Pınar AKALIN Burcu SAYINLI, Ayten Y. KARATAŞ Merkez: Şube: Tel: Web:

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Pınar AKALIN Burcu SAYINLI, Ayten Y. KARATAŞ Merkez: Şube: Tel: Web:"

Transkript

1 Pınar AKALIN, Ltd. Şti. Burcu SAYINLI, İstanbul Teknik Üniversitesi Kimya Bölümü Polimer Bilim ve Teknolojisi Ayten Y. KARATAŞ, İstanbul Teknik Üniversitesi Moleküler Biyoloji ve Genetik Bölüm Merkez: Sarıyer Cad. 117/B ABC Plaza İstinye, Sarıyer - İSTANBUL Şube: İ.T.Ü. ARI Teknokent ARI8 Maslak İSTANBUL Tel: (212) , 36 Faks: (212) Web:

2 Moleküler uygulamaların başarısı nükleik asit izolasyonunun başarısına bağlıdır. İnhibitör varlığı izolat konsantrasyonunun olduğundan düşük görünmesine ve yanlış negatif sonuca neden olur. İnhibitörden etkilenmeyen, seçici DNA İzolasyonu Hesaplı ve özel bir lab cihazı gerektirmeden tek step hedef NA saptaması (Biyosensör entegrasyonuna uygun) SKY-FOM009v /16

3 Grafik: Jacob A. DOI: /cureus.170 Manyetik nanopartikül: nm Manyetik mikropartikül: µm çapındadır SKY-FOM009v /16

4 MNP-Oligo Fe 2 O 3 -SiO 2 -C=O-O-N-DNA SKY-FOM009v /16

5 CCCCCCGCTAGCTACGTAGCTCGTAG MNP-Oligo kompleksi (COLA) SKY-FOM009v /16

6 COCA: COLA-Adaptor COLA: Carboxy Linked Amino Complex CCCCCCGCTAGCTACGTAGCTCGTAG CATCGAGCATCAAGCTTACGC... MNP-Oligo kompleksi (COLA) Hedef DNA ya Özgü Adaptör Prob (50 baz) (COCA) TTCGAATGCGATCTACTG CATCGAGCATCAAGCTTACGCTAGATGAC AGCTAGCTACGTAGCTCGTAG SKY-FOM009v /16

7 Coca-Cola lı SKY-FOM009v /16

8 1.2MNP-6Cola 2.2MNP-3Cola 3.2MNP-Cola 11 ng/ul 14 ng/ul 17 ng/ul qpcr da saptanamadı SKY-FOM009v /16

9 LAMP (isothermal PCR) Bst1 SKY-FOM009v /16

10 LAMP (isothermal PCR) Bst1 Notomi et al SKY-FOM009v /16

11

12 LAMP primerleri

13 1.2MNP-6Cola 2.2MNP-3Cola 3.2MNP-Cola 11 ng/ul 14 ng/ul 17 ng/ul LAMP aşaması eklendiğinde >100 kat artış kaydedildi Şekil 2: Salmonella qpcr doğrulaması SKY-FOM009v /16

14 MNP-Oligo kompleksi (COLA) CATCGAGCATCAAGCTTACGCTAGATGAC AGCTAGCTACGTAGCTCGTAG Adaptör Prob (COCA) MNP- COOH SKY-FOM009v /16

15 AGCTAGCTACAAGCTTACGCTAGATGACGGTGAGACC... Hedefe özgü oligonükleotid bağlı MNP MNP-COOH SKY-FOM009v /16

16 1.2MNP-6Cola 2.2MNP-3Cola 3.2MNP-Cola 11 ng/ul 14 ng/ul 17 ng/ul Doğrudan MNP bağlı hedef DNA ile yapılan deneyde 10 kat artış kaydedildi SKY-FOM009v /16

17 0,005 0,000 Su içinde, Suya kar si baseline MNP (only) MNP-Cola MNP-3C-Cola MNP-6C-Cola MNP-6C-amino-ttr4 MNP-30T -0,004 Su içinde, Suya karsi baseline MNP (only) MNP-Cola MNP-3C-Cola MNP-6C-Cola MNP-6C-ttr4 MNP-30T Absorbans (A) -0,005 Absorbans (A) -0,006-0,008-0,010-0, Da lga Sayisi (cm -1 ) Da lga Sayisi (cm -1 ) IR Absorbansları 3428 cm -1 O-H gerilme titreşimi 1680 cm -1 O-H eğilme titreşimi 1481 cm -1 O=C=O gerilme titreşimi cm -1 C-H gerilme titreşimi IR Absorbansları Guanin 1710 cm -1 C-O gerilme titreşimi 1527 cm -1 Molekül düzlem titreşimi Timin 1663 cm -1 C=O gerilme titreşimi Adenin 1610 cm -1 C=N gerilme titreşimi Sitozin 1491 cm -1 Molekül düzlem 1527 cm -1 titreşimi SKY-FOM009v /16

18 Aynı Yüzde Seyreltmedeki Oligo Bağlı MNP lerin Empedans Ölçümleri Z (kohms) Zim/kohm MNP-Cola_%0,18 (v/v) MNP-3C-Cola_%0,18 (v/v) MNP-6C-Cola_%0,18 (v/v) MNP-30T_%0,18 (v/v) PBS 0,024 0,032 0, Zre/kohm 600 MNP-Cola_%0,18 (v/v) MNP-3C-Cola_%0,18 (v/v) MNP-6C-Cola_%0,18 (v/v) 500 MNP-30T_%0,18 (v/v) PBS Z (kohms) Zim/kohm 0,004 0,002 0,000 Zre/kohm 0,8 0,9 1 1,1 1,2 Frequency (Hz) Phase of Z (deg) Yim (ms) ,01 0,012 0, MNP-Cola_%0,18 (v/v) 10 MNP-3C-Cola_%0,18 (v/v) MNP-6C-Cola_%0,18 (v/v) 0 MNP-30T_%0,18 (v/v) PBS -10 1E-3 0,01 0, Frequency (Hz) Phase of Z (deg) Frequency (Hz) MNP-Cola_%0,18 (v/v) MNP-3C-Cola_%0,18 (v/v) MNP-6C-Cola_%0,18 (v/v) MNP-30T_%0,18 (v/v) PBS 0 1E-3 0,01 0, Frequency (Hz) Yre (ms) SKY-FOM009v /16

19 1 µm 0,5 µm 0,3 µm MNP (only) MNP-3C-Cola MNP-6C-Cola T u t k u g e n e t i k t i r. SKY-FOM009v /30

20 1 µm MNP (only) MNP-3C-Cola MNP-6C-Cola MNP-30T MNP-6C-ttr4 T u t k u g e n e t i k t i r. SKY-FOM009v /30

21 MNP (only) MNP-Cola MNP-3C-Cola MNP-30T MNP-6C-Cola

22 SEM Görüntüleri_500nm ölçekte MNP (only) MNP-3C-Cola

23 Biz sentezledik Ticari, hazır alındı ttr4 primeri dt20mer primeri

24 Çalışmada iki tür manyetik nanopartikülün kombine kullanımı ve LAMP aşamasıyla seçici ve hassas saptama yapılabileceği gösterilmiştir. Adaptör oligosuz doğrudan hedefe özgü MNP ile daha yüksek DNA eldesi gözlemlenmiştir. Amino modifiye oligoların MNP ye bağlanması iyileştirilirse daha iyi sonuç alınabilir. SKY-FOM009v /16

25 SentroPure DNA Ekstraksiyon ve Saflaştırma SentroPlex Real-time PCR SentroPrime Oligo Sentezleme PCR ve Dizileme Primerleri

26 Teşekkür ederiz! Proje No: TÜBİTAK-TEYDEB 1511 Öncelikli Alanlar Araştırma Teknoloji Geliştirme ve Yenilik Projeleri Programı ile desteklenmiş tarafından yürütülmüştür. SKY-FOM009v /16

Pınar AKALIN Fatma Neşe KÖK Zeliha GÜLER, Sezai SARAÇ Yıldız ULUDAĞ, Merkez: Şube: Tel: Web:

Pınar AKALIN Fatma Neşe KÖK Zeliha GÜLER, Sezai SARAÇ Yıldız ULUDAĞ, Merkez: Şube: Tel: Web: Pınar AKALIN, Ltd. Şti. Fatma Neşe KÖK, İstanbul Teknik Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Zeliha GÜLER, İstanbul Teknik Üniversitesi Nanobilim ve Nanomühendislik Bölümü Sezai SARAÇ, İstanbul

Detaylı

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ SELÇUK KILIÇ, BEKİR ÇELEBİ, MEHMET GENÇ, CANAN KETRE, MUSTAFA KOLUKIRIK 1, Ankara 2 Bioeksen Ar-Ge Teknolojileri

Detaylı

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT gulden.haspolat@gthb.gov.tr

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

Gıda Kaynaklı Patojenlerin Belirlenmesinde Yenilikçi Yaklaşımlar: Nanopartiküllerin Kullanımı

Gıda Kaynaklı Patojenlerin Belirlenmesinde Yenilikçi Yaklaşımlar: Nanopartiküllerin Kullanımı Gıda Kaynaklı Patojenlerin Belirlenmesinde Yenilikçi Yaklaşımlar: Nanopartiküllerin Kullanımı Dünya Sağlık Örgütü 2014 verilerine göre, birçoğu çocuk olmak üzere 2,2 milyon insanın su ve/veya gıda kaynaklı

Detaylı

Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören

Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu. Dr. Mahmut Çerkez Ergören Genetik Bilgi: DNA Yapısı, Fonksiyonu ve Replikasyonu Dr. Mahmut Çerkez Ergören Genetik materyal; Kendini çoğaltır. Bilgi depolar. Bilgiyi ifade eder. Mutasyonla varyasyonlara izin verir. Genetik Tarihçe

Detaylı

RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050

Detaylı

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A

Detaylı

RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500

Detaylı

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor!

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor! Uygulamalı Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları Yaz Dönemi Başlıyor! : DNA izolasyonu, Primer tasarımı, PCR Teknikleri, Agaroz Jel Elektroforezi,

Detaylı

Bilkent Cyberpark C Blok, no:1b7 Bilkent / Ankara

Bilkent Cyberpark C Blok, no:1b7 Bilkent / Ankara www.sentegen.com Bilkent Cyberpark C Blok, no:1b7 Bilkent / Ankara!!! Bilkent Üniversitesi Fen Fakültesi ne 5 dakika Yürüme mesafesindeyiz!!! Burak Yılmaz Genel Müdür VİZYON VE MİSYON Vizyonumuz Türkiye

Detaylı

ö ğ ğ ğ ö ö ö ö ç ö çö ç ö ö ö ğ ç ö ç ğ ğ ö ğ ö ç ğ ö ğ ç ğ ğ ç ğ Ö ğ ğ ç ç ö ç ğ ö ğ ç ö ğ ç ç ö ö ğ ç ğ ğ ö ğ ç ğ ğ ö ç ö ç ö ö ğ ö ç Ş Ü ğ Ü ö Ö Ş ğ Ş Ü ö ğ ö ğ ö ö Ü ö «Ç ğ ö ğ ç ğ ğ ğ çö ç ğ ö ğ

Detaylı

Ğ Ğ Ğ Ç Ç Ç Ş ç Ş Ü ö çö ö ö Ç ö ç ç ç ö ö ç ç ç ö Ç Ç ç Ç Ç Ç Ç ç ç ç Ç Ö Ç ç Ç ç ç ç ö ç ö ö Ç ç ö ö ö ö ç ö Ş Ş Ü Ü ç ö ö Ö ö ö ö çö ç Ğ ö ç Ğ ö Ü Ü ç ö ö Ö Ç Ç ç Ç Ç ç Ç Ö ö ö ç Ş Ç ç ö Ö Ş Ş Ü Ü ç

Detaylı

Ğ İ Ç Ü Ö Ö ö Ü ö ç İ ö ç ç ğ ç «Ü İ ğ İ Ü Ü İ İ İ ğ Ü Ü İ İ ğ ç ç ğ ğ ö ö Ç Ö İ ö İ ö ö ö ç ç ö ç ç ö ö ç ç ö ğ ğ ç ğ ğ ğ ö ğ ğ ğ ğ ç ğ ö ğ ğ ğ ç ğ ğ ğ ğ ö ö ö ö ç ç ö ç ç ö ö ç ç ö ğ ğ ç ğ ğ ğ ö ğ ğ

Detaylı

ODTÜ Biyoteknoloji Enstitü ABD 25. Yıl. Prof Dr. Canan Çilingir 14 Kasım 2014 ODTÜ

ODTÜ Biyoteknoloji Enstitü ABD 25. Yıl. Prof Dr. Canan Çilingir 14 Kasım 2014 ODTÜ ODTÜ Biyoteknoloji Enstitü ABD 25. Yıl Prof Dr. Canan Çilingir 14 Kasım 2014 ODTÜ Kutlu Olsun Üniversitemizde interdisipliner çalışmalara olan katkısı Alanın güncel konularında yürüttüğü başarılı araştırmalar

Detaylı

BAKTERİLERİN GENETİK KARAKTERLERİ

BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür

Detaylı

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU DOKTORA DERS KATALOĞU ERCİYES ÜNİVERSİTESİ GDM 638 Lipid Kimyası Zorunlu DERS SAATİ: 3 Bahar Yrd. Doç. Dr. Hasan YALÇIN KREDİSİ :3 Tel:(352) 4374901 (32731), E-mail: hyalcin@erciyes.edu.tr, Web sayfası

Detaylı

12. SINIF KONU ANLATIMI 2 DNA VE RNA

12. SINIF KONU ANLATIMI 2 DNA VE RNA 12. SINIF KONU ANLATIMI 2 DNA VE RNA DNA (DEOKSİRİBONÜKLEİK ASİT) Temel nükleik asittir. Prokaryot hücrelerin sitoplazmasında, ökaryot hücrelerde çekirdek, mitokondri ve kloroplast organelinde bulunur.

Detaylı

SİNOP ÜNİVERSİTESİ BİLİMSEL VE TEKNOLOJİK ARAŞTIRMALAR UYGULAMA VE ARAŞTIRMA MERKEZİ ANALİZ-METOT ÜCRET LİSTESİ X-Işınları Tek Kristal Analizi (XRD)

SİNOP ÜNİVERSİTESİ BİLİMSEL VE TEKNOLOJİK ARAŞTIRMALAR UYGULAMA VE ARAŞTIRMA MERKEZİ ANALİZ-METOT ÜCRET LİSTESİ X-Işınları Tek Kristal Analizi (XRD) XRD-1 Ön İnceleme 50 TL 60 TL 75 TL XRD-2 Data Toplama 100 TL 150 TL 200 TL SİNOP ÜNİVERSİTESİ BİLİMSEL VE TEKNOLOJİK ARAŞTIRMALAR UYGULAMA VE ARAŞTIRMA MERKEZİ ANALİZ-METOT ÜCRET LİSTESİ X-Işınları Tek

Detaylı

J Popul Ther Clin Pharmacol 8:e257-e260;2011

J Popul Ther Clin Pharmacol 8:e257-e260;2011 SİTOMEGALOVİRUS (CMV) Prof. Dr. Seyyâl ROTA Gazi Ü.Tıp Fakültesi LOW SYSTEMIC GANCICLOVIR EXPOSURE AND PREEMPTIVE TREATMENT FAILURE OF CYTOMEGALOVIRUS REACTIVATION IN A TRANSPLANTED CHILD J Popul Ther

Detaylı

Biyoterörizm ve Besin Güvenliğine Diyetisyen Yaklaşımı: Mevcut Hızlı Teşhis Yöntemleri

Biyoterörizm ve Besin Güvenliğine Diyetisyen Yaklaşımı: Mevcut Hızlı Teşhis Yöntemleri Biyoterörizm ve Besin Güvenliğine Diyetisyen Yaklaşımı: Mevcut Hızlı Teşhis Yöntemleri Hacettepe Beslenme ve Diyetetik Günleri V. Mezuniyet Sonrası Eğitim Kursu Hacettepe Üniversitesi Kongre Merkezi 26.06.2015

Detaylı

BRCA 1/2 DNA Analiz Paneli

BRCA 1/2 DNA Analiz Paneli FAST-BRCA Sequencing Kit BRCA 1/2 DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR... 3 5

Detaylı

DNA ve Genetik Kod Kazanım Değerlendirme Sınavı 2 1-

DNA ve Genetik Kod Kazanım Değerlendirme Sınavı 2 1- DNA ve Genetik Kod Kazanım Değerlendirme Sınavı 2 1-4- C-G-T-T-A-G-C-G-G-A-G-G-T DNA zincirinin diğer halkası aşağıdakilerden hangisidir? A. G-C-A-A-T-C-G-C-C-T-C-C-G B. T-C-A-A-T-G-C-C-C-T-C-C-T C. G-C-A-A-T-C-G-C-C-T-C-C-A

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı Dönem I. 2. Ders Kurulu II. HÜCRE BİLİMLERİ-I Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Prof. Dr. Alirıza ERDOĞAN Yrd. Doç. Ders Kurulu

Detaylı

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.

Detaylı

3.1. Karbonhidratların Tanımı 3.2. Karbonhidratların Sınıflandırılması 3.3. Monosakkaritler ve Monosakkarit Türevleri Monosakkaritler

3.1. Karbonhidratların Tanımı 3.2. Karbonhidratların Sınıflandırılması 3.3. Monosakkaritler ve Monosakkarit Türevleri Monosakkaritler 3.1. Karbonhidratların Tanımı 3.2. Karbonhidratların Sınıflandırılması 3.3. Monosakkaritler ve Monosakkarit Türevleri 3.3.1. Monosakkaritler 3.3.1.1. Monosakkaritlerin isimlendirilmesi 3.3.2. Monosakkaritlerin

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

* İleri Teknoloji Uygulama ve Araştırma Merkezi, Önceden Haber Vermeksizin Ücretleri ve/veya Ücretlendirme Sistemini Değiştirme Hakkına Sahiptir.

* İleri Teknoloji Uygulama ve Araştırma Merkezi, Önceden Haber Vermeksizin Ücretleri ve/veya Ücretlendirme Sistemini Değiştirme Hakkına Sahiptir. Cumhuriyet Üniversitesi İleri Teknoloji Uygulama ve Araştırma Merkezi (CÜTAM) 2017 Yılında Döner Sermaye Kapsamında Gerçekleştirilecek Analizler için Fiyat Listesi Başvuru Yapan Kuruma Bağlı Olarak Analiz

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyolojide Kullanılan Teknikler Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim

Detaylı

YGS YE HAZIRLIK DENEMESi #20

YGS YE HAZIRLIK DENEMESi #20 YGS YE HAZIRLIK DENEMESi #20 1) Canlı birey sayısı 2) Kalbin Odacık Sayısı Ortama uyum Solunum şekli Döllenme ve Gelişme X Y B A Zaman Aynı ekosistemdeki sayısal değişimleri şekildeki grafikte gösterilen

Detaylı

Bileşiğin basit formülünün bulunması (moleküldeki C, H, O, X atomlarının oranından, veya molekül ağırlığından)

Bileşiğin basit formülünün bulunması (moleküldeki C, H, O, X atomlarının oranından, veya molekül ağırlığından) 1 SPEKTROSKOPİ PROBLEMLERİ Ref. e_makaleleri, Enstrümantal Analiz, Kütle Spektrometre Uygulamaları Molekül yapısı bilinmeyen bir organik molekülün yapısal formülünün tayin edilmesi istendiğinde, başlangıç

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Yrd. Doç. Dr. Umut Fahrioğlu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA ET ÜRÜNLERİNDE TAĞŞİŞ Tağşiş; gıda maddesinin mevzuata veya izin verilen özelliklerine aykırı olarak üretilmesi hali olarak tanımlanmaktadır. Gıda ürünlerinde; tağşiş bir çok şekilde yapılabilmektedir.

Detaylı

GÜZ DÖNEMİ KİMYA A.B.D YÜKSEK LİSANS VE DOKTORA DERS PROGRAMI

GÜZ DÖNEMİ KİMYA A.B.D YÜKSEK LİSANS VE DOKTORA DERS PROGRAMI 2016-2017 GÜZ DÖNEMİ KİMYA A.B.D YÜKSEK LİSANS VE DOKTORA DERS PROGRAMI ÖĞRETİM ÜYESİ DERS ADI PAZARTESİ SALI ÇARŞAMBA PERŞEMBE CUMA Prof. Dr. Salih Fizikokimyasal Denge Koşulları (Özel 08.30-15.50 YILDIZ

Detaylı

A. DNA NIN KEŞFİ VE ÖNEMİ

A. DNA NIN KEŞFİ VE ÖNEMİ DNA nın Yapısı ve Replikasyonu Biyoloji Ders Notları A. DNA NIN KEŞFİ VE ÖNEMİ İlk olarak Friedrich Miescher (1869) akyuvar hücreleri ve balık sperminde yönetici molekülleri tespit etmiştir. Çekirdekte

Detaylı

PEYNİR ALTI SUYU VE YOĞURT SUYUNDA Zn Ve TOPLAM ANTİOKSİDAN KAPASİTESİ TAYİNİ DANIŞMANLAR. 29 Haziran-08 Temmuz MALATYA

PEYNİR ALTI SUYU VE YOĞURT SUYUNDA Zn Ve TOPLAM ANTİOKSİDAN KAPASİTESİ TAYİNİ DANIŞMANLAR. 29 Haziran-08 Temmuz MALATYA TÜBİTAK -BİDEB Kimya Lisans Öğrencileri Kimyagerlik, Kimya Öğretmenliği, Kimya Mühendisliği- Biyomühendislik Araştırma Projesi Eğitimi Çalıştayı KİMYA-3 (ÇALIŞTAY 2012) PEYNİR ALTI SUYU VE YOĞURT SUYUNDA

Detaylı

BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER

BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER www.benimdershanem.esy.es Bilgi paylaştıkça çoğalır. BİYOLOJİ DERS NOTLARI YGS-LGS YÖNETİCİ MOLEKÜLLER NÜKLEİK ASİTLER Nükleik asitler, bütün canlı hücrelerde ve virüslerde bulunan, nükleotid birimlerden

Detaylı

Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz.

Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz. 1 / 107 Malzeme Kodu : JENL1243 33893 BCR-ABL T(9;22) TRANSLOKASYON 2 SUBTIPIN BELIRLENMESI ICIN KANTITATIF PCR KITI.SUBTIPLER:P190 (MBCR), P210 (MBCR) (TEST/KUTU) SATINALMA BİLGİSİ (ŞARTNAME) (*) Düzenleme

Detaylı

III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler

Detaylı

Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler

Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler ADANA BİLİM ve TEKNOLOJİ ÜNİVERSİTESİ Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler Ar. Gör. Sevgin DIBLAN Yrd. Doç. Dr. Pınar KADİROĞLU 1 İçerik Tağşiş nedir ve etkileri Gıda tağşişinin

Detaylı

Biyokimya ya ya Giriş. Prof. Dr. Arif Altınta

Biyokimya ya ya Giriş. Prof. Dr. Arif Altınta Biyokimya ya ya Giriş Prof. Dr. Arif Altınta ntaş Biyokimya Yunanca canlı anlamındaki bios sözcüğünden köken alır Biyokimya canlı kimyası anlamına gelir Biyokimya canlı varlıkların yapı, oluşum, işlev

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyokimya Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

Mitokondrial DNA Analiz Paneli

Mitokondrial DNA Analiz Paneli FAST-mtDNA Sequencing Kit Mitokondrial DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade

Detaylı

LYS ANAHTAR SORULAR #4. Nükleik Asitler ve Protein Sentezi

LYS ANAHTAR SORULAR #4. Nükleik Asitler ve Protein Sentezi LYS ANAHTAR SORULAR #4 Nükleik Asitler ve Protein Sentezi 1) İncelenen bir nükleotidin DNA ya mı yoksa RNA ya mı ait olduğu; I. Bağ çeşidi II. Pürin bazı çeşidi III. Pirimidin bazı çeşidi IV. Şeker çeşidi

Detaylı

Protokolü PD S Reaksiyon

Protokolü PD S Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S00 0 50 Reaksiyon REŞİT GALİP CADDESİ 74-7 06700 ÇANKAYA, ANKARA, TÜRKİYE T +90 32 447 22 79 / 80 F +90 32 447 22 07 www.bmlabosis.com İnternal Pozitif

Detaylı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı MIKROARRAY TEKNOLOJİSİ Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı 2602040083 vshancer@yahoo.com EŞ ANLAMLILAR Biochip DNA chip DNA microarray Gene array 2 Neden bu teknolojiye ihtiyaç

Detaylı

BIONEER MARKA ACCUPOWER EBV QUANTATIVE PCR KİTİ PROTOKOLÜ

BIONEER MARKA ACCUPOWER EBV QUANTATIVE PCR KİTİ PROTOKOLÜ BIONEER MARKA ACCUPOWER EBV QUANTATIVE PCR KİTİ PROTOKOLÜ Kullanılan Ekipmanlar : - Bioneer Marka ExiPrep16 Plus Model Tam Otomatik Nükleik Asit Ekstraksiyon Sistemi - Bioneer Marka ExiPrep Viral DNA/RNA

Detaylı

Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri

Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü Araştırma Laboratuarları ve Üniteleri Biyoloji Bölümünde Merkezi Araştırma Laboratuarlarının Kurulumu Osmaniye Korkut Ata Üniversitesi, Biyoloji Bölümü

Detaylı

Nükleik Asit Temelli Mikroorganizma Tanımlama Yöntemleri

Nükleik Asit Temelli Mikroorganizma Tanımlama Yöntemleri MİKROORGANİZMALARIN TANIMLAMASINDA YENİ YAKLAŞIMLAR; Nükleik Asit Temelli Mikroorganizma Tanımlama Yöntemleri Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. Mikroorganizmaların

Detaylı

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml

Detaylı

ÇANAKKALE BOĞAZINDAKİ CHLOROPHYTA ENTEROMORPHA YOSUNUNDAN POTASYUM HİDROKSİT DESTEKLİ KATALİZÖR VARLIĞINDA BİYODİZEL ELDESİ

ÇANAKKALE BOĞAZINDAKİ CHLOROPHYTA ENTEROMORPHA YOSUNUNDAN POTASYUM HİDROKSİT DESTEKLİ KATALİZÖR VARLIĞINDA BİYODİZEL ELDESİ TÜBİTAK-BİDEB KİMYAGERLİK, KİMYA ÖĞRETMENLİĞİ VE KİMYA MÜHENDİSLİĞİ KİMYA LİSANS ÖĞRENCİLERİ ARAŞTIRMA PROJESİ EĞİTİMİ ÇALIŞTAYI (KİMYA-2 ÇALIŞTAY 2011) ÇANAKKALE BOĞAZINDAKİ CHLOROPHYTA ENTEROMORPHA YOSUNUNDAN

Detaylı

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Türkiye'de 2015-2016 İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Dilek Güldemir 1,Ayşe Başak Altaş 1,Fatma Filiz Arı 1,Zekiye Bakkaloğlu 1,Özlem Ünaldı 1,Fatma

Detaylı

IDC Savunma Sanayi Nakliye Ticaret A.Ş. HIZLI BİYOLOJİK PATHOJEN/TOKSİN ve KİMYASAL GAZ TESPİT SİSTEMLERİ

IDC Savunma Sanayi Nakliye Ticaret A.Ş. HIZLI BİYOLOJİK PATHOJEN/TOKSİN ve KİMYASAL GAZ TESPİT SİSTEMLERİ IDC Savunma Sanayi Nakliye Ticaret A.Ş HIZLI BİYOLOJİK PATHOJEN/TOKSİN ve KİMYASAL GAZ TESPİT SİSTEMLERİ IDC Savunma Sanayi Nakliye Ticaret A.Ş HIZLI BİYOLOJİK PATHOJEN/TOKSİN TESPİT SİSTEMLERİ Biyolojik

Detaylı

BIONEER ExiCycler 96 REAL TIME PCR CİHAZI. Gradient Real Time PCR Cihazı. Kullanım Amacı. Uygulama Alanları. Temel Teknik Özellikler

BIONEER ExiCycler 96 REAL TIME PCR CİHAZI. Gradient Real Time PCR Cihazı. Kullanım Amacı. Uygulama Alanları. Temel Teknik Özellikler REAL TIME PCR CİHAZI BIONEER ExiCycler 96 Gradient Real Time PCR Cihazı Cihaz, gerçek zamanlı PCR (Polimeraz Zincir Reaksiyonu) yöntemi ile DNA ve RNA nın Amplifikasyonu (çoğaltılması) ve analiz edilmesi

Detaylı

ALETLİ ANALİZ YÖNTEMLERİ

ALETLİ ANALİZ YÖNTEMLERİ ALETLİ ANALİZ YÖNTEMLERİ Spektroskopiye Giriş Yrd. Doç. Dr. Gökçe MEREY SPEKTROSKOPİ Işın-madde etkileşmesini inceleyen bilim dalına spektroskopi denir. Spektroskopi, Bir örnekteki atom, molekül veya iyonların

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen

Detaylı

Çevre Biyoteknolojisi. BİYOTEKNOLOJİ 25.yıl

Çevre Biyoteknolojisi. BİYOTEKNOLOJİ 25.yıl Başlıca Konular Çevresel problemlerin çözümüne yönelik; Atıksu Yönetimi (arıtım, bertaraf ve geri kazanım) Atıklardan biyo-enerji/biyo-ürün eldesi Tehlikeli kimyasalların biyodegradasyonu Sera gazı mitigasyonu

Detaylı

Sentil Mastarları. Kod No. Diş Mastarları Kod No. Diş Tipi Yaprak Adedi. Radius Mastarları. Kod No. Radius (mm) Yaprak Adedi

Sentil Mastarları. Kod No. Diş Mastarları Kod No. Diş Tipi Yaprak Adedi. Radius Mastarları. Kod No. Radius (mm) Yaprak Adedi MASTARLAR Sentil Mastarları Boyutları (mm) Yaprak Uzunluğu Yaprak Adedi MC851-108 0.03 1.00 mm 100 8 MC851-113 0.05 1.00 mm 100 13 MC851-120 0.05 1.00 mm 100 20 MC851-220 0.05 1.00 mm 200 20 Diş Mastarları

Detaylı

МАКЕДОНСКО БИОЛОШКО ДРУШТВО MAKEDONYA CUMHURİYETİ BİYOLOGLAR BİRLİĞİ BİYOLOJİ 4.CUMHURİYET YARIŞМАSI LİSE (II) İKİNCİ SINIF

МАКЕДОНСКО БИОЛОШКО ДРУШТВО MAKEDONYA CUMHURİYETİ BİYOLOGLAR BİRLİĞİ BİYOLOJİ 4.CUMHURİYET YARIŞМАSI LİSE (II) İKİNCİ SINIF 20.05.2017 МАКЕДОНСКО БИОЛОШКО ДРУШТВО MAKEDONYA CUMHURİYETİ BİYOLOGLAR BİRLİĞİ BİYOLOJİ 4.CUMHURİYET YARIŞМАSI LİSE (II) İKİNCİ SINIF 1. Verilen ifadelerden doğru olanların önündeki D harfini, yanlış

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

TEOG1 DENEME SINAVI 1 ( DNA, Mitoz, Mayoz Kapsamlı)

TEOG1 DENEME SINAVI 1 ( DNA, Mitoz, Mayoz Kapsamlı) TEOG1 DENEME SINAVI 1 ( DNA, Mitoz, Mayoz Kapsamlı) 4. 1.Şekilde hayvan hücresinin mitoz bölünmede bir evresi gösterilmiştir. Bu evreden sonra aşağıdakilerden hangisi gerçekleşmez? A) Kalıtım maddesinin

Detaylı

Biyokimya (CEAC 212) Ders Detayları

Biyokimya (CEAC 212) Ders Detayları Biyokimya (CEAC 212) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Saati Kredi AKTS Biyokimya CEAC 212 Güz 3 0 0 3 5 Ön Koşul Ders(ler)i CEAC 202 Dersin Dili Dersin Türü

Detaylı

ANKARA ATMOSFERİNDEKİ AEROSOLLERİN KİMYASAL KOMPOZİSYONLARININ BELİRLENMESİ

ANKARA ATMOSFERİNDEKİ AEROSOLLERİN KİMYASAL KOMPOZİSYONLARININ BELİRLENMESİ ANKARA ATMOSFERİNDEKİ AEROSOLLERİN KİMYASAL KOMPOZİSYONLARININ BELİRLENMESİ İlke ÇELİK 1, Seda Aslan KILAVUZ 2, İpek İMAMOĞLU 1, Gürdal TUNCEL 1 1 : Ortadoğu Teknik Üniversitesi, Çevre Mühendisliği Bölümü

Detaylı

Kistik Fibrozis DNA Analiz Paneli

Kistik Fibrozis DNA Analiz Paneli FAST-CFTR Sequencing Kit Kistik Fibrozis DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

Minimal Kalıntı Hastalık (MRD)

Minimal Kalıntı Hastalık (MRD) Minimal Kalıntı Hastalık (MRD) Doç. Dr. Müge GÖKÇE İstanbul Yeni Yüzyıl Üniversitesi Özel Gaziosmanpaşa Hastanesi Çocuk Hematoloji & Onkoloji Bilim Dalı Sitomorfolojik Remisyon Kemik iliğinde %5 in altında

Detaylı

Şekil 1. DEÜ Test Asansörü kuyusu.

Şekil 1. DEÜ Test Asansörü kuyusu. DOKUZ EYLÜL ÜNĐVERSĐTESĐ TEST ASANSÖRÜ KUYUSUNUN DEPREM YÜKLERĐ ETKĐSĐ ALTINDAKĐ DĐNAMĐK DAVRANIŞININ ĐNCELENMESĐ Zeki Kıral ve Binnur Gören Kıral Dokuz Eylül Üniversitesi, Mühendislik Fakültesi, Makine

Detaylı

TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM

TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM TÜBERKÜLOZUN MOLEKÜLER TANISINDA GÜNCEL DURUM Doç. Dr. Alpaslan Alp Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Dünya Sağlık Örgütü 2009 Yılı Raporu Aktif tüberkülozlu hasta

Detaylı

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013])

TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) TÜBİTAK BİDEB LİSE ÖĞRETMENLERİ-FİZİK, KİMYA, BİYOLOJİ, MATEMATİK- PROJE DANIŞMANLIĞI EĞİTİMİ ÇALIŞTAYI (LİSE-3 [ÇALIŞTAY 2013]) BİYOLOJİ PROJE SUNUMU GRUP SUSTURUCU PROJE ADI Bazı Bitki Türlerindeki mirna

Detaylı

26 Mart 2018 (Pazartesi) 1. HAFTA

26 Mart 2018 (Pazartesi) 1. HAFTA TIP 104 HÜCRE BİLİMLERİ DERS KURULU IV (7 HAFTA) KURUL SORUMLUSU YRD. DOÇ. DR. LÜTFİYE TUTKUN KURUL SORUMLUSU YARDIMCISI YRD. DOÇ. DR. AYÇA ÇAKMAK TIP104 HÜCRE BİLİMLERİ DERS KURULU IV 26 Mart 2018 (Pazartesi)

Detaylı

TEOG1 DENEME SINAVI 2 ( DNA, Mitoz,Mayoz Kapsamlı)

TEOG1 DENEME SINAVI 2 ( DNA, Mitoz,Mayoz Kapsamlı) 1. TEOG1 DENEME SINAVI 2 ( DNA, Mitoz,Mayoz Kapsamlı) Yukarıdaki şekil için aşağıda yapılan yorumlardan hangisi yanlıştır? A) Hücre 2 kere mitoz bölünme geçirmiştir. B) Oluşan yavru hücreler ana hücrenin

Detaylı

www.demiraylisesi.com

www.demiraylisesi.com YÖNETİCİ MOLEKÜLLER C, H, O, N, P atomlarından meydana gelir. Hücrenin en büyük yapılı molekülüdür. Yönetici moleküller hücreye ait genetik bilgiyi taşır, hayatsal faaliyetleri yönetir, genetik bilginin

Detaylı

Orta Doğu Teknik Üniversitesi Biyoloji Bölümü, Lab 205, Çankaya, Ankara. Ağ sayfası: E-posta:

Orta Doğu Teknik Üniversitesi Biyoloji Bölümü, Lab 205, Çankaya, Ankara. Ağ sayfası:  E-posta: Babür Erdem Orta Doğu Teknik Üniversitesi Biyoloji Bölümü, Lab 205, 06800 Çankaya, Ankara Ağ sayfası: http://metu.edu.tr/~e165381/ E-posta: baburerdem@gmail.com Lab: +90 312 210 7626 GSM: +90 506 229 9206

Detaylı

11. Hafta: Prof. Dr. Şule PEKYARDIMCI NÜKLEOTİDLER

11. Hafta: Prof. Dr. Şule PEKYARDIMCI NÜKLEOTİDLER 11. Hafta: Nükleik Asitler: Nükleik asitlerin yapısal üniteleri, nükleozitler, nükleotidler, inorganik fosfat, nükleotidlerin fonksiyonları, nükleik asitler, polinükleotidler, DNA nın primer ve sekonder

Detaylı

Non-İnvaziv Prenatal Tarama (NİPT) Uluslararası kalite güvenceniz

Non-İnvaziv Prenatal Tarama (NİPT) Uluslararası kalite güvenceniz Non-İnvaziv Prenatal Tarama (NİPT) Uluslararası kalite güvenceniz NIPT Testi Nedir? Non-İnvaziv Prenatal Tarama (NIPT) trizomi taraması için geliştirilmiş daha güvenilir ve daha hassas ileri düzey bir

Detaylı

Elektronun haraketi sonunda magnetik alana konan madde magnetik özellik kazanır.

Elektronun haraketi sonunda magnetik alana konan madde magnetik özellik kazanır. MAGNETİK ÖZELLİKLER Orbitallerinde çiftlenmemiş elektronu bulunan maddeler paramanyetik, bütün elektronları orbitallerde çiftlenmiş olarak bulunan maddeler ise diyamanyetik özellik gösterirler. Paramanyetik

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

TÜBİTAK Özel Sektöre Yönelik Ar-Ge ve Yenilik Destek Programlarına İlişkin İstatistikler

TÜBİTAK Özel Sektöre Yönelik Ar-Ge ve Yenilik Destek Programlarına İlişkin İstatistikler Özel Sektöre Yönelik Ar-Ge ve Yenilik Destek Programlarına İlişkin İstatistikler Teknoloji ve Yenilik Destek Programları Başkanlığı (TEYDEB) 2013 1995-2012 Yılları Arasında Ne Yapıldı? 16.422 Proje Başvurusu

Detaylı

Pencere & Kapı Sistemleri

Pencere & Kapı Sistemleri Pencere & Kapı Sistemleri Bazı deneyimler nesiller boyunca aktarılmaz YASANIR!!! wwwakipencomtr Çünkü Biz Büyük Bir Aileyiz! Akipen Sirket Profili Yıllardır Pvc Kapı ve Pencere sektörü içerisinde bulunan

Detaylı

İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi. Prof. Dr. Demir Budak Dekan

İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi. Prof. Dr. Demir Budak Dekan DERS KURULU YÜRÜTME KURULU DÖNEM I KOORDİNATÖRÜ: Prof. Dr. Mine KÜÇÜKER KURUL III KOORDİNATÖRÜ: Prof. Dr. Mine KÜÇÜKER İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi Prof. Dr. Demir Budak Dekan Eğitim

Detaylı

Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi

Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi Aylin Altay Koçak 1, İpek Tüney 2, Koray Ergünay 2, Alp Usubütün 3, Kunter Yüce 4, Ahmet

Detaylı

Etkin Proje Ar-Ge projelerinin yönetimi ve finansmanı konularında uçtan uca kaliteli hizmet prensibi hizmet veren danışmanlık firmasıdır

Etkin Proje Ar-Ge projelerinin yönetimi ve finansmanı konularında uçtan uca kaliteli hizmet prensibi hizmet veren danışmanlık firmasıdır AR- GE DESTEKLERİ Etkin Proje Ar-Ge projelerinin yönetimi ve finansmanı konularında uçtan uca kaliteli hizmet prensibi hizmet veren danışmanlık firmasıdır 1 2 3 1 Merkez İstanbul 2 Şube Gebze GOSB Teknokent

Detaylı

Kozmetik Ürünlerde Nanoteknoloji Kullanımı

Kozmetik Ürünlerde Nanoteknoloji Kullanımı Kozmetik Ürünlerde Nanoteknoloji Kullanımı Esin Burunkaya, Merve Kurtbelen, Burcu Becer, Murat Akarsu, Ertuğrul Arpaç AKDENİZ ÜNİVERSİTESİ Fen Fakültesi Kimya Bölümü ANTALYA 2013 Saç Teli H 2 O 0,37 nm

Detaylı

PLAZMA TEKNİĞİ İLE POLİÜRETAN HİDROJELLERİN YÜZEY ÖZELLİKLERİNİN DEĞİŞTİRİLMESİ. Asuman Koç, Tuğba Akkaş, F. Seniha Güner a

PLAZMA TEKNİĞİ İLE POLİÜRETAN HİDROJELLERİN YÜZEY ÖZELLİKLERİNİN DEĞİŞTİRİLMESİ. Asuman Koç, Tuğba Akkaş, F. Seniha Güner a PLAZMA TEKNİĞİ İLE POLİÜRETAN HİDROJELLERİN YÜZEY ÖZELLİKLERİNİN DEĞİŞTİRİLMESİ Asuman Koç, Tuğba Akkaş, F. Seniha Güner a a İstanbul Teknik Üniversitesi, Kimya Mühendisliği Bölümü, Maslak 34469 İstanbul,

Detaylı

artus BK Virus QS-RGQ Kit

artus BK Virus QS-RGQ Kit artus BK Virus QS-RGQ Kit Performans Özellikleri artus BK Virus QS-RGQ Kit, Versiyon 1, 4514363 Testi gerçekleştirmeden önce www.qiagen.com/products/artusbkvirusrgpcrkit.aspx adresinde yeni elektronik

Detaylı

Spektroskopi ve Spektrofotometri. Yrd. Doç. Dr. Bekir Engin Eser Zirve University EBN Medical School Department of Biochemistry

Spektroskopi ve Spektrofotometri. Yrd. Doç. Dr. Bekir Engin Eser Zirve University EBN Medical School Department of Biochemistry Spektroskopi ve Spektrofotometri Yrd. Doç. Dr. Bekir Engin Eser Zirve University EBN Medical School Department of Biochemistry Spektroskopi Nedir? Maddeyle ışığın (elektromagneek radyasyon) etkileşimini

Detaylı

FİRMA SİCİL BİLGİLERİ

FİRMA SİCİL BİLGİLERİ FİRMA SİCİL BİLGİLERİ İSTANBUL TİCARET ODASI BİLGİ BANKASI Sicil No 244688/0 Takyidat bulunmamaktadır! Ünvan SANOVEL İLAÇ SANAYİ VE TİCARET ANONİM ŞİRKETİ Eski Ünvan İş Adresi Şube Adresi Telefon No Faks

Detaylı

Molekül formülü bilinen bir bileşiğin yapısal formülünün bulunmasında:

Molekül formülü bilinen bir bileşiğin yapısal formülünün bulunmasında: 1 1 H NMR İLE KALİTATİF ANALİZ-2 IR ve 1 H NMR ile Yapı Tayini Ref. e_makaleleri, Enstrümantal Analiz, 1 H NMR ile Yapı Tayini Molekül formülü bilinen bir bileşiğin yapısal formülünün bulunmasında: 1.

Detaylı

FİRMA SİCİL BİLGİLERİ

FİRMA SİCİL BİLGİLERİ FİRMA SİCİL BİLGİLERİ İSTANBUL TİCARET ODASI BİLGİ BANKASI Sicil No 32686/0 Takyidat bulunmamaktadır! Ünvan BİRLİK TİCARET TÜRK ANONİM ŞİRKETİ Eski Ünvan İş Adresi BEYBİ GİZ PLAZA DEREBOYU CAD. MEYDAN

Detaylı

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL III. Kurul Hücresel Metabolizma ve Moleküler Tıp III. Kurul Süresi: 6 hafta III. Kurul Başlangıç Tarihi: 23 Aralık 2009 III. Kurul Bitiş ve Sınav Tarihi: 1 2 Şubat 2010 Ders Kurulu Sorumlusu: Yrd. Doç.

Detaylı

ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ

ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ PROF.DR.OĞUZ ÖZTÜRK İSTANBUL ÜNİVERSİTESİ DENEYSEL TIP ARAŞTIRMA ENSTİTÜSÜ (DETAE) MOLEKÜLER TIP ANABİLİM DALI Bal ve Diğer Arı Ürünleri ile Sağlıklı Yaşam Platformu

Detaylı

TÜBİTAK TEYDEB. Ar-Ge ve Yenilik Destek Programları. Emel ÖNDER FIRAT, Bilimsel Programlar Uzmanı

TÜBİTAK TEYDEB. Ar-Ge ve Yenilik Destek Programları. Emel ÖNDER FIRAT, Bilimsel Programlar Uzmanı TÜBİTAK TEYDEB Ar-Ge ve Yenilik Destek Programları Emel ÖNDER FIRAT, Bilimsel Programlar Uzmanı TEYDEB - Teknoloji ve Yenilik Destek Programları Başkanlığı Kuruluş Amacı Ülkemiz özel sektör kuruluşlarının

Detaylı

FİRMA SİCİL BİLGİLERİ

FİRMA SİCİL BİLGİLERİ FİRMA SİCİL BİLGİLERİ TİCARET ODASI BİLGİ BANKASI Sicil Kaydı Kapalı! Karar Tarihi: 31/03/2017 Sicil No 622584/0 Takyidat bulunmamaktadır! Ünvan GAP MAĞAZACILIK ANONİM ŞİRKETİ Eski Ünvan İş Adresi Şube

Detaylı