı Yetiştirme Bilimsel, tıbbi, sosyal alanlarda araştırma yapacak bilim adamları karşılaşacakları biyolojik sistemleri anlayıp bu bilgiyi insanlık yararına kullanabilecek şekilde yetiştirilmelidir.

56 Etik, Yasal ve Sosyal Uygulama Tüm alanlardaki genom çalışmalar etik kurallara uygun olarak yapılmalıdır. Gerekli düzenlemelerin oluşturulması için ELSI (Ethical, Legal and Social Issues) adı verilen biyoetik araştırma programı kurulmuştur. Genetik bilgilerin ulaşılması ve kullanılması, bunların yanı sıra veritabanlarında, doku ve örnek arşivlerinin de korunması bakımından uygun politikaların geliştirilmesi gerekmektedir

57 Eğitim Sağlık personelinin genomik araştırma sonuçlarını verimli kullanabilmeleri, toplumun kendilerine uygulanan tedavileri anlayıp verimli kullanabilmesi amacıyla konuyla ilgili olarak bilgilendirilmelidir.

58 4.TÜRKİYE VE GENOM PROJELERİ

59 Türkiye Ulusal Genom Projesi oluşturmamış ülkeler arasında yer almaktadır. Ülkemizin moleküler biyoloji konusunda yetişmiş insan gücü, yeterli düzeydedir. İnsan, hayvan, bitki ve mikroorganizma genom projeleri, yaşantımıza yön veren etkinliklere dönüşmüşlerdir. Ulusal Genom Araştırmaları Projesi adı altında geliştirilecek bir programla yaygın bir alana dağılan genom uygulamaları, bağımsız ama çok katılımlı bir bilim ve teknoloji projesi altında birleştirilmedir.

60 5. SONUÇ

61 Sonuç olarak diyebiliriz ki; genomik araştırmaların geleceğine bakılınca, olabileceklerin hem mutluluk verici hem de korkutucu yanları olduğu görülmektedir. Bugün genom projesi tamamlanmış, hayvanlarda klonlama modelleri oluşturulmuş ve hatta insan embriyosu klonlanmıştır. Gelecekte yapılması gerekenler ise genom projesi temeli üzerine kaynakları, eğitimi ve teknolojiyi kullanarak yeni katlar çıkmak ve bunların tümünü insanlık yararına kullanmaktır.

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ 1 Genetik mühendisliği canlıların kalıtsal özelliklerinin değiştirilerek onlara yeni işlevler kazandırılmasına yönelik araştırmalar yapan bilim dalıdır. Genetik mühendisleri

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI 12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların genlerine

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

DNA ve DNA GÜNÜ Lütfi TUTAR 27 Nisan 2015

DNA ve DNA GÜNÜ Lütfi TUTAR 27 Nisan 2015 DNA ve DNA GÜNÜ Lütfi TUTAR 27 Nisan 2015 www.dna-gunu.com Organizma = İnsan = Homo sapiens İnsan Kromozomları (Karyotip) Deoksiribo Nükleik Asit GEN İFADESİ DNA KEŞFİNDE ÖNEMLİ OLAYLAR 1863 te

Detaylı

Gen haritasının ne kadarı tamamlandı DNA'nın şimdiye kadar yüzde 99'u deşifre edildi.

Gen haritasının ne kadarı tamamlandı DNA'nın şimdiye kadar yüzde 99'u deşifre edildi. Bilim dünyası, yaşamı alt üst edecek yeni bir gelişmeye daha imza atarak insan DNA'sının şifresini çözmeyi başardı. Çıkarılan 'gen haritası' sayesinde kalp ve kanser hastalığı tarihe karışacak ve insan

Detaylı

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI Moleküler biyolojiye giriş Doç.Dr.Pınar AKSOY SAĞIRLI Molecular biology terimi ilk kez Warren Weaver tarafından 1938 de kullanıldı. Hayatın fiziksel ve kimyasal olarak açıklanması olarak tanımlandı. 1977

Detaylı

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ GENOM PROJELERĐ Doç. Dr. Hilâl Özdağ Genom Projeleri Dizileme Klon kütüphaneleri Stratejiler Genom Dizilemesi Tekrar eden DNA dizileri Biraraya getirme (Assembly) PHRAP, PHRED,CONSED Bitiş Boşlukların

Detaylı

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

GENETİK HASTALIKLAR. Dr.Taner DURAK. Tıbbi Genetik Uzmanı. Bursa Orman Bölge Müdürlüğü Fikir Bahçesi Konferansı 06.03.2014

GENETİK HASTALIKLAR. Dr.Taner DURAK. Tıbbi Genetik Uzmanı. Bursa Orman Bölge Müdürlüğü Fikir Bahçesi Konferansı 06.03.2014 GENETİK HASTALIKLAR Dr.Taner DURAK Tıbbi Genetik Uzmanı Bursa Orman Bölge Müdürlüğü Fikir Bahçesi Konferansı 06.03.2014 Dr. Taner DURAK özgeçmişi 1966 Artvin Şavşat doğumlu 1983-1989, Bursa, Uludağ Üniv,Tıp

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Kök Hücre Biyolojisi Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013])

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) BİYOLOJİ PROJE SUNUMU GRUP SUSTURUCU PROJE ADI Bazı Bitki Türlerindeki mirna

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

TÜBİTAK MAM GEN MÜHENDM HENDİSLİĞİ VE BİYOTEKNOLOJB YOTEKNOLOJİ ENSTİTÜSÜ (GMBE) TANITIMI IKEV Türkiye için Biyoteknoloji Toplantısı 8 Kasım m 2007 1 GMBE Personeli Araştırmacı 50 Toplam Personel 65 Teknisyen

Detaylı

KALITSAL MADDE PROF. DR. SERKAN YILMAZ

KALITSAL MADDE PROF. DR. SERKAN YILMAZ KALITSAL MADDE PROF. DR. SERKAN YILMAZ Kalıtsal madde (kalıtsal molekül, genetik materyal) (1) canlının yapı ve işlevlerinin belirlenmesinden, (2) canlının kendine benzer bir canlıyı meydana getirmesinden,

Detaylı

TEMEL VETERĠNER GENETĠK

TEMEL VETERĠNER GENETĠK DİKKATİNİZE: BURADA SADECE ÖZETİN İLK ÜNİTESİ SİZE ÖRNEK OLARAK GÖSTERİLMİŞTİR. ÖZETİN TAMAMININ KAÇ SAYFA OLDUĞUNU ÜNİTELERİ İÇİNDEKİLER BÖLÜMÜNDEN GÖREBİLİRSİNİZ. TEMEL VETERĠNER GENETĠK KISA ÖZET KOLAYAOF

Detaylı

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ Değişik canlı gruplarında kalıtsal molekülün çeşidi, sayısı, biçimi ve organizasyonu bakımından farklılıklar bulunur. Ortak özellik: nükleik

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Doğal Bileşikler ve Yeni İlaçların Keşfindeki Önemi

Doğal Bileşikler ve Yeni İlaçların Keşfindeki Önemi Doğal Bileşikler ve Yeni İlaçların Keşfindeki Önemi Doç. Dr. Ömer KOZ HO Bursa Teknik Üniversitesi, Kimya Bölümü HO BTÜ, 2014-2015 Güz Yarıyılı Seminerleri «Perşembe Seminerleri» 20 Kasım 2014 Bursa Başlıklar:

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

Model Organizmalar. Yusuf DOĞAN

Model Organizmalar. Yusuf DOĞAN Model Organizmalar Yusuf DOĞAN Model Organizma Nedir? Model organizmalar çeşitli biyolojik olayların anlaşılması için üzerinde çalışılan bir türdür. Bu organizmaları laboratuvar ortamında üretmek ve üretimlerini

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

DNA NEDİR? NASIL KEŞFEDİLDİ

DNA NEDİR? NASIL KEŞFEDİLDİ DNA NEDİR? NASIL KEŞFEDİLDİ DNA, Deoksiribonükleik asit in kısaltılmış halidir. DNA, canlılardaki biyolojik işlemlerin şifresini taşıyan genleri oluşturur. DNA Nedir? Vücudumuzdaki her hücrede, 23 çift

Detaylı

Gen Organizasyonu ve Genomların Evrimi

Gen Organizasyonu ve Genomların Evrimi GENETĐK 111-503 Gen Organizasyonu ve Genomların Evrimi Doç. Dr. Hilâl Özdağ 1 RNA nın Kendi Kendini Kopyalayabiliyor Olmalıydı Đlkin zamanlardaki RNA dünyasında RNA moleküllerinin kopyalanması. RNA polimerazlar

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Haziran 2013

Moleküler Biyoloji ve Genetik Bölümü Haziran 2013 Moleküler Biyoloji ve Genetik Bölümü Haziran 2013 Moleküler Biyoloji ve Genetik Bölümü (MBGB) Güçlü ve çok yönlü bir eğitim programı sunarak, gelişen teknoloji çağında, çok hızlı gelişen alanımızda ileri

Detaylı

Tıpta Kusursuzluğa Doğru Yaklaşım (Precision Medicine)

Tıpta Kusursuzluğa Doğru Yaklaşım (Precision Medicine) Tıpta Kusursuzluğa Doğru Yaklaşım (Precision Medicine) İncelikli tıp olarak da tanımlayabileceğimiz Precision Medicine, kişinin genetik yapısı, çevresel faktörler ve yaşam tarzındaki farklılıkları dikkate

Detaylı

ADIM ADIM YGS LYS. 93. Adım KALITIM -19 MODERN GENETİK UYGULAMALAR

ADIM ADIM YGS LYS. 93. Adım KALITIM -19 MODERN GENETİK UYGULAMALAR ADIM ADIM YGS LYS 93. Adım KALITIM -19 MODERN GENETİK UYGULAMALAR GEN KLONLAMA Seçilmiş bir genin plazmit ya da bir virüs içerisine yerleştirilerek bir bakteriye aktarılması ve bakteri aracılığı ile birçok

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky.

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky. Evrimsel Perspektifte KARŞILAŞTIRMALI GENOMİK Fatih Dikmen http://cigbrowser.berkeley.edu/ Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky Santral Dogma kavramı 1958

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

10. SINIF KONU ANLATIMI 37 KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

10. SINIF KONU ANLATIMI 37 KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI 10. SINIF KONU ANLATIMI 37 KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların

Detaylı

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces YAPAY KROMOZOMLAR Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces cerevisiae. de kurulmuştur. Halkasal plazmid maya sentromerinden,replikasyon orijininden, seçici bir işaret geninden ve

Detaylı

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG)

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) TANIM Canlı hücre içindeki malzemeleri (DNA, Protein, Enzim vb.), hücre yapısının işlevini ve hücreler arasındaki etkileşimi laboratuvar ortamında inceleyerek ortaya çıkaran kişidir. A- GÖREVLER - Canlıları

Detaylı

BİYOLOJİ SORU BANKASI

BİYOLOJİ SORU BANKASI BİYOLOJİ SORU BANKASI Bölüm: 1 Biyolojiye Giriş ve Bilimsel Düşünce ÖĞRETMENLİK ALAN BİLGİSİ TESTİ SORULAR 1. Biyoloji biliminin, bazı alt dallarına ait özellikler aşağıda verilmiştir; Hayatın başlangıcını

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Sitogenetik Laboratuarı Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

ECZACILAR ĠÇĠN BĠREYE ÖZGÜ ĠLAÇ KULLANIMI

ECZACILAR ĠÇĠN BĠREYE ÖZGÜ ĠLAÇ KULLANIMI ANADOLU ÜNĠVERSĠTESĠ ECZACILIK FAKÜLTESĠ ve 9. BÖLGE ESKĠġEHĠR-BĠLECĠK ECZACI ODASI ve ÖNGÖRÜSEL VE BĠREYE ÖZGÜ TEDAVĠ DERNEĞĠ (BĠTED) EĞĠTĠM PROGRAMI 24 ġubat 2013, Pazar ECZACILAR ĠÇĠN BĠREYE ÖZGÜ ĠLAÇ

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören

Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu Dr. Mahmut Çerkez Ergören Genetik materyal; Kendini çoğaltır. Bilgi depolar. Bilgiyi ifade eder. Mutasyonla varyasyonlara izin verir. Genetik Tarihçe

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM

1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1. ÜNİTE : HÜCRE BÖLÜNMESİ VE KALITIM 1 DNA (Deosiribo Nükleik Asit) Kalıtım maddesi hücre çekirdeğinde bulunur. Kalıtım maddesi iğ ipliği (Yumak) şeklinde bir görünümdedir. İğ ipliğindeki kalıtım maddesi

Detaylı

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI

BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI BİYOİNFORMATİK ARAŞTIRMALARI VE ARAÇLARI Aslı YA)AĞAN 1 İçe ik ağlık ektö ü, Ge etik Ve i ve Biyoi fo Biyolojik Ve ita a la ı A aliz A açla ı atik 2 ağlık ektö ü Moleküle Biyoloji ve Ge o ili ile ağlıkta

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

BAŞKENT ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DÖNEM I 5. DERS KURULU PROGRAMI BÜYÜME, GELİŞME VE HÜCRESEL PATOLOJİ

BAŞKENT ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DÖNEM I 5. DERS KURULU PROGRAMI BÜYÜME, GELİŞME VE HÜCRESEL PATOLOJİ BAŞKENT ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DÖNEM I 5. DERS KURULU PROGRAMI BÜYÜME, GELİŞME VE HÜCRESEL PATOLOJİ Dönem Koordinatörü Koordinatör Yardımcısı Ders Kurulu Sorumlusu : Doç.

Detaylı

Tıbbi Biyoloji ve Genetik

Tıbbi Biyoloji ve Genetik TIP FAKÜLTESİ Tıbbi Biyoloji ve Genetik Yüksek Lisans Programı Tıbbi Biyoloji ve Tıbbi Genetik Anabilim Dalları Yüksek Lisans Programı Ders Sorumluları, nedimeserakinci@gmail.com Prof. Dr. Osman Hayran,

Detaylı

BİYOLOG TANIM. Canlı türlerinin tanımlanması, sınıflandırılması, yaşamı ve evrimini etkileyen koşullar üzerinde araştırma yapan kişidir.

BİYOLOG TANIM. Canlı türlerinin tanımlanması, sınıflandırılması, yaşamı ve evrimini etkileyen koşullar üzerinde araştırma yapan kişidir. TANIM Canlı türlerinin tanımlanması, sınıflandırılması, yaşamı ve evrimini etkileyen koşullar üzerinde araştırma yapan kişidir. A- GÖREVLER Biyologların görevleri araştırmacı ve uygulamacı olmalarına göre

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

DERS BİLGİLERİ. Ders Kodu Dönem T+U Saat Kredi AKTS. V. Ders Kurulu TIP 105 1 121 + 73 9 10. Kurul Dersleri Teorik Pratik Toplam.

DERS BİLGİLERİ. Ders Kodu Dönem T+U Saat Kredi AKTS. V. Ders Kurulu TIP 105 1 121 + 73 9 10. Kurul Dersleri Teorik Pratik Toplam. DERS BİLGİLERİ Ders Kodu Dönem T+U Saat Kredi AKTS V. Ders Kurulu TIP 105 1 121 + 73 9 10 Kurul Dersleri Teorik Pratik Toplam Anatomi 25 29 54 Tıbbi Biyokimya 31 2 33 Tıbbi Biyoloji 13-13 Histoloji- Embriyoloji

Detaylı

Kromozom Biyolojisi. Tarihçe

Kromozom Biyolojisi. Tarihçe Kromozom Biyolojisi Tarihçe Kromozom Biyolojisi ve Sitogenetik -Son 300 yıldır önemli araştırma alanlarından -Moleküler biyolojideki gelişmeler de kromozomlar üzerindeki araştırmaları etkiledi -Kromozomlar

Detaylı

TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ

TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ 1 GİRİŞ Adli olayların aydınlatılmasında biyolojik örneklerin kimliklendirilmesi

Detaylı

BAŞKENT ÜNİVERSİTESİ TIP FAKÜLTESİ EĞİTİM - ÖĞRETİM YILI DÖNEM I 4. DERS KURULU PROGRAMI KALITIM VE İNSAN EMBRİYOLOJİSİ

BAŞKENT ÜNİVERSİTESİ TIP FAKÜLTESİ EĞİTİM - ÖĞRETİM YILI DÖNEM I 4. DERS KURULU PROGRAMI KALITIM VE İNSAN EMBRİYOLOJİSİ BAŞKENT ÜNİVERSİTESİ TIP FAKÜLTESİ 2016-2017 EĞİTİM - ÖĞRETİM YILI DÖNEM I 4. DERS KURULU PROGRAMI KALITIM VE İNSAN EMBRİYOLOJİSİ Dönem Koordinatörü Koordinatör Yardımcısı Ders Kurulu Sorumlusu : Doç.

Detaylı

DNA ve Özellikleri. Şeker;

DNA ve Özellikleri. Şeker; DNA ve Özellikleri Hücrelerdeki hayatsal olayların yönetimini çekirdek sağlar. Çekirdek içinde, hücrenin beslenme, solunum, üreme gibi canlılık faaliyetlerin yönetilmesini sağlayan genetik madde bulunur.

Detaylı

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER Plazmid ve Epizomlar Bakterilerin kendi kromozomlarının yanı sıra, kromozom dışı bazı genetik parçacıklar bulunmaktadır Bakteri kromozomundan daha küçük yapıda

Detaylı

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG)

MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) MOLEKÜLER BİYOLOJİ VE GENETİKÇİ (MOLEKÜLER BİYOLOG) TANIM Canlı hücre içindeki malzemeleri (DNA, Protein, Enzim vb.), hücre yapısının işlevini ve hücreler arasındaki etkileşimi laboratuar ortamında inceleyerek

Detaylı

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN

GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE UYGULAMALARI. Neslihan ATLIHAN GIDA BİYOTEKNOLOJİSİNDE GÜVENLİK GIDA BİYOTEKNOLOJİSİNDE VE GDO UYGULAMALARI GÜVENLİK VE GDO UYGULAMALARI Neslihan ATLIHAN Neslihan ATLIHAN Gıda Yüksek Mühendisi Gıda Yüksek Mühendisi Gıda ve Yem Kontrol

Detaylı

Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) 11:30 12:15 Tıbbi Biyoloji ve Genetik: DNA. Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma)

Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) 11:30 12:15 Tıbbi Biyoloji ve Genetik: DNA. Yrd. Doç. Dr. Seda SABAH Teknolojisi (Tartışma) HÜCRE BİLİMLERİ DERS KURULU III KURUL SORUMLUSU: DOÇ. DR. A.YEŞİM GÖÇMEN KURUL SORUMLUSU YARDIMCISI: YRD. DOÇ. DR. TEKİN YILDIRIM TIP103 HÜCRE BİLİMLERİ DERS KURULU III I. HAFTA 06.02.2017 (Pazartesi)

Detaylı

Öğrenim Kazanımları Bu programı başarı ile tamamlayan öğrenci;

Öğrenim Kazanımları Bu programı başarı ile tamamlayan öğrenci; Image not found http://bologna.konya.edu.tr/panel/images/pdflogo.png Ders Adı : GENEL BİYOLOJİ II Ders No : 0000000 Teorik : Pratik : Kredi : ECTS : 8 Ders Bilgileri Ders Türü Öğretim Dili Öğretim Tipi

Detaylı

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler

Detaylı

Celal Bayar Üniversitesi Tıp Fakültesi. Temel Tıp Bilimleri Bölümü Parazitoloji Anabilim Dalı. Parazit Bankası. Proje Yöneticisi Ahmet ÖZBİLGİN

Celal Bayar Üniversitesi Tıp Fakültesi. Temel Tıp Bilimleri Bölümü Parazitoloji Anabilim Dalı. Parazit Bankası. Proje Yöneticisi Ahmet ÖZBİLGİN Celal Bayar Üniversitesi Tıp Fakültesi Temel Tıp Bilimleri Bölümü Parazitoloji Anabilim Dalı Parazit Bankası Proje Yöneticisi Ahmet ÖZBİLGİN Üniversitemiz Parazit Bankası Üniversitemiz Tıp Fakültesi Temel

Detaylı

Eğitim Yönetimi ve Denetimi Tezsiz Yüksek Lisans Programı (5 Zorunlu Ders+ 6 Seçmeli Ders)

Eğitim Yönetimi ve Denetimi Tezsiz Yüksek Lisans Programı (5 Zorunlu Ders+ 6 Seçmeli Ders) Eğitim Yönetimi ve Denetimi Tezsiz Yüksek Lisans Programı (5 Zorunlu Ders+ 6 Seçmeli Ders) Eğitim Yönetimi ve Denetimi Tezsiz Yüksek Lisans Programı Dersin Kodu Dersin Adı T U/L Kredi ECTS EYD-504 Eğitim

Detaylı

Türkiye Sağlık Hizmetlerinin Finansmanı ve Sağlık Harcamalarının Analizi 2002-2013 Dönemi

Türkiye Sağlık Hizmetlerinin Finansmanı ve Sağlık Harcamalarının Analizi 2002-2013 Dönemi Türkiye Sağlık Hizmetlerinin Finansmanı ve Sağlık Harcamalarının Analizi 2002-2013 Dönemi Mehmet ATASEVER Mayıs, 2015 Türkiye Sağlık Hizmetlerinin Finansmanı ve Sağlık Harcamalarının Analizi 2002-2013

Detaylı

Ders Kodu Ders Adı Ders Türü AKTS Hafta Teorik

Ders Kodu Ders Adı Ders Türü AKTS Hafta Teorik Önlisans - Sağlık Hizmetleri Meslek Yüksekokulu - Tıbbi Laboratuvar Teknikleri Y : Yıl D : Dönem Ders Kodu Ders Adı Ders Türü Y D AKTS TLT137 Genel Biyoloji Zorunlu 1 1 4 Dersin Amacı Prokaryotik ve ökaryotik

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Kanser Biyolojisi ve Genetiği Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan

Detaylı

BİYOLOJİ ANABİLİM DALI YÜKSEK LİSANSDERSLERİ (TEZLİ) Ders Kodu Dersin Adı T U K AKTS Dersin Türü FBİ 601 Omurgalıların Karşılaştırmalı Anatomisi 4 0

BİYOLOJİ ANABİLİM DALI YÜKSEK LİSANSDERSLERİ (TEZLİ) Ders Kodu Dersin Adı T U K AKTS Dersin Türü FBİ 601 Omurgalıların Karşılaştırmalı Anatomisi 4 0 BİYOLOJİ ANABİLİM DALI YÜKSEK LİSANSDERSLERİ (TEZLİ) Ders Kodu Dersin Adı T U K AKTS Dersin Türü FBİ 601 Omurgalıların Karşılaştırmalı Anatomisi 4 0 4 7,5 Seçmeli FBİ 602 Tohumlu Bitkilerde Revizyon Çalışmaları

Detaylı

ENDÜSTRİYEL BİYOTEKNOLOJİ

ENDÜSTRİYEL BİYOTEKNOLOJİ ENDÜSTRİYEL BİYOTEKNOLOJİ Prof. Fazilet VARDAR SUKAN EBİLTEM 3 Nisan 2013, Ankara Tanımlar Biyoteknoloji Biyoekonomi Giriş Endüstriyel Biyoteknoloji sınırları, ürünlerin niteliği ve hangi sektöre hizmet

Detaylı

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Yrd. Doç. Dr. Neşe Direk Dokuz Eylül Üniversitesi Psikiyatri Anabilim Dalı Genetik Epidemiyoloji ve Psikiyatri Genome-Wide vs. Aday Gen Asosiyasyon

Detaylı

SAĞLIKTA NANOTEKNOLOJİ

SAĞLIKTA NANOTEKNOLOJİ SAĞLIKTA NANOTEKNOLOJİ Uzm. Hem. İlknur Yayla *Acıbadem Kozyatağı Hastanesi Hemşirelik Hizmetleri Müdürü, Acıbadem Sağlık Grubu Ameliyathaneler ve MSÜ Koordinatörü Hazırlanma Tarihi: 23 Mart 2016 http://www.haberturk.com/saglik/haber/536313-kanserde-nano-teknoloji-mucizesi

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

Gen Klonlama ve Uygulamaları. Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı

Gen Klonlama ve Uygulamaları. Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı Gen Klonlama ve Uygulamaları Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı Klonlama Gen klonlaması : DNA segmentleri veya bir genin kopyalarının Reproduktif klonlama : Bir canlının

Detaylı

HAFTA I Genetik Nedir? Mitoz Mayoz Bölünme Mendel Genetiği

HAFTA I Genetik Nedir? Mitoz Mayoz Bölünme Mendel Genetiği Doç. Dr. Hilâl Özdağ Ankara Üniversitesi Biyoteknoloji Enstitüsü Merkez Laboratuvarı eposta: hilalozdag@gmail.com Tel: 2225826/202 Ders kapsamına http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa

Detaylı

T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ HEMŞİRELİK YÜKSEK LİSANS PROGRAMI 2014-2015 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ

T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ HEMŞİRELİK YÜKSEK LİSANS PROGRAMI 2014-2015 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ HEMŞİRELİK YÜKSEK LİSANS PROGRAMI 2014-2015 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) SAĞLIK TANILAMASI (HEM 601 TEORİK 2, 2

Detaylı

Biyoetik İhtisas Komitesi Prof. Dr. Meral Özgüç

Biyoetik İhtisas Komitesi Prof. Dr. Meral Özgüç Biyoetik İhtisas Komitesi Prof. Dr. Meral Özgüç UNESCO Türkiye Millî Komisyonu Yönetim Kurulu Üyesi, Temel Bilimler ve Biyoetik Komiteleri Başkanı Komite Başkanı: Prof. Dr. Meral ÖZGÜÇ Temel Bilimler ve

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

ÜNİTE 1: BİYOLOJİYE GİRİŞ

ÜNİTE 1: BİYOLOJİYE GİRİŞ ÜNİTE 1: BİYOLOJİYE GİRİŞ Anahtar kavramlar 1.1 Biyologlar mikroskobik türlerden dev türlere kadar bütün canlıları inceler. 1.2 Biyologlar yaşamdaki çeşitliliği açıklamaya çalışırlar. 1.3 Biyoloji de son

Detaylı

Fen Edebiyat Fakültesi

Fen Edebiyat Fakültesi MOLEKÜLER BİYOLOJİ ve GENETİK AMERİKAN KÜLTÜRÜ ve EDEBİYATI PSİKOLOJİ MATEMATİK MÜTERCİM TERCÜMANLIK HALİÇ SENİ BEKLİYOR MOLEKÜLER BİYOLOJİ ve GENETİK Genetik, canlılıkla ilgili özelliklerin nasıl kazanıldığını

Detaylı

TIBBİ BİYOKİMYA ANABİLİM DALI LİSANSÜSTÜ DERS PROGRAMI

TIBBİ BİYOKİMYA ANABİLİM DALI LİSANSÜSTÜ DERS PROGRAMI TIBBİ BİYOKİMYA ANABİLİM DALI LİSANSÜSTÜ DERS PROGRAMI SAĞLIK BİLİMLERİ ENSİTÜSÜ İ Yüksek Lisans Programı SZR 101 Bilimsel Araştırma Yöntemleri Ders (T+ U) 2+2 3 6 AD SZR 103 Akılcı İlaç Kullanımı 2+0

Detaylı

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz İnsan Mikrobiyom Projesi Prof. Dr. Tanıl Kocagöz Human Microbiome Project İnsan Mikrobiyom Projesi (İMP) 2007 yılında NIH tarafından başlatıldı 300 gönüllünün 5 vücut bölgesinden değişik zamanlarda, toplam

Detaylı

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü 7 İNSAN GENOM PROJESİ Ifl k YULU * In this article, the author has summarized the Human Genome Project and what it aims to achieve. Following the description of the human genome the history, applications,

Detaylı

DİŞ HEKİMLİĞİNDE ARAŞTIRMA ve YAYIN ETİĞİ

DİŞ HEKİMLİĞİNDE ARAŞTIRMA ve YAYIN ETİĞİ Hacettepe Üniversitesi Diş Hekimliği Fakültesi Asistan Etik Eğitimi 20-21 Şubat 2015 DİŞ HEKİMLİĞİNDE ARAŞTIRMA ve YAYIN ETİĞİ Yrd Doç Dr FUNDA GÜLAY KADIOĞLU ÇUKUROVA ÜNİVERSİTESİ Tıp Fakültesi Tıp Tarihi

Detaylı

Tarımsal Biyoteknolojiye Giriş

Tarımsal Biyoteknolojiye Giriş Tarımsal Biyoteknolojiye Giriş Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TAB 101 Muavviz Ayvaz (Yrd. Doç. Dr.) 12. Hafta (03.12.2013) 1 Genetiği Değiştirilmiş Organizmalar (GDO) 2 Genetik: Biyolojinin

Detaylı

26 Mart 2018 (Pazartesi) 1. HAFTA

26 Mart 2018 (Pazartesi) 1. HAFTA TIP 104 HÜCRE BİLİMLERİ DERS KURULU IV (7 HAFTA) KURUL SORUMLUSU YRD. DOÇ. DR. LÜTFİYE TUTKUN KURUL SORUMLUSU YARDIMCISI YRD. DOÇ. DR. AYÇA ÇAKMAK TIP104 HÜCRE BİLİMLERİ DERS KURULU IV 26 Mart 2018 (Pazartesi)

Detaylı

AKILCI İLAÇ KULLANIMI

AKILCI İLAÇ KULLANIMI AKILCI İLAÇ KULLANIMI 04.Kasım.2012 Abant-BOLU Prof. Dr. Akçahan Gepdiremen AİBÜ Tıp Fakültesi Tıbbi Farmakoloji AD Bşk. ÜLKEMİZDE YILLARA GÖRE REÇETE SAYILARI 2007: 271 milyon adet 2008: 302 milyon adet

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde

Detaylı

NEDEN DENEYSEL ARAŞTIRMALAR?

NEDEN DENEYSEL ARAŞTIRMALAR? NEDEN DENEYSEL ARAŞTIRMALAR? ÜLKEMİZDE DENEYSEL ARAŞTIRMALARDA MEVCUT DURUM DOÇ.. DR. ÖNER DİKENSOYD GAZİANTEP ANTEP ÜNİVERSİTESİ GÖĞÜS S HASTALIKLARI AD. İçerik 1. Giriş 2. Araştırma Yöntemleri 3. Türkiye

Detaylı

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL III. Kurul Hücresel Metabolizma ve Moleküler Tıp III. Kurul Süresi: 6 hafta III. Kurul Başlangıç Tarihi: 23 Aralık 2009 III. Kurul Bitiş ve Sınav Tarihi: 1 2 Şubat 2010 Ders Kurulu Sorumlusu: Yrd. Doç.

Detaylı

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni.

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni. BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr Özgeçmişimim Postdoctoral

Detaylı

Genetik Yöntemlerle Bakterilere Gen Transferleri. (Cüneyt Akdeniz)

Genetik Yöntemlerle Bakterilere Gen Transferleri. (Cüneyt Akdeniz) Genetik Yöntemlerle Bakterilere Gen Transferleri (Cüneyt Akdeniz) Bakterilerde genetik maddenin bir kısmı bakteriden bakteriye aktarılabilmekte ve bunun sonucunda önemli genetik değişmeler olmaktadır.

Detaylı

Ders (Saat/Hafta) Uygulama (Saat/Hafta) Yarıyılı AKTS. Dersin Amacı. Yaşlı Popülasyonda Akılcı İlaç Kullanımı II SEC127 2 2 0 3. Ön Koşul Dersleri -

Ders (Saat/Hafta) Uygulama (Saat/Hafta) Yarıyılı AKTS. Dersin Amacı. Yaşlı Popülasyonda Akılcı İlaç Kullanımı II SEC127 2 2 0 3. Ön Koşul Dersleri - Dersin Adı Kodu Yarıyılı Ders (Saat/Hafta) (Saat/Hafta) AKTS Yaşlı Popülasyonda Akılcı İlaç Kullanımı II SEC127 2 2 0 3 Ön Koşul Dersleri - Dersin Dili Türkçe Dersin Türü Seçmeli Dersin Seviyesi Lisans

Detaylı