KAFKAS ÜNİVERSİTESİ VETERİNER FAKÜLTESİ DERGİSİ

Transkript

1

2 ISSN: e-issn: KAFKAS ÜNİVERSİTESİ VETERİNER FAKÜLTESİ DERGİSİ THE JOURNAL OF THE FACULTY OF VETERINARY MEDICINE UNIVERSITY OF KAFKAS (TEMMUZ - AĞUSTOS) (JULY - AUGUST) Cilt/Volume: 18 Sayı/Number: 4 Yıl/Year: 01

3 This journal is indexed and abstracted by Thomson Reuters Services beginning with Volume 13 (1) 007 in the followings: Science Citation Index Expanded (also known as SciSearch ) Journal Citation Reports/Science Edition This journal is also indexed and abstracted in: ELSEVIER CAB Abstracts TÜRKİYE ATIF DİZİNİ ULAKBİM-TÜBİTAK EBSCO Bu dergi Kafkas Üniversitesi Veteriner Fakültesi tarafından iki ayda bir yayımlanır This journal is published bi-monthly, by the Faculty of Veterinary Medicine, University of Kafkas YAZIŞMA ADRESİ (Address for Correspondence) Kafkas Üniversitesi Veteriner Fakültesi Dergisi Editörlüğü Kars / TÜRKİYE Phone: /58 Fax: vetdergi@kafkas.edu.tr ELEKTRONİK BASKI (Electronic Edition) ISSN: ONLINE MAKALE GÖNDERME (Online Submission)

4 YABANCI DİL EDİTÖRLERİ (English Editors) Doç.Dr. Hasan ÖZEN Doç.Dr. Ahmet ÜNVER İSTATİSTİK EDİTÖRÜ (Statıstıcs Editor) Prof.Dr. Gül ERGÜN Prof.Dr. Kemal AK Prof.Dr. Harun AKSU Prof.Dr. Belma ALABAY Prof.Dr. Mustafa ALİŞARLI Prof.Dr. Feray ALKAN Prof.Dr. Çiğdem ALTINSAAT Prof.Dr. Kemal ALTUNATMAZ Prof.Dr. Mustafa ARICAN Prof.Dr. Mustafa ATASEVER Prof.Dr. Sırrı AVKİ Prof.Dr. Metin BAYRAKTAR Prof.Dr. Burhan ÇETİNKAYA Prof.Dr. Nazir DUMANLI Prof.Dr. Hasan Hüseyin DÖNMEZ Prof.Dr. Hüdaverdi ERER Prof.Dr. Ayhan FİLAZİ Prof.Dr. Ekrem GÜREL Prof.Dr. Tolga GÜVENÇ Prof.Dr. Ali İŞMEN Prof.Dr. Hakkı İZGÜR Prof.Dr. Zafer KARAER Prof.Dr. Arif KURTDEDE Prof.Dr. Erdoğan KÜÇÜKÖNER Prof.Dr. Mehmet MADEN Prof.Dr. Kamil ÖCAL Prof.Dr. Metin PETEK Prof.Dr. Sevim ROLLAS Prof.Dr. Berrin SALMANOĞLU Prof.Dr. Nesrin SULU Prof.Dr. Ayşe TOPAL Prof.Dr. Ş. Doğan TUNCER Prof.Dr. Cevdet UĞUZ Prof.Dr. Zafer ULUTAŞ Prof.Dr. Rıfat VURAL Prof.Dr. Cengiz YALÇIN Prof.Dr. Halis YERLİKAYA Kafkas Üniversitesi Veteriner Fakültesi Adına Sahibi (Owner) Prof.Dr. Hidayet Metin ERDOĞAN Dekan (Dean) EDİTÖR (Editor-in-Chief) Prof.Dr. İsa ÖZAYDIN EDİTÖR YARDIMCILARI (Associate Editors) Prof.Dr. Mehmet ÇİTİL Doç.Dr. Özgür AKSOY Yrd.Doç.Dr. Duygu KAYA DANIŞMA KURULU (Advisory Board) SAYFA TASARIMI (Design) Dr. Erol AYDIN SEKRETER (Secretary) Fahri ALTUN İstanbul Üniversitesi Veteriner Fakültesi İstanbul Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi İstanbul Üniversitesi Veteriner Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Atatürk Üniversitesi Veteriner Fakültesi Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Abant İzzet Baysal Üniversitesi Fen Edebiyat Fakültesi Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Süleyman Demirel Üniversitesi Mühendislik Mimarlık Fakültesi Selçuk Üniversitesi Veteriner Fakültesi Adnan Menderes Üniversitesi Veteriner Fakültesi Uludağ Üniversitesi Veteriner Fakültesi Marmara Üniversitesi Eczacılık Fakültesi Ankara Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Uludağ Üniversitesi Veteriner Fakültesi Ankara Üniversitesi Veteriner Fakültesi Afyon Kocatepe Üniversitesi Veteriner Fakültesi Gaziosmanpaşa Üniversitesi Ziraat Fakültesi Ankara Üniversitesi Veteriner Fakültesi Dicle Üniversitesi Veteriner Fakültesi Fırat Üniversitesi Veteriner Fakültesi BASKI (Print) ESER OFSET MATBAACILIK Tel: ERZURUM

5 Bu Sayının Hakem Listesi (alfabetik sıra) The Referees List of This Issue (in alphabetical order) AKTAŞ Abit İstanbul Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı AKYÜZ Bilal Erciyes Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı ALKAN Feray Ankara Üniversitesi Veteriner Fakültesi Viroloji Anabilim Dalı AYDENİZÖZ Meral Kırıkkale Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı BARAN Alper İstanbul Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı BERBER Selçuk Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Temel Bilimler Bölümü BÜYÜKOĞLU Tülay Afyon Kocatepe Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı CİRİT Ümüt İstanbul Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı COŞKUN Behiç Selçuk Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı ÇAM Mehmet Akif Ondokuz Mayıs Üniversitesi Ziraat Fakültesi Zootekni Bölümü ÇARLI Tayfun Uludağ Üniversitesi Veteriner Fakültesi Viroloji Anabilim Dalı ÇELEBİ Fikret Atatürk Üniversitesi Veteriner Fakültesi Fizyoloji Anabilim Dalı ÇENESİZ Sena Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı ÇETİN Nazmi Erciyes Üniversitesi Veteriner Fakültesi Fizyoloji Anabilim Dalı DAĞOĞLU Gürdal Fırat Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı DİDİNEN Behire Işıl Süleyman Demirel Üniversitesi Eğirdir Su Ürünleri Fakültesi Yetiştiricilik Bölümü ERDOĞAN Zeynep Mustafa Kemal Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı EREN Meryem Erciyes Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı EŞSİZ Dinç Kafkas Üniversitesi Veteriner Fakültesi Farmakoloji ve Toksikoloji Anabilim Dalı FIRATLI Çetin Ankara Üniversitesi Ziraat Fakültesi Zootekni Bölümü GANDOLFI Greta Department of Agri-food Protection and Improvement (DIPROVAL), University of Bologna, Italy GÜMÜŞSOY Kadir Semih Erciyes Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı GÜNER Ahmet Selçuk Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı GÜNEŞ Vehbi Erciyes Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı İKİZ Ramazan Akdeniz Üniversitesi Su Ürünleri Fakültesi Su Ürünleri Yetiştiriciliği Bölümü KARABAĞ Kemal Akdeniz Üniversitesi Ziraat Fakültesi Zootekni Bölümü KARACA Orhan Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü KARAPEHLİVAN Mahmut Kafkas Üniversitesi Veteriner Fakültesi Biyokimya Anabilim Dalı KAYA Mükerrem Atatürk Üniversitesi Ziraat Fakültesi Gıda Mühendisliği Bölümü KAYIŞ Seyit Ali Selçuk Üniversitesi Ziraat Fakültesi Zootekni Bölümü KELEŞ İhsan Yüzüncü Yıl Üniversitesi Veteriner Fakültesi İç Hastalıkları Anabilim Dalı KIRKAN Şükrü Adnan Menderes Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı ONUK Ertan Emek Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Su Ürünleri ve Hastalıkları Anabilim Dalı ÖZAK Ahmet Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı ÖZEN Asuman Ankara Üniversitesi Veteriner Fakültesi Histoloji ve Embriyoloji Anabilim Dalı ÖZEN Rahşan Fırat Üniversitesi Veteriner Fakültesi Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı ÖZER Barbaros Abant İzzet Baysal Üniversitesi Mühendislik Mimarlık Fakültesi Gıda Mühendisliği Bölümü ÖZGÜR Atilla Ankara Üniversitesi Veteriner Fakültesi Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı ÖZKUL Türel Uludağ Üniversitesi Veteriner Fakültesi Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı SARI Mehmet Kafkas Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı SARICA Musa Ondokuz Mayıs Üniversitesi Ziraat Fakültesi Zootekni Bölümü ŞEN Ayşin Uludağ Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı ŞİRELİ Tansel Ankara Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı ŞİRİN Özlem ŞENGÖZ Mehmet Akif Ersoy Üniversitesi Veteriner Fakültesi Cerrahi Anabilim Dalı TİLKİ Muammer Kafkas Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı TUNCER Sezginer Çanakkale Onsekiz Mart Üniversitesi Su Ürünleri Fakültesi Temel Bilimler/Deniz Biyolojisi TUZCU Mehmet Cumhuriyet Üniversitesi Veteriner Fakültesi Patoloji Anabilim Dalı TÜRK Gaffari Fırat Üniversitesi Veteriner Fakültesi Dölerme ve Suni Tohumlama Anabilim Dalı TÜRKMEN İ. İsmet Uludağ Üniversitesi Veteriner Fakültesi Hayvan Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı TÜZEMEN Naci Atatürk Üniversitesi Ziraat Fakültesi Zootekni Bölümü UDDIN Muhammad Jasim Agricultural University Faculty of Veterinary Science, Bangladesh UMUCALILAR Huzur Derya Selçuk Üniversitesi Veteriner Fakültesi Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı USLU Uğur Selçuk Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı ÜNAL Necmettin Ankara Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı ÜNVER Ahmet Kafkas Üniversitesi Veteriner Fakültesi Mikrobiyoloji Anabilim Dalı VATANSEVER Leyla Kafkas Üniversitesi Veteriner Fakültesi Besin Hijyeni ve Teknolojisi Anabilim Dalı YAMAN Mehmet Mustafa Kemal Üniversitesi Veteriner Fakültesi Parazitoloji Anabilim Dalı YAŞAR Aşkın Selçuk Üniversitesi Veteriner Fakültesi Deontoloji Anabilim Dalı YETİŞEMİYEN Atila Ankara Üniversitesi Ziraat Fakültesi Süt Teknolojisi Bölümü YILDIZ Mustafa İstanbul Üniversitesi Su Ürünleri Fakültesi Su Ürünleri Yetiştiriciliği Bölümü YILMAZ Alper İstanbul Üniversitesi Veteriner Fakültesi Zootekni Anabilim Dalı

6 İÇİNDEKİLER (CONTENTS) ARAŞTIRMA MAKALELERİ (Research Articles) Van Yöresinde İnsan ve Köpeklerde Toxocariasis in Yayılışı CICEK M, YILMAZ H... Evaluation of the Biogenic Amine Content and Some Chemical and Microbiological Properties of Urfa and Van Herby Cheeses SENEL E, YILDIZ F, YETISEMIYEN A, DURLU-OZKAYA F, OZTEKIN FS, SANLI E... Oral Zinc Supplementation Protects Rat Kidney Tissue from Oxidative Stress in Diabetic Rats OZSOY N, CAN A, MUTLU O, AKEV N, YANARDAG R... Karagöz İstavrit (Trachurus trachurus) Balığının Hematolojik Parametrelerine Su Sıcaklığı, Tuzluluk, Mevsim, Üreme, Cinsiyet, Balık Büyüklüğü ve Yaşın Etkisi CELIK ES, KAYA H, YILMAZ S, CAKICI H... Isolation and Characterization of Enterohaemorragic Escherichia coli O157:H7 and EHEC O157:NM from Raw Bovine, Camel, Water Buffalo, Caprine and Ovine Milk in Iran RAHIMI E, KHAMESIPOUR F, YAZDI F, MOMTAZ H... Distribution of Paw Preference in Female and Male Rats: Assessed by a Modified Version Food-Reachıng Test KUTLU N, BAYAZIT TO, MUTLU F... Bazı Buğdaygil Kaba Yemlerinin İn Vitro Gaz Üretimi, Sindirilebilir Organik Madde, Nispi Yem Değeri ve Metabolik Enerji İçeriklerinin Karşılaştırılması CANBOLAT O... Investigation of Relationship Between Bovine Herpesvirus-1 (BHV-1) Infection and Fertility in Repeat Breeding Dairy Cows in Family-Type Small Dairy Farms ATA A, KOCAMUFTUOGLU M, HASIRCIOGLU S, KALE M, GULAY MS... Evaluation of the Serum Lipid Profiles in Dogs with Symptomatic Visceral Leishmaniasis DURGUT R, DALKILINC D, GUZEL M... Determination and Pharmacokinetics of Recombinant Human Growth Hormone in Rabbit Plasma by Spectrofluorometry Method YILMAZ B, KADIOGLU Y, MERAL K, CELEBI F, ONGANER Y... Comparison of Swarming Tendency and Defensive Behavior of Yığılca Local and Other Commonly Used Honeybee Genotypes in Turkey GOSTERIT A, CIKILI Y, KEKECOGLU M... İstanbul da Çalışan Veteriner Hekimlerin İş Doyumu ve Tükenmişlik Düzeyleri BABAOGLU UT, CEVIZCI S, ARSLAN M... Türkiye de Veteriner Hekimliği Üzerine Araştırmalar: I. Veteriner Hekimliği Eğitim-Öğretimi OZEN A, DOGAN O, BASAGAC GUL RT, OZKUL T, YUKSEL E... Prevalence of Salmonella in Edible Offal in Afyonkarahisar Province, Turkey AKKAYA L, ATABAY HI, GOK V, YAMAN H... Detection of Brucella spp. in Vaginal Swab Samples of Aborting Cattle: Comparison of Immunoperoxidase to Bacteriological Culture Technique DAG S, BUYUK F, OZEN H, CELEBI O, KARAMAN M, AKCA D, SAHIN M... Leylek (Ciconia ciconia) Dili Üzerine Morfolojik Bir Çalışma TUTUNCU S, ONUK B, KABAK M... Predicting Breeding Values in Animals by Kalman Filter: Application to Body Condition Scores in Dairy Cattle KARACAOREN B, JANSS LLG, KADARMIDEEN HN... Sayfa (Page)

7 Sayfa (Page) Determination of Various Mycotoxin Concentrations in the Feedstuffs and Feed Produced by A Feed Manufacturer in Turkey ORUC HH, SORUCU A, TURKMEN II, ARSLAN E... Social Factors that Affect the Hand Hygiene of Elementary and Highschool Students in İstanbul - Turkey DUMEN E, OZGUR NY, SEZGIN FH... The Determination of Oxidative Stress by Paraoxonase Activity, Heat Shock Protein and Lipid Profile Levels in Cattle with Theileriosis TURUNC V, KONTAS ASKAR T... Seroprevalence of Avian Reovirus Infections in Chickens in Western Provinces of Turkey EROL N, SENGUL SS... Hayvan Koruma Kavramı ve Biyoetik Çerçevesinde Yaban Hayatı Koruma ve Yaban Hayatı Geliştirme Sahaları ASLIM G, YIGIT A, IZMIRLI S, YASAR A... Halk Elinde Yetiştirilen Beyaz ve Alaca Kazlarda Karkas ve Et Kalitesi Özellikleri YAKAN A, AKSU ELMALI D, ELMALI M, SAHIN T, MOTOR S, CAN Y... The Effects of Ketoprofen and Meloxicam on Bone Healing in Rat Model: A Comparative Dual Energy X-Ray Absorptiometry Study KURUM B, PEKCAN Z, KARSLI B, KUMANDAS A, ELMA E... Yetiştirici Elinde Bulunan Norduz Koyunlarının Laktasyon Süt Verimi ve Laktasyon Eğrisine Etki Eden Faktörler KONCAGUL S, DASKIRAN I, BINGOL M... The mrna Expression Pattern of Skeletal Muscle Regulatory Factors in Divergent Phenotype Swine Breeds CINAR MU, FAN H... The Effects of Pregnancy, Early Lactation Weeks and the Number of Suckling Kittens on the Serum Mineral and Metabolite Profiles of Van Cats in Breeding Season USLU BA, SENDAG S, UCAR O, GULYUZ F, TASAL I, CETIN N, WEHREND KISA BİLDİRİ (Short Communıcatıon) Siyah Alaca Sığırlarda Akrabalı Yetiştirme ve Akrabalı Yetiştirmenin Kontrolünde Çiftleştirme Programının Önemi DURU S DERLEME (Review) Sütçü İneklerde Negatif Enerji Dengesi ve Metabolik İndikatörleri SERBESTER U, CINAR M, HAYIRLI A

8 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Van Yöresinde İnsan ve Köpeklerde Toxocariasis in Yayılışı Mutalip ÇİÇEK * Hasan YILMAZ ** * Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, TR-180 Diyarbakır - TÜRKİYE ** Yüzüncü Yıl Üniversitesi Tıp Fakültesi Tıbbi Parazitoloji Anabilim Dalı, TR Van - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu araştırma, Van yöresinde ELISA yöntemi ile Toxocara canis in insanlardaki seroprevalansını ve köpeklerde bağırsak parazitlerinin yaygınlığını saptamak amacıyla yapıldı. Araştırma Eylül 005-Eylül 007 tarihleri arasında yürütüldü. Çalışma kapsamına, Yüzüncü Yıl Üniversitesi Araştırma Hastanesinin değişik polikliniklerinde muayene edilen eozinofili, ürtiker ve karın ağrısı gibi şikâyetleri olan 800 hasta ile kontrol grubu olarak sağlıklı görünümlü 100 kişi alındı. Hastalar ve kontrol grubunu oluşturan kişilerden alınan kan örneklerinde eozinofil ve total IgE düzeyleri ve ELISA yöntemiyle T. canis seropozitifliği araştırıldı; dışkı örnekleri ise nativ-lugol, trichrome boyama ve formol-eter çöktürme yöntemleri ile incelendi. Ayrıca 40 köpekten dışkı örneği alınarak makroskobik olarak, nativ-lugol, modifiye asit-fast boyama ve yüzdürme yöntemleri ile T. canis ve diğer bağırsak parazitleri araştırıldı. İnsanların %15.5 inde toxocariasis pozitifliği, %13.88 inde ise bağırsak parazitleri saptandı. Hastaların %5 inde eozinofili ve bu hastaların ise %8.05 inde toxocariasis pozitifliği belirlendi. Toxocariasis li hastaların %3.78 inde ürtiker, %.13 ünde kaşıntı, %9.83 ünde ise karın ağrısı saptandı. Köpeklerin %63.10 unda bir ya da daha çok sayıda bağırsak paraziti bulunmuş olup, T.canis e %19.05 oranında rastlandı. İnsanlarda toxocariasis ile kırsal alanda ikamet etme (P<0.01), eozinofili (P<0.001), yaşın artması (P<0.001) ve IgE yüksekliği (P<0.001) arasında ayrı ayrı anlamlı ilişkiler saptandı. Van yöresinde insan ve köpeklerde toxocariasis e sık rastlandığı ve bu hastalıktan korunmak için tedbirlerin alınması gerektiği ve insanlarda bu hastalığın teşhisi için ELISA yönteminin rutin tanı testleri arasına alınmasının gerekli olduğu kanaatine varıldı. Anahtar sözcükler: İnsan, Köpek, Prevalans, Toxocariasis, Van Prevalence of Toxocariasis in Human and Dogs in Van Province Summary This investigation was performed to detect the seroprevalence of Toxocara canis in humans by ELISA and distribution of intestinal parasites in dogs in Van province. The study was carried out between Septembers. Eight hundred patients with complaints such as abdominal pain, hypereosinophilia and urticaria who were inspected in various outpatients clinics of the Research Hospital of Yüzüncü Yıl University and 100 healthy individuals as control group were investigated. T. canis seropositivity by ELISA, eosinophil counts and total IgE levels were investigated in blood samples received from patients and control group individuals; stool samples of persons were also examined with native-lugol, trichrome staining and formalinether sedimentation methods. Besides, the stool samples of 40 dogs were also taken for the investigation of intestinal parasites. The stools of the dogs were examined for T. canis and other intestinal parasites macroscopically, by native-lugol, modified acid-fast staining and flotation methods. It was detected toxocariasis seropositivity in 15.5% and intestinal parasites in 13.88% of human. It was determined the eosinophilia in 5% of patients and toxocariasis seropositive in 8.05% of these patients. It was detected urticaria in 3.78%, pruritus in.13% and abdominal pain in 9.83% of patients with toxocariasis. One or more intestinal parasites were founded in 63.10% of the dogs, and T. canis was encountered as 19.05%. Positive relationship was detected among toxocariasis and living in rural area (P<0.01), eosinophilia (P<0.001), ageing (P<0.001) and high level of IgE (P<0.001). It was concluded that, toxocariasis is frequently encountered in humans and animals in Van province, measures should be taken to prevent this disease and ELISA method should be take place between routine diagnostic tests for diagnosis of this disease in human. Keywords: Human, Dog, Prevalance, Toxocariasis, Van, Turkey İletişim (Correspondence) /409 muttalipcicek@hotmail.com

9 53 Van Yöresinde İnsan ve... GİRİŞ Köpekler, insan sağlığı bakımından çok önemli olan bazı paraziter hastalıkları taşımakta olup, bu paraziter hastalıkların en önemlilerinden biri de köpeklerin bağırsak paraziti olan Toxocara canis in larvaları tarafından oluşturulan toxocariasis tir. T. canis köpek, kurt ve tilkilerin ince bağırsağında yaşamakta olup, larvalarının insanın iç organlarına göç etmeleri sonucunda eozinofilik granülomlarla kendini gösteren hastalık, visceral larva migransı (VLM) olarak adlandırılır 1,. Toxocariasis in teşhisinde yaygın olarak ELISA ve desteklemek amacıyla Western-Blot yöntemleri kullanılır 3-5. Türkiye de hastalığın nadir görüldüğünün düşünülmesi ve toxocariasis e ait spesifik bulguların olmaması, klinisyenlerin hastalığa gereken önemi vermemelerine neden olmuştur. Ülkemizde VLM ın gerçek prevalansı tam olarak bilinmemektedir. Son zamanlarda Türkiye de; yorgunluk, karın ağrısı, öksürük, baş ağrısı, karaciğer büyümesi, epilepsi, astım, uyku düzensizliği, eozinofil sayısında artış ve allerjik belirtileri olan değişik hasta gruplarında yapılan çalışmalar hastalığa sanıldığının aksine daha sık rastlandığını ortaya koymuştur Bu çalışma, Van yöresinde ELISA yöntemi ile toxocariasis in insanlardaki seroprevalansını ve köpeklerde T. canis ve diğer bağırsak parazitlerin yaygınlığını ve insanlardaki VLM riskini ortaya koymak için ayrıca seropozitif insanlarda klinik bulguları değerlendirmek amacıyla yapıldı. MATERYAL ve METOT Çalışma, Eylül Eylül 007 tarihleri arasında Van merkez ve Edremit, Özalp, Gürpınar, Gevaş ve Erciş ilçelerinde ikamet eden insanlar ile yine bu yörede bulunan köpekler üzerinde yürütüldü. Çalışma, Yüzüncü Yıl Üniversitesi Tıp Fakültesi Araştırma Hastanesinde muayene edilen ve yaşları -70 arasında değişen kişiler üzerinde yürütüldü. Çalışma kapsamına eozinofilisi olan 00 kişi ile ürtiker, kaşıntı, karın ağrısı, kronik halsizlik, baş ağrısı, artralji, aşırı ve ani sinirlenme, astım-nefes darlığı, hepatomegali ve ateş gibi klinik belirti ve bulgulardan bir ya da birkaçına sahip 800 kişi alındı. Bu kişilerin 430 u erkek, 370 i ise kadın bireylerden oluştu. Kontrol grubuna ise eozinofilisi bulunmayan ve toxocariasis belirtileri olmayan sağlıklı görünümlü 100 kişi alındı. Çalışma kapsamına alınan bütün hastaların her birinden 3 ml kan örneği alındı ve bu hastaların yaş, cinsiyet, ikamet yeri, muayene oldukları poliklinik ve şikâyetleri kaydedildi. Köpeklerde bağırsak parazitlerinin saptanması amacıyla, 40 köpeğe ait dışkı örneği, köpeklerin yaşadığı kulübeler veya konutların içerisinden ve sahipsiz köpeklerde ise takip şeklinde ve taze olarak elde edildi. Köpeklerin 170 i yavru (0-1 yaş), 50 si ise erişkin (1 yaş ve üzeri) hayvanlar olup, bunların 150 si sahipli ve 70 i ise sahipsizdi. Köpeklere ait dışkı örnekleri, üzerinde hayvanların eşkali ve yaşları ile ilgili bilgilerin yazılı olduğu geniş ağızlı dışkı kaplarına konuldu. Alınan bütün materyallerin incelenmesi Yüzüncü Yıl Üniversitesi Araştırma Hastanesi Parazitoloji Laboratuvarında yapıldı. Alınan kan örneklerinin serumları ya aynı gün çalışıldı ya da derin dondurucuda çalışma gününe kadar -0 o C de muhafaza edildi. Kan serumları, T. canis IgG ELISA (R-Biopharm AG-Almanya) kitleri ile çalışıldı. Hazırlanan plaklar 450 nanometrede okundu ve sonuçlar kit prosedürüne göre değerlendirildi. Ayrıca aynı hastalardan alınan kan örneklerinden eozinofil sayıları ve total IgE düzeyleri belirlendi. Ayrıca olası çapraz reaksiyonların dikkate alınması amacıyla bu hastalarda bağırsak parazitleri araştırması yapıldı. İnsanlarda bağırsak parazitlerinin teşhisi için, nativ-lugol, trichrome boyama, selofan-bant ve formol-etil asetat karışımı ile çöktürme yöntemleri 14 kullanıldı. Parazitoloji Laboratuvarına getirilen köpeklere ait dışkı örneklerinin bir kısmı önce makroskobik olarak olgun helmintler ve sestod halkaları yönünden, daha sonra nativ, çinko sülfat solüsyonu ile flotasyon ve modifiye asit-fast boyama yöntemleri kullanılarak helmint yumurtaları ile protozoon kist ve trofozoitleri yönünden incelendi 14,15. İnsan ve köpeklerde saptanan parazitlerin teşhisinde ilgili kaynaklardan 1,,15-19 faydalanıldı. Elde edilen sonuçların istatistiksel değerlendirilmesinde, Z-Testi ile oran karşılaştırması ve Ki-kare (c ) testi kullanıldı. BULGULAR Çalışmada, erkek hastaların %14.65 inde, kadın hastaların ise %15.94 ünde olmak üzere kan örnekleri incelenen toplam 800 kişinin 1 sinde (%15.5) T. canis IgG antikoru saptandı. Çalışmaya alınan kişilerden, kırsal alanda oturan 450 kişinin %18.44 ünde, kent merkezinde oturan 350 kişinin ise %11.14 ünde, çocuk yaş grubundaki 75 kişinin %6.54 ünde, 55 erişkinin ise %19.80 inde toxocariasis saptandı Kan örnekleri çalışılan 800 kişinin %5 inde eozinofili saptanmış olup, eozinofilili bu kişilerin %8.5 inde, eozinofilisi olmayan 600 kişinin ise %10.83 ünde toxocariasis pozitif bulundu. Ayrıca eozinofil sayısındaki artışın, antikor titresinin artışı ile doğru orantılı olarak da değiştiği görüldü. Total IgE değeri yüksek olan 163 kişinin %4.94 ünde, normal değerler arasında olan 637 kişinin ise %8.16 sında toxocariasis saptandı. Toxocariasis ile kırsal alanda ikamet etme (P<0.01), eozinofili (P<0.001), yaşın artması (P<0.001) ve IgE yüksekliği (P<0.001) arasında ayrı ayrı anlamlı ilişkiler saptandı (Tablo 1, Tablo ). Çalışmada, toxocariasis pozitif bulunan 1 hastanın %3.78 inde ürtiker, %.13 ünde kaşıntı, %9.83 ünde karın ağrısı, %9.83 ünde kronik halsizlik, %10.69 unda baş ağrısı, %9.16 sında artralji, %9.16 sında sinirlilik, %6.11 inde astım-

10 533 ÇİÇEK, YILMAZ Tablo 1. Hastalarda saptanan eozinofil oranları ile T.canis antikor titresi arasındaki ilişki Table 1. Relation between T.canis antibody titers with eozinofil rates detected in patient Eozinofil Oranları % Hasta Sayısı (n: 1) T. canis Seropozitif Hastalarda Antikor Titresi (n: 1) Sayı % ve üzeri Sayı % Sayı % Sayı % ve üzeri c = 51.37, P<0.001 Tablo. T. canis seropozitifliğinin hasta gruplarına göre dağılımı Table. Distribution according to patient groups of T. canis seropositivity Pozitif Hasta Hasta Grupları Hasta Sayısı Sayısı (%) İstatistiksel Değerlendirmeler Muayene edilen kişiler Z=.96 Kontrol grubu P<0.01 Çocuk yaş grubu Z= 4.36 Erişkin yaş grubu P<0.001 Erkek hastalar Z= 0.50 Kadın hastalar P>0.05 Eozinofilisi olanlar Z= 5.81 Eozinofilisi olmayanlar P<0.001 Total IgE si yüksek olanlar Z= 9.96 Total IgE si normal olanlar P<0.001 Kırsalda ikamet edenler Z=.8 Kentde ikamet edenler P<0.01 nefes darlığı, %4.91 inde hepatomegali, %5.34 ünde ateş ve %3.05 inde ise epilepsi saptandı. Araştırmada, dışkı örnekleri incelenen araştırma grubundan 800 kişinin %13.88 inde bağırsak paraziti saptandı. Bağırsak parazitlerinden Ascaris lumbricoides %1.38, Enterobius vermicularis %0.38, Trichuris trichiura %0.13, Hymenolepis nana %1.38, Fasciola hepatica %1.13, Giardia intestinalis %.88, Blastocystis hominis %3.5, Entamoeba coli %1.75, Entamoeba histolytica/entamoeba dispar %0.5, Chilomastix mesnili %0.63, Endolimax nana %0.13 ve Iodamoeba butschlii %0.63 oranında saptandı. Fasciola hepatica hariç diğer parazitlerle T. canis arasında çapraz reaksiyon görülmedi. F. hepatica antijenlerinin T. canis seropozitifliğini etkilemiş olabileceği düşünülerek bu hastalar toxocariasis pozitifliği yönünden değerlendirmeye alınmadı. Çalışmada, sağlıklı görünümlü 100 kişi kontrol grubu olarak kullanıldı. Herhangi bir şikâyeti olmayan bu kişilerin üçünde (%3) T. canis IgG pozitif bulundu. Bu çalışmada, sahipli köpeklerin %61.33 ünde, sokak köpeklerinin ise %64.07 sinde olmak üzere toplam 40 köpeğin %63.10 unda bir ya da daha fazla parazit türü saptandı. Sahipli ve sokak köpekleri arasında bağırsak parazitlerine rastlama sıklığı bakımından önemli bir fark saptanmamış olup, bu fark istatistiksel olarak da anlamlı bulunmadı (Z=0.94, P>0.05). Çalışmada sokak köpeklerinde yaş tayini hayvanın dişlerine göre yapılamadığı ve ancak takip suretiyle belirlendiği için yaş ile parazit arasındaki ilişkinin istatistiksel olarak verilmesi doğru bulunmadı. Çalışmada Toxocara leonina köpeklerin %6.19 unda saptanmış olup, en sık rastlanan parazit türü olduğu görüldü. Köpeklerin %19.05 inde T. canis saptandı. Bu parazit 110 yavru sokak köpeğinin %38.18 inde, 60 sahipli yavru köpeğin %55.00 inde, 160 erişkin sokak köpeğinin %1.88 inde, 90 sahipli erişkin köpeğin %. sinde bulundu. Köpeklerde saptanan parazit türleri ile bunların sayı ve oranları Tablo 3 te gösterildi. TARTIŞMA ve SONUÇ Türkiye de, evlerde köpek besleme alışkanlığı son zamanlarda giderek artmaktadır. Fakat bu hayvanların

11 534 Van Yöresinde İnsan ve... Tablo 3. Köpeklerde saptanan parazit türleri ile bunların sayı ve oranları Table 3. The number and rates of parasite species determined in dogs Parazitli Köpek Bulunan Parazitler % Sayısı (n: 40) Toxocara canis Toxocara leonina Trichuris vulpis Strongyloides spp Ancylostoma caninum Uncinaria stenocephala Filaroides spp Crenosoma vulpis Taeniidae spp Diphylidium caninum Linguatula serrata Sarcocystis spp Giardia canis Cystoisospora spp Cryptosporidium spp bakımı ve tedavisine yeterince önem verilmemektedir. Şehir merkezlerinde bile evlerde beslenen köpeklerin yanında, çok sayıda başıboş sokak köpeği bulunmakta ve bunlar taşıdıkları parazitler ile halk sağlığını tehdit etmektedir. Bu parazitlerden biri de T. canis olup, oluşturduğu toxocariasis genelde köpeklerin çok sayıda bulunduğu bölgelerde insanlarda sık rastlanmaktadır. Van yöresi park, bahçe ve oyun alanlarından toplanan toprak örneklerinin %5.97 sinde Toxocara spp. yumurtaları tespit edilmiştir 0. Türkiye de yaş grupları, yaşadıkları ortam ve şikâyetleri farklı olan insan popülasyonlarında yapılan çalışmalarda toxocariasis prevalansının % arasında değiştiği bildirilmektedir 6-13,1. İlimizi kapsayan çalışmada, şüpheli klinik bulguları olan 800 hastanın %15.5 inde, sağlıklı 100 kişilik kontrol grubunun da %3 ünde toxocariasis pozitifliği saptandı (Z=.96, P<0.01). Çocukluk dönemi bu hastalığa yakalanma ihtimalinin en yüksek olduğu yaş grubudur. Hijyen kurallarına dikkat etmeme, parkta oynama, bilinçsiz köpekle temas etme gibi durumlar çocukların enfeksiyona yakalanma riskini artırmaktadır. Fakat yurt dışında yetişkin popülasyonunda yapılan bazı çalışmalarda enfeksiyon % gibi yüksek oranda bulunmuştur. Tayvan da aborjinler arasında 0-9 yaş aralığında %0, 60 yaş üzerinde ise %88 olarak bulunmuş ve yaşın artmasıyla birlikte enfeksiyon oranının arttığı görülmüştür. Nijerya da 3 erişkinlerde (%30.4) çocuklara (%9.6) göre yüksek olduğu bildirilmiştir. Benzer şekilde erişkinlerdeki enfeksiyon oranı Brezilya da 4 %0.5, Venezuela da %5.6 5 Fransa nın La Reunion adasında %9 6 olarak rapor edilmiştir. Bu çalışmada da yaşları -14 arasında değişen çocukların %7.7 si, yetişkinlerin ise %19.4 si seropozitif olup, bu sonuç diğer ülkelerde yapılan bazı araştırmaların,3 sonuçlarına benzemektedir. Erişkin insanlarda enfeksiyonun yüksek oranda saptanmasının nedeni, yaşın ilerlemesiyle birlikte etkenle karşılaşma ve etkenin vücuda alınma ihtimalinin artmasıyla açıklanabilir. Günümüzde toxocariasis in tanısı için en sık kullanılan yöntem ELISA dır. ELISA nın duyarlılığının %80, özgüllüğünün ise %90-95 olduğu bildirilmiştir. T. canis ile Fasciola, Trichinella, Strongyloides ve Schistosoma türleri arasında ortak antijenler ve buna bağlı çapraz reaksiyonların olabileceği bildirilmiştir 3,4. Çalışmada sadece Fasciola ile Toxocara arasında çapraz reaksiyon saptanmıştır. Ancak klinik, laboratuar ve ultrasonografi bulguları değerlendirilerek fascioliasis teşhisi konmuş hastalar toxocariasis grubuna dahil edilmemiştir. Çalışmada fascioliasis li kişilerin dışında hastalarda çapraz reaksiyon verebilecek parazite rastlanmaması nedeniyle ELISA yöntemi ile saptanan toxocariasis olgularının gerçek pozitifliği yansıttığı kanaatindeyiz. Toxocara canis gibi doku invazyonu yapan helmintlerin insanlarda allerjik reaksiyonlara neden olduğu ve bu kişilerde allerjik ürtikere rastlandığı bildirilmiştir Bu çalışmada da toxocariasis tanısı almış 1 kişide en fazla görülen belirti %35.4 oranında ürtiker olmuştur. Bu hastalarda, ürtikerin dışında karın ağrısı, kronik halsizlik, baş ağrısı, artralji, sinirlilik, astım-nefes darlığı, hepatomegali, ateş ve epilepsi gibi belirtilerden bir veya birkaçı görülmüştür. Yine bu helmintin insanlarda eozinofil sayısında 8,30-3 ve serum IgE 7,33,34 düzeyinde artışa neden olduğu rapor edilmiştir. Benzer şekilde bu çalışmada da toxocariasis pozitifliği ile eozinofili (Z=5.81, P<0.001) ve total IgE yüksekliği arasındaki (Z= 9.96, P<0.001) ilişki istatistiksel olarak anlamlı bulunmuştur. Bu yüzden toxocariasis in total IgE ve eozinofil oranını yükselttiği ayrıca yukarıda belirtilen şikayetlerin nedeni olduğu ve bu yüzden total IgE yüksekliği ya da eozinofilisi olan veya bahsedilen semptomplardan bir veya birkaçına sahip hastalarda toxocariasis in düşünülmesi gerektiği kanaatine varıldı. Toxocariasis in kırsal ve kentsel alanlardaki yayılışı ile ilgili olarak gerek Türkiye de ve gerekse diğer bazı ülkelerde yapılan çalışmalarda kırsal yerleşim yerlerinde daha yüksek oranda toxocariasis bulunduğu rapor edilmiştir 1,6,30,35. Bu çalışmada ise kırsal alanda ikamet eden 450 kişinin %18.44 ünde, kent merkezlerinde ikamet eden 350 kişinin %11.14 ünde pozitiflik saptandı (Z=.8, P<0.01). Bu araştırmada elde edilen bulgular, diğer çalışmalarda 1,6,35 saptanan bulgulara benzemekte olup, bunun sebepleri arasında kırsal alandaki insanların eğitim seviyesinin düşüklüğü, köpeklerle daha fazla yakın temasta olunması, köpek sayısının fazla olması ve köpeklerde paraziter ilaçlamanın yapılmaması gibi faktörler sayılabilir. Bazı ülkelerde köpekler üzerinde yapılan çalışmalarda bağırsak parazitlerine % oranlarında, Türkiye de ise % , oranlarında rastlandığı bildiril-

12 535 ÇİÇEK, YILMAZ miştir. Bu çalışmada, 40 köpeğin %63.10 unda bir veya daha fazla sayıda helmint ya da protozoon türü saptandı. Elde edilen bu oran Konya ve Erzurum da yapılan çalışmalardan 43,46 daha yüksek bulunurken, Kuzey Marmara da yapılan çalışma 41 ile benzerlik göstermektedir. Yine bu çalışmada sahipli köpeklerin %61.33 ünde ve sokak köpeklerinin %64.07 sinde parazite rastlandı. Bu araştırmada sahipli köpeklerdeki parazit oranı, Konya da ve Kuzey Marmara da yapılan her iki çalışmanın 41,43 verilerinden daha yüksektir, sokak köpeklerinde elde edilen oran ise Konya da yapılan çalışmanın bulgularına benzemektedir. Van yöresi köpeklerinde bağırsak parazitlerinin yüksek oranda bulunmasında; başıboş köpeklerin çokluğu, kontrolsüz ve kaçak hayvan kesimleri sırasında sakatatların başıboş köpekler tarafından yenmesi, sahipli köpeklerde parazit kontrollerinin ve tedavilerinin yapılmaması, incelenen köpeklerin çoğunun sokak köpekleriyle sık temas eden bahçe köpekleri olmaları gibi faktörlerin etkili olduğu söylenebilir. Köpeklerin T. canis ile enfeksiyon oranının hayvanın yaşına, cinsiyetine ve çevre koşullarına bağlı olarak değiştiği bildirilmektedir 47. Bu çalışmada köpeklerin %19.05 inde T. canis enfeksiyonu saptanmış olup, bu sonuç Türkiye de daha önce yapılan araştırmalarda elde edilen oranlara 41-46,48 (% ) benzemektedir. Sonuç olarak, Van yöresinde toxocariasis prevalansı, köpeklerde ve insanlarda hiç de küçümsenmeyecek bir oranda bulunmuştur. Bu parazitin insanlarda meydana getirdiği enfeksiyonun tedavisinin olmadığı düşünülecek olursa, zoonoz karakterdeki bu parazite karşı köpeklerde ve insanlarda koruyucu tedbirlerin alınması önemlidir. Ayrıca insanlarda hastalığın teşhisinin yapılabilmesi için sağlık kurumlarında ELISA yönteminin rutin tanı testleri arasına alınmasının uygun olacağı kanaatine varıldı. KAYNAKLAR 1. Markell EK, Voge M, John DT: Medical Parasitology. 7 th ed., WB Saunders Company, Philadelphia, Unat EK, Yücel A, Altaş K, Samastı M: Unat ın Tıp Parazitolojisi. 6. Baskı, İstanbul Üniversitesi Cerrahpaşa Tıp Fak Vakfı Yayınları, İstanbul, Magnaval JF, Glickman LT, Dorchies P, Morassin B: Highlights of human toxocariasis. K J Parasitol, 39, 1-11, Jacquier P, Gottstein B, Stingelin Y, Eckert J: Immunodiagnosis of Toxocariosis in humans: Evaluation of a new enzyme-linked ımmunosorbent assay kit. J Clin Microbiol, 9, , Magnaval JF, Fabre R, Maurières P, Charlet JP, de Larrard B: Application of the western blotting procedure for the immunodiagnosis of human toxocariasis. Parasitol Res, 77, , Akyol A, Biçerol B, Ertuğ S, Ertabaklar H, Kıylıoğlu N: Epilepsy and seropositivity rates of Toxocara canis and Toxoplasma gondii. Seizure, 16, 33-37, Güngör Ç, Çiftçi E, Aral Akarsu G: Nedeni belirlenemeyen karın ağrısı şikâyeti olan çocuklarda Toxocara antikoru prevalansı. Türkiye Parazitol Derg, 3, 4-7, Oğuztürk H, Saygı G: Toxocara canis larvaları ile oluşan enfeksiyonun ilköğretim okulu öğrencilerinde araştırılması. Türkiye Parazitol Derg, 6, , Kaplan M, Bulut S, Gödekmerdan A, Kuk S, Kalkan A: Epileptik hastalarda Toxocara canis seropozitifliği. Türkiye Parazitol Derg, 6, , Kaplan M, Kalkan A, Hoşoğlu S, Kuk S, Özden M, Demirdağ K, Özdarendeli A: The frequency of Toxocara infection in mental retarded children. Mem Inst Oswaldo Cruz, 99, 11-15, Kuştimur S, Doğruman AF, Oğuzülgen K, Bakır H, Maral İ, Türktaş H, Tüzün H: Toxocara seroprevalence in adults with brochial asthma. Trans R Soc Trop Med Hyg, 101, 70-74, Yazar S, Yaman O, Çetinkaya Ü, Hamamcı B, Şahin İ: Erciyes Üniversitesi Tıp Fakültesi Parazitoloji Anabilim Dalı na müracaat edenlerde anti Toxocara canis IgG antikorlarının araştırılması. Türkiye Parazitol Derg, 34, 4-6, Akdemir C: Visceral larva migrans among children in kütahya (Turkey) and an evaluation of playgrounds for T. canis eggs. Turk J Pediatr, 5, 58-16, Ok ÜZ, Girginkardeşler N, Kilimcioğlu A, Limoncu E: Dışkı inceleme yöntemleri. In, Özcel MA, Altıntaş N (Eds): Parazit Hastalıklarında Tanı. I. Baskı, s. 16-4, Türkiye Parazitoloji Derneği Yayınları, İzmir, Tınar R: Helmintoloji. 1. Baskı, Nobel Yayınları, Ankara, Soulsby EJL: Helminths, Arthropods and Protozoa of Domesticated Animals. 7th ed., Baillere Tindall, London, Yamaguti S: Systema Helminthum. Vol. II: The Cestodes of Vertebrates. Interscience Publishers, New York & London, Yamaguti S: Systema Helminthum. Vol. III: The Nematodes of Vertebrates. Interscience Publishers, New York & London, Pinckney RD: Canine Filaroides Infection. In, Bowman DD (Ed): Companion and Exotic Animal Parasitology. Publisher: International Veterinary Information Service. School of Veterinary Medicine, University of Wisconsin-Madison, Wisconsin, USA, Parasit_Bowman/pinckney_filaroides/ivis.pdf, Accessed: Ayaz E, Yaman M, Gul A: Prevalance of Toxocara spp. eggs in soil of public parks in Van, Turkey. Indian Vet J, 80, , Büyükbaba Ö, Özkan E, Büget E: Toxocariasis canis ve çocuklardaki seroprevalansının ELISA ile araştırılması. İnfek Derg, 10, 7-11, Fan CK, Lan HS, Hung CC, Chung WC, Liao CW, Du WY, Su KE: Seroepidemiology of Toxocara canis infection among mountain aboriginal adults in Taiwan. Am J Trop Med Hyg, 71, 16-1, Ajayi OO, Duhlinska DD, Agwale SM, Njoku M: Frequency of human toxocariasis in Jos, Plateau State, Nigeria. Mem Inst Oswaldo Cruz, 95, , Anaruma Filho F, Chieffi PP, Correa CR, Camargo ED, Silveira EP, Aranha JJ, Ribeiro MC: Human toxocariasis: A seroepidemiological survey in the municipality of Campinas (SP), Brazil. Rev Inst Med Trop Sao Paulo, 44, , Lynch N, Eddy K, Hodgen A, Lopez R, Turner K: Seroprevalence of Toxocara canis infection in tropical Venezuela. Trans R Soc Trop Med Hyg, 8, 75-81, Magnaval JF, Michault A, Calon N, Charlet JP: Epidemiology of human toxocariasis in La Réunion. Trans R Soc Trop Med Hyg, 88, , Buijs J, Borsboom G, Renting M, Hilgersom WJA, Van Wieringen JC, Jansen G, Neijens J: Relationship between allergic manifestations and Toxocara seropositivity: A cross-sectional study among elementary school children. Eur Respir J, 10, , Humbert P, Niezborala M, Salambier R, Aubin F, Piarroux R, Buchet S, Barale T: Skin manifestation associated with toxocariasis: A case-control study. Dermatology, 01, , Figueiredo SD, Taddei JA, Menezes JJ, Novo NF, Silva EO, Cristóvão HL, Cury MC: Clinical-epidemiological study of toxocariasis in a pediatric population. J Pediatr (Rio J), 81, 16-13, Chiodo P, Basualdo J, Ciarmela L, Pezzani B, Apezteguia M, Minvielle M: Related factors to human toxocariasis in rural community of Argentina. Mem Inst Oswaldo Cruz, 101, , Maraghi S, Rafiei A, Hajihossein R, Sadjjadi SM: Seroprevalence of toxocariasis in hypereosinophilic individuals in Ahwaz, south-western Iran.

13 536 Van Yöresinde İnsan ve... J Helminthol, 7, 1-4, Kwon NH, Oh MJ, Lee SP, Lee BJ, Choi DC: The prevalence and diagnostics value of toxocariasis in known eosinophilia. Ann Hematol, 85, 33-38, Kojima S, Yokogawa M, Tada T: Raised levels of serum IgE in human helminthiases. Am J Trop Med Hyg, 1, , Magnaval JF, Faufingue JH, Morassin B, Fabre R: Eosinophil cationic protein, specific IgE and IgG4 in human toxocariasis. J Helminthol, 80, , Sadjjadi SM, Khosravi M, Mehrabani D, Oryan A: Seroprevalence of Toxocara infection children in Shiraz, Southern Iran. J Trop Pediatr, 46, , Dubna S, Langrova I, Napravnik J, Jankovska I, Vadlejch J, Pekar S, Fechtner J: The prevalence of intestinal parasites in dogs from Prague, rural areas, and shelters of the Czech Republic. Vet Parasitol, 145, 10-18, Fontanarrosa MF, Vezzani D, Basabe J, Eiras DF: An epidemiological study of gastrointestinal parasites of dogs from Southern Greater Buenos Aires (Argentina): Age, gender, breed, mixed infections, and seasonal and spatial patterns. Vet Parasitol, 136, 83-95, Martinez-Moreno FJ, Hernandez S, Lopez-Cobos E, Becerra C, Acosta I, Martinez-Moreno A: Estimation of canine intestinal parasites in Cordoba (Spain) and their risk to public health. Vet Parasitol, 143, 7-13, Pullola T, Vierimaa J, Saari S, Virtala AM, Nikander S, Sukura A: Canine intestinal helminths in Finland: Prevalence, risk factor and endoparasite control practices. Vet Parasitol, 140, 31-36, Ramirez-Barrios RA, Barboza-Mena G, Munoz J, Angulo-Cubillan F, Hernandez E, Gonzalez F, Escalona F: Prevalence of intestinal parasites in dogs under veterinary care in Maracaibo, Venezuela. Vet Parasitol, 11, 11-0, Başaran E: Kuzeydoğu Marmara Bölgesinde kedi ve köpeklerin helmint enfeksiyonları. Doktora Tezi, Uludağ Üniv Sağlık Bil Enst., Doğanay A, Öge S: Ankara sokak köpeklerinde ascariasis in yayılışı. Ankara Üniv Vet Fak Derg, 40, 55-56, Güçlü F, Aydenizöz M: Konya da köpeklerde dışkı bakılarına göre parazitlerin yayılışı. T Parazitol Derg, 19, , Şenlik B, Çırak VY, Karabacak A: Intestinal nematode infections in Turkish military dogs with special reference to Toxocara canis. J Helminthol, 80, , Ünlü H, Eren H: Aydın yöresi sokak köpeklerinde dışkı bakısına göre saptanan mide bağırsak helmintleri. Türkiye Parazitol Derg, 31, 46-50, Balkaya İ, Avcıoğlu H: Gastro-intestinal helminths detected by coprological examination in stray dogs in the Erzurum province Turkey. Kafkas Univ Vet Fak Derg, 17, 43-46, O Lorcain P: Epidemiology of Toxocara spp. in stray dogs and cat in Dublin. Ireland. J Helminthol, 68, , Öncel T: İstanbul da evlerde beslenen köpeklerde Toxocariosis canis. Kafkas Univ Vet Fak Derg, 10, , 004.

14 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Evaluation of the Biogenic Amine Content and Some Chemical and Microbiological Properties of Urfa and Van Herby Cheeses [1] Ebru ŞENEL * Filiz YILDIZ * Atila YETİŞEMİYEN * Fügen DURLU-ÖZKAYA ** F. Şebnem ÖZTEKİN * Ebru ŞANLI * [1] This study was supported by Ankara University, Scientific Researches Projects (Project number of ) * Ankara University, Faculty of Agriculture, Department of Dairy Technology, TR Ankara - TURKEY ** Gazi University, Tourism Faculty, Gölbaşı Campus, TR Ankara - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, the biogenic amine contents and some microbiological and chemical properties of Urfa and Van herby cheeses obtained from local supermarkets in Urfa and Van provinces were investigated. Tryptamine, β-phenylethylamine, putrecine, cadaverine, histamine and tyramine levels were detected in these cheeses. In addition some chemical properties (ph, total solids, fat-in-dry matter and salt-in-dry matter, protein, ripening coefficient, water soluble nitrogen and water activity) and some microbiological properties (total aerobic mesophilic bacteria, lactic acid bacteria and Enterobacteriaceae) were determined. Tyramine, cadaverine, histamine and putrecine were predominant biogenic amines in Urfa and Van herby cheese, respectively. β-phenylethylamine and tryptamine in Urfa cheese, were predominant in Van herby cheeses. The amounts of tyramine in Urfa and Van herby cheeses were found to be the highest with an average of 1.80 mg 100 g -1, 0.56 mg 100 g -1, respectively. None of the detected biogenic amines was higher than the toxic limit. Keywords: Biogenic amine, Enterobacteriaceae, Lactic acid bacteria, Total aerobic mesophilic bacteria, Urfa cheese, Van herby (otlu) cheese Urfa ve Van Otlu Peynirlerinin Bazı Kimyasal ve Mikrobiyolojik Özellikleri ve Biyojen Amin İçeriklerinin Değerlendirilmesi Özet Bu çalışmada, Urfa ve Van bölgelerindeki süpermarketlerden temin edilen Urfa ve Van otlu peynirlerinin biyojen amin içerikleri ve bazı mikrobiyolojik ve kimyasal özellikleri incelenmiştir. Bu peynirlerde triptamin, β-feniletilamin, putresin, kadaverin, histamin ve tiramin düzeyleri belirlenmiştir. İlaveten bazı kimyasal özellikleri (ph değeri, toplam kurumadde, kurumadde de yağ ve kurumadde de tuz içeriği, protein, olgunlaşma katsayısı, suda çözünür azot ve su aktivitesi) ve bazı mikrobiyolojik özellikleri (toplam aerobik mezofil bakteri, laktik asit bakterileri ve Enterobacteriaceae türleri) belirlenmiştir. Tiramin, kadaverin, histamin ve putresin her iki peynirde de dominant biyojen aminlerdir. β-feniletilamin Urfa peynirinde dominat iken triptamin Van otlu peynirinde dominanttır. Urfa ve Van otlu peynirlerinde en yüksek tiraminin miktarı sırasıyla 1.80 mg 100 g -1, 0.56 mg 100 g -1 olarak saptanmıştır. Biyojen aminlerin hiçbiri toksik limitin üzerinde değildir. Anahtar sözcükler: Biyojen amin, Enterobacteriaceae, Laktik asit bakterisi, Toplam aerobik mezofil bakteri, Urfa peyniri, Van otlu peyniri INTRODUCTION Biogenic amines are organic compounds of low molecular weight that exhibit biological activity and are usually produced by the decarboxylation of amino acids or by amination and transformation of aldehydes and ketones. The formation of biogenic amines in foods requires the availability of free amino acids, the presence of decarboxylase-positive microorganisms and conditions that enable bacterial growth 1. Biogenic amines are organic İletişim (Correspondence) senel@agri.ankara.edu.tr

15 538 Evaluation of the Biogenic... substances present in food, which are responsible for toxicological risks and can be detrimental to health. The presence of high levels of biogenic amines in foods may cause migraine, headaches, hypo or hypertension, heart palpitations, flushing, gastric and intestinal problems and pseudo allergic responses 3. The most important biogenic amines occurring in foods and beverages are Histamine (HI), Phenylethylamine (PHE), Tyramine (TY), Tryptamine (TR), Putrescine (PU), Cadavarine (CA), Spermine (SM) and Spermidine (SD) 4,5. These biogenic amines may be present in ripened cheeses and fermented products 6. Cheese is one of the foods reported to have the highest content of amines, and it is the most prevalent product associated with amine poisoning 3. Biogenic amines also can cause cheese syndrome and histamine intoxication related to tyramine and histamine respectively 7. The factors which are related to the formation of biogenic amines in dairy products, are the microflora that can produce decarboxylases, microbiological quality of the milk, cheese production technology, cheese ripening conditions and hygienic conditions during production processes 1,8. A high concentration of these amines could be used as an indicator of poor hygienic quality of cheese 7. Urfa and Van herby cheeses are most important two traditional cheeses in Turkey. They are produced in the Eastern and South eastern Anatolia regions of Turkey. Urfa cheese is a semi hard brined Turkish type cheese manufactured from raw ovine milk or appropriate mixtures of ovine and caprine milk, without any starter culture 9. The production of Urfa cheese is carried out from March to June in South Eastern Turkey 10. The popularity of Urfa cheese has been increasing, and it is exported to Middle Eastern and Central Asian countries 11. The annual production of Urfa cheese has been estimated to be approximately tons 1. The cheese making procedure of Urfa cheese is as following: raw milk is coagulated with rennet at 30-3ºC. When the coagulum is obtained, it is cut into small cubes and then drained in triangular moulds, called parzin, which contain g of curd. The parzins have finer pores than regular cheese cloth, and whey removal may not be completed lesser than 1 h at room temperature 13. After removing the whey by gravity drainage, the curd is scalded with whey at around 90ºC/3 min. and stretched until it becomes well knit. Then it is shaped by hand in a cotton bag. Afterwards the cheese blocks are dry salted at room temperature, then they are stored in brine (15% NaCl) for 3-4 months 10,11,13. Van herby (otlu) cheese is a very famous brined cheese variety in Turkey, and its popularity has been gradually increasing 13. It is generally produced from raw sheep milk. In case that sheep milk is not available, a mixture of sheep and goat or cow milk can be used 14. The local production has been being continued for more than 00 years 15. Although its production is concentrated in eastern Turkey. Van herby cheese is marketed throughout Turkey and has a considerable export potential to the EU once its production is standardized 16. Van herby cheese is traditionally produced as following: After the filtering of raw sheep milk, rennet is added at the milking temperature. After coagulation, it is cut into small pieces and the whey is removed. Van herby cheese is produced using herbs which give the cheese a characteristic appearance and aroma/flavour and also extend its shelf life 13,16. Previously sliced herbs are added into the curd. As many as 5 kinds of herbs such as Alliums spp., Thymus spp., Ferula spp., Anthriscus nemorasa, etc can be used to make Van herby cheese. These herbs, can be added individually or as a mixture 16,17. The amount of the added herb varies from 0.5 to kg or from 0.5 to 3 kg per curd obtained from 100 L of milk 14,17. Afterwards, the curd is mixed well to obtain a homogenous distribution of the herbs. Then the mixture of curd and herbs is pressed with a heavy object for approximately 3 hours to remove the whey sufficiently. The pressed cheese is cut into blocks and the blocks are salted with dry salt or ripened in brine. Then the cheese blocks are put into the bottom of a plastic container as the first layer. Cacik (a quark like product made from yoghurt), is placed over the cheese blocks, and is used to fill the spaces between blocks in the container in order to force out the air. When the container is entirely filled up with cheese, the top is covered with a clean cloth and the container is turned upside down and buried in the ground in a cool place. During ripening, the water drains from the cheese and absorb by the soil. This cheese is ripened for more than 3 months to obtain its characteristic taste and flavour 14. However, this traditional production method has been replaced in dairies by brine-salting and the cheese is marketed in a vacuum-packed in containers 16. In summary, Urfa and Van herby cheeses are economically and culturally important traditional products. These cheeses are usually manufactured using traditional methods. With the traditional manufacturing methods, high amounts of biogenic amines could be expected in these cheeses due to expected potentially high microbiological contents. To date, numerous studies concerning Urfa and Van herby cheeses have been published, describing their chemical, microbiological, and technological properties as well as antioxidant capacity and mineral contents 9-1,14,15, However studies on the contents of the biogenic amines in Urfa and Herby cheese are not adequate. In one study, Durlu-Özkaya 3 obtained nine samples of Van herby cheese and nine samples of Urfa cheese from a supermarket in Ankara province and determined the biogenic amine content of these cheeses. On the other hand, the biogenic amine content of several other Turkish cheeses including white brined cheese, Tulum cheese, Civil cheese, Kaşar cheese etc, have been well characterized 3,0,1. The objectives of this study are to determine some microbiological and chemical properties and the types and quantities of biogenic amines present in Urfa and Van

16 539 ŞENEL, YILDIZ, YETIŞEMIYEN DURLU-ÖZKAYA, ÖZTEKIN, ŞANLI herby cheeses and, to correlate the biogenic amines with the other properties. MATERIAL and METHODS Materials Twenty samples for each of two cheese types were purchased from different urban vendors of the Şanlıurfa and Van provinces of Turkey between May and June. Five hundred gram samples were obtained and kept on ice in an insulated container until being transferred to the laboratory. Then the samples were then analyzed in the laboratory of Dairy Technology Department of Ankara University. Methods Chemical Analyses The total solid content of the cheese samples was determined by the gravimetric method, and fat content by the Gerber method using a Van-Gulik butyrometer. The salt content of the cheeses was detected according to the Mohr method described by Hooi et al.. The ph values were measured by using a ph-meter model Mettler Toledo (Analytical, Switzerland) fitted with a standard, combined with glass electrode. The total nitrogen (TN) and water soluble nitrogen (WSN) contents of samples were determined according to Gripon, Desmazeaud, Bars & Bergere 3. Ripening coefficients were estimated as the percentage of WSN in TN. The water activity was measured using a Novasina thermoconstanter (Axair Ltd. Systems, Switzerland). Microbiological Analyses Samples were prepared according to AOAC methods 4. The samples were aseptically opened, and homogenized with 0.1% peptone water for 90 s in sterile stomacher bags. Related dilutions were spread plated onto Plate Count Agar (Merck) for Total aerobic mesophilic bacteria (TAMB), MRS agar (Merck) for lactic acid bacteria (LAB) and Violet Red Bile Dextrose Agar (Merck) for Enterobacteriaceae. Results were calculated as CFU per gram 4,5. Determination of Biogenic Amines Using HPLC Samples were prepared according to the method used by Maijola and Eerola 6 and Durlu-Özkaya et al. 0. Acetonitrile/ Percholoric acid (AP) solution (1:1) was used for precipitation of protein in the cheese and internal standard (IS) (1-7 diamino heptane, Sigma) was added into this mixture. After centrifugation of the mixture, the aqueous layer was removed and mixed with acetonitrile, bidistilled water, sodium carbonate solution and dansyl chloride, followed by agitation on a vortex mixer The samples were then maintained in a water-bath at 37 C for 30 min. Naglutaminate solution (50 mg ml -1 ) was added and the samples were agitated and then incubation in a waterbath at 37 C for 60 min. Acetonitrile (ACN) was added once again and the samples were centrifuged. The aqueous layer was used for determination of biogenic amine contents. Standard solutions of each biogenic amine were prepared separately in AP solution. 5 ml from each of these standard solutions were dissolved in 0 ml of AP solution and 500 µl of IS was added into mixture. The chromatograms of biogenic amines were obtained according to Bütikofer, Fuchs, Hurni & Bosset 7. High pressure liquid chromatographic (HPLC) system (Hewlett Packard, model 1100, CA, US) equipped with UV detector (HP-G 1314 A) was used for detection of biogenic amine. Measurements were performed at 54 nm, using a reversed phase Luna C 18 column (50x 4.6 mm, 5 µm). A and B solutions as a mobile phase were used at a flow rate of 1 ml min -1 while the column temperature was set as 35 C. A and B mobile phases were prepared buffer/ethanol/acetonitrile/h O:7.5/ 50/75/117.5 ml and buffer/ethanol/acetonitrile/h O:0.5 /11.5/11.5/5 ml, respectively. Also buffer solution was prepared tris/acetic acid/ H O:/1/. The injection volume was 0 µl. Statistical Analyses Minitab version 13. (Minitab, Inc., State College, Pa.) was used for data analyses. A two-tailed t test at the 95% confidence interval was conducted to determine differences in microbial content and biogenic amines, and chemical properties and biogenic amines 8. RESULTS Mean, minimum and maximum values of water activity, ph, total solids, protein, water soluble nitrogen (WSN), ripening coefficient, fat-in-dry mater and salt-in-dry matter in Urfa and Van herby cheeses are given in Table 1. The mean value of ph, total solids, fat in dry matter, salt in dry matter, protein, WSN and ripening coefficient in Urfa cheese were determined as 5.04±0.8, 47.5±1.08, 57.57±.0, 1.99±1.69, 18.7±1.9, 0.46±0.11, 15.7±1.30, respectively. The mean value of ph, total solids, fat in dry matter, salt in dry matter, protein, WSN and ripening coefficient in Van herby cheese were determined as 4.74±0.07, 5.14±0.74, 47.6±1.9, 1.10±0.7, 0.51±0.40, 0.49±0.0, 15.13±0.59, respectively. The values of Enterobacteriaceae, LAB, TAMB, and individual biogenic amines in Urfa cheese are given Table. The values of Enterobacteriaceae, LAB, TAMB and individual biogenic amines in Van herby cheese are given Table 3.

17 540 Evaluation of the Biogenic... Table 1. The results of chemical properties of Urfa and Van herby cheese Tablo 1. Urfa ve Van otlu peynirlerin kimyasal analiz sonuçları Chemical Urfa Cheese Van Herby Cheese Properties Min Max Mean Min Max Mean Water Activity, (aw) ± ±0.06 ph Value ± ±0.07 Total Solids, (g 100 g -1 ) ± ±0.74 Protein, (g 100 g -1 ) ± ±0.40 WSN, (g 100 g -1 ) ± ±0.0 Ripenning Coefficient, % ± ±0.59 Fat in Dry Matter, (g 100 g -1 ) ± ±1.9 Salt in Dry Matter, (g 100 g -1 ) ± ±0.7 Table. Microbiological properties and biogenic amines content of Urfa cheese samples Tablo. Urfa peynirlerinin mikrobiyolojik özellikleri ve biyojen amin içeriği Samples Enterobacteriaceae spp. Bacteria (log cfu g -1 ) Biogenic Amines (mg 100 g -1 ) LAB TAMB TR PHE PU CA HI TY Total Amine nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd 3.75 nd nd nd nd nd 1.01 nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd Min Max Mean 4.1± ± ± ± ± ± ± ± ± ±0.58 nd: not determined, LAB: Lactic acid bacteria, TAMB: Total Aerobic Mezophylic Bacteria, TR: Tryptamine, PHE: Phenylethylamine, PU: Putrecine, CA: Cadaverine, HI: Histamine, TY: Tyramine

18 541 ŞENEL, YILDIZ, YETIŞEMIYEN DURLU-ÖZKAYA, ÖZTEKIN, ŞANLI Table 3. Microbiological properties and biogenic amines content of Van herby cheese samples Tablo 3. Van otlu peynirinin mikrobiyolojik özellikleri ve biyojen amin içeriği Samples Enterobacte riaceae spp. Bacteria (log cfu g -1 ) Biogenic Amines (mg100 g -1 ) LAB TAMB TR PHE PU CA HI TY Total Amine 1 < nd < nd < nd < nd nd < nd < nd nd nd nd nd nd nd nd nd < nd nd < nd nd nd nd < nd nd nd nd nd nd nd 15 < < nd nd < nd < nd nd Min < Max Mean.48± ± ± ± ± ± ± ± ± ±0.5 nd: not determined, LAB: Lactic acid bacteria, TAMB: Total Aerobic Mezophylic Bacteria, TR: Tryptamine, PHE: Phenyl ethylamine, PU: Putrecine, CA: Cadaverine, HI: Histamine, TY: Tyramine

19 54 Evaluation of the Biogenic... DISCUSSION The ph, total solids, fat- in-dry matter, salt- in- dry matter, protein, WSN and ripening coefficient in Urfa cheese are in accordance with the results reported by other researchers 9,11,9, 30. These results indicated that Urfa cheese has similar properties as full fat, white-brined cheese 11. However the salt-in dry matter is higher than in whitebrined cheese. In traditional Urfa cheese production, producers prefer very high brine concentrations in order to provide microbial safety 11. Therefore Urfa cheese has a very high salt concentration. Yalçın et al. 9, detected the mean of the salt content in dry matter in 30 Urfa cheese as 0.01%. The ph, total solids, fat- in- dry matter, saltin- dry matter, protein, WSN and ripening coefficient in Urfa cheese results also show similarity with the results of previous studies 18,31,3. Both Urfa and Van herby cheeses have a wide range of chemical properties. As a result of demoisturing and/or biochemical changes during ripening, the compositional properties of cheeses were changed. In this regard, a significant difference between the chemical properties of fresh and ripened Van herby cheeses was found by Tarakçı et al. 18. Another possible reason could be that a standard manufacturing procedure is not used by producers, since these cheeses are generally produced traditionally. İşleyici and Akyüz 31 reported that the microbial flora and chemical properties of Van herby cheese can vary due to the following reasons; production from different raw milk, post contamination after pasteurization, using different ripening techniques and conditions. In addition, Erkan et al. 33 reported that the microbiological properties of the herbs have not been investigated; therefore herbs could be one of the contamination points in herbed cheeses. The mean value of Enterobacteriaceae, LAB, and TAMB determined from 0 Urfa cheese samples were found as 4.1±0.35 log cfu.g -1, 6.64±0.1 log cfu.g -1, 7.35±0.15 log cfu.g -1, respectively. Özer et al. 34 and Yetişmeyen, Yıldız 30 found a higher TAMB count in Urfa cheese ( cfu.g -1 and cfu.g -1, respetively). Atasoy et al. 35 reported that TAMB in Urfa cheese varied from and cfu.g -1. Of twenty Urfa cheese samples, five cheeses were found not to contain Enterobacterieceae (<100 cfu.g -1 ). The mean value of Enterobacteriaceae, LAB and TAMB determined from 0 Van herby cheese samples were found as.48±0.19 log cfu.g -1, 4.95±0.7 log cfu.g -1, and 6.30±0.5 log cfu.g -1, respectively. The TAMB counts for Van herby cheese were found to be lower than those obtained by Kurt and Akyüz 36, Coşkun and Öztürk 14 and İşleyici and Akyüz 31 ( cfu.g -1, 7.14 log 10 cfu g -1 and 7.8 log cfu g-1, respectively) but higher than that measured by Yetişmeyen et al. 3. Enterobacteriaceae were not found in 13 of the samples of Van herby cheeses (<100 cfu. g -1 ), and higher levels were detected in the rest of the samples. SM and SD were not detected in the Urfa cheese samples. Similarly, Durlu-Özkaya 3 found that SM content was absent in some Turkish cheeses including Urfa and Van herby cheese. In Urfa cheese, TY was detected in 17 samples out of 0 (85%). Also Durlu-Özkaya 3 reported that TY was detected in 89% of cheeses. TY was found to be highest among the biogenic amines (max mg 100 g -1 ) in Urfa cheeses. However, the TY amount did not exceed the tolerable limits for TY in cheese as reported (00 mg kg -1 ) by Karovicova & Kohajdova. It was found that TY (85%), PU (75%), PHE (70%), CA (60%) and HI (55%) were the predominant biogenic amines in Urfa cheese. Also TR was detected in 30% of Urfa cheeses. The mean values of TY, PHE and CA in Urfa cheeses were found to be high as 1.80±0.50 mg 100 g -1, 0.36±0.18 mg 100 g -1, and 0.1±0.11 mg 100 g -1, respectively. Elsanhoty et al. 1 reported that the contents of TY, PHE and CA in cheese are associated with the number of Enterobactericeae. Also the accumulation of TY has been related to non starter lactic acid bacteria, mainly lactobacilli 5,37. Durlu-Özkaya and Özkan 38 reported that the production of TY was also related to number of lactococci. In this study, the data indicate that the number of both Enterobacteriaceae and LAB were very high in Urfa cheeses. The formation of these biogenic amines increased along with the high microbial counts of Urfa cheeses. The total amount of biogenic amines in detectable samples was.80±0.58 mg 100 g -1. The biogenic amine content of Urfa cheeses is lower than that of the other studies reported in Turkey. In addition, the content of individual biogenic amines was in accordance with the levels obtained from Feta cheese 39. But, on the contrary, it was lower than those reported elsewhere in various cheeses, like Domiati cheese 1, Manchego cheese 1,40. Although the spices and herbs used in the manufacture of Van herby cheese have an antimicrobial effect, their own microflora must be taken into consideration 41. It is reported that a positive correlation exists between biogenic amines, especially the content of CA, and the number of Enterobacteriaceae in cheese. Enterobacteriaceae may result in an increase in decarboxylase content 4. In Van herby cheese, CA (95%), and PU (95%), TY (90%), HI (85%), TR (55%) were the predominant biogenic amines. However, PHE amount was detected fairly low (mean 0.08±0.04 mg 100 g -1 ) in 0% of samples. Although the content of TY was found to be the highest with 0.56±0.04 mg 100 g -1, none of biogenic amines exceed the tolerable limit. Toxic doses were given as 10 mg 100 g -1 for HI, 80 mg 100 g -1 for TY and 3 mg 100 g -1 for PHE, depending on the immune system of individuals 43. However, in the study performed by Durlu-Özkaya 3, PHE was not detected in Van herby cheese and the amounts of other biogenic amines detected were found to be higher than those in this research. The higher content of CA, PU and HI in cheese batches from raw milk could be explained by the higher Enterobacteriaceae and lactobacilli counts found in those batches. These amines are commonly

20 543 ŞENEL, YILDIZ, YETIŞEMIYEN DURLU-ÖZKAYA, ÖZTEKIN, ŞANLI associated with Enterobacteriaceae 37. However, in this study, although Enterobacteriaceae and lactobacilli counts in Urfa cheese were approximately twice as high as those of Van herby cheese. CA, PU and HI contents in Van herby cheese were found to be higher. Taking into account all of the chemical and microbiological results from Urfa and Van herby cheeses, there is a clear necessity for standardization in their production as seen by the large range of the cheese properties. In addition, the cheeses should be produced from pasteurized milk in order to reduce the bacteriological load. Since these types of cheeses are generally produced from raw milk, a high microbiological load results in formation of biogenic amines. Notably, the total biogenic amine content of Urfa cheese, which had high microbiological counts, was higher than the total biogenic amine content of Van herby cheese. However, generally the low levels of biogenic amine content in both type of cheeses could be attributed the low ripening index of the cheeses. REFERENCES 1. Elsanhoty R, Mahrous H, Ghanaimy A: Chemical, microbiological counts and evaluation of biogenic amines during the ripening of Egyptian Soft Domiati cheese made from raw an pasteurized buffaloes milk. Int J Dairy Sci, 4, 80-90, Karovicova J, Kahajdova Z: Biogenic amines in Food. Chem Pap, 59, 70-79, Durlu-Ozkaya F: Biogenic amines content of some Turkish cheeses. J Food Process Pres, 6, 59-65, Bodmer S, Imark C, Kneubuhl M: Biogenic amines in foods: Histamine and food processing. Inflamm Res, 48, , Ayhan K, Durlu-Ozkaya F: Biogenic amines in Food. In, Özer B (Ed): Metabolism and Applications of Lactic Acid Bacteria. pp , Research Signpost Trivandrum India, Chang SF, Ayres JW, Sandine WE: Analysis of cheese for histamine, tyramine, tryptamine, histidine, tyrosine and tryptophane. J Dairy Sci, 68, , Novella-Rodriquez S, Veciana-Nogues M, Roig-Sagues A, Trujillo- Mesa A, Vidal-Carou M: Influence of starter and nonstarter on the formation of biogenic amine in Goat cheese during ripening. J Dairy Sci, 85, , Rak L: Biogenic amines in dairy products. CAB abstract cababstractsplus.org/abstracts/abstract.aspx.acno= , Atasoy F, Turkoglu H: Changes of composition and free fatty acid contents of Urfa cheeses (a white-brined Turkish cheese) during ripening: Effects of heat teratments and starter cultures. Food Chem, 110, , Ardıc M, Atasever M, Adıguzel G, Atasever Y, Unsal C, Durmaz H: A survey on the Aflatoxin M1 in Urfa Cheese. Int J Food Safety, 10, 9-96, Ozer BH, Robinson RK, Grandison S: Textural and Microstructural properties of Urfa cheese (a white-brined Turkish cheese). Int J Dairy Technol, 56, , Ozer B, Atasoy F, Akın S: Some properties of Urfa cheese (a traditional white-brined cheese) produced from bovine and ovine milks. Int J Dairy Technol, 55, 94-99, Hayaloglu AA, Ozer BB, Fox PF: Cheeses of Turkey:. Varieties ripened under brine. Dairy Sci Technol, 88, 5-44, Coskun H, Ozturk B: Vitamin C contents of some herbs used in Van herby cheese (Van Otlu Peyniri). Nahrung, 44, , Celik E, Ozyurek M, Altun M, Bektasoglu B, Guclu K, Berker K, Ozgokce F, Apak R: Antioxidant capacities of herbal plants used in the manufacture of Van herby cheese: Otlu peynir. Int J Food Prop, 11, , Hayaloglu AA, Fox PF: Cheeses of Turkey: 3. Varieties containing herbs or spices. Dairy Sci Technol, 88, 45-56, Tarakçı Z, Coskun H, Tuncturk Y: Some properties of Fresh Ripened Herby Cheese a Traditional Variety Produced in Turkey. Food Technol Biotech, 4, 47-50, Ardıc M, Kav K, Guner A, Dogruer Y: Identification of enterobacteriaceae in Urfa cheese. Acta Aliment, 36, , Durmaz H, Tarakcı Z, Sangun E, Sancak H: Effect of ripening time on mineral contents of herby cheese. J Anim Vet Adv, 5, , Durlu-Ozkaya F, Ayhan K, Ozkan G: Biogenic amine determination in Tulum cheese by high performance liquid chromatography (HPLC). Milchwissenschaft, 55, 7-8, Yıldız F, Yetisemeyen A, Senel E, Durlu-Ozkaya F, Oztekin S, Sanlı E: Some properties of Civil cheese: A type of traditional Turkish cheese. Int J Dairy Technol, 63, , Hooi R, Barbano DM, Bradley RL, Budde D, Bulthaus M, Chettiar M, Lynch J, Reddy R: Chemical and physical met hods. In, Wehr HM, Frank JF (Eds): Standard Methods for the Examination of Da iry Products. American Public Health Association, pp , Washington D.C, Gripon JC, Desmazeaud MJ, Bars D, Bergere JL: Etude Du Role des Micro-Organismes et des Enzymes au Cours de la Maturatian des Fromages. Le Lait, 55, , Anonymous: Official Methods of Analysis the Association of Official Agricultural Chemists. The Association of Agricultural Chemists. 17th ed., Washington, Harrigan WF, Mccance ME: Laboratory methods in food and dairy microbiology. Academic Press, London, Maijala R, Erola S: Contaminant lactic acid bacteria of dry sausages produce histamine and tyramine. Meat Sci, , Butikofer U, Fuchs D, Hurni D, Bosset J: Beitrag zur Bestimmung biogener amine in kase. Mitt Gebiete Lebensm Hgy, 81, , Rosner B: Fundamentals of Biostatistics, 6 th ed., Thomson Higher Education 10 Davis Drive, Belmont, CA, USA, Yalcin S, Ardic M, Nizamoglu M: Some quality characteristics of Urfa Cheese. Atatürk Üniv Vet Fak Derg,, 90-95, Yetismeyen A, Yıldız F: Urfa peynirlerinin mikrobiyolojik, kimyasal ve duyusal özelliklerinin saptanmasi. Gıda Derg, 8, 87-94, Işleyici O, Akyuz N: The determination of lactic acid bacteria and microflora in Herby cheese offered for sale in Van. Yüzüncü Yıl Üniv Vet Fak Derg, 0, 59-64, Yetismeyen A, Yildirim M, Yildirim Z: Ankara piyasasında tüketime sunulan otlu peynirlerin kimyasal, mikrobiyolojik ve duyusal niteliklerinin belirlenmesi. Ankara Üniv Zir Fak Yay, 173, s. 1-17, Erkan EM, Ciftcioglu G, Vural A, Aksu H: Some microbiological characteristics of herbed cheeses, J Food Qual, 30, 8-36, Ozer BH, Atasoy AF, Akın MS: Pastörizasyon ve haslama islemlerinin geleneksel Urfa peynirlerinin mikrobiyolojik ve kimyasal nitelikleri üzerine etkileri. VI. Süt ve Süt Ürünleri Sempozyumu, -3 Mayıs, Tekirdag, Turkey, s , Atasoy F, Turkoglu H, Ozer HB: Some microbhiological properties of raw milk, yoghurt and fresh Urfa cheese produced and sold in Şanlıurfa province. Harran Üniv Zir Fak Derg, 7, 77-83, Kurt A, Akyuz N: The production of Van herby cheese and its microbiological, physical and chemical properties. Gıda Derg, 9, , Novella-Rodriquez S, Veciana-Nogues M, Roig-Sagues A, Trujillo- Mesa A, Vidal-Carou M: Evaluation of biogenic amines and microbial counts throught the ripening of goat cheeses from pasteurized and raw milk. J Dairy Res, 71, 45-5, 004.

21 544 Evaluation of the Biogenic Durlu-Ozkaya F, Ayhan K, Ozkan G: Determination of biogenic amines produced by Enterobacteriaceae isolated from meat products. Meat Sci, 58, , Valsamaki K, Michaelidou A, Polychroniadou A: Biogenic amine production in Feta cheese. Food Chem, 71, 59-66, Fernández-garcía E, Tomillo J, Uñez M: Formation of biogenic amines in raw milk Hispanico cheese manufactured with proteinases and different levels of starter culture. J Food Protect, 63, , Coskun H: The problems and solutions related to the production of Van Herby Cheese. Dünya Gıda Derg, 1, 37-39, Marino M, Maifreni M, Moret S, Rondinini G: The capacity of Enterobacteriaceae species to produce biogenic amines in cheese. Lett Appl Microbiol, 31, , Halasz A, Barath A, Sarkadi S, Holzapfel W: Biogenic amines and their production by microorganisms in food. Trends Food Sci Tech, 5, 4-49, 1994.

22 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Oral Zinc Supplementation Protects Rat Kidney Tissue from Oxidative Stress in Diabetic Rats [1] Nurten OZSOY * Ayse CAN * Ozgur MUTLU ** Nuriye AKEV * Refiye YANARDAG ** [1] This work was presented at 3. Uluslararası Hücre Zarları ve Oksidatif Stres Kongresi: Kalsiyum Sinyali ve TRP Kanalları Congress, held on - 7 June 010, Isparta/TURKEY * Istanbul University, Department of Biochemistry, Faculty of Pharmacy, TR Istanbul - TURKEY ** Istanbul University, Department of Chemistry, Faculty of Engineering, TR-3430 Istanbul - TURKEY Makale Kodu (Article Code): KVFD Summary Zinc (Zn) is a trace element possessing a wide range of functions and antioxidant properties. This study was undertaken in order to illuminate the conflicting data on the status of zinc in diabetes, present in literature. Female Swiss albino rats were randomly divided into 4 groups: Group I, control; Group II, control + zinc sulfate; Group III, streptozotocin (STZ)-diabetic; Group IV, STZ-diabetic + zinc sulfate. Diabetes was induced by intraperitoneal injection of STZ (65 mg/kg body weight). Zinc sulfate was given daily by gavage at a dose of 100 mg/kg body weight every day for 60 days to Groups II and IV. At the last day of the experiment, rats were killed under anesthesia, kidney tissue was taken and homogenized. Antioxidant enzyme activities such as catalase (CAT), glutathione reductase (GR), glutathione peroxidase (GPx), glutathione-s-transferase (GST), superoxide dismutase (SOD) and myeloperoxidase (MPO), were determined in tissue homogenates as well as protein carbonyl content (PCC). Carbonic anhydrase (CA) was also determined as a functional enzyme for kidney. It was shown that kidney tissue antioxidant enzyme activities which were significantly impaired in the untreated diabetic group, were reversed in zinc treated diabetic groups, thus showing the beneficial effect of Zn treatment in diabetes via its antioxidant effect. Keywords: Zinc, Oxidative stress, Kidney, Diabetes mellitus, Antioxidant enzymes Ağızdan Çinko Verilmesi Diyabetik Sıçanlarda Böbrek Dokusunu Oksidatif Hasara Karşı Korur Özet Çinko (Zn), çok sayıdaki fonksiyonlarının yanı sıra antioksidan özellik de gösteren bir eser elementtir. Bu çalışma, bilimsel kaynaklarda, çinkonun diyabetteki etkisi ile ilgili çelişkili verileri aydınlatmak amacıyla gerçekleştirilmiştir. Swiss albino ırkı dişi sıçanlar 4 gruba ayrılmıştır: Grup I, kontrol; Grup II, kontrol + çinko sülfat, Grup III, streptozotosin (STZ)-diyabetik; Grup IV, STZ-diyabetik + çinko sülfat. Diyabet, intraperitoneal STZ (65 mg/kg) injeksiyonu ile oluşturulmuştur. Çinko sülfat, 60 gün süreyle, her gün 100 mg/ kg oranında, gavaj yoluyla Grup II ve IV e verilmiştir. Deneyin son gününde, sıçanlar anestezi altında kesildikten sonra böbrek dokuları alınarak homojenize edilmiştir. Doku homojenatlarında katalaz (CAT), glutatyon redüktaz (GR), glutatyon peroksidaz (GPx), glutatyon -S-transferaz (GST), superoksit dismütaz (SOD) ve miyeloperoksidaz (MPO) gibi antioksidan enzimlerin aktiviteleri ve protein karbonil miktarı (PCC) saptanmıştır. Ayrıca, böbrek için fonksiyonel bir enzim olan karbonik anhidraz (CA) aktivitesi de tayin edilmiştir. Diyabetik grupta anlamlı olarak değişiklik gösteren antioksidan enzim aktivitelerinin, çinko sülfat ile muamele edilmiş sıçanlarda iyileşme gösterdiği saptanmıştır. Sonuç olarak çinkonun diyabetteki olumlu etkisinin antioksidan etkisi nedeniyle olabileceği ileri sürülmüştür. Anahtar sözcükler: Çinko, Oksidatif stres, Böbrek, Diabetes mellitus, Antioksidan enzimler INTRODUCTION Diabetes is a major cause of vascular complications affecting heart, kidney, retina and peripheral nerves. Hyper- glycemia leads to oxidative stress that plays an important role in vascular degenerative lesions observed in diabetes 1. İletişim (Correspondence) /13478 nozsoy@istanbul.edu.tr

23 546 Oral Zinc Supplementation... Streptozotocin (STZ) is a naturally produced antibiotic from Streptomyces achromogenes which has been widely used to induce diabetes in experimental animals. It causes the selective destruction of pancreatic b-cells, probably by a free-radical-mediated mechanism. Zinc (Zn) is a microelement required for the activity of nearly two hundred enzymes and is considered essential for cell division, DNA and protein biosynthesis 3. The relation of plasma and urine Zn levels to diabetes mellitus has been investigated in several studies. Although hyperzincuria appears to be a common finding in most diabetic subjects 4, there are controversial findings about plasma Zn concentrations in diabetes 5. Zn status is decreased in blood and tissues in most type diabetic patients 1,3. Zn levels in plasma, lymphocytes, granulocytes and platelets have been found lower in diabetic subjects in comparison to controls and it was concluded that diabetic patients are Zn deficient 3. Zn metabolism seems to be altered in diabetic patients as well as in diabetic animals, and Zn supplementation has been shown to exhibit beneficial effects in diabetic animals and humans, which indicates that this metal might qualify as a future therapeutic intervention in diabetes mellitus This hypothesis is supported by the identification of zinc transporter (ZnT)- 8, a protein responsible for zinc regulation, and by the proposed involvement of metallothionein (MT) another protein contributing to zinc homeostasis, in diabetes and its complications. In rats made diabetic by administration of STZ, a model of Type 1 diabetes mellitus, the zinc concentration in liver and kidney was increased, possibly due to an increase in MT, which could be observed in diabetic animals or the elevated zinc levels in these animal models could be explained by the sudden destruction of pancreatic b-cells by STZ, thus causing the release of zinc that was stored in b-cells 11. Zn has numerous targets to modulate insulin activity, including its antioxidant capacity. Shisheva et al. 1, have concluded that Zn + mimics several actions of insulin both in vitro and in vivo by a mechanism unrelated to insulin. The insulinomimetic effect of Zn complexes have been studied in last years and the pharmacology of new complexes reported 13. Superoxide dismutase (SOD) is the first antioxidant enzyme to deal with oxidative free radicals by accelerating the dismutation of superoxide to hydrogen peroxide, while catalase (CAT) is a peroxisomal heme protein that catalyses the removal of hydrogen peroxide formed during the reaction catalyzed by SOD. Thus, SOD and CAT act as mutually supportive antioxidative enzymes, which provide protective defense against reactive oxygen species (ROS). Any increase in SOD activity is beneficial in the event of increased free radical generation. However, a rise in SOD activity, without a concomitant rise in the activity of CAT and/or glutathione peroxidase (GPx) might be detrimental since SOD generates hydrogen peroxide as a metabolite, which must be scavenged by CAT or GPx. Glutathione antioxidant system plays a fundamental role in cellular defense against reactive free radicals and other oxidant species. It consisted of reduced glutathione and an array of functionally-related enzymes, of which glutathione reductase (GR) is responsible for the regeneration of reduced glutathione (GSH), whereas GPx and glutathione-s-transferase (GST) work together with GSH in the decomposition of hydrogen peroxide or other organic hydroperoxides 14,15. Kupffer cell myeloperoxidase (MPO) may be an important source of oxidative damage during tissue injury 16. We have also measured tissue MPO activity to evaluate the degree of tissue infiltration by neutrophils. Oxidative damage to several of amino acid residues and/or to the backbone of proteins can generate carbonyl products. Indeed, measurement of protein carbonyls has been used as a sensitive assay for oxidative damage to proteins, partly because it measures several different consequences of oxidative damage 17. Carbonic anhydrase (CA), is a cytosolic enzyme present in most tissues of higher vertabrates and catalyzes the CO /HCO 3 interconversion. It is speculated that changes in the activity of CA, may be of fundamental importance in the regulation of intracellular ph for the basic control of metabolism in diabetes mellitus. The altered CA activity could change an intracellular ion imbalance that might cause insulin resistance, which in turn might lead to type II diabetes 18. Though the mechanism laying beyond the beneficial effect of Zn in diabetes has been explained through its insulinomimetic effect 13, the beneficial effect of Zn supplementation in non-diabetic animals via amelioration of the antioxidant balance has also been reported 19,0. In addition, it is known that in diabetes, impairement of antioxidant defense system affects kidney tissue, leading to nephropathy. Nevertheless, the pathophysiology of diabetic nephropathy is not well defined. It is reported that high glucose directly increases hydrogen peroxide production by mesangial cells and lipid peroxidation of glomerular mesangial cells 1. Regarding these hypotheses, in order to elucidate the mechanism of action of Zn, the present study intends to evaluate the effect of Zn treatment on the antioxidant parameters in the kidney tissue of diabetic rats. MATERIAL and METHODS Animals and Tissue Preparation The experiments were approved and supervised by Animal Care and Use Comittee of Istanbul University. Female Swiss albino rats weighing g were

24 547 OZSOY, CAN, MUTLU AKEV, YANARDAG used throughout the study. The animals were months old and clinically healthy. The rats were fed with standard laboratory pellet chow with water ad libitum. The experimental period was maintained at constant laboratory temperature and the rats were submitted to 1 hours light/dark cycles. The animals were divided into 4 groups: Group I. Control (intact) animals (n=5). Group II. Control animals given zinc sulfate (n=6). Group III. STZ-induced diabetic animals (n=6). Diabetes was induced by intraperitoneal injection of STZ in a single dose of 65 mg/kg body weight. Freshly prepared solution was made by dissolving STZ in cold 0.01 M sodium citrate- HCl buffer. Group IV. STZ-induced diabetic animals given zinc sulfate (n=9). Zinc sulfate heptahydrate (Merck) was given to groups II and IV by gavage at a dose of 100 mg/kg body weight, every day, for 60 days. At the last day of the experiment, rats were killed, kidney tissues were taken, homogenized using Art-MICCRA D-1 homogenator by means of a glass homogenizer in cold saline ( rpm) to make a 10% (w/v) homogenate. The homogenates were centrifuged at rpm for 5 min (Megafuge Hereaus1.0R) and the clear supernatants were used for enzyme and protein analysis. Biochemical Assays Blood glucose levels after 18 h fasting were estimated by the o-toluidine method as described previously 10. Each animal with a fasting blood glucose concentration above 00 mg/dl was considered diabetic. All the assays were performed using the kidney tissue homogenate in appropriate dilutions. Shimadzu Spectrophotometer UV-(1800) was used for all spectrophotometric measurements. CAT activity was measured according to Aebi. The rate of decomposition of H O was measured spectrophotometrically from change in absorbance at 40 nm. Activity of catalase was expressed as mmol H O /mg protein. GR activity was determined by following the oxidation of NADPH at 340 nm (extinction coefficient 6. mm -1 cm -1 ) as described by Carlberg and Mannervik 3. GR activity was expressed as mmol NADPH oxidized/min/mg protein. The activity of GPx was measured using a coupled enzyme assay system linked with GR as described by Lawrence and Burk 4. Enzyme activity was calculated as mmol of NADPH oxidized per min per mg protein using the molar extinction coefficient for NADPH at 340 nm of 6. mm -1 cm -1. GST activity using 1-chloro-,4-dinitrobenzene as substrate was assayed spectrophotometrically as described by Habig and Jakoby 5. Specific activity was expressed as mmol conjugate formed/min/mg protein using a molar extinction coefficient of 9.6 mm -1 cm -1. Total SOD activity was measured by its ability to increase the effect of riboflavin sensitized photo-oxidation of o-dianisidine, according to Mylroie et al. 6. Tissue MPO levels were measured according to Hillegass et al U of activity was defined as change in absorbance of 1.0 per minute at 5 o C. Results were expressed as units of MPO per gram of protein of supernatant as determined by method of Lowry. The p-nitrophenylacetate esterase activity of CA was measured by the method of Verpoorte et al. 8. One unit of enzyme activity was expressed as mmol nitrophenol formed per minute at 0 o C using a molar extinction coefficient of 5 x Protein carbonyl content (PCC) was assayed by the modification of the procedure described by Levine et al. 9 and Reznick and Packer 30 using dinitrophenylhydrazine (DNPH) dissolved in HCl, accompanied by blanks in HCl alone. Results were expressed as nmol of protein carbonyl per mg of protein using a molar extinction coefficient of.000 M -1 cm -1 for DNPH. Tissue protein levels were measured by the method of Lowry et al. 31 using bovine serum albumin as a standard. Statistical Analysis Biochemical results were evaluated using an unpaired t-test and ANOVA variance analysis using the NCSS statistical computer package. The values were expressed as mean ± SD. Analysis between control and experimental groups was performed using the Mann-Whitney test. P< 0.05 was considered as significant. RESULTS A significant increase was observed in kidney tissue CAT activity in STZ-diabetic rats (P<0.001). Zinc sulfate treatment caused a significant decrease (P<0.005) in the activity of this enzyme. The difference between the groups was significant (P ANOVA = ; Table 1). GR activity was significantly higher in STZ-diabetic rats kidney tissue compared to control group (P<0.05). The decrease in GR activity in the Zn treated group was not significant. The difference between the groups was significant (P ANOVA = 0.01; Table 1). Zn treatment to normal animals in the control group caused a significant rise in GPx activity in rat kidney tissue (P<0.05). Induction of diabetes rised significantly GPx

25 548 Oral Zinc Supplementation... activity compared to the control group (P<0.001) and Zn treatment lowered significantly (P<0.05) the enzyme activity. The difference between the groups was significant (P ANOVA = ; Table 1). A significant increase was also seen in GST activity levels in the diabetic group versus the control group (P<0.005) whereas the levels were lowered almost to control levels (P<0.05) in the Zn treated group. The difference between the groups was significant (P ANOVA = ; Table 1). SOD activity was also significantly increased in the kidney tissue of diabetic rats (P<0.05) and though insignificant, a decrease was observed after zinc sulfate administration. The difference between the groups was significant (P ANOVA = 0.009; Table 1). Kidney tissue MPO activity which was significantly increased (P<0.001) by the induction of diabetes, was lowered by treatment with zinc sulfate (P<0.005). The difference between the groups was significant (P ANOVA = ; Table ). STZ-induced diabetes provoked a significant increase (P<0.05) in kidney tissue CA activity, the diabetic group which have received zinc sulfate showed significant decrease (P<0.05) in these values compared to the diabetic group. The difference between the groups was significant (P ANOVA = 0.003; Table ). An insignificant increase of PCC was observed in the kidney tissue of diabetic rats. This value was decreased in the diabetic group treated with zinc (P ANOVA = 0.06; Table ). In summary, Zn administration made an unsignificant rise in the antioxidant enzyme levels in the control + Zn group. In STZ-diabetic group all enzyme activities were raised significantly and it was observed that Zn treatment reverses significantly the oxidative damage caused by diabetes. DISCUSSION In a previous study, significant hypoglycemic effect was seen between the fasting blood glucose levels of the diabetic group and diabetic + Zn group 10. This suggests that Zn supplementation stimulates glucose metabolism and is in agreement with literature reporting protective effects of Zn on blood glucose levels 3,33. The role of Zn in modulating oxidative stress has been recognized, thus Zn could be a physiological constituent of the antioxidant defense system. Zn deficiency has been demonstrated to trigger oxidative stress and oxidantmediated damage to cell components 34. Combined supplementation of chromium and Zn in people with type diabetes mellitus had potential beneficial effects with Table 1. The activities of antioxidant enzymes, catalase (CAT), glutathione reductase (GR), glutathione peroxidase (GPx), glutathione-s-transferase (GST) and superoxide dismutase (SOD) in the kidney tissues of all groups Tablo 1. Tüm grupların böbrek dokularında, katalaz (CAT), glutatyon redüktaz (GR), glutatyon peroksidaz (GPx), glutatyon-s-transferaz (GST) ve superoksit dismutaz (SOD) antioksidan enzimlerinin aktiviteleri Group CAT (U/mg protein) GR (U/mg protein) GPx (U/mg protein) GST (U/mg protein) SOD (U/mg protein) Control 7.65± ±.6 99± ± ±0.01 Control+Zn 38.81± ± ±3.46 *** 51.3± ±0.05 Diabetic 7.17±3.97 * 17.43±4.5 *** 491.7±84.85 * 13.16±19.17 ***** 0.63±0.08 *** Diabetic+Zn 56.97±.17 ** 1.77± ±5.35 **** 73.3±.0 **** 0.147±4.9 P ANOVA Values are given as Mean ± S.D.; * P< compared with control; ** P<0.005 compared with diabetic; *** P<0.05 compared with control; **** P<0.05 compared with diabetic; ***** P<0.005 compared with control Table. The activities of myeloperoxidase (MPO) and carbonic anhydrase (CA) and the levels of protein carbonyl contents (PCC) in the kidney tissues of all groups Tablo. Tüm grupların böbrek dokularında, miyeloperoksidaz (MPO) ve karbonik anhidraz (CA) aktiviteleri ve protein karbonil miktarları (PCC) Group MPO (U/g protein) CA (U/mg protein) PCC (nmol PC/mg protein) Control 4.8± ± ±0.75 Control+Zn 5.10± ± ±0.89 Diabetic 10.7±1.14 * 4.07±8.3 *** 6.49±4.84 Diabetic+Zn 7.55±1.5 ** 11.80±3.84 **** 3.0±1.58 P ANOVA Values are given as Mean ± S.D.; * P< compared with control; ** P< compared with diabetic; *** P<0.05 compared with control; **** P<0.05 compared with diabetic

26 549 OZSOY, CAN, MUTLU AKEV, YANARDAG significant reduction of plasma thiobarbituric acid reactive substances (TBARS) 6. Zn supplementation of diabetic patients ameliorated initially increased parameters of lipid peroxidation in both forms of diabetes mellitus 7,35. In some studies, reduced activities of SOD and CAT in tissues of diabetic animals have been related to the increased production of ROS 36. A decrease in SOD activity by increased intake of Zn has also been reported 37. On the contrary, in agreement with the findings of the present study, the activity of CAT was increased in diabetic animals tissues 38. Similarily, increase in GR and GPx activities in the heart tissue of diabetic rabbits has been reported to be an efficacious defense against oxidative stress 39. GPx has also been shown to be an important adaptive response to conditions of increased peroxidative stress 40. GSTs belong to a group of multigene and multifunctional detoxification enzymes and an important condition affecting GST expression is known to be oxidative stress 41. Zn is an inhibitor of the enzymes NADPH oxidases which catalyzes the production of O - from oxygen by using NADPH as the electron donor. The dismutation of O - to H O is catalyzed by another enzyme, SOD which contains copper and Zn 4. It was reported that Zn deficiency induce lipid peroxidation, increase free radical generation and decrease hepatic CuZn-SOD activity in exercised mice 43. An additional antioxidative mechanism by which Zn may be functioning was proposed by Prasad et al. 4 in a study in which they have shown that Zn negatively regulates gene expression of inflammatory cytokines such as TNFa and IL-1b. MPO is a heme peroxidase released by polimorphnuclear neutrophils which catalyzes the formation of numerous ROS and thus has strong proinflammatory and pro-oxidative properties 44. This enzyme changes hydrogen peroxide to cytotoxic compound, hypochloric acid 45. In the present study, the fact that in diabetic kidney CAT, GR, GPx, GST, SOD and MPO activities were increased, leads to the consideration that the expression of antioxidant defense enzymes augmented due to increased free radical production. Administration of Zn have reversed the effect showing that antioxidant defense is no more needed and thus confirming the beneficial effect of zinc sulfate on the oxidation provoked by diabetes induction. In a previous study undertaken on the stomach tissue of STZ-diabetic rat models, it was demonstrated that Zn supplementation shows a protective effect on impaired oxidative stress parameters such as LPO, GSH, NEG levels 46. The increase in antioxidant enzymes in the kidney tissue of STZ-diabetic rats and the beneficial effect of Zn determined in the present study, are in agreement with these findings. In a recent study, pretreatment with zinc was found effective in preventing indomethacin-induced renal damage in rats, by ameliorating oxidative stress 47. It has been reported that STZ-induced diabetes mellitus resulted in a reduction in concentration of CA-III, which is a key enzyme in acid-base regulation of the kidney, in some tissues of rats 48. As CA is known to be present in rat kidney mitochondria 49 and be involved in rat renal glucose synthesis as well 50, we have investigated the effect of Zn supplementation on this enzyme in STZ-diabetic rat models. The significant change in CA levels after Zn administration in the control + Zn group, is probably due to the activator effect of Zn on CA. Oxidative stress modifies body proteins, carbohydrates and lipids with generation of reactive carbonyl compounds. It has been hypothesized that carbonyl stress may be a causative factor for lipid peroxidation and chronic complications of type diabetes mellitus, like nephropathy, neuropathy and coronary artery disease 51. It was reported that PCC were significantly increased in diabetic kidney tissue homogenates 5. In accordance, in the present study an increase (though statistically insignificant) in PCC levels was observed in the diabetic group and Zn treatment seems to be effective in lowering these levels similarily to antioxidant enzymes activities. Considering the beneficial effects of Zn supplementation on glycemic control in type 1 and type diabetic animals and humans, its insulinomimetic effects, the zinc-mediated protection of β cells from damage by immune cells and cytokines and its antioxdant effect demonstrated in the present study, Zn might be regarded as a possible new candidate molecule for diabetes prevention and therapy, especially for type diabetic patients. However, the Zn dose administered has to be determined individually and the Zn status should be controlled in order to prevent adverse effects based on inappropriately high Zn dosage 11. REFERENCES 1. Faure P: Protective effects of antioxidant micronutrients (vitamin E, zinc and selenium) in type diabetes mellitus. Clin Chem Lab Med, 41, , Beltramini M, Zambenedetti P, Raso M, Idrissi IbnlKayat M, Zatta P: The effect of Zn(II) and streptozotocin administration in the mouse brain. Brain Res, 1109, 07-18, Pai LH, Prasad AS: Cellular zinc in patients with diabetes mellitus. Nutr Res, 8, , Walter RM, Uriu-Hare JY, Olin KL, Oster MH, Anawalt BD, Critchfield JW, Keen CL: Copper, zinc, manganese, and magnesium status and complications of diabetes mellitus. Diabetes Care, 14, , Zargar AH, Bashir MI, Masoodi SR, Laway BA, Wani AI, Khan AR, Dar FA: Copper, zinc and magnesium levels in type-1 diabetes mellitus. Saudi Med J, 3, , Isbir T, Tamer L, Taylor A, Isbir M: Zinc, copper and magnesium status in insulin-dependent diabetes. Diabetes Res, 6, 41-45, Roussel AM, Kerkeni A, Zouari N, Mahjoub S, Matheau JM, Anderson RA: Antioxidant effects of zinc supplementation in Tunisians with type diabetes mellitus. J Am Coll Nutr,, , Adachi Y, Yoshida J, Kodera Y, Kiss T, Jakusch T, Enyedy EA, Yoshikawa Y, Sakurai H: Oral administration of a zinc complex improves

27 550 Oral Zinc Supplementation... type diabetes and metabolic syndromes. Biochem Biophys Res Commun, 351, , Yoshikawa Y, Adachi Y, Sakurai H: A new type of orally active antidiabetic Zn(II)-dithiocarbamate complex. Life Sci, 80, , Bolkent S, Yanardag R, Bolkent S, Mutlu O: The influence of zinc supplementation on the pancreas of streptozotocin-diabetic rats. Dig Dis Sci, 54, , Jansen J, Karges W, Rink L: Zinc and diabetes-clinical links and molecular mechanisms. J Nutr Biochem, 0, , Shisheva A, Gefel D, Shechter Y: Insulinlike effects of zinc ion in vitro and in vivo. Preferential effects on desensitized adipocytes and induction of normoglycemia in streptozotocin-induced rats. Diabetes, 41, , Sakurai H, Adachi Y: The pharmacology of the insulinomimetic effect of zinc complexes. BioMetals, 18, , Meister A: Glutathione metabolism and its selective modification. J Biol Chem, 63, , Harding JJ, Blakytny R, Ganea E: Glutathione in disease. Biochem Soc Trans, 4, , Brown KE, Brunt EM, Heinecke JW: Immunohistochemical detection of myeloperoxidase and its oxidation products in Kupffer cells of human liver. Am J Pathol (AJP), 159, , Halliwell B, Whiteman M: Measuring reactive species and oxidative damage in vivo and in cell culture: How should you do it and what do the results mean? Brit J Pharmacol, 14, 31-55, Gambhir KK, Ornasir J, Headings V, Bonar A: Decreased total carbonic anhydrase esterase activity and decreased levels of carbonic anhydrase 1 isozyme in erythrocytes of type II diabetic patients. Biochem Genet, 45, , Bülbül A, Bülbül T, Küçükersan S, Şireli M, Eryavuz A: Effects of dietary supplementation of organic and inorganic Zn, Cu and Mn on oxidant/antioxidant balance in laying hens. Kafkas Univ Vet Fak Derg, 14 (1): 19-4, Yılmaz M, Karapehlivan M, Kaya İ: Effects of zinc sulphate on transcaucasian barb (Capoeta capoeta [Guldenstaedt, 1773]) plasma nitric oxide, malondialdehyde and total sialic acid levels. Kafkas Univ Vet Fak Derg, 18 (1): 61-64, Rahimi R, Nikfar S, Larijani B, Abdollahi M: A review on the role of antioxidants in the management of diabetes and its complications. Biomed Pharmacother, 59, , Aebi H: Catalase in vitro. Methods Enzymol, 105, 11-16, Carlberg I, Mannervik B: Glutathione reductase. Methods Enzymol, 113, , Lawrence RA, Burk RF: Glutathione peroxidase activity in seleniumdeficient rat liver. Biochem Biophys Res Commun, 71, , Habig WH, Jakoby WB: Assays for differentation of glutathione-stransferases. Methods Enzymol, 77, , Mylroie AA, Collins H, Umbles C, Kyle J: Erythrocyte superoxide dismutase activity and other parameters of copper status in rats ingesting lead acetate. Toxicol Appl Pharmacol, 8, 51-50, Hillegass LM, Griswold DE, Brickson B, Albrightson-Winslow C: Assessment of myeloperoxidase activity in whole rat kidney. J Pharmacol Methods, 4, 85-95, Verpoorte JA, Mehta S, Edsall JT: Esterase activities of human carbonic anhydrases B and C. J Biol Chem, 4, 41-49, Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz A-G, Ahn B-W, Shaltiel S, Stadtman ER: Determination of carbonyl content in oxidatively modified proteins. Methods Enzymol, 186, , Reznick AZ, Packer L: Oxidative damage to proteins: Spectrophotometric method for carbonyl assay. Methods Enzymol, 33, , Lowry OH, Rosebrough NJ, Farr AL, Randall RJ: Protein measurement with the Folin phenol reagent. J Biol Chem, 193, 65-75, Chen MD, Liou SJ, Lin PY, Yang VC, Alexander PS, Lin WH. Effects of zinc supplementation on the plasma glucose level and insulin activity in genetically obese (ob/ob) mice. Biol Trace Elem Res, 61, , Kojima Y, Yoshikawa Y, Ueda E, Ueda R, Yamamoto S, Kumekawa K, Yanagihara N, Sakurai H: Insulinomimetic zinc (II) complexes with natural products: In vitro evaluation and blood glucose lowering effect in KK-A y mice with type diabetes mellitus. Chem Pharm Bull, 51, , Oteiza PI, Mackenzie GG: Zinc, oxidant-triggered cell signaling, and human health. Mol Aspects Med, 6, 45-55, Anderson RA, Roussel AM, Zouari N, Mahjoub S, Matheau JM, Kerkeni A: Potential antioxidant effects of zinc and chromium supplementation in people with type diabetes mellitus. J Am Coll Nutr, 0, 1-18, Ravi K, Ramachandran B, Subramanian S: Protective effect of Eugenia jambolana seed kernel on tissue antioxidants in streptozotocininduced diabetic rats. Biol Pharm Bull, 7, , Samman S: Dietary versus cellular zinc: The antioxidant paradox. Free Radical Biol Med, 14, 95-97, Yanardag R, Tunali S: Vanadyl sulfate administration protects the streptozotocin-induced oxidative damage to brain tissue in rats. Mol Cell Biochem, 86, , Gumieniczek A, Hopkała H, Wójtowicz Z, Nikołajuk J: Changes in antioxidant status of heart muscle tissue in experimental diabetes in rabbits. Acta Biochim Pol, 49, , Matkovics B, Varga SI, Szabó L, Witas H: The effect of diabetes on the activities of the peroxide metabolism enzymes. Horm Metab Res, 14, 77-79, Wang G, Zhang L, Li Q: Genetic polymorphisms of GSTT1, GSTM1, and NQO1 genes and diabetes mellitus risk in Chinese population. Biochem Biophys Res Commun, 341, , Prasad AS, Bao B, Beck FWJ, Kucuk O, Sarkar FH: Antioxidant effect of zinc in humans. Free Radic Biol Med, 37, , Cao G, Chen J: Effects of dietary zinc on free radical generation, lipid peroxidation, and superoxide dismutase in trained mice. Arch Biochem Biophys, 91, , Roman RM, Wendland AE, Polanczyk CA: Myeloperoxidase and coronary arterial disease: From research to clinical practice. Arq Bras Cardiol, 91, e11-e18, Maruyama Y, Lindholm B, Stenvinkel P: Inflammation and oxidative stress in ESRD: The role of myeloperoxidase. J Nephrol, 17 Suppl 8, S7-S76, Bolkent S, Bolkent S, Yanardag R, Mutlu O, Yildirim S: Alterations in somatostatin cells and biochemical parameters following zinc supplementation in gastrointestinal tissue of streptozotocin-induced diabetic rats. Acta Histochem Cytochem, 39, 9-15, Varghese J, Faith M, Jacob M: Zinc prevents indomethacin-induced renal damage in rats by ameliorating oxidative stress and mitochondrial disfunction. Eur J Pharmacol, 614, , Nishita T, Igarashi SI, Asari M: Determination of carbonic anhydrase- III by enzyme-immunoassay in liver, muscle and serum of male rats with streptozotocin-induced diabetes mellitus. Int J Biochem Cell Biol, 7, , Dodgson SJ, Contino LC: Rat kidney mitochondrial carbonic anhydrase. Arch Biochem Biophys, 60, , Dodgson SJ, Cherian K: Mitochondrial carbonic anhydrase is involved in rat renal glucose synthesis. Am J Physiol, 57, E791 E796, Sarkar P, Kar K, Mondal MC, Chakraborty I, Kar M: Elevated level of carbonyl compounds correlates with insulin resistance in type diabetes. Ann Acad Med Singapore, 39, , Cumaoglu A, Ozansoy G, Irat AM, Aricioglu A, Karasu C, Ari N: Effect of long term, non cholesterol lowering dose of fluvastatin treatment on oxidative stress in brain and peripheral tissues of streptozotocin-diabetic rats. Eur J Pharmacol, 654, 80-85, 011.

28 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Karagöz İstavrit (Trachurus trachurus) Balığının Hematolojik Parametrelerine Su Sıcaklığı, Tuzluluk, Mevsim, Üreme, Cinsiyet, Balık Büyüklüğü ve Yaşın Etkisi [1] [1] * ** *** Ekrem Şanver ÇELİK * Hasan KAYA * Sevdan YILMAZ ** Hasan ÇAKICI *** Bu çalışma Çanakkale Onsekiz Mart Üniversitesi BAP (Bilimsel Araştırma Projeleri) Komisyonu tarafından desteklenmiştir (Proje No: 005/09) Çanakkale Onsekiz Mart Universitesi, Su Ürünleri Fakültesi, Temel Bilimler Bölümü, TR Çanakkale - TÜRKİYE Çanakkale Onsekiz Mart Universitesi, Su Ürünleri Fakültesi, Yetiştiricilik Bölümü, TR Çanakkale - TÜRKİYE Çanakkale Onsekiz Mart Universitesi, Çanakkale Sağlık Hizmetleri Meslek Yüksekokulu, TR Çanakkale - TÜRKİYE Özet Bu çalışma, Nisan 005-Mart 007 tarihleri arasında Karagöz istavrit, Trachurus trachurus, balığının bazı hematolojik parametrelerinin belirlenmesi amacıyla Çanakkale Boğazı nda gerçekleştirilmiştir. Aynı zamanda hematolojik parametrelerin mevsim, üreme, cinsiyet, balık büyüklüğü, yaş, suyun sıcaklık ve tuzluluğuna göre değişimleri takip edilmiştir. Hematolojik parametreler için elde edilen yıllık ortalama değerleri; hematokrit oranı (Hct), dişilerde %38.0±0.3, erkeklerde %37.3±0.36; hemoglobin seviyesi (Hb), dişilerde 1.8±0.13 g/100 ml, erkeklerde 13.0±0.16 g/100 ml; eritrosit (RBC) sayısı, dişilerde ± mm 3, erkeklerde ± mm 3 ; lökosit (WBC) sayısı, dişilerde ±59.11 mm 3, erkeklerde ± mm 3 ; ortalama eritrosit hacmi (MCV), dişilerde 363.±3.1 µm 3, erkeklerde 358.8±3.57 µm 3 ; eritrosit başına düşen ortalama hemoglobin (MCH), dişilerde 13.0±1.16 pg, erkeklerde 14.3±1.48 pg; eritrosit başına düşen ortalama hemoglobin konsantrasyonu (MCHC), dişilerde 33.7±0.17 g/100 ml, erkeklerde 34.8±0. g/100 ml şeklindedir. Hematolojik parametrelerin mevsim ve üremeye göre önemli derecede (P<0.05) farklılıklar gösterdiği belirlenmiştir. Erkek ve dişi Karagöz istavrit balıklarında balık büyüklüğü ve yaşın artışıyla birlikte Hct, Hb, RBC, WBC, MCV ve MCH değerlerinin de arttığı (P<0.05) görülmüştür. Deniz suyu sıcaklığının artışıyla birlikte erkek ve dişi balıkların WBC (P<0.05) sayısında artış meydana gelmiştir. Bu çalışmada, hematolojik parametrelerin referans değerleri elde edilmiş ve bu parametrelerin fizyolojik (balık büyüklüğü, yaş, üreme) ve çevresel (mevsim, sıcaklık) faktörlerden etkilendiği sonucuna varılmıştır. Karagöz istavrit balığı ile ilgili yapılacak olan hematolojik çalışmalarda, söz konusu faktörlerin ve referans değerlerinin göz önünde bulundurulması gerekmektedir. Anahtar sözcükler: Trachurus trachurus, Hematolojik parametreler, Mevsim, Üreme, Yaş, Çanakkale Boğazı Effect of Water Temperature, Salinity, Season, Reproduction, Sex, Size, and Age on Hematological Parameters of Horse Mackerel (Trachurus trachurus) Summary Makale Kodu (Article Code): KVFD In order to determine some hematological parameters of horse mackerel, Trachurus trachurus, sampling was conducted between April 005 and March 007 at the Dardanelles. Moreover, the effects of season, reproduction, sex, size, age, water temperature, and salinity on the horse mackerel hematologic parameters were investigated. The following annual averages were obtained for the hematological parameters: hematocrit ratio (Hct), females 38.0±0.3%, males 37.3±0.36%; hemoglobin level (Hb), females 1.8±0.13 g/100 ml, males 13.0±0.16 g/100 ml; erythrocyte (RBC) count, females ± mm 3, males ± mm 3 ; leukocyte (WBC) count, females ±59.11 mm 3, males ± mm 3 ; mean corpuscular volume (MCV), females 363.±3.1 µm 3, males 358.8±3.57 µm 3 ; mean corpuscular hemoglobin (MCH), females 13.0±1.16 pg, males 14.3±1.48 pg; mean corpuscular hemoglobin concentration (MCHC), females 33.7±0.17 g/100 ml, males 34.8±0. g/100 ml. Hematological parameters differed significantly (P<0.05) between reproduction periods and between seasons. For both, male and female horse mackerel, the Hct, Hb, RBC, WBC, MCV, and MCH values increased significantly (P<0.05) with size and age. The WBC increased significantly (P<0.05) with increasing sea water temperature in both sexes. In this study, the reference values of hematological parameters were obtained and it was concluded that these parameters were affected by physiological (fish size, age, reproduction) and environmental (season, temperature) factors. Such factors as well as the reference values should be taken into consideration when hematologic studies for horse mackerel is to be conducted. Keywords: Trachurus trachurus, Hematologic parameters, Season, Reproduction, Age, Dardanelles İletişim (Correspondence) /1559 sanver_celik@comu.edu.tr

29 55 Karagöz İstavrit (Trachurus... GİRİŞ Doğal ortamda yaşayan balıkların hematolojik parametrelerinin normal değerlerinin tespit edilmesi, populasyonlar arası tanıda ve sudaki kirleticiler ile ilgili bilgilerin belirlenmesinde yardımcı olur 1. Balıklarda hematolojik parametreler, çevresel ve fizyolojik faktörlere karşı balığın vereceği tepkiyle yakından ilişkilidir. Bu faktörlere bağlı olarak balık kan kompozisyonunda özellikle hormonlar, eritrositler, lökositler, hematokrit ve hemoglobin konsantrasyonunda değişiklikler meydana gelir. Bundan dolayı, hematolojik analizler, kültür ve doğal ortamda yaşayan balıkların sağlık durumlarının takibinde kullanılabilmektedir 3,4. Yapılan araştırmalarda; mevsim 1,5,6, balık türü, yaş, üreme 1,7, balık büyüklüğü 1,8, sıcaklık, oksijen 1,6,9 ve tuzluluğun 10 balık kan parametrelerini etkilediği görülmüştür. Buna ek olarak hastalık 4, stres 11, fotoperiyod 1, beslenme durumu 13, balık kan parametrelerinin belirlenmesinde kullanılan metadoloji 14, toksikantlara maruz kalma 15 ve ph 16 gibi çeşitli faktörler de kan parametrelerini değiştirebilmektedir. Doğal ortamda yaşayan farklı balık türleri için hematolojik ve serum biyokimya parametrelerinin referans değerleri az sayıda olup, bu nedenle geniş ölçüde kullanılmamaktadır 17. Dolayısıyla, sucul organizmaların sağlık durumlarının takibinde hematolojik verilerin belirlenmesi büyük önem taşımaktadır 18. Bu çalışmada, Çanakkale Boğazı nda doğal olarak yaşayan ve ekonomik öneme sahip 19 karagöz istavrit türünün, (1) hematolojik parametreler için referans değerlerinin oluşturulması () bu parametrelerin mevsim, üreme, balık büyüklüğü, cinsiyet ve yaşa göre değişiminin takip edilmesi ve (3) hematolojik parametreler ile su sıcaklığı ve tuzluluk arasındaki ilişkinin belirlenmesi amaçlanmıştır. MATERYAL ve METOT Bu çalışmada, Nisan Mart 007 tarihleri arasında, Çanakkale Boğazı ndan (Kilitbahir; K D, Eceabat; K D, Çanakkale Limanı; K D ve Sarıçay civarı; K D) yıl boyunca aylık olarak avlanan karagöz istavrit balığı (Trachurus trachurus) incelenmiştir. Balıkların örneklemesinde, küçük balıkçı teknesi kullanılmış ve balıklar olta ile yakalanmıştır. Gonadosomatik indeks (GSİ) takibinde 680 balık kullanılmıştır. Bu balıklar içerisinden hematolojik parametrelerin eşeylere, yaşa, üremeye, suyun sıcaklık ve tuzluluğuna göre değişiminin belirlenmesinde 61, mevsime göre değişiminin belirlenmesinde ise 579 balık incelenmiştir. Canlı olarak balıkların boy ve ağırlıkları alındıktan sonra anal yüzgecinin hemen arkasından kaudal venaya plastik enjektörle girilerek kan numuneleri alınmış ve kan EDTA içerikli hematoloji tüplerine konmuştur 0. Kandaki eritrositler (RBC, mm 3 ) ve lökositler (WBC, mm 3 ) Thoma lamında Dacie s ve Turck solüsyonu kullanılarak sayılmıştır. Hematokrit (Hct, %) analizi kabiler hematokrit tüpleri yardımıyla hematokrit santrifüjde tespit edilmiştir. Hemoglobin (Hb, g/100 ml) analizinde ise siyanomethemoglobin metodu kullanılmıştır 1. Ortalama Eritrosit Hacmi (MCV), Eritrosit Başına Düşen Ortalama Hemoglobin (MCH) ve Eritrosit Başına Düşen Ortalama Hemoglobin Konsantrasyonu (MCHC) ise aşağıdaki formüller yardımıyla tespit edilmiştir : MCV (μm 3 ) = Hct (%) x 10/RBC (10 6 /μl) MCH (pg) = [Hb (g/100ml) x 10]/RBC (10 6 /µl) MCHC (g/100 ml) = [Hb (g/100ml) x 100] / Hct (%) Suyun sıcaklık ve tuzluluğu YSI multiple probe cihazıyla ölçülmüştür. Balıkların cinsiyet tayini makroskobik ve stero binoküler mikroskopta yapılmıştır 3. Üreme mevsiminin takibinde, dişi ve erkek karagöz istavrit balıklarının aylık olarak hesaplanan gonadosomatik indeks (GSİ) değerlerinden faydalanılmıştır. Hesaplamada; GSİ= Gonad ağırlığını (g)/balık ağırlığını (g)x100 formülü kullanılmıştır 4. Yaş tayini için otolitler kullanılmıştır. Otolitlerin yıllık büyüme halkaları binoküler mikroskop altında tespit edilmiştir 5. Kan parametrelerinin üreme ve mevsime göre değişimlerinin değerlendirilmesi tek yönlü varyans analizi (ANOVA) ile yapılmıştır. Gruplar arası farkın tespiti için ise Duncan testi kullanılmıştır. Balık büyüklüğü ve suyun fizikokimyasal parametreleri ile kan parametreleri arasındaki ilişkileri incelemek için Pearson un korelasyon katsayısı uygulanmıştır. Balıkların cinsiyetleri arasındaki kan parametre farklılıklarının değerlendirilmesinde ise t testi yapılmıştır 6. Hesaplamalarda SPSS 17.0 paket programı kullanılmıştır 7. BULGULAR İki yıl boyunca takip edilen dişi ve erkek karagöz istavrit balıklarının GSİ değeri, 005 yılı Nisan ve 006 yılı Şubat ayından Mayıs ayına kadar artış göstermiştir (üreme öncesi dönem). 005 ve 006 yılı Mayıs ayında en yüksek seviyeye ulaşan erkek ve dişi karagöz istavrit balıklarının GSİ değeri Haziran ayından itibaren düşmeye başlamış ve bu azalma Kasım ayına kadar devam etmiştir (üreme dönemi). Daha sonra erkek ve dişi karagöz istavrit balıklarının GSİ değeri 005 ve 006 Kasım ayından Ocak ayına kadar yaklaşık olarak aynı seviyede kalmış (üreme sonrası dönem) ve 007 yılı Şubat ayından itibaren tekrar artmaya başlamıştır (üreme öncesi dönem) (Şekil 1). Karagöz istavrit balığının eşeylere göre dağlımı Tablo 1 de verilmiştir. Buna göre erkek ve dişi bireylerinin hematolojik parametreleri arasındaki fark istatistiksel olarak önemsiz çıkmıştır (P>0.05). Hematolojik parametrelerin yıllık ortalama değerleri izlendiğinde hematokrit oranı (Hct), dişilerde %38.0±0.3, erkeklerde %37.3±0.36; hemoglobin

30 553 ÇELİK, KAYA YILMAZ, ÇAKICI seviyesi (Hb), dişilerde 1.8±0.13 g/100 ml, erkeklerde 13.0±0.16 g/100 ml; eritrosit sayısı (RBC), dişilerde ± mm 3, erkeklerde ± mm 3 ; lökosit sayısı (WBC), dişilerde ±59.11 mm 3, erkeklerde ± mm 3 ; ortalama eritrosit hacmi (MCV), dişilerde 363.±3.1 µm 3, erkeklerde 358.8±3.57 µm 3 ; eritrosit başına düşen ortalama hemoglobin (MCH), dişilerde 13.0±1.16 pg, erkeklerde 14.3±1.48 pg; eritrosit başına düşen ortalama hemoglobin konsantrasyonu (MCHC), dişilerde 33.7±0.17 g/100 ml, erkeklerde 34.8±0. g/100 ml olarak bulunmuştur (Tablo 1). Karagöz İstavrit balığının aylara göre boy ve ağırlığı ile suyun sıcaklık ve tuzluluk değerleri Tablo de gösterilmiştir. Bu türün hematolojik parametreleri ile balık büyüklüğü, suyun sıcaklık ve tuzluluğu arasındaki ilişki ise Tablo 3 te verilmiştir. MCHC hariç diğer hematolojik parametrelerin balık büyüklüğüyle birlikte önemli derecede (P<0.01) arttığı görülmüştür. Dişi ve erkek karagöz istavrit balıklarının WBC (dişilerde P<0.01; erkeklerde P<0.05) sayısının su sıcaklığının artışıyla birlikte arttığı belirlenmiştir. Hct, Hb, RBC, MCV, MCH ve MCHC değerleri suyun sıcaklık ve tuzluğu arasında önemli bir ilişki (P>0.05) tespit edilememiştir (Tablo 3). Karagöz istavrit balığında hematolojik parametrelerin yaş gruplarına göre dağılımı Tablo 4 te verilmiştir. Buna göre, MCHC hariç, diğer hematolojik parametrelerin yaşla birlikte arttığı görülmüştür (P<0.05). Karagöz istavrit balığının hematolojik parametrelerinin üremeye göre değişimi takip edildiğinde (Tablo 5); 005 üreme döneminde elde edilen Hct (erkek balıklarda), Hb, MCH, MCV (erkek balıklarda) ve MCHC (dişi balıklarda) değerleri, üreme öncesi dönemde (005, 007) belirlenen değerlere göre önemli derecede (P<0.05) yükselme göstermiştir. Dişi balıklarda 005 üreme döneminin RBC sayısı 006 üreme öncesi döneminin RBC sayısından önemli derecede (P<0.05) yüksek çıkmıştır. Benzer şekilde, dişi balıklarda 005 üreme döneminin WBC sayısında görülen yükselme, 006 üreme öncesi döneme göre önemli (P<0.05) bulunmuştur. Karagöz istavrit balığının hematolojik parametrelerinin mevsime göre değişimi Tablo 6 da verilmiştir. Buna göre; dişi ve erkek balıklarda İlkbahar mevsiminde (005, 007) en yüksek seviyede görülen Hct ve Hb seviyesi ile Kış mevsiminde belirlenen Hct ve Hb seviyesi arasındaki fark önemli (P<0.05) çıkmıştır. Erkek balıklarda İlkbahar (005, 007) ve 005 Yaz mevsimlerinde yüksek seviyelerde belirlenen RBC sayısı, Kış mevsiminde en düşük seviyede tespit edilen RBC sayından önemli derecede Şekil 1. Karagöz istavrit balığının GSİ değerlerinin aylara göre değişimi Fig 1. Monthly variation of GSI values in horse mackerel Tablo 1. Karagöz istavrit balığının eşeylere göre hematolojik parametreleri Table 1. Hematological parameters of horse mackerel by sex Dişi (N=319) Erkek (N=30) Dişi + Erkek (N=61) Parametreler X±SH Min-Mak X±SH Min-Mak X±SH Min-Mak Boy (cm) 15.± ± ± Ağırlık (g) 30.8± ± ± Hct (%) 38.0± ± ± Hb (g/100 ml) 1.8± ± ± RBC (mm 3 ) ± ± ± WBC (mm 3 ) ± ± ± MCV (µm 3 ) 363.± ± ± MCH (pg) 13.0± ± ± MCHC (g/100 ml) 33.7± ± ± Ortalama±SH, N: Örnek sayısı

31 554 Karagöz İstavrit (Trachurus... Tablo. Karagöz istavrit balığının aylara göre balık büyüklüğü ile suyun sıcaklık ve tuzluluk değerleri Table. Monthly fish size, water temparatue, and salinity values in horse mackerel Dişi Erkek Sıcaklık ve Tuzluluk Yıl Ay N Lt (cm) Wt (g) N Lt (cm) Wt (g) S ( o C) T ( ) Nisan ± ± ± ± Mayıs ± ± ± ± Haziran ± ± ± ± Temmuz ± ± ± ± Ağustos ± ± ± ± Eylül ± ± ± ± Ekim ± ± ± ± Kasım ± ± ± ± Aralık ± ± ± ± Ocak ± ± ± ± Şubat ± ± ± ± Mart ± ± ± ± Nisan ± ± ± ± Mayıs ± ± ±0.8.± Haziran 1 15.± ± ± ± Temmuz ± ± ± ± Ağustos ± ± ± ± Eylül ± ± ± ± Ekim ± ± ± ± Kasım ± ± ± ± Aralık ± ± ± ± Ocak ± ± ± ± Şubat ± ± ± ± Mart ± ± ± ± Ortalama±SH, N: Örnek sayısı, Lt: Balık boyu, Wt: Balık ağırlığı, S: Sıcaklık, T: Tuzluluk Tablo 3. Karagöz istavrit balığının hematolojik parametreleri ile balık büyüklüğü, suyun sıcaklık ve tuzluluğu arasındaki ilişki Table 3. Relationship of hematological parameters with fish size, water temparature and salinity in horse mackerel Parametreler Eşey N Hct (%) Hb (g/100 ml) RBC (mm 3 ) WBC (mm 3 ) MCV (µm 3 ) MCH (pg) MCHC (g/100 ml) Sıcaklık (ºC) D ** E * Tuzluluk ( ) D E Boy (cm) D ** 0.36** 0.30** 0.17* 0.7** 0.** 0.01 E ** 0.45** 0.5** 0.7** 0.33** 0.37** 0.09 Ağırlık (g) D ** 0.35** 0.9** 0.19* 0.8** 0.* 0.01 E ** 0.46** 0.6** 0.5* 0.36** 0.38** 0.08 * Önemli (P<0.05), ** Çok önemli (P<0.01), ( -) Negatif Korelasyon, Ortalama±SH, E: Erkek, D: Dişi, N: Örnek sayısı (P<0.05) farklı bulunmuştur. Erkek balıklarda WBC de en yüksek değer 005 Sonbahar mevsiminde, en düşük değer ise Kış mevsiminde elde edilmiştir (P<0.05). Dişi balıklarda WBC ve MCV de en yüksek değere 005 Sonbahar mevsiminde, en düşük değere ise Kış mevsiminde ulaşılmıştır (P<0.05). Dişi balıklarda MCH değeri en yüksek 005 Yaz mevsiminde, en düşük ise Kış mevsiminde belirlenmiştir (P<0.05). Erkek balıklarda en yüksek İlkbahar mevsiminde (005, 007) tespit edilen MCV ile en düşük Kış mevsiminde

32 555 ÇELİK, KAYA YILMAZ, ÇAKICI Tablo 4. Karagöz istavrit balığının yaş gruplarına göre ortalama boy değerleri ve hematolojik parametrelerinin dağılımı Table 4. Average fish lenght and range of hematological parameters by age in horse mackerel Yaş Eşey N Ortalama Boy (cm) Hct (%) Hb (g/100 ml) RBC (mm 3 ) WBC (mm 3 ) MCV (µm 3 ) MCH (pg) MCHC (g/100 ml) 0 1 D ± ±0.38 a 1.3±0.15 a ± a ±316.3 a 355.8±.90 a 119.9±1.31 a 33.8±0.9 a E ± ±0.58 a 11.±0.0 a ± a ±64.90 a 346.1±5.35 a 115.9±1.65 a 34.4±0.3 a D ± ±0.66 b 13.±0.5 b ± b ± ab 364.3±3.85 a 1.7±1.79 ab 33.8±0.4 a E ± ±0.46 b 1.8±0.0 b ± b ± ab 350.8±4.5 a 11.6±1.61 b 34.8±0.3 a D ± ±0.73 c 14.0±0.30 c ± b ±598.9 b 378.8±4.9 b 17.7±1.71 b 33.7±0.31 a E ± ±0.69 c 15.3±0.43 c ± c ±59.08 b 381.7±4.15 b 138.±3.0 b 35.1±0.51 a a, b, c : Balıkların yaşları bakımından aynı sutünda ve aynı cinsiyette, farklı harfle gösterilen değerler arasında istatistiksel olarak önemli fark vardır (P<0.05), Ortalama±SH, E: Erkek, D: Dişi, N: Örnek sayısı Tablo 5. Karagöz istavrit balığının üreme dönemlerine göre hematolojik parametrelerinin değişimi Table 5. Variations in hematological parameters according to reproduction period in horse mackerel Yıl/Üreme Dönemleri Eşey N Hct (%) Hb (g/100 ml) RBC (mm 3 ) WBC (mm 3 ) MCV (µm 3 ) MCH (pg) MCHC (g/100 ml) *005, 007 ÜÖD 005 ÜD ÜSD 006 ÜÖD 006 ÜD ÜSD D ±0.68 a 1.4±0.18 a ± ab ± a 365.±5.69 a 11.1±1.77 a 33.±0.7 ab E ±0.86 a 11.9±0.33 a ± a ±57.16 a 37.3±7.80 a 113.4±.99 a 34.7±0.48 ab D ±0.9 a 14.1±0.37 b ± b ± b 37.0±8.67 a 131.9±3.4 b 35.4±0.43 c E ±0.86 b 14.7±0.41 b ± a ± ab 374.3±8.00 b 138.5±3.60 b 36.8±0.46 b D ±1.06 a 1.7±0.36 a ± ab ±644.7 a 368.0±11.49 a 13.1±3.86 ab 33.4±0.1 b E ±0.93 ab 1.3±0.30 a ± a ±668.4 ab 350.5±9.6 ab 116.9±3.07 a 33.3±0.11 a D ±0.51 a 1.8±0.9 a ± a ± a 373.5±8.44 a 14.4±.77 ab 34.0±0.5 b E 9 38.±3.06 ab 1.6±0.81 a ± a ±99.51 ab 364.3±19.80 ab 11.4±6.60 a 33.±0.93 a D ±0.41 a 1.4±0.18 a ± ab 17.7± b 354.0±4.75 a 118.0±1.58 a 33.±0.33 ab E ±0.48 ab 1.9±0.3 a ± a ± b 369.3±5.05 b 13.1±1.68 ab 33.9±0.51 a D ±0.71 a 11.9±0.19 a ± ab ± a 357.4±6.59 a 119.1±.0 a 3.1±0.41 a E ±0.8 ab 1.5±0.35 a ± a ±57.91 ab 369.±8.93 b 13.0±.98 ab 33.6±0.48 a a, b, c: Üreme dönemleri bakımından aynı sutünda ve aynı cinsiyette, farklı harfle gösterilen değerler arasında istatistiksel olarak önemli fark vardır (P<0.05), ÜÖD: Üreme Öncesi Dönem, ÜD: Üreme Dönemi, ÜSD: Üreme Sonrası Dönem, Ortalama±SH, E: Erkek, D: Dişi, N: Örnek sayısı, * 005 ve 007 ÜÖD verileri birlikte kullanılmıştır belirlenen MCV arasındaki fark önemli (P<0.05) bulunmuştur. Aynı zamanda, erkek balıklarda da MCH ve MCHC nin en yüksek seviyesine İlkbahar mevsiminde (005, 007) ulaşılmış ve diğer mevsimlerde elde edilen MCH ve MCHC değerlerinden önemli derecede (P<0.05) farklılık göstermiştir. TARTIŞMA ve SONUÇ İncelenen erkek ve dişi karagöz istavrit balıklarının hematolojik parametreleri arasında fark istatistiksel açıdan önemsiz olup (P>0.05) balıkların hematolojik parametre değerleri ile eşeylere göre dağılımı Tablo 1 de verilmiştir. Yapılan araştırmalarda; Scorpaena porcus türünde belirlenen Hct (%5.7), Hb (7.4 g/100 ml) ve RBC ( mm 3 ) bu araştırmada erkek ve dişi balıklarda belirlenen değerden daha düşük bulunurken, WBC (33903 mm 3 ), MCV ( µm 3 ), MCH ( pg) ve MCHC (8.94 g/100 ml) ise daha yüksek çıkmıştır 8. Leuciscus cephalus türünde ise RBC ( mm 3 ) ve WBC ( mm 3 ) bu araştırmada erkek ve dişi balıklarda belirlenen değerden yüksek, Hb (10 g/100 ml), MCV (7 µm 3 ), MCH (70 pg) ve MCHC (%6) ise daha düşük olarak tespit edilmiştir 9. Scophthalmus aquosus balığında Hct (% ), Hb ( g/100 ml) ve MCHC ( g/100 ml) bu çalışmada her iki cinsiyette tespit edilenden daha düşük olarak bildirilmiştir 30. Hematolojik parametrelerin balıklar arasında farklılık göstermesi su kalitesi, mevsim ve balıkların beslenmesi, üremesi, türü, büyüklüğü, yaşı ve cinsiyeti gibi biyotik ve abiyotik faktörlere bağlanabilir 1,6,7,31. Karagöz istavrit balığında hematolojik parametrelerin, MCHC hariç, balık büyüklüğü ve yaşla birlikte arttığı (P<0.05) tespit edilmiştir (Tablo 3 ve Tablo 4). Bu bulgulara benzer olarak yapılan farklı çalışmalarda Acanthobrama marmid 1 ve Chondrostoma regium 8 türlerinde Hct, Hb, RBC ve WBC nin, Chalcalburnus mossulensis 3 türünde ise RBC ve WBC nin ağırlık, boy ve yaşla birlikte arttığı görülmüştür. Spicara maena 33 türünün hematolojik parametrelerinin

33 556 Karagöz İstavrit (Trachurus... Tablo 6. Karagöz istavrit balığının mevsimlere göre hematolojik parametrelerinin değişimi Table 6. Variations in hematological parameters according to season in horse mackerel Yıl/Mevsim Eşey N Hct (%) Hb (g/100 ml) RBC (mm 3 ) WBC (mm 3 ) MCV (µm 3 ) MCH (pg) MCHC (g/100 ml) *005, 007 İlkbahar 005 Yaz 005 Sonbahar Kış 006 İlkbahar 006 Yaz 006 Sonbahar Kış D ±0.87 b 14.0±0.3 d ± a ± ab 365.3±6.73 ab 130.0±.73 cd 35.7±0.58 b E ±0.98 b 15.6±0.53 b ± b ±49.1 a 38.7±6.90 b 146.3±4.50 b 38.0±0.75 c D ±1.51 b 13.7±0.68 cd ± a ± bc 370.1±1.48 ab 131.4±5.51 d 35.3±0.61 b E ±1.34 a 13.7±0.59 ab ± b ± a 349.8±10.75 ab 16.7±4.80 a 36.0±0.54 b D ±1.4 ab 13.1±0.41 bc ± a ± c 377.3±14.41 b 16.3±4.88 bcd 33.5±0.14 a E ±1.06 a 1.6±0.36 a ± ab ± c 366.8±13.33 ab 1.5±4.48 a 33.4±0.14 a D ±0.87 ab 1.7±0.8 abc ± a ± a 359.1±8.6 ab 119.5±.81 ab 33.3±0.3 a E ±1.00 a 1.8±0.37 a ± ab ± a 346.7±11.90 ab 10.1±4.15 a 33.7±0.43 a D ±0.46 ab 1.4±0. ab ± a ± a 364.3±5.93 ab 11.4±1.96 abcd 33.±0.4 a E ±1.00 a 1.4±0.33 a ± ab ± a 361.5±10.93 ab 10.5±3.64 a 33.9±0.53 a D ±0.49 ab 1.6±0.5 abc ± a ± ab 36.9±6.9 ab 11.0±.31 abc 3.9±0.49 a E ±0.61 a 1.4±0.5 a ± ab ± b 354.0±4.37 ab 118.0±1.46 a 33.7±0.43 a D ±0.7 ab 1.1±0.3 ab ± a ± c 356.5±7.50 ab 118.8±.50 ab 33.1±0.46 a E ±0.79 a 1.4±0.45 a ± ab ± bc 368.5±9.38 ab 1.8±3.13 a 34.1±1.08 a D ±0.6 a 11.9±0.1 a ± a ±44.71 a 341.8±5.77 a 113.9±1.9 a 3.7±0.43 a E ±0.78 a 1.4±0.35 a ± a ± a 36.6±1.55 ab 10.9±4.18 a 33.6±0.45 a a, b, c, d: Mevsimsel bakımdan aynı sutünda, aynı cinsiyette, farklı harfle gösterilen değerler arasında istatistiksel olarak önemli fark vardır (P<0.05), Ortalama±SH, E: Erkek, D: Dişi, N: Örnek sayısı, * 005 ve 007 İlkbahar mevsimi verileri birlikte kullanılmıştır (MCHC hariç) ağırlık ve boyla birlikte arttığı tespit edilmiştir. Acanthopagrus latus 34 türünde, Hct, Hb ve RBC nin boy ve ağırlıkla birlikte arttığı bildirilmiştir. Acanthobrama marmid 1 ve Sarotherodon melanotheron 35 balıklarında MCV ve MCH değerlerinin boy ve ağırlık artışına paralel olarak arttığı tespit edilmiştir. Capoeta capoeta umbla 36 balığında ise boy, ağırlık ve yaşa bağlı olarak Hb, Hct ve RBC nin önemli derecede arttığı belirlenmiştir. Dişi ve erkek karagöz istavrit balıklarında deniz suyu sıcaklığının artışıyla birlikte WBC (dişilerde P<0.01; erkeklerde P<0.05) nin de arttığı görülmüştür (Tablo 3). Sıcaklık mevsime bağlı olarak değişen bir parametre olup sonbahar ve kış aylarında düşmekte ve bu aylarda fotoperiyot da kısalmaktadır 1, Balıklarda sıcaklığın düşüşü ile beslenmenin azaldığı bildirilmiştir 13. Sıcaklık, fotoperiyot ve beslenme gibi çevre faktörlerinin de WBC değişiminde önemli etkenler oldukları tespit edilmiştir 4,39. Bu çalışmada görüldüğü gibi özellikle kışın balıklarda WBC azalmıştır. Spicara maena 33 balığı ile yapılan bir çalışmada da WBC nin sıcaklıkla birlikte artması bu araştırmanın bulgularıyla uyumluluk göstermiştir. Karagöz istavrit balıklarının hematolojik parametrelerinin üremeye göre değişimi Tablo 5 te verilmiştir. Buna göre; 005 üreme döneminde Hct (erkek balıklarda), Hb, MCH, MCV (erkek balıklarda) ve MCHC (dişi balıklarda) de görülen yükselme, üreme öncesi döneme (005, 007) göre önemli (P<0.05) çıkmıştır. 005 üreme döneminde dişi balıkların RBC sayısındaki yükselme de 006 üreme öncesi döneminin RBC sayısına göre önemli (P<0.05) bulunmuştur. Benzer şekilde, dişi balıklarda 005 üreme döneminde belirlenen WBC sayısı, 006 üreme öncesi dönemde belirlenen WBC sayısına göre önemli derecede (P<0.05) yüksek elde edilmiştir. Karagöz istavrit balığının üreme döneminde hematolojik parametrelerinde görülen benzer artışlar; Spicara maena 33 türünün Hct, Hb, RBC, WBC, MCH ve MCV, Scorpaena porcus 40 türünün Hct, Hb, RBC ve WBC, Tilapia zilli 41 türünün Hct ve Hb ve RBC sayısında, Chondrostoma nasus 17 türünün Hct (erkek bireylerde), Hb (erkek bireylerde), RBC ve WBC, Oreochromis niloticus 6 türünün Hct, Hb ve RBC sayısında bildirilmiştir. Karagöz istavrit balığının hematolojik parametrelerinde üreme döneminde görülen artış, balıkların üreme faaliyetleri esnasında fazla enerji sarfiyatından dolayı meydana gelen oksijen eksikliğinden ve ayrıca su sıcaklığının da üreme döneminde artmış olmasından kaynaklanabilir 6,40,41. Karagöz istavit balığının hematolojik parmetrelerinin mevsimlere göre dağılımı dikkate alındığında; genel olarak, Bahar ve Yaz mevsimlerinde hematolojik parametrelerde kış mevsimine göre önemli derecede artış (P<0.05) meydana gelmiştir. Bu çalışmadaki bulgulara benzer olarak; Spicara maena türünün Hct ve Hb değerinde Yaz mevsiminde önemli derecede (P<0.05) yükselme ve Kış mevsiminde önemli derecede (P<0.05) azalma tespit edilirken RBC, MCV ve MCH değerlerinde ise Yaz mevsiminde önemli derecede yükselme (P<0.05) bildirilmiştir 33. Alburnoides bipunctatus, Chalcalburnus mossulensis ve Cyprinion macrostomus un hematolojik parametrelerinde (Hct, Hb, RBC, WBC) özellikle Bahar ve Yaz Mevsimlerinde artış görülmüştür 43.

34 557 ÇELİK, KAYA YILMAZ, ÇAKICI Çalışmalarda alınan benzer sonuçların nedeni, yılın bu periyodunun balıklar için üreme dönemi olmasına bağlanabilir. Kan parametreleri seviyelerindeki artış ise bu periyotta balıkların yüksek enerjiye duyduğu ihtiyaçtan kaynaklanabilir 43. Bu araştırma bulgularından farklı olarak Acanthobrama marmid türünde RBC ve Hct en yüksek kış, MCV ve MCH en yüksek İlkbahar mevsiminde bildirilmiştir 1. Mevsimlere göre balıkların hematolojik parametrelerinde meydana gelen bu farklılıklar balık büyüklüğüne, beslenme durumuna, çevresel koşullara, üreme döneminin farklı olmasına, suyun kalitesine ve balığın yaşama şekline (pelajik ve demersal) bağlanabilir 1,6,17,40,4. Sonuç olarak, balıklarda kan değişkenlerinin sağlık göstergesi olarak kullanılabilmesi için her balık türünde bu parametrelerin referans değerlerinin bilinmesi gerekmektedir. Bu amaçla, karagöz istavrit balığının hematolojik parametrelerinin referans değerleri kaydedilmiştir. Aynı zamanda, karagöz istavrit balığının hematolojik parametrelerinin üreme, yaş, balık büyüklüğü, su sıcaklığı ve mevsim gibi çoğu fizyolojik ve çevresel faktörlerden etkilendiği görülmüştür. Çevresel değişiklikler için biyoindikatör olarak kullanılan kan parametrelerinin değerlendirilmesinde 4 söz konusu fizyolojik ve çevresel faktörlerinde göz önünde bulundurulması gereklidir. Karagöz istavrit balığının hematolojik parametrelerinin incelenmesi sonucu elde edilen bulgular bu türle ilgili gelecekte yapılacak olan biyolojik ve ekolojik çalışmalara katkı sağlayacaktır. KAYNAKLAR 1. Başusta GA, Şen D: Keban Baraj Gölü nde yaşayan Acanthobrama marmid Heckel, 1843 de kan parametrelerinin incelenmesi. Turk J Vet Anim Sci, 8 (1): 1-6, Fernandes MN, Mazon AF: Environmental pollution and fish gill morphology. In, Val AL, Kapoor BG (Eds): Fish Adaptations. Enfield: Science Publishers, pp , Alyakrinskyaya IO, Dolgova SN: Hematological features of young sturgeons. Vopr Ikhtiol, 4, , De Pedro N, Guijarro AE, Lopez-Patino MA, Marinez-Alvarez R, Delgado M: Daily and seasonal variation in haematological and blood biochemical parameters in tench Tinca tinca. Aquaculture Res, 36, 85-96, Van Vuren JHJ, Hattingh J: A seasonal study of the haematology of wild freshwater fish. J Fish Biol, 13 (3): , Azizoğlu A, Cengizler İ: Sağlıklı Oreochromis niloticus (L.) bireylerinde bazı hematolojik parametrelerin saptanması üzerine bir araştırma. Turk J Vet Anim Sci, 0 (6): , Hrubec TC, Cardinale JL, Smith SA: Hematology and plasma chemistry reference intervals for cultured tilapia (Oreochromis hybrid). Vet Clin Pathol, 9 (1): 7-1, Başusta GA, Şen D: Keban Baraj Gölü ndeki Chondrostoma regium (Heckel, 1843) da hematolojik parametrelerin değişimi. FÜ Fen ve Müh Bil Derg, 13 (): 47-54, Langston AL, Hoare R, Stefansson M, Fitzgerald R, Wergeland H, Mulcahy M: The effect of temperature on non-specific defence parameters of three strains of juvenile Atlantic halibut (Hippoglossus hippoglossus L.). Fish Shellfish Immunol, 1 (1): 61-76, Brown JA, Moore WM, Quabius ES: Physiological effects of saline waters on zander. J Fish Biol, 59 (6): , Hofer R, Stoll M, Romani N, Koch F, Sordyl H: Seasonal changes in blood cells of Artic char (Salvelinus alpinus L.) from a high mountain lake. Aquat Sci 6 (4): , Leonardi MO, Klempau AE: Artificial photoperiod influence on the immune system of juvenile rainbow trout (Oncorhynchus mykiss) in the Southern Hemisphere. Aquaculture, 1 (1-4): , Lim C, Klesius PH: Influence of feed deprivation on hematology, macrophage chemotaxis, and resistance to Edwardsiella ictaluri challenge of channel catfish. J Aquat Anim Health, 15 (1): 13-0, Huffman PA, Arkoosh MR, Casillas E: Characteristics of peripheral blood cells from rainbow trout evaluated by particle counter, ımage analysis, and hemocytometric techniques. J Aquat Anim Health, 9 (4): 39-48, Handy RD, Depledge MH: Physiological responses: their measurement and use as environmental biomarkers in ecotoxicology. Ecotoxicology, 8 (5): , Wilkie MP, Simmons HE, Wood CM: Physiological adaptations of rainbow trout to chronically elevated water ph (ph=9.5). J Exp Zool, 74 (1): 1-4, Lusková V, Halačka K, Lusk S: Dynamics of the haemogram in the nase, Chondrostoma nasus. Folia Zool, 44 (1): 69-74, Satheeshkumar P, Senthilkumar D, Ananthan G, Soundarapandian P, Khan AB: Measurement of hematological and biochemical studies on wild marine carnivorous fishes from Vellar estuary, southeast coast of India. Comp Clin Pathol, 0, , TÜİK: Su Ürünleri Avcılığı ve Yetiştiriciliğinde Artış. Haber Bülteni. Sayı: 139, Val AL, De Menezes GC, Wood CM: Red blood cell adrenergic responses in Amazonian teleost. J Fish Biol, 5, 83-93, Blaxhall PC, Daisley KW: Routine haematological methods for use with fish blood. J Fish Biol, 5 (6): , Lewis SM, Bain BJ, Bates I: Dacie and Lewis Practical Haematology. 10th ed., Churchill Livingstone Elsevier, Philadelphia, Nikolsky GW: The Ecology of Fishes. Acedemic Press. London and New York, Vladykov VD: Fecundity of wild speckled trout (Salvelinus fontinalis) in quebec lakes. J Fish Res Board Can, 13 (6): , Karlou-Riga C, Sinis A: Age and growth of horse mackerel, Trachurus trachurus (L.), in the Gulf of Saronikos (Greece). Fish Res, 3 (): , Düzgüneş O, Kesici T, Gürbüz P: İstatistik Metotları. Ankara Üniv. Ziraat Fak. Yayınları, Ankara, Anonim: SPSS 17.0 Paket Programı. downloads/spss-17.0.html, Erişim tarihi: Çelik EŞ, Bircan R: Çanakkale Bogazı ndaki siyah iskorpit balığı (Scorpaena porcus Linnaeus, 1758) nın hematolojik parametrelerinin belirlenmesi. FÜ Fen ve Mühendislik Bil Derg, 16 (4): , Haşiloğlu MA, Atamanalp M: Demirdöven Baraj Gölü (Erzurum) Tatlısu Kefali (Leuciscus cephalus) populasyonu hematolojik parametrelerinin belirlenmesi. OMU Zir Fak Derg, 17 (): 34-38, Dawson MA: Blood chemistry of the windowpane flounder Scophthalmus aquasus in long island sound: Geographical, seasonal, and experimental variations. Fis B-NOAA, 88 (3): , Jawad LA, Al-Mukhtar HK, Ahmed HK: The relationship between haematocrit and some biological parameters of the Indian shad, Tenualosa ilisha (Family Clupidae). Anim Biodivers Conserv, 7, , Başusta GA, Şen D: Investigation changes of in blood parameters Chalcalburnus mossulensis (Heckel, 1843) living in Keban Dam Lake. GÜ Gazi Eğitim Fak Derg, 3 (1): 11-1, Aslan A: Çanakkale Boğazı ndaki izmarit balığının, Spicara maena (Linnaeus, 1758), bazı hematolojik ve biyokimyasal kan parametrelerinin belirlenmesi. Yüksek Lisans Tezi, Çanakkale Onsekiz Mart Üniv. Fen Bil. Enst., Çanakkale, Al-Hassan LAJ, Ahmed HK, Majeed SA: Some haematological

35 558 Karagöz İstavrit (Trachurus... parameters in relation to the biology of the fish Acanthopagrus latus. J Environ Sci Health A, 8 (7): , Lea MBR, Brock JA, Fujioka RS, Nakamura RM: Hematologic and blood chemistry values for Sarotherodon melanotheron and a red hybrid tilapia in freshwater and seawater. Comp Bioc Physiol, 97 (4): 55-59, Örün İ, Erdemli AÜ: A study on blood parameters of Capoeta capoeta umbla (Heckel, 1843) captured from Karakaya Dam Lake. FÜ Fen ve Mühendislik Bil Derg, 15 (): , Houston AH, Dobric N, Kahurananga R: The nature of hematological response in fish studies on rainbow trout Oncorhynchus mykiss exposed to simulated winter, spring and summer conditions. Fish Physiol Biochem, 15 (4): , Melingen GO, Pettersen EF, Wergeland HI: Leucocyte populations and responses to immunization and photoperiod manipulation in Atlantic salmon (Salmo salar L.) 0+ smolt. Aquaculture, 14 (1-4): , Aydın S, Çiltaş AK, Yetim H, Akyurt İ: Clinical, pathological and haematological effects of Micrococcus luteus ınfections in rainbow trout (Oncorhynchus mykiss Walbaum). J Anim Vet Adv, 4 (): , Çelik EŞ: Çanakkale Boğazı nda bulunan iskorpit balığının (Scorpaena porcus Linnaeus, 1758) hematolojik ve biyokimyasal özellikleri üzerine üremenin ve mevsimlerin etkisi. Doktora Tezi, Ondokuz Mayıs Üniv. Fen Bil. Enst., Samsun, Ezzat AA, Shabana MB, Farghaly AM: Studies on the Blood Characteristics of Tilapia zilli (Gervais). J Fish Biol, 6, 1-1, Cazenave J, Wunderlin DA, Hued AC, de los Ángeles-Bistoni M: Haematological parameters in a neotropical fish, Corydoras paleatus (Jenyns, 184) (Pisces, Callichthyidae), captured from pristine and polluted water. Hydrobiologia, 537, 5-33, Örün I, Dörücü M, Yazlak H: Haematological Parameters of Three Cyprinid Fish Species from Karakaya Dam Lake, Turkey. J Biol Sci, 3 (3): 30-38, 003.

36 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Isolation and Characterization of Enterohaemorragic Escherichia coli O157:H7 and EHEC O157:NM from Raw Bovine, Camel, Water Buffalo, Caprine and Ovine Milk in Iran Ebrahim RAHIMI * Faham KHAMESIPOUR ** Farzad YAZDI ** Hassan MOMTAZ *** * ** *** Department of Food Hygiene, College of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord - IRAN Under Graduated Student of Veterinary Medicine, College of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord - IRAN Department of Microbiology, College of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord - IRAN Makale Kodu (Article Code): KVFD Summary This study was conducted to determine the prevalence rate, virulence genes, and antimicrobial resistance of Escherichia coli O157:H7/NM isolated from dairy bovine, ovine, caprine, camel, and water buffalo milk in Iran. From August 010 to August 011, a total of 734 raw milk samples from bovine (19), camel (87), water buffalo (109), caprine (08), and ovine (138) were collected from 69 randomly selected herds in four provinces, Iran and they were evaluated for the presence of Escherichia coli O157:H7/NM using microbiological culture and PCR. Overall, 17 of 734 raw milk samples (.3%) were found to be contaminated with E. coli O157. The highest prevalence of E. coli O157 was found in water buffalo milk samples (5.5%), followed by bovine (3.6%), ovine (1.4%) and caprine (1.0%). E. coli O157 was not isolated from any of camel milk samples. Of 17 E. coli O157 isolates, 3 were serotype O157:H7 and 14 were serotype O157:NM. All of the 3 E. coli O157:H7 isolates were positive for stx1, stx, eae A and ehly A genes. The results of this study show that milk from bovine and water buffalo could be a significant source of enterohaemorrahagic E. coli O157:H7 and EHEC O157:NM serotypes in Iran. Keywords: Escherichia coli O 157, Milk, Water buffalo, Bovine, Camel, Ovine, Caprine İran da İnek, Deve, Manda, Koyun ve Keçi Çiğ Sütlerinden Enterohaemorragic Escherichia coli O157:H7 ve EHEC O157:NM İzolasyonu ve Karaterizasyonu Özet Bu çalışma İran da sığır, koyun, keçi, deve ve manda sütlerinden izole edilen Escherichia coli O157:H7/NM nin prevalansını, virulens genlerini ve antimikrobiyal dirençlerini belirlemeyi amaçlamıştır. Ağustos Ağustos 011 arasında İran da 4 farklı ildeki rastgele seçilen 69 sürüden toplam 734 çiğ süt örneği sığır (19), deve (87), manda (109), keçi (08) ve koyun (138) dan toplandı ve bu örneklerde E. coli O157:H7/NM varlığı bakteriyolojik kültür ve PCR ile belirlendi. Genel olarak, 734 çiğ süt örneğinin 17 sinin (%.3) E. coli O157 ile kontamine olduğu bulundu. E. coli O157 nin en yüksek prevalans oranı manda sütlerinde (%5.5) bulundu ve bunu sığır (%3.6), koyun (%1.4), ve keçi (%1.0) örneklerindeki oranlar takip etti. Deve sütlerinden ise E. coli O157 izole edilmedi. On yedi E. coli O157 izolatı arasında, 3 ü serotip O157:H7 ve 14 ü serotip O157:NM olarak belirlendi. E. coli O157:H7 izolatlarının üçü de stx1, stx, eae A ve ehly A genlerinin varlığı bakımından pozitif bulundu. Bu sonuçlar İran da sığır, koyun, keçi, deve ve manda sütlerinin enterohemorajik E. coli O157:H7 ve EHEC O157:NM serotipleri bakımından önemli bir kaynak olduğunu ortaya koymaktadır. Anahtar sözcükler: Escherichia coli O157, Süt, Manda, Sığır, Deve, Koyun, Keçi İletişim (Correspondence) ebrahimrahimi55@yahoo.com

37 560 Isolation and Characterization of... INTRODUCTION Human diseases caused by Shiga toxin-producing Escherichia coli (STEC) strains have been reported throughout the world 1. In developed countries serotype O157:H7/NM represents the major cause of human diseases; however, there have been increasing reports of non-o157 STEC strains associated with gastrointestinal infections,3. Domestic and wild animals are the sources of E. coli O157, but ruminants are regarded as the main natural reservoirs 1. Sporadic cases and outbreaks of human diseases caused by E. coli O157 have been linked to ground beef, raw milk, meat and dairy products, vegetables, unpasteurized fruit juices and water 4. Infections can also be acquired by direct contact with animals and by person-to-person spread 5,6. Escherichia coli O157:H7 is known with its high virulence and low minimal infectious dose. Multiple virulence factors contribute to the pathogenicity of E. coli O157:H7 and include, as a major one, the production of Shiga-like toxins (stx1-stx). These toxins are associated with HC and HUS in humans, mostly children and elderly persons. Like Shiga toxins, the eaea gene that encodes intimin and the hly gene that encodes hemolysin are the other main virulence factors 7,8. In addition, the flich7 gene that encodes the flagellar motility is playing a significant role in pathogenicity of the agent 9. Currently, there is limited information regarding the prevalence of E. coli O157:H7/NM in raw milk in Iran. The present study was conducted to determine the prevalence rate, and virulence genes, of E. coli O157:H7/NM isolated from dairy bovine, camel, water buffalo, caprine, and ovine milk Isfahan, Chaharmahal va Bakhtiari, Yazd and Khuzestan provinces, Iran. MATERIAL and METHODS Sampling Overall, 69 bovine, ovine, caprine, camel, and water buffalo herds were randomly selected in Isfahan, Chaharmahal va Bakhtiari, Yazd and Khuzestan provinces, Iran. From August 010 to August 011 a total of 19 bovine bulk milk samples were collected from 84 commercial dairy herds, 138 ovine bulk milk samples were collected from 66 sheep breeding farms, 08 caprine bulk milk samples were collected from 75 goat breeding farms, 87 camel bulk milk samples were collected from 16 camel breeding farms, and 109 water buffalo bulk milk samples were collected from 8 water buffalo breeding farms. The animals whose milk samples collected for this study were clinically healthy and the milk samples showed physical (color, ph, and density) consistency. The samples were immediately transported to the laboratory in a cooler with ice packs and were processed within one hour of collection. Microbiological Analyses Ten ml of each sample was homogenized in 90 ml trypton soya broth (Oxoid) supplemented with novobiocin (0 mg/l, Sigma, Germany) and incubated at 37 C for 18-4 h. A total 100 μl of cultures were plated on Sorbitol MacConkey Agar (Oxoid) plates containing Cefixime-tellurite Supplement (Oxoid). After 4 h incubation at 4 C, sorbitol negative colonies were tested for the O157 antigen by latex agglutination (Oxoid) 10 and up to five agglutination positive colonies were taken for PCR analysis. DNA Extraction Purification of DNA was achieved using a Genomic DNA purification kit (Fermentas, GmbH, Germany) according to the manufacturer s instruction and the total DNA was measured at 60 nm optical density according to the method described by Sambrook and Russell 11. Detection of flich7 Gene by PCR Analysis All oligonucleotide primers were obtained from a commercial source (Cinna Gen, Iran). In order to determine the H7 (flich7) gene of E. coli O157:H7 strains, PCR analysis was used 1. The PCR was performed with primers as Table 1. Primer sequences and predicted lengths of PCR amplification products Tablo 1. PCR amplikonları için primer dizilimleri ve tahmini uzunlukları Gene Primer Oligonucleotide Sequence (5-3) Fragment Size (pb) Reference stx1 SLT1-F TGTAACTGGAAAGGTGGAGTATACA SLT1-R GCTATTCTGAGTCAACGAAAAATAAC 10 stx SLTII-F GTTTTTCTTCGGTATCCTATTCC SLTII-R GATGCATCTCTGGTCATTGTATTAC 484 ehlya AE ATTACCATCCACACAGACGGT Fratamico et al AE0- ACAGCGTGGTTGGATCAACCT eaea MFS1-F ACGATGTGGTTTATTCTGGA MFS1-R CTTCACGTCACCATACATAT 166 flich7 FLICH7-F GCGCTGTCGAGTTCTATCGAGC 65 FLICH7-R CAACGGTGACTTTATCGCCATTCC

38 561 RAHIMI, KHAMESIPOUR YAZDI, MOMTAZ described previously (Table 1) 9 in a final volume of 50 μl containing 1 Reaction Buffer (Fermentas, GmbH, Germany), MgCl (Fermentas, GmbH, Germany), each of the four deoxynucleoside triphosphates (dntps) (Fermentas, GmbH, Germany), Taq DNA polymerase (Fermentas, GmbH, Germany), 0.50 μm of primers and 10 μl DNA. DNA amplification reactions were carried out using a DNA thermal cycler (Master Cycler Gradiant, Eppendrof, Germany) with the following program: one cycle of min at 94 C, 35 cycles of denaturation at 94 C for 0 s, annealing at 54 C for 1 min, and extension at 7 C for 1 min, with a final extension at 7 C for 10 min. The PCR products were stained with 1% solution of ethidium bromide and visualized under UV light after gel electrophoresis on 1.5% agarose. Detection of Virulence Factors by Multiplex PCR Analysis The E. coli O157:H7/NM isolates were screened for the presence of stx1 (encoding for Shiga toxin 1), stx (encoding for Shiga toxin ), eaea (encoding for intimin), and ehlya (encoding for enterohemolysin) genes using PCR method 9,1. According to Fratamico et al. 9 (Table 1), multiplex PCR protocol was used to prepare the master mix with a total concentration of 50 μl containing incomplete 1 Reaction Buffer [160 mm (NH 4 ) SO 4, 670 mm Tris-HCl (ph 8.8); 0.1% Tween-0] (Fermentas, GmbH, Germany), 3.0 mm MgCl (Fermentas, GmbH, Germany), 400 μm each of the four deoxynucleoside triphosphates (dntps) (Fermentas, GmbH, Germany),.5 U Taq DNA polymerase (Fermentas, GmbH, Germany), 0.50 μm of all primers that were used. Then, 10 μl of DNA was added to reaction mixture. Thermal cycling and gel documentation was carried out as mentioned above. E. coli O157:H7 ATCC and ATCC strains that carrying five virulence genes such as flich7, stx1, stx, eaea and ehly were used as positive controls and DNase free water was used as the negative control (Fig. 1). Statistical Analysis Data were transferred to a Microsoft Excel spreadsheet (Microsoft Corp., Redmond, WA, USA). Using SPSS 16.0 statistical software (SPSS Inc., Chicago, IL, USA), a Pearson chi-square test and Fisher s exact two-tailed test analysis was performed and differences were considered significant at values of P<0.05. RESULTS Table shows the prevalence of E. coli O157:H7/NM isolated from bovine, camel, water buffalo, ovine, and caprine milk in Isfahan, Chaharmahal & Bakhtyari, Yazd and Khuzestan, Iran. Overall, 17 of 734 raw milk samples (.3%) were found to be contaminated with E. coli O157. The highest prevalence of E. coli O157 was found in water buffalo milk samples (5.5%), followed by bovine (3.6%), ovine (1.4%), and caprine (1.0%). E. coli O157 was not isolated from any of camel milk samples. There were not significant differences in the level of contamination with E. Fig1. Electropherogram of the amplification products of PCR used for the detection of stx1 (encoding for Shiga toxin 1), stx (encoding for Shiga toxin ), eaea (encoding for intimin), and ehlya (encoding for enterohemolysin) genes of EHEC isolated from raw water buffalo, camel, bovine, ovine, and caprine milk in Iran. Lane M, molecular size markers (100-bp DNA ladder) Sekil 1. İran da manda, deve, sığır ve keçi çiğ süt örneklerinden izole edilen EHEC lerin stx1 (Shiga toksin 1 i kodlar), stx (Shiga toksin i kodlar), eaea (intimin I kodlar), ve ehlya (enterohemolizin I kodlar) genlerinin PCR ile yapılan amplifikasyon ürünlerinin elektroforez sonrası resmi. Sıra M, moleküler büyüklük standardı (100-bp DNA ladder)

39 56 Isolation and Characterization of... Table. Prevalence of Escherichia coli O157:H7/NM isolated from raw water buffalo, camel, bovine, ovine, and caprine milk in Isfahan, Chaharmahal va Bakhtyari, Yazd and Khuzestan, Iran Tablo. Iran ın Isfahan, Chaharmahal va Bakhtyari, Yazd ve Khuzestan illerindeki manda, deve, sığır ve keçi süt örneklerinden izole edilen Escherichia coli O157:H7/NM nin prevalansı Samples No. of Samples Examined E. coli O157 E. coli O157:H7 Virulence Genes No. (%) No. (%) Stx 1 Stx Stx 1 + Stx eaea ehlya Water buffalo (5.5) 1 (0.9) Camel 87 0 (0.0) 0 (0.0) Bovine 19 7 (3.6) (1.0) Ovine 138 (1.4) 0 (0.0) Caprine 08 (1.0) 0 (0.0) Total (.3) 3 (0.4) coli O157 between different milk samples. Of 17 E. coli O157 isolates, 3 were serotype O157:H7 and 14 were serotype O157:NM. Two of the O157:H7 were isolated from bovine milk and 1 was from water buffalo milk samples. All of the 3 E. coli O157:H7 isolates were positive for stx1, stx, eae A and ehly A genes. From among 14 E. coli 157:NM isolates, two, three and one strains were positive for stx, eaea and ehlya genes, respectively. The highest prevalence of E. coli O157 occurred in summer (4.4%), followed by spring (%), fall (1.3%) and winter (0.0%). No significant differences in the prevalence rates of E. coli O157 were observed for ovine and caprine milk samples taken in different seasons; however, significantly higher prevalence rates of E. coli O157 (P<0.05) were found in bovine and water buffalo samples taken in summer. DISCUSSION Among all the various milk tested in this study, water buffalo and cow milk samples had the highest prevalence rate of E. coli O157 and E. coli O157:H7, which is comparable with those reported by others. In a large U.S. survey focusing on the presence of E. coli O157:H7 in bulk tank bovine milk, only 0.0% of the samples were deemed likely to be contaminated with this organism, but the estimated contamination with other STEC serotypes was reported to be higher 13. Solomakos et al. 14 examined samples of raw bovine milk in Greece and reported that.% and 0.7% of raw bovine milk samples contained E. coli O157 and E. coli O157:H7, respectively. Abdul-Raouf et al. 15 reported that 6% of raw cow s milk samples examined in Egypt were contaminated with E. coli O157:H7. Perelle et al. 16 examined samples of raw bovine milk in France and reported an overall STEC prevalence of 1% with only 4.8% of the samples containing serogroups of major public health concern including O6, O103, O111, O145 and O157. Oksuz et al. 17 form Turkey, Picozzi et al. 18 from Italy and Cizek et al. 19 from the Czech Republic, reported that 1%, 0.7% and.0% raw cow samples were positive for E. coli O157, respectively. However, similar studies on raw cow s milk performed in the UK (Scotland) analyzing 500 samples 0, in the Netherlands analyzing 1011 samples 1, in Greece analyzing 100 samples 10, and in Brazil analyzing 50 samples resulted in no E. coli O157:H7 isolation. In a study, on Verocytotoxin-producing E. coli O6 in raw water buffalo (Bubalus bubalis) milk products in Italy, of 160 analyzed samples, 1 (0.6%) tested positive for E. coli O6, and all of the isolates were positive for stx1, stx, and hlya genes 3. In this study, all of the 5 Shiga-toxin positive and all except one of eaea and ehly A positive isolates were from cattle and water buffalo milk samples. These indicate that cattle and water buffalo are important reservoirs of E. coli O157:H7/NM in Iran. In the present study, 1.4% and 1.0% of ovine and caprine bulk milk samples were E. coli O157-positive, respectively, and no E. coli O157:H7 strain was isolated. Characterization of E. coli O157 isolates from ovine and caprine milk samples by PCR revealed that only one were positive for eaea. This is in agreement with finding of Caro et al. 4, Rey et al. 5 from Spain, and Dontorou et al. 10 from Greece. In our study, no E. coli O157 strain was isolated from the raw camel milk samples tested. The results of this study show that raw camel milk is not an important source for E. coli O157 infection. Although, it has been shown that camel s milk has a bacteriostatic effect against E. coli 6, further studies are needed to confirm and explore this relationship. Also, in a study on camel fecal samples from the United Arab Emirates, no E. coli O157:H7 and other STEC strains was identified 7. The presence of other STEC strains was not investigated in that study. In another study, no STEC or anti-stx antibodies were detected in fecal and serum samples from 400 camels in five East African countries 8. The sources of E. coli O157 in raw milk have been shown to be fecal and environmental contamination during milking, storage and transport, infected animals in dairy farms. High prevalence of E. coli O157:H7/NM have been reported in fecal samples from cattle, water buffalo, goat and sheep Therefore, the contamination source of E. coli O157:H7/NM in raw milk in this study is likely insufficient

40 563 RAHIMI, KHAMESIPOUR YAZDI, MOMTAZ hygiene during milking, milk storage or transportation. In the current study, the highest prevalence of E. coli O157 in bovine and water buffalo milk samples occurred in summer, however, no apparent pattern in the seasonality of E. coli O157 prevalence was observed in ovine and caprine milk samples. Ferens and Hovde 3 reported that prevalence of E. coli O157 in cattle peaks between late spring and early fall. Chapman et al. 33 also reported the highest isolation rate of E. coli O157 from animals during the summer. In conclusion, the presence of E. coli O157 has been shown in variety of raw milk samples in Iran. The results presented in this study indicate the potential risk of consumption of raw milk or unpasteurized milk and traditional dairy products in Iran. More studies on the occurrence of E. coli O157 are needed to establish microbiological criteria of foods in other part of the country. In addition recommendations for E. coli O157 in food need to be made by governmental authority. Acknowledgements The authors would like to thank Mr. Manochehr Momeni and Mr. Majed Riahi for the sincere help in performing technical parts of the project. REFRENCES 1. Beutin L: Emerging enterohaemorrhagic Escherichia coli, causes and effects of the rise of a human pathogen. J Vet Med B Infect Dis Vet Public Health, 53, , Lockary VM, Hudson RF, Ball CL: Shiga toxin-producing Escherichia coli, Idaho. Emerg Infect Dis, 13, , Werber D, Behnke SC, Fruth A, Merle R, Menzler S, Glaser S, Kreienbrock L, Prager R, Tschäpe H, Roggentin P, Bockemühl J, Ammon A: Shiga toxinproducing Escherichia coli infection in Germany - different risk factors for different age groups. Am J Epidemiol, 165, , Griffin PM, Tauxe RV: The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol Rev, 13, 60-98, Caprioli A, Morabito S, Brugère H, Oswald E: Enterohemorrhagic Escherichia coli: Emerging issues on virulence and modes of transmission. Vet Res, 36, , Cho S, Diez-Gonzales F, Fossler CP, Wells SJ, Hedberg CW, Kaneene JB, Ruegg PL, Warnick LD, Bender JB: Prevalence of Shiga toxin-encoding bacteria and Shiga toxin-producing Escherichia coli isolates from dairy farms and county fair. Vet Microbiol, 118, 89-98, Doyle MP, Zhao T, Meng J, Zhao S: Escherichia coli O157:H7. In, Doyle MP, Beuchat LR, Montville TJ (Eds): Food Microbiology: Fundamental and Frontiers. ASM Press, Washington, DC, Mead PS, Griffin PM: Escherichia coli O157:H7. Lancet, 35, , Fratamico PM, Bagi LK, Pepe T: A multiplex polymerase chain reaction assay for rapid detection and identification of Escherichia coli O157:H7 in foods and bovine feces. J Food Prot, 63, , Dontorou C, Papadopoulou C, Filiousis G, Economou V, Apostolou U, Zakkas G, Salamoura A, Kansouzidou A, Levidiotou S: Isolation of Escherichia coli O157:H7 from foods in Greece. Int J Food Microbiol, 8, 73-79, Sambrook J, Russell DW: Molecular Cloning: A laboratory Manual. Third ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, Goncuoglu M, Erol I, Ayaz ND, Ormanci FSB, Kaspar CW: Isolation and genomic characterization of Escherichia coli O157:H7 in bile of cattle. Ann Microbiol, 60, 93-97, Karns JS, Van Kessel JS, McClusky BJ, Perdue ML: Incidence of Escherichia coli O157:H7 and E. coli virulence factors in US bulk tank milk as determined by polymerase chain reaction. J Dairy Sci, 90, , Solomakos N, Govaris A, Angelidis AS, Pournaras S, Burriel AR, Kritas SK, Papageorgiou DK: Occurrence, virulence genes and antibiotic resistance of Escherichia coli O157 isolated from raw bovine, caprine and ovine milk in Greece. Food Microbiol, 6, , Abdul-Raouf UM, Ammar MS, Beuchat LRK: Isolation of Escherichia coli O157:H7 from some Egyptian foods. Int J Food Microbiol, 9, 43-46, Perelle S, Dilasser F, Grout J, Fach P: Screening food raw materials for the presence of the world s most frequent clinical cases of Shiga toxinencoding Escherichia coli O6, O103, O111, O145 and O157. Int J Food Microbiol, 113, 84-88, Oksuz O, Arici M, Kurultay S, Gumus T: Incidence of Escherichia coli O157 in raw milk and white pickled cheese manufactured from raw milk in Turkey. Food Control, 15, , Picozzi C, Foschiion R, Heuvelink A, Beumer R: Phenotypic and genotypic characterization of sorbitol-negative of slow-fermenting (suspected O157) Escherichia coli isolated from milk samples in Lombardy region. Lett Appl Microbiol, 40, , Cízek A, Dolejská M, Novotná R, Haas D, Vyskocil M: Survey of Shiga toxigenic Escherichia coli O157 and drug-resistant coliform bacteria from in-line milk filters on dairy farms in the Czech Republic. Appl Environ Microbiol, 104, , Coia JE, Johnston Y, Steers NJ, Hanson MF: A survey of the prevalence of Escherichia coli O157 in raw meats, raw cow s milk and raw-milk cheeses in south east Scotland. Int J Food Microbiol, 66, 63-69, Heuvelink AE, Bleumink B, van den Biggelaar FL, Te Giffel MC, Beumer RR, de Boer E: Occurrence and survival of verocytotoxin producing Escherichia coli O157:H7 in raw cow s milk in the Netherland. J Food Prot, 61, , Timm CD, Conceicao FR, Menin A, Conceicao RCS, Dellagostin OA, Alleixo JAG: Prevalence of Shiga toxin-producing Escherichia coli in Southern Brazil isolated from ground beef and milk. Cienc Anim Brasileira, 10, , Lorusso V, Dambrosio A, Quaglia NC, Parisi A, La Salandra G, Lucifora G, Mula G, Virgilio S, Carosielli L, Rella A, Dario M, Normanno G: Verocytotoxin-producing Escherichia coli O6 in raw water buffalo (Bubalus bubalis) milk products in Italy. J Food Prot, 7, , Caro I, Fernandez-Barata VM, Alonso-Liamazares A, Garcia-Armesto MR: Detection, occurrence and characterization of Escherichia coli O157:H7 from raw ewe s milk in Spain. J Food Prot, 69, 90-94, Rey J, Sachez S, Blanco JE, Hermoso de Mendoza J, Hermoso se Mendoza M, Garcia A, Gil C, Tejero N, Rubio R, Alnso JM: Prevalence, serotypes, and virulence genes of Shiga toxin-producing Escherichia coli isolated from ovine and caprine milk and other dairy products in Spain. Int J Food Microbiol, 107, 1-17, Benkerroum N, Mekkaoui M, Bennani N, Hidane K: Antimicrobial activity of camel s milk against pathogenic strains of Escherichia coli and Listeria monocytogenes. Int J Dairy Technol, 1, 39-43, Moore JE, McCalmont M, Xu JR, Nation G, Tinson AH, Cartothers L: Prevalence of faecal pathogens in calves of racing camels (Camelus dromedarius) in the United Arab Emirates. Trop Anim Health Prod, 4, 83-87, El-Sayed A, Ahmed S, Awad W: Do camels (Camelus dromedarius) play an epidemiological role in the spread of Shiga toxin producing Escherichia coli (STEC) infection? Trop Anim Health Prod, 40, , Islam MA, Mondol AS, de Boer E, Beumer RR, Zwietering MH, Talukder KA, Heuvelink AE: Prevalence and genetic characterization of Shiga toxin-producing Escherichia coli isolates from slaughtered animals

41 564 Isolation and Characterization of... in Bangladesh. Appl Environ Microbiol, 74, , Vu-Khac H, Cornick NA: Prevalence and genetic profiles of Shiga toxin-producing Escherichia coli strains isolated from buffaloes, cattle, and goats in central Vietnam. Vet Microbiol, 16, , Franco A, Lovari S, Cordaro G, Di Matteo P, Sorbara L, Lurescia M, Donati V, Buccella, C, Battisti A: Prevalence and concentration of verotoxigenic Escherichia coli O157:H7 in adult sheep at slaughter from Italy. Zoonoses Public Health, 56, 15-0, Ferens WA, Hovde CJ: Escherichia coli O157:H7: Animal reservoir and sources of human infection. Foodborne Pathog Dis, 8, , Chapman PA, Cerdan Malo AT, Ellin M, Ashton R, Harkin MA: Escherichia coli O157 in cattle and sheep at slaughter, on beef and lamb carcasses and in raw beef and lamb products in South Yorkshire, UK. Int J Food Microbiol, 64, , 001.

42 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Distribution of Paw Preference in Female and Male Rats: Assessed by A Modified Version Food-Reaching Test [1] Necip KUTLU * Turan Onur BAYAZIT * Fahriye MUTLU * [1] This study is based on data acquired for two separate theses (156673/004 and /00) submitted for MSc degree in the Department of Physiology, Institute of Health Sciences, CBU, and is supported by a grant from Scientific Research Projects Directorate (CBUBAP-05/000) * Celal Bayar University, Medical School, Department of Physiology, TR Manisa - TURKEY Makale Kodu (Article Code): KVFD Summary We re-studied the distribution of paw preference in male and female rats using a new food-reaching test. Paw preference was assessed using a modified new version of food reaching task in quadrupedal position. Of the total sample (N=165). Of 165 rats, 86 (5.1%) were right-handed, 7 (43.64%) were left-handed, and 7 (4.4%) were mixed-handed. Of the in male (N=74) 36 (48.65%) were right-handed, 35 (47.30%) were left-handed, and 3 (4.05%) were mixed-handed. The right-minus left paw reaches fitted to gaussian data with two prominent peaks due to right and left preference. In female (N=91) 50 (54.94%) were right-handed, 37 (40.66%) were left-handed, and 4 (4.40%) were mixed-handed. The female right-preference showed a right-bais compared to males. The males leftpreference were more than female left-preference.the distribution of right minus left paw reach was not U-shaped, it was J-shaped like in humans. The results indicate that the distribution of paw preference in rats is similar to that of other animals and to human handedness. It was concluded that there is a right-bias in paw rats, which is caused by the female right-preference under the influence of a biological factor. The right-pawed males were found to be least lateralized than the male left-preference, and female right-and left preference. The brain is in general more lateralized than the female brain. Keywords: Food reaching, Paw preference, Rat, Laterality, Handedness Özet Erkek ve Dişi Sıçanlarda Modifiye Besine Uzanma Test Yöntemi ile Pençe Tercih Dağılımı Biz, modifiye bir besine uzanma testi kullanarak, erkek ve dişi sıçanlarda pençe tercihi dağılımını çalıştık. Modifiye besine uzanma testi sıçanlarda dört ayaklı pozisyonda besine uzanması sağlayarak pençe tercihi dağılımını yeniden değerlendirildi. Toplam örneklemin (N=165) 86 (%5.1) sağlak, 7 (%43.64) solak ve 7 (%4.4) iki elli olduğu belirlendi. Erkek sıçanların (N=74) 36 (%48.65) sağlak, 35 (%47.30) solak ve 3 (%4.05) iki elli olduğu belirlendi. Dişilerin ise (N=91) 50 (%54.94) sağlak, 37 (%40.66) solak ve 4 (%4.40) iki elli olduğu belirlendi. Sağ eksi sol pençe normal dağılımı sağ ve sol tarafta pik yaparak gaus eğrisine uyuyordu. Dişilerde, erkeklere göre sağlaklığın daha baskın olduğu gözlendi. Erkekler sol pençe tercih dağılımının dişilerdeki sol pençe tercihine göre daha fazla olduğu saptandı. Sağ eksi sol pençe dağılımı U-dağılımı şeklinde değil de insanlarda olduğu gibi J-dağılımı şeklindeydi. Çalışılan sıçanlarda pençe tercihi dağılımının sonuçları, diğer hayvan ve insan el tercihi dağılımıyla benzerdi. Dişi sıçanlarda sağlaklığın baskın olma nedeni olarak hormonal faktörlerin olduğu sonucuna varıldı. Erkeklerde sağ pençe tercihi erkek sol pençe tercihi ve dişilerde sağ ve sol pençe tercihi göre daha az lateralizedir. Genelde erkek beyni dişi beyninden daha çok laterizedir. Anahtar sözcükler: Besine uzanma testi, Pençe tercihi, Sıçan, Laterizasyon, Ellilik INTRODUCTION Right-handedness in conjunction with functions of the left brain such as language and self-consciousness can be considered as one of the most prominent human characteristics. Manuel specialization seems to be of great İletişim (Correspondence) /07-34 kutlunecip@hotmail.com

43 566 Distribution of Paw Preference... importance in relation to cognition and phyletic basis of human behavioral lateralization 1. Handedness has been important in this continuity discontinuity debate, largely because right-handedness in humans is associated with the left hemisphere s specialization for language and speech production. Not surprisingly, the first attempts to see whether animals other than humans might be lateralized focused on measuring hand preferences in primates. The first conclusion drawn from these investigations was that on-human primates lacked any species-typical, directional bias for using a preferred hand, although individuals of some species often had hand preferences, left and right in approximately equal numbers, which were seen to be the result of learning through practice. Hand preferences of primates are discussed as part of the broad perspective of brain lateralization in animals, and compared with paw preferences in non-primates. Previously, it has been suggested that primates are more likely to express a speciestypical hand preference on complex tasks, especially in the case of coordinated hand use in using tools 3. The finding of hemispheric specialization in the rat was important for the main point that I am discussing here, because it was not associated with the paw preferences of the rats. Although the rats that a study tested exhibited individual paw preferences to use either the left or right paw to reach into a tube to obtain food, there was no population bias for a preferred paw, whereas the lateralization of hemispheric function was present at a population level, as confirmed many times subsequently 4,5. In other words, a brain can be lateralized without that lateralization being manifested as a paw or hand preference. These examples demonstrate that species-typical hand/paw preferences are present in some primates and non-primates. Even right-hand preference is not exclusive to humans and did not evolve solely in the hominid line in association with language, as postulated by some authors 6-8. Hand preference has been centered at the very heart of a debate for a long time in the scientific arena. It has long been known that hand preference exists in animals and it is considered to be similar to the handedness of man 9. Many factors are thought to be involved in cerebellar lateralization including sex, genetic, and cultural and social environment in which animal is reared. In a previous study it was claimed that animals having a strong left paw preference are as frequent as the ones having right paw preference. He observed such a behavior in cats, rats and mice. Annett s theory of deviation to the right in paw preference based on his observations of through-bred animals and sex dimorfizm. According to his theory, the domination of right-handedness in the development of a person and a population, which indicates a more or less equal distribution, is under the influence of cerebellar lateralization and/or related to the absence of verbal capacity. In a study it was found that right-pawed 5% of the mice were 5% were using their left paws, and 50% were ambidextrous 10,11. Many authors studied the handedness in both men and animals; on rats, on mice, on cats and rhesus monkeys, and on orangutans and gorillas 1-14,. On the other hand, observed an inclination to right-pawedness among house mice and left-pawedness in white mice population 15,16. In rats, a population-level right-handedness was reported since There are structural and functional asymmetries at the population level in fish, amphibians, and reptiles 1. Recently, some authors a have reported a population-level right-paw preference in rats, providing further strong support for the argument that humans are not unique in hand preference and that a homology exists between human and rat reaching movement 13. There are, however, some other reports indicating no population-level right-handedness in rats 9. According to some author, these seemingly inconsistent results in the literature can be explained in terms of the differences among testing methods have recently used a different method for assessing hand preference in rats 13,19. They evaluated the frequency of paw reaching, the number of the paw entries within 10min, instead of simple counting of paw entries without considering the time, and found that the distribution of paw preference in rats is J-shaped, and there is a right-sided population bias in handedness as in humans. This study was carried the distribution of paw preference in male and female rats using a modified new version of food reaching test in quadrupedal position and find the difference, if there is any, in paw usage between male and female animals investigated. MATERIAL and METHODS This research was conducted at the laboratories of the Department of Physiology at the Faculty of Medicine, Celal Bayar University. The experiments were performed on male and female Wistar rats adapted to the animal room for at least two weeks. The paw preference of rats was assessed by the method used by modified food-reaching test 14. This food-reaching test has been applied to cats, three feet above the food reaching test was modified and wistar albino rats (N=165) was the first time by applying the distribution of rat paw. In this cage, 4x17x1cm (LxWxH) sized transparent plastic cage was used. They could reach the food by a hole in away from the hole in front of the cage and cm high. The rats in this hole in the cage to take feed pellet were observed (Fig.1 A-B). Of 91 female and 74 male rat paw preference was determined by the distribution of food reaching test. Nutrients reach test for each rat right and left in a day for ten days to be repeated a total of fifty-paw. By the observer during the rat chow used to take the total number of rightand left-paw preference was determined by continuing until 50.

44 567 KUTLU, BAYAZIT MUTLU Fig 1. Rat observed during the use of the right paw reaching test food in quadrupedal position (A) and side view (B) Şekil 1. Dört ayak pozisyonundaki sıçanın besine uzanma testi esnasında sağ pençesini kullanımı (A) ve yandan görünüşü (B) görülmektedir A Statistical Analysis: SPSS for Windows (V.15) was used for the statistical analysis of data. Results was calculated for each significant Wilcoxon Signed Rank Test and Mann- Whitney Test. RESULTS According to the paw preference in reaching for food, 165 wistar rats were observed. The frequencies of the right-left and mixed handed rats did also not fit to 5:5:50, expected from a binomial distribution. Table 1 presents the numbers and percentages of the male and female right-, left-, and mixed-pawed rats. Statistical analysis indicated that all categories, right-left-and mixed-handers were not equal (X =315, df=0.1, P=.000). Applying a Z-test according to the identicality of difference between right and left paw preferences of rats, they were divided into three groups as right-pawed, left-pawed, and B DISCUSSION During food-reaching test rats were observed to mainly prefer to use one of their paws. This was found very interesting and worth investigation. It was not known, however, whether this was because of the task they performed, the environment they were reared, or sexual dimorphism. As result of the study conducted in our labs with through bred wistar rats, right handedness was found to be the dominant phenotype of the population. With respect to paw preference in rats, the number of the rightpawed male and female rats were found quite higher than those of the left-pawed and ambidextrous ones. Of 165 rats, 86 (5.1%) were right-handed, 7 (43.64%) were lefthanded, and 7 (4.4%) were mixed-handed. There were significantly more right-handers than left-handers. Of the in male (N=74) 36 (48.65%) were right-handed, 35 (47.30%) were left-handed, and 3 (4.05%) were mixed-handed. Table1. The female and male rats, the number and percentage of the right-left and mixed-paw usage Tablo1. Dişi ve erkek sıçanların sağ-sol ve karışık pençe kullanım sayısı ve yüzdesi Right-handers Left-handers Mixed-handers Rats N % N % N % Total (165) Females (91) Males (74) ambidextrous. Total sample to assess paw preference indicated that of 86 (5.1%) were right-preference 7 (43.64%) left-preference, and 7 (4.4%) ambilateral (Z=-1.639, P=0.101), Of 91 female rats, 50 (54.94%), were right-pawed 37 (40.66%) of them were left-pawed and 4 (4.40%) of them were ambidextrous (Z=-0.737, P=0.461). Of 74 male rats, 36 (48.65%) were right-pawed, 35 (47.30%) were left-pawed and 3 (4.05%) of them were ambidextrous (Z=-0.936, P=0.349). The correlation between percentages was examined. The hypothesis test of the difference of two ratios was used. As seen in Fig. ; the percentage difference between the preference of right paw and that of left paw in total sample, male and female rats. Fig. 3 shows the distributions of the right minus left paw preference in total (A) female (B) and male rats (C). Distributions of the R-L paw reaches for the female rats showed a right-bais compared to male Total Females Males Right Pawed Left Pawed Ambidextrous Pawed Fig. Distribution of right - left and ambidextrous paw preference (right + left = 50) in the total sample, female and male rats Abscissa: Total sample,female and male, ordinate: Paw percentage of rats Şekil. Toplam örneklem, dişi ve erkek sıçanlarda sağ-sol ve her iki pençe tercihi(sağ+sol=50) dağılımı Apsis: Toplam örneklem, dişi ve erkek sıçan sayısı, Ordinat: Pençe tercih yüzdesi

45 568 Distribution of Paw Preference... TOTAL FEMALE MALE Frequency 30 0 Frequency 30 0 Frequency ,00-40,00-30,00-0,00-10,00 0,00 10,00 0,00 30,00 40,00 50,00 Mean =5,56 Std. Dev. =43, 455 N = ,00-40,00-30,00-0,00-10,00 0,00 10,00 0,00 30,00 40,00 50,00 Mean =9,01 Std. Dev. =4, 7 N = ,00-40,00-30,00-0,00-10,00 0,00 10,00 0,00 30,00 40,00 50,00 Mean =1,33 Std. Dev. =44, 61 N =74 R-L R-L R-L A B C Fig 3. Illustrates the distribution of the right minus left (R-L) in the total sample (A), female (B) and male (C) rats Şekil 3. Toplam örneklem (A), dişi (B) ve erkek (C) sıçanların sağ eksi sol (R-L) dağılımları görülmektedir In regarding the paw preference, rats were observed to constitute a dominantly right-pawed community. That rate of right-pawedness was similar to right-handedness in men. The rate of right-pawedness in males was higher than that of females, but this was not statistically important. In a previous study it was claimed that assertion of the distribution in total rats were 70.%, right-pawed 19.3% left-pawed and ambidextrous 11.9%; Of the in male rats were 71.% right-pawed, 16.9% left-pawed and 11.9% ambidextrous; Of the in male female rats were 69% rightpawed, 1.8% left-pawed and 11.9%. ambidextrous 1. In a study it was claimed that assertion of the distribution of animals as 5% right-pawed, 5% left-pawed and 50% ambidextrous was found to be contradictory to our findings 11. Although many scientists presume that righthandedness is peculiar to human beings, studies show that animals are also inclined to use their right paws. Although cerebellar laterally was considered to be the essential of many scientific progresses, the evolutionary basis of this odd peculiarity of human beings still a waits for further investigations; Additionally, there should be some kind of explanation regarding the deviation to the right paw preference in other animals too. There should exist the absolute precursor of right-handedness in man. 90% of human beings are right handed in respect of hand preference; but it is asserted that in animals it is distributed coincidentally. That is, only human beings form a right-handed community; but the reason for this is still unknown. From evolutionary aspect, no proof of this manner was found in other animals 11. While one group of researchers assert that preference of hand is distributed into two groups as right-handed and left-handed; another group claims that hand preference indicates a constant distribution, not an interrupted one. Although there have been widespread thoughts trying to identify right-handedness or left-handedness with intrauterine location and hormonal effects, widespread view is that hand preference is a genetically determined peculiarity. Those who approache the subject from genetic aspect point out that especially hand preference is together with finger print asymmetry which can be observed since the middle of pregnancy period, asymmetry of eye and cerebral asymmetry. It is assumed that environmental factors and left-handedness in the family affect hand preference. In a study it was claimed that the difference between male and female was formed by hormones. The difference in hand preference can be explained by means of the influence of sex characters on the brain, probably the hormone of masculinity, testosterone decreases righthandedness and increases left-handedness 3. In other a study it was asserted that estrogen, the hormone of femininity, increases left-handedness and increases righthandedness by affecting the brain 4. Rats are available group to research to comprehend essentials of human asymmetry. Rats are neither so dissimilar as birds, nor similar as apes. One by one rats indicate some neurophysiological and behavioral asymmetry. However there are very small number of findings to prove that rats have a behavioral asymmetry as a species 5. In our study, in both males and females, the rate of the right-pawed was higher than both the left-pawed and the ambidextrous. Right-pawedness is the function of the left brain hemisphere, and left-pawedness is the function of the right brain hemisphere. The right brain hemisphere is related to the behavior of possessing. Meanwhile, the right brain is important for emotional cases. On earth, it is the right brain that causes people to tend to fight and to prefer avoiding fighting or makes them angry. The right brain develops more rapidly than the left brain, because the struggle for life is more important than speaking ability 17,6,7. The present study introduced a new method to assess handedness in rats. The distribution of paw preference R- L was also j-shaped as in human hand preference.

46 569 KUTLU, BAYAZIT MUTLU REFERENCES 1. Tan Ü: The distribution of hand prefrence in normal men and women. Int J Neurosci, 41, 35-55, Warren JM, Ablanalp JM, Warren HB: The development of handedness in cats and monkeys. In, Rheingold HL (Ed): Earlv Behavior. pp , NewYork: Willey, Rogers LJ: Hand and paw preferences in relation to the lateralized brain. Philos Trans R Soc Lond B Biol Sci, 364 (1519): , Cowell PE, Waters NS, Denenberg VH: The effects of early environment on the development of functional laterality in Morris maze performance. Laterality,, 1-3, Bradshaw JL, Rogers LJ: The Evolution of Lateral Asymmetries, Language, Tool Use and Intellect. San Diego, CA: Academic Press, Crow TJ: Handness, language lateralization and anatomical asymmetry: Relevance of protocadherin XY to hominid speciation and the aetiology of psychosis. BJP, 181, 95-97, Annett M: Handedness and brain asymmetry: The right shift theory. Hove, UK: Psychology Press, McManus C: Handedness, cerebral lateralization, and the evolution of handedness. In, Corballis MC, Lea SEG (Eds): The Descent of Mind. pp , Oxford, UK: Oxford Univ Press, Collins RL: On the inheritance of handedness, II: Selection for sinistralitv in mice. J Hered, 60, , Annett M: Left, Right Hand and Brain: The Right Shift Theory. pp , London, Laurence Eribaum Ass Ltd, Annett M: The distribution of manual asymmetry. BJP, 63, , Pençe S: Paw preference in rats. JBC Physiol Pharmacol, 13 (1): 41-49, Collins RL: On the inheritance of direction and degrees of asymmetry. In, Stanley DG (Ed): Cerebral Lateralisation in Non Human Species. London, Academic Press Inc. pp. 3-75, Tan U, Yaprak M, Kutlu N: Paw reference in cat: Distribution and sex difference. Int J Neurosci, 50,195-08, Bianki V, Kaiddanov N, Novikov S: The genetic analysis of right handedness in the domestic mouse. J Higher Nenmis Activity, 5, , Fu QL, Shen YQ, Gao MX, Dong J, Neveu PJ, Li KS: Brain interleukin asymmetries and paw preference in mice. Neuroscience,116 (3): , Güven M, Elalmış D, Binokay S, Tan Ü: Population-level right-paw preference in rats assessed by a new computerized food-reaching test. Int J Neurosci, 113, , Elalmış D, Özgünen K, Bınokay S, Tan M, Tan Ü, Özgünen T: Differential contributions of right and left brains to paw skil in right-and left-pawed female rats. Int J Neurosci, 113, , Tang AC, Verstynen T: Early life environment modulates handedness in rats. Behav Brain Res, 131, 1-7, Tsai L S, Maurer S: Right-handedness in white rats. Science, 7, , Bisazza A, Rogers LJ, Vallortigara G: The origins of cerebral asymmetry: A review of evidence of behavioural and brain lateralization in fishes, reptiles and amphibians. Neurosci Biobehav Rev,, , Tan Ü: The relationship of testosterone nonverbal intelligence to hand preference and skill in right-handed young adults. Int J Neurosci, 54 (3-4): 83-90, Tan Ü: The relationship between serum testosterone level and visuo motor learning in right-handed young men. Int J Neurosci, 56 (1-4): 19-4, Tan Ü: Relation of spatial reasoning ability to hand performance in male and female left-handers to familial sinistrality and writing hand. Int J Neurosci, 53 (-4): , Nicholas P, La Mendola A: Peripheral and cerebral asymmetries in the rat. Science, 78, 31-34, Ettlinger G, Blakemor CB, Milner AD: Opposite hand preferences in two sense modalities. Nature, 18, 176, Fcysenck HS: The theory of intelligence and the psychophysiology of cognition. In, Sternberg RJ (Ed): Advonces in the psychology of human intelligence. pp , Lawrence New Jersey, Eribaum Hillsaale, 1986.

47 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Bazı Buğdaygil Kaba Yemlerinin in vitro Gaz Üretimi, Sindirilebilir Organik Madde, Nispi Yem Değeri ve Metabolik Enerji İçeriklerinin Karşılaştırılması Önder CANBOLAT * * Uludağ Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR Görükle, Bursa - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada, mısır, sorgum, buğday, arpa, yulaf, çavdar ve tritikale gibi bazı buğdaygil hasıllarının kimyasal bileşimleri, in vitro gaz üretimleri, metabolik enerji (ME), organik madde sindirimi (OMS) ve nispi yem değerleri (NYD) karşılaştırılmıştır. Gaz ölçümleri 3, 6, 1, 4, 48, 7 ve 96 saat aralıklarla yapılmış ve gaz değerleri y = a+b(1-e -ct ) eşitliği kullanılarak saptanmıştır. Buğdaygil hasıllarının kimyasal bileşimleri arasında önemli farklılıklar saptanmıştır (P<0.01). Buğdaygil hasıllarının kimyasal bileşimleri ham protein için %7.-8.8; ham yağ için %.6-3.1; ham kül için % ; nötr deterjan lif (NDF) için % ; asit deterjan lif (ADF) için % ve asit deterjan lignin (ADL) için % arasında değişmiştir. Toplam gaz üretimi ml/00 mg KM, ME değeri MJ/kg KM, organik madde sindirimi (OMS) % , nispi yem değeri (NYD) ise arasında değişmiştir. Araştırma sonucunda yulaf, buğday ve mısırın toplam gaz üretimi, ME, OMS ve NYD içeriği diğer buğdaygil hasıllarından önemli düzeyde yüksek saptanmıştır (P<0.01). Anahtar sözcükler: Buğdaygil hasılları, Kimyasal bileşim, Besleme değeri, Gaz üretimi, Nispi yem değeri Summary Comparison of in vitro Gas Production, Organic Matter Digestibility, Relative Feed Value and Metabolizable Energy Contents of Some Cereal Forages The aim of this study was to compare the chemical composition, in vitro gas production, metabolizable energy (ME) organic matter digestibility (OMD), relative feed values (RFV) of the cereal forages from maize, sorghum, wheat, barley, oats, rye and triticale. Gas production were determined at 0, 3, 6, 1, 4, 48, 7 and 96 h and their kinetics were described using the equation y = a+b(1-e -ct ). There were significant differences among cereal hay in terms of chemical composition (P<0.01). The crude protein content of cereal forages ranged from 7. to 8.8%; ether extract from.6 to 3.1%; crude ash from 5.4 to 6.9%; neutral detergent fiber (NDF) from 46.6 to 55.9%; acid detergent fiber (ADF) from 4.9 to 3.6% and acid detergent lignin (ADL) from 6.3 to 8.1%. Total gas production ranged from 66.6 to 76.8 ml/00 mg DM, ME from 9.1 to 10.9 MJ/kg DM, organic matter digestibility (OMD) from 63.9 to 76.8% and relative feed values (RFV) from to As a result of this research it has been determined that the total gas production, ME, OMD and RFV of oats, wheat and maize were significantly higher than the other cereal forages (P<0.01). Keywords: Cereal forages, Chemical composition, Nutritive value, Gas production, Relative feed value GİRİŞ Ülke hayvancılığımızın geliştirilmesinde çözülmesi gereken en önemli sorunlardan biri kaliteli ve ucuz kaba yem ihtiyacının karşılanmasıdır. Kaba yemler hayvan besleme fizyolojisine uygunluğu olmalarının yanı sıra, kaliteli ve ucuz olmaları durumunda pahalı olan ve daha ziyade in- san beslenmesinde kullanılan yoğun yemlerin kullanımını azaltmaktadır. Kuru ot, yeşil yemler ve silo yemleri gibi kaba yemlerin maliyetlerinin düşük olması hayvancılık işletmelerinin karlılığını artırmaktadır 1,. Hayvancılık işletmelerinde üretim maliyetlerinin %60-70 ini yem girdilerinin İletişim (Correspondence) canbolat@uludag.edu.tr

48 57 Bazı Buğdaygil Kaba Yemlerinin... oluşturması, yemleme ile yapılacak iyileştirmenin karlılığa etkilemesi de mümkündür 3-5. Bu amaçla hayvan beslemede temel kaba yem kaynağı olarak; çayır meralar, baklagil yem bitkileri ile tahılların sap ve samanlarından yararlanılmaktadır. Ancak gerekli olan kaliteli kaba yemin tamamı bu kaynaklardan sağlanamamaktadır. Yem açığının kapatılabilmesi için çeşitli alternatifler araştırılmaktadır. Bu alternatiflerden birisi de kültürü yapılan buğdaygillerin kuru ot olarak kullanılmasıdır 6. Bu amaçla kullanılacak olan buğdaygil yemleri son yıllarda silo yemi olarak 7,8 yaygın olarak kullanılmaktadır. Ancak son yıllarda hayvancılık sektöründeki gelişmelerde dikkate alındığında kaliteli kaba yem açığı da önemli bir sorun olarak ortaya çıkmaktadır. Hayvan beslemede kullanılan yem bitkileri tarımımızda uzun yıllardan beri ciddi bir gelişme olmamış ve tarla tarımı içindeki oranı ancak %8 9 civarlarına ulaşabilmiştir. Bu oran tarımı gelişmiş ülkelerde çok daha yüksektir 10. Çok değişik toprak, iklim ve üretim desenlerine sahip olan ülkemizde, bilinen ve dünyada yaygın olarak tarımı yapılan pek çok yem bitkisinin tarla koşullarında başarıyla yetiştirilmesi mümkündür 11. Buna rağmen ülkemizde çok az sayıda yem bitkisi tür ve çeşidinin tarımı yapılmakta ve mevcut bitkilerle, yem bitkileri tarımını geliştirmek çok kolay görülmemektedir. Bu nedenle, yem bitkileri tarımına mevcutların yanı sıra yeni tür ve çeşitlerin eklenmesi gereklidir. Ya da ülkemizde yoğun bir şekilde tarımı yapılan buğdaygillerin kaba yem olarak kullanımı gündeme gelmektedir. Buğdaygil kaba yemleri başta enerji olmak üzere vitamin ve mineraller bakımından önemeli yem kaynaklarından olup dünyada yaygın olarak kullanılmaktadır 1,13. Buğdaygil kaba yemlerinin besleme değerleri genetik yapı başta olmak üzere iklim, toprak yapısı, sulama vb. çevre faktörlerinden de etkilenmektedir 14. Yemler arasında görülen farklılıkların ortaya konmasında, yemlerin kimyasal bileşimleri ile enerji ve sindirilebilir besin maddelerinin saptanması önem taşımaktadır. Yemlerin enerji ve sindirilebilir besin maddelerinin saptanması, beslenme değerlerini belirleyen önemli ölçütlerden olup, genellikle in vivo yöntemlerle saptanmaktadır. Bu yöntemlerin zaman alıcı ve pahalı olması, araştırıcıları in vitro çalışmalara yöneltmiştir. Bu durumu dikkate alarak Menke ve ark. 15 yemlerin in vitro koşullarda besleme değerinin saptanması için in vitro gaz üretim tekniğini geliştirmişlerdir. Hayvanların yemlenme davranışı, yem tüketimi, yemin sindirimi ve hayvansal ürüne dönüştürülmesi yemin kalitesine bağlı olarak değişir 16. Yem kalitesi genellikle yemin kimyasal, fiziksel ve biyolojik değerlerinin ölçülmesi ile saptanır. Amerika Bileşik Devletleri nde yonca bitkisi için geliştirilen ve diğer yemler için de kullanılan nispi yem değeri (NYD) (Relative Feed Value, RFV) yemlerin besleme değerini ölçmede kullanılmaktadır 17. Nispi yem değerinin hesaplanmasında asit deterjan fiber (ADF) ve nötr deterjan fiber (NDF) değerlerinden yararlanılmaktadır 18. Yonca için NYD değeri 100 olarak alınmakta ve NYD değeri, bu değerin altına düştükçe yem kalitesi düşmekte yükselmesi durumunda ise artmaktadır 19. Buna göre NYD 75 in altında ise 5. kalite, ise 4. kalite, ise 3. kalite, ise. kalite, ise 1. kalite ve 150 nin üzerinde ise en iyi kalite olarak kabul edilmektedir 17. Bu çalışma, Bursa nın Görükle beldesinde kültürü yapılan buğdaygil kaba yemlerinin yem değerlerinin kimyasal analizler ve in vitro gaz üretim tekniği ile saptanması ve yemlerin besleme değerlerinin karşılaştırılması amacıyla yapılmıştır. MATERYAL ve METOT Yem Materyali Araştırmanın yem materyalini 010 yılında Bursa Görükle beldesinden elde edilen mısır (Zea mays L.), sorgum (Sorghum bicolor), buğday (Triticum aestivum), arpa (Hordeum vulgare L), yulaf (Avena sativa), çavdar (Secale cereale) ve tritikale (xtriticosecale Wittmack) den oluşan 7 farklı buğdaygil hasılları oluşturmuştur. Buğdaygil hasılları geç süt olum döneminde hasat edilmiş ve hasat sonrası yemler 65 o C de etüvde kurutulmuştur. Hayvan Materyali İn vitro gaz üretim tekniğinin uygulanması amacıyla 3 baş Holstein ırkı inek kullanılmıştır. Denemede kullanılan hayvanlar Uludağ Üniversitesi Tarımsal Araştırma ve Uygulama Çiftliğinde yarı açık ahırda barındırılmaktadır. Rumen sıvısı alınan hayvanlar mısır silajı ve yoğun yem karması (%19 ham protein, 850 kcal/kg KM) temeline dayanan rasyonla yemlenmişlerdir. Rasyonlarda kaba ve yoğun yem oranı kuru madde temeline göre 50/50 olacak şekilde düzenlenmiş ve rumen sıvısı sonda aracılığıyla alınmıştır. Kimyasal Analizler Yemler 1 mm elek çapına sahip değirmende öğütülerek analizlerde kullanılmıştır. Yemlerin kuru madde (KM) içerikleri 105 o C de 4 saat etüvde kurutularak, ham kül içeriği ise 550 o C de 4 saat kül fırınında yakılarak saptanmıştır. Azot (N) içeriğinin saptanmasında Kjeldahl metodundan yararlanılmıştır. Ham protein ise Nx6.5 formülü ile hesaplanmıştır 0. Ham yağ analizi de AOAC da 0 bildirilen yönteme göre yapılmıştır. Yemlerin hücre duvarı bileşenlerini oluşturan nötr deterjanda çözünmeyen lif (NDF), asit deterjanda çözünmeyen lif (ADF) ve asit deterjanda çözünmeyen lignin (ADL) içerikleri ise Van Soest ve ark. 1 tarafından bildirilen yöntemlere göre ANKOM 00 Fiber Analyzer (ANKOM Technology, 008) aleti kullanılarak analiz edilmiştir. İn Vitro Gaz Üretimi ve Nispi Yem Değerinin Saptanması Yem ham maddelerinin in vitro koşullarda sindirilebilir-

49 573 CANBOLAT lik özelliklerinin değerlendirilmesinde Menke ve Steingass tarafından bildirilen Gaz Üretim Tekniği kullanılmıştır. Yöntemde yemlerin gaz üretimini saptayabilmek için 100 ml hacimli özel cam şırıngalar (Model Fortuna, Häberle Labortechnik, Lonsee-Ettlenschieb, Germany) kullanılmış ve yaklaşık 0.00±10 g kuru yem (kuru maddede) örnekleri üç tekerrürlü olarak cam şırıngalar içerisine konulmuştur. Gaz oluşumunu sağlamak amacıyla tüplerin içerisine 10 ml rumen sıvısı ve 0 ml çözelti konmuştur. Rumen sıvısıyla birlikte kullanılan bu çözeltinin karışımı 474 ml saf su + 37 ml makro element çözeltisi ml iz element çözeltisi, 37 ml tampon çözelti + 1. ml resazurin ml redüksiyon çözeltilerinden oluşmuştur. Bu işlemden sonra tüpler 39 o C deki su banyosunda inkübasyona alınmışlardır. Daha sonra sırasıyla inkübasyonun 3, 6, 1, 4, 48, 7 ve 96. saatlerinde tüpler içerisinde üretilen gaz miktarları saptanmıştır. Üretilen gaz miktarları, Ørskov ve McDonald 3 tarafından geliştirilen y = a+b(1-e -ct ) modele göre Neway bilgisayar programında hesaplanmıştır. Eşitlikte; a = kolay çözünebilir fraksiyonların gaz miktarı, ml b = çözünemeyen fakat yavaş fermente olan fraksiyonların gaz üretim miktarı, ml c = b fraksiyonunun saatteki gaz üretim oranı a+b = potansiyel gaz üretimi, ml t = inkübasyon süresi, saat (s) y = t süresince üretilen gaz miktarı Yemlerin metabolik enerji ve net enerji laktasyon düzeyleri Blümmel ve Ørskov 4, sindirilebilir organik madde derecesi ise Menke ve ark. 15 tarafından geliştirilen aşağıdaki denklemler kullanılarak hesaplanmıştır. ME (MJ/kg KM) = x GÜ x HP x HY NEL (MJ/kg KM) = x GÜ x HP x HY x HK-0.36 OMS (%) = x GÜ x HP x HK GÜ: 4 saatlik fermantasyon sonucu açığa çıkan gaz miktarı (ml); HP: Yemin ham protein içeriği (g/kg DM); HY: Yemin ham yağ içeriği (g/kg DM); HK: Yemin ham kül içeriği (g/kg DM) Nispi yem değeri Van Dyke ve Anderson 5 tarafından geliştirilen aşağıdaki eşitlikler ile saptanmıştır. Nispi yem değerini hesaplamak için öncelikle kuru madde sindirimi (%KMS) ADF değerinden hesaplanmaktadır. %KMS = 88.9-(0.779 x %ADF) Hayvanın canlı ağırlığına bağlı olarak kuru madde tüketimi (%KMT) NDF değerinden hesaplanmaktadır. %KMT = 10/NDF Nispi yem değerini hesaplamak için %KMS ve %KMT değerleri formülde yerine konulur. NYD = %KMS x %KMT x İstatistik Analizler Araştırmadan elde edilen verilerin istatistiki olarak değerlendirilmesinde ortalamalar arasındaki farklılıkların saptanmasında varyans analizi (General Linear Model) 6, görülen farklılıkların önem seviyelerinin belirlenmesinde ise Duncan çoklu karşılaştırma testinden yararlanılmıştır. Yemlerin kimyasal kompozisyonu ile gaz üretimi, ME, NEL, OMS, KMS, KMT, ve NYD arasındaki ilişki basit korelasyon analizlerine tabi tutularak saptanmıştır 7. BULGULAR Araştırmada kullanılan buğdaygil hasıllarının kimyasal bileşimleri saptanmış ve Tablo 1 de verilmiştir. Tablo incelendiğinde buğdaygil hasıllarının kimyasal bileşimleri arasında önemli farklılıklar saptanmıştır (P<0.01). Araştırmada kullanılan buğdaygil kaba yemlerinin in vitro gaz üretim miktarları (ml) saptanmış ve Tablo de verilmiştir. Yemlerin in vitro gaz üretim miktarları inkübasyon süresinin artışına bağlı olarak artmıştır. Yemlerin 96 saatlik gaz üretimi 66.6 Tablo 1. Buğdaygil kaba yemlerinin kimyasal bileşimleri, % Table 1. Chemical composition of some cereal forages, % Yemler Kimyasal Bileşim, % OM HP HK HY NDF ADF ADL Mısır 94.6 a 8.8 a 5.4 d.9 b 53. b 30.1 b 6.3 d Sorgum 93.3 cd 7.4 bc 6.7 ab.7 c 55.4 a 3.0 a 6.9 c Buğday 93.6 c 8.6 a 6.4 bc.6 c 49.9 c 7.6 c 6.3 d Arpa 94.5 a 8. a 5.5 d.7 c 53.1 b 9.8 b 7.9 ab Yulaf 93.9 b 7.7 b 6.1 c 3. a 46.6 d 4.9 d 6.4 d Çavdar 93.1 d 7.1 c 6.9 a.6 c 55.9 a 3.6 a 8.1 a Tritikale 93.7 bc 7.8 b 6.3 bc.3 bc 5.7 b 9.6 b 7.5 bc SH* a-d Aynı sütunda farklı harfler ile gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<0.01), * SH: Standart Hata NDF: Nötr deterjanda çözünmeyen lif, ADF: Asit deterjanda çözünmeyen lif, ADL: Asit deterjanda çözünmeyen lignin,

50 574 Bazı Buğdaygil Kaba Yemlerinin... ile 76.8 ml arasında değişmiş ve aralarındaki farklılıklar önemli bulunmuştur (P<0.05). Buğdaygil hasıllarının organik madde sindirimi (OMS), metabolik enerji (ME) ve net enerji laktasyon (NEL) içerikleri saptanmış ve Tablo 3 te, kuru madde sindirilebilir (KMS), kuru madde tüketimi (KMT) ve nispi yem değerleri (NYD) ise Tablo 4 te verilmiştir. Tablolar incelendiğinde buğday hasılları arasında gözlenen farklılıkları önemli olduğu saptanmıştır (P<0.01). Yemlerin besin maddeleri bileşimleri ile ME, NEL, OMS, KMS, KMT ve NYD arasındaki korelasyonlar saptanmış ve Tablo 5 te verilmiştir. Tablo. Buğdaygil kaba yemlerinin toplam in vitro gaz miktarları (ml) Table. Gas production (ml) of some cereal forages İnkübasyon Süresi, (saat) Yemler Mısır 17.3 ab 7. cde 4.3 d 57.9 ab 68.5 a 7.9 a 76.8 a Sorgum 15.8 bc 5.3 e 40.9 d 56.8 b 67.3 a 71.6 ab 75.8 ab Buğday 18. a 35.7 a 50. a 59. a 68.3 a 7.0 a 74. bc Arpa 15.5 c 7.0 de 45.0 c 53.4 c 60.1 c 66. c 67.9 d Yulaf 16. bc 31.5 b 46.8 b 56.3 b 65.1 b 69.5 b 73.3 c Çavdar 14.8 c 8.4 cd 41.1 d 47.7 d 58.3 c 63.9 c 66.6 d Tritikale 14.9 c 9.1 c 41.6 d 5.4 c 58.8 c 64.1 c 67.6 d SH* a-e Aynı sütunda farklı harfler ile gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<0.01), * SH: Standart Hata Tablo 3. Buğdaygil kaba yemlerinin organik madde sindirilebilir (OMS), metabolik enerji (ME) ve net enerji laktasyon (NEL) içerikleri Table 3. Organic matter digestibility (OMD), metabolizable energy (ME) and net energy lactation (NEL) values of some cereal forages Yemler OMS, % ME, MJ/kg KM NEL, MJ/kg KM Mısır 73.8 ab 10.7 ab 6.9 a Sorgum 73.1 b 10.5 b 6.6 b Buğday 75.5 a 10.9 a 6.9 a Arpa 63.9 d 9.8 c 5.6 d Yulaf 7.3 b 10.5 b 6.6 b Çavdar 64.1 d 9.1 d 5.4 d Tritikale 69. c 9.9 c 6.1 c SH* a-d Aynı sütunda farklı harfler ile gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<0.01), * SH: Standart Hata, ** OMS: Organik madde sindirimi, ME: Metabolik enerji, NEL: Net enerji laktasyon Tablo 4. Buğdaygil kaba yemlerinin kuru madde sindirimi (KMS), kuru madde tüketimi (KMT) ve nispi yem değerleri (NYD) Table 4. Digestible dry matter (DDM), dry matter intake (DMI) and relative feed value (RFV) values of some cereal forages Yemler KMS, % KMT, % NYD Mısır 65.5 c.3 c c Sorgum 63.9 d.1 d d Buğday b 15.7 b Arpa 65.5 c.3 c c Yulaf 69.5 a.6 a a Çavdar 63.6 d.1 d d Tritikale 65.8 c.3 c c SH* a-d Aynı sütunda farklı harfler ile gösterilen ortalamalar arasındaki farklılıklar önemlidir (P<0.01), * SH: Standart Hata, ** KMS: Kuru madde sindirimi, KMT: Kuru madde tüketimi, NYD: Nispi yem değerleri Tablo 5. Besin madde bileşimi ile ME, NEL, OMS, KMS, KMT ve NYD arasındaki korelasyonlar (r) Table 5. Correlation coefficient (r) of relationship of chemical composition with in vitro gas production, ME, NEL, DDM, DMI and RFV Unsurlar Besin Maddeleri Bileşimi HP HY NDF ADF ADL ME 0.54 * öd * * ** NEL * 0.35 öd öd * ** OMS öd * ** ** * KMS * 0.30 öd ** ** ** KMT 0.63 öd * öd öd * NYD 0.87 öd * ** ** * ME: Metabolik enerji, NEL: Net enerji laktasyon, OMS: Organik madde sindirimi, KMS: Kuru madde sindirimi, KMT: Kuru madde tüketimi, NYD: Nispi yem değerleri, * P<0.05, ** P<0.01, öd: önemli değil

51 575 CANBOLAT TARTIŞMA ve SONUÇ Yemlerin Kimyasal Bileşimi Araştırmada kullanılan buğdaygil hasıllarının kimyasal bileşimleri saptanmış ve Tablo 1 de verilmiştir. Tablo incelendiğinde buğdaygil hasıllarının kimyasal bileşimleri arasında önemli farklılıklar saptanmıştır (P<0.01). Buğdaygil hasıllarının ham protein içerikleri %7.1 ile %8.8 arasında değişmiştir. En yüksek ham protein %8.8 ile mısır hasılında, en düşük ise %7.1 ile çavdar hasılında saptanmıştır. Bunları buğday = arpa > tritikale = yulaf = sorgum hasılı izlemiştir. Buğdaygil hasıllarının ham protein bileşimi Ensminger ve ark. 1 ile Karabulut ve Filya nın 13 bildirdikleri sınırlar içerisinde bulunmuştur. Ham protein içeriği buğday, mısır ve sorgum ile çalışan Filya ve Sucu nun 8 bulgularından daha yüksek saptanmıştır. Ancak buğday, arpa ve tritikale hasılının ham protein içerikleri ile çalışan Adıyaman ın 9 bildirdikleri değerlerden düşük bulunmuştur. Yemlerin ham kül içerikleri ise %5.4 ile 6.9 arasında değişmiştir. Ham kül içeriği çavdarda hasılında, diğer buğdaygil hasıllarından daha yüksek bulunmuştur (P<0.01). Yemlerin ham kül içerikleri Ensminger ve ark. 1 ile Karabulut ve Filya nın 13 bildirdiği sonuçlarla benzer bulunmuştur. Buğday, arpa ve tritikale hasıllarının ham kül içerikleri Adıyaman ın 9 bildirdikleri değerlerle de aynı saptanmıştır. Ayrıca buğday, mısır ve sorgum ile çalışan Filya ve Sucu nun 8 bulguları ilde benzer bulunmuştur. Yemlerin hücre duvarı bileşenlerinden NDF, ADF ve ADL içerikleri ise sırasıyla %46.6 ile 55.9, %4.9 ile 3.6 ve %6.3 ile 8.1 arasında değişmiş ve yemler arasında gözlenen önemli farklılıklar belirlenmiştir (P<0.01). En yüksek NDF içeriği %55.9 ile çavdar ve %55.4 ile sorgum hasılında bulunmuştur P<0.01). Buğdaygil hasıllarının NDF içerikleri yapılan bir çok çalışma ile uyum göstermektedir 13,9. Lekgari ve ark. nın 30 tritikale ve buğday hasılında saptadıkları NDF değerinden düşük saptanmıştır. Yemlerdeki yüksek NDF değeri sindirimi yavaşlattığından fiziksel olarak hayvanın tokluk hissetmesine neden olur ve hayvanın aldığı yem miktarını düşürür 31. Asit deterjan lif içerikleri incelendiğinde %3.6 ve %3.0 ile çavdar ve sorgum hasılında en yüksek, en düşük ise %4.9 ile yulaf hasılında belirlenmiştir. Hücre duvarı bileşenlerinden ADL içeriği ise çavdar hasılında diğer buğdaygil hasıllarından daha yüksek bulunmuştur (P<0.01). Bu çalışmada kullanılan kaba yemlerden mısır ve buğday hasılının ADF içeriği Ensminger ve ark. 1 ile Kılıç ın 3 bildirdikleri sonuçlarla benzerlik göstermektedir. Tritikale ve buğday hasılında aynı parametreler Lekgari ve ark. nın 30 bulgularından düşük olarak belirlenmiştir. ADF ve ADL in sindirilme derecesinin düşük olması rasyonda düşük miktarlarda bulunmasını gerektirmektedir 31. Bu kimyasal değerlerle yulaf ve buğday hasılının diğer buğdaygil hasıllarından daha yüksek besleme değerine sahip oldukları söylenebilir. Yemlerin in vitro Gaz Üretimi Tablo incelendiğinde yemlerin toplam in vitro gaz üretim miktarları inkübasyon süresinin artışına bağlı olarak artmıştır. Yemlerin 96 saatlik gaz üretimi 66.6 ile 76.8 ml arasında değişmiş ve yemlerin üretmiş oldukları gazlar aralarındaki farklılıklar önemli bulunmuştur (P<0.01). 96 saatlik gaz üretimleri 76.8 ml ile en yüksek mısır hasılında, 66.6 ml ile en düşük çavdar hasılında saptanmıştır (P<0.01). Gaz üretim miktarları bakımından sıralama sorgum = buğday yulaf > arpa > tritikale hasılı şeklinde olmuştur. Çalışmada kullanılan buğdaygil hasıllarının in vitro gaz üretimlerinin düşük olmasının nedeni, rumen mikroorganizmaları için daha az yararlanılabilir protein sağlama 33,34 ve söz konusu buğdaygil hasıllarının mikroorganizmaların daha az yararlanabildiği NDF, ADF ve ADL bakımından zengin olmalarından kaynaklandığı söylenebilir (Tablo 1). Yemlerin protein ve enerji içeriğinin artmasının, NDF, ADF ve ADL içeriğinin düşmesinin gaz üretimini olumlu etkilediği birçok araştırmada da bildirilmektedir 35. Mısır silajı ve mısır kuru otunun in vitro gaz üretimi Kılıç 3 ve mısır silajı ile çalışan Canbolat ve ark. nın 36 bildirdikleri sonuçlar ile benzer saptanmıştır. Diğer buğdaygil hasıllarının in vitro gaz üretimlerinin saptanmasına yönelik literatür bulgusuna rastlanamamıştır. Yemlerin ME, NEL ve OMS İçerikleri Araştırmada kullanılan buğdaygil hasıllarının organik madde sindirimi (OMS), metabolik enerji (ME) ve net enerji laktasyon (NEL) içerikleri saptanmış ve Tablo 3 te verilmiştir. Buğdaygil hasıllarının OMS leri %63.9 ile %75.5 arasında saptanmış ve yemler arasında görülen farklılıklar önemli bulunmuştur (P<0.01). Sindirilebilir organik madde düzeyi %75.5 ile en yüksek buğday hasılında saptanmıştır. En düşük ise arpa ve çavdar hasılında bulunmuştur. Buğdaygil kaba yemlerinin HP içeriği (Tablo 1) ile 4. saatte ürettikleri gaz miktarının artması (Tablo ) OMS düzeyini artırmıştır. Ayrıca araştırma bulguları değerlendirildiğinde NDF, ADF ve ADL gibi rumende çözünmesi zor olan besin maddelerince zengin olan yemlerin mikrobiyal fermentasyonu sınırlayarak OMS düşürdüğü söylenebilir. Araştırmada belirlenen OMS içerikleri farklı buğdaygil kaba yemleri ile çalışan Kılıç ve ark. 6 ve Ozturk ve ark. nın 37 bildirdikleri değerlerle benzer bulunmuştur Ayrıca buğday, arpa ve tritikale hasılı ile çalışan Adıyaman ın 9 bildirdikleri değerlerden daha yüksek bulunmuştur. Buğdaygil hasıllarının ME ve NEL içerikleri sırasıyla; 9.1 ile 10.9 MJ/kg KM ve 5.4 ile 6.9 MJ/kg KM arasında değişmiştir. Metabolik enerji ve NEL içeriği en yüksek buğday ve mısır hasılında, en düşük ise çavdar hasılında saptanmış ve yemler arasındaki farklılıklar önemli bulunmuştur (P<0.01). Çavdar hasılında OMS, ME ve NEL içeriklerinin düşük çıkmasının nedeni, bu yemin HP ve in vitro gaz üretim miktarının diğer buğdaygil kaba yemlerinden daha

52 576 Bazı Buğdaygil Kaba Yemlerinin... düşük olması ile açıklanabilir. Yemlerin 4 saatlik in vitro gaz üretimleri ile HP ve HY içeriklerinin artması ME ve NEL içeriğini olumlu etkilemesine rağmen, yemlerin sindirimini zorlaştıran hücre duvarı bileşenlerinin (NDF, ADF ve ADL) artması ise olumsuz yönde etkilemiştir. Buğdaygil hasıllarının ME düzeyi Kılıç ve ark. nın 6 sonuçları ile uyum içerisinde bulunurken Adıyaman ın 9 bildirdikleri değerlerden daha yüksek saptanmıştır. Yemlerin KMS, KMT ve NYD İçerikleri İle Besin Maddeleri Arası Korelasyonlar Buğdaygil hasıllarının kuru madde sindirimi (KMS), kuru madde tüketimi (KMT) ve nispi yem değerleri (NYD) saptanmış ve Tablo 4 te verilmiştir. Buğdaygil hasıllarının KMS leri %63.6 ile %69.5 arasında saptanmıştır. Sindirilebilir kuru madde yulaf hasılında en yüksek, çavdar ve sorgum hasılında ise en düşük bulunmuştur (P<0.01). Kuru madde tüketimleri ise.1 ile.6 arasında değişmiş ve yulaf hasılında en yüksek bulunmuştur (P<0.01). Yemlerin yapısında yer alan ve sindirimi yavaşlatan NDF, ADF ve ADL düzeylerinin artması, fiziksel olarak hayvanın tokluk hissetmesine neden olarak, hayvanların yem tüketimini sınırladığı bildirilmektedir 31. Araştırmadan elde edilen bulgularda bunu destekler nitelikte bulunmuştur. Araştırmada saptanan KMS tritikale ve buğday hasılı ile çalışan Lekgari ve ark. nın 30 bulgularından düşük saptanmıştır. Buğdaygil kuru otlarının NYD i ile arasında değişmiş ve yulaf hasılında en yüksek, en düşük ise çavdar ve sorgum hasılında bulunmuştur. Bunları sırasıyla buğday > mısır = arpa = tritikale hasılı izlemiş ve yemler arasındaki farklılıklar önemli bulunmuştur (P<0.01). Yemlerin sindirimini zorlaştıran hücre duvarı bileşenlerinin (NDF, ADF ve ADL) artması NYD ni olumsuz yönde etkilemiştir. Buğdaygil hasıllarında saptanan NYD normal yonca değeri olarak kabul edilen 100 e kıyaslandığında yemlerin hepsinin yüksek kalitede olduğu görülmektedir. Bu yemlerden NYD 138 nin üzerinde olan yulaf hasılı en iyi kalitede kaba yem olarak saptanmıştır. Buğdaygil hasıllarının NYD tritikale ve buğday hasılı ile çalışan Lekgari ve ark. nın 30 sonuçları ile uyum içerisinde bulunmuştur. Yemlerin besin maddeleri bileşimleri ile ME, NEL, OMS, KMS, KMT ve NYD arasındaki korelasyonlar saptanmış ve Tablo 5 te verilmiştir. ME, NEL, OMS, KMS, KMT ve NYD ile yemlerin ham besin maddelerinden ham protein ile önemli pozitif korelasyonlar (P<0.05; P<0.01) belirlenirken, ham yağ ile de pozitif korelasyon saptanmış fakat korelasyonlar arasındaki farklılık önemsiz bulunmuştur (P>0.01). Yemlerin bileşiminde bulunan ham protein ile ham yağ ME, NEL, OMS, KMS, KMT ve NYD ni olumlu yönde etkilemiştir. Ham protein ve ham yağ ile ME ve OMS arasında pozitif korelasyonlar Karabulut ve ark. 38 ile KMS, KMT ve NYD i ise Canbolat ve ark. nın 39 araştırma bulguları ile desteklenmektedir. Yemlerin rumende yavaş parçalanan hücre duvarı bileşenlerinden NDF, ADF ve ADL ile ME, NEL, OMS, KMS, KMT ve NYD i arasında önemli negatif korelasyonlar saptanmıştır (P<0.05; P<0.01). Yemlerin yapısında NDF, ADF ve ADL içeriğinin artması ME, NEL, OMS, KMS, KMT ve NYD ni olumsuz etkilemiştir. Araştırmadan elde edilen ME ve OMS ile ilgili sonuçlar Aydın ve ark. 40 ve Karabulut ve ark. nın 38 sonuçları ile uyum içerisinde bulunmuştur. Nispi yem değeri ile besin maddeleri arasındaki korelasyonlar tritikale ve buğday hasılı ile çalışan Lekgari ve ark. nın 30 bulguları ile benzer saptanmıştır. Sonuç olarak bu çalışmada bazı buğdaygil hasıllarının besleme değerleri ortaya konmuştur. Araştırmada kullanılan buğdaygil hasılları arasında bulunan kimyasal farklılıklar yemlerin in vitro gaz üretimini önemli derecede etkilemiştir. Yem ham maddelerin yapısında yer alan HP, HY ve HK bakımından zengin, NDF, ADF ve ADL bakımından diğer buğdaygil hasıllarına göre fakir olan yulaf, mısır ve buğday hasıllarının in vitro gaz üretimi, ME, NEL, OMS, KMT ve NYD i diğer buğdaygil kuru otlarından yüksek saptanmıştır. Araştırma bulgularının tümü değerlendirildiğinde tüm buğdaygil hasıllarının ruminant beslemede önemli bir potansiyele sahip oldukları söylenebilir. Bu nedenle kaliteli kaba yem açığının giderilmesinde bu kaynakların kullanılmasında yarar vardır. Ayrıca mevcut yem bitkileri ekim alanlarında uygun karışımlar (buğdaygil - baklagil karışımı şeklinde) oluşturarak ve bilimsel yetiştirme teknikleri kullanılarak buğdaygil hasıllarından yararlanma olanağı arttırılmalıdır. KAYNAKLAR 1. Bilgen H, Alçiçek A, Sungur N, Eichhorn H, Walz OP: Ege bölgesi koşullarında bazı silajlık kaba yem bitkilerinin hasat teknikleri ve yem değeri üzerine araştırmalar. Hayvancılık 96 Ulusal Kongresi, Cilt 1, s , Alçiçek A, Kılıç A, Ayhan V, Özdogan M: Türkiye de kaba yem üretimi ve sorunları. Türkiye Ziraat Mühendisliği VII. Teknik Kongresi, Ocak, Ankara, Alçiçek A, Tarhan F, Özkan K, Adısen F: İzmir ili ve civarında bazı süt sığırcılığı işletmelerinde yapılan silo yemlerinin besin madde içeriği ve silaj kalitesinin saptanması üzerine bir araştırma. Hay Üret, 39-40, 54-63, Alçiçek A: Süt Sığırı Rasyonu Yapımında Temel İlkeler. Ege Tarımsal Araştırma Enstitüsü Müdürlüğü Yayınları, No: 106, s , Serin Y, Tan M: Yem Bitkileri Kültürüne Giriş. Atatürk Üniversitesi Ziraat Fakültesi Yayınları, No: 06, Kılıç Ü, Yurtseven S, Boğa M, Aydemir S: Bazı buğdaygil yem bitkilerinin besin madde içerikleri ve in vitro gaz üretimi üzerine toprak tuz düzeyinin etkisi. 7. Ulusal Zootekni Bilim Kongresi, Eylül, Adana, Filya İ: 001. Silaj Teknolojisi. Alltech Bilimsel Yayınlar Serisi, Hakan Ofset, İzmir, Ozduven ML, Kursun Onal Z, Koc F: The effects of bacterial ınoculants and/or enzymes on the fermentation, aerobic stability and in vitro dry and organic matter digestibility characteristics of triticale silages. Kafkas Univ Vet Fak Derg, 6 (5): , Sabancı CO, Baytekin H, Balabanlı C, Acar Z: Yem bitkileri üretiminin artırılması olanakları. 7e77c835af3da8_ek.pdf., 010, Erişim Tarihi:

53 577 CANBOLAT 10. Başaran U, Acar Z, Mut H, Önal Aşcı Ö: Doğal olarak yetişen bazı baklagil yem bitkilerinin bazı morfolojik ve tarımsal özellikleri. OMÜ Zir Fak Derg, 1 (3): , Avcıoğlu R, Açıkgöz E, Soya H, Tan M: Yem Bitkileri Üretimi. Türkiye Ziraat Mühendisliği, V. Teknik Kongresi, 17-1 Ocak, Ankara, , Ensminger ME, Oldfield JE, Heinemann WW: Feed and Nutrition. The Ensminger Publishing Co., California U.S.A., 1544 p, Karabulut A, Filya İ: Yemler Bilgisi ve Yem Teknolojisi. 4. Basım. Uludağ Üniv Zir Fak, Ders Notları, No: 67, Açıkgöz E: Yem Bitkileri. 3. Baskı, Uludağ Üniversitesi Güçlendirme Vakfı Yayın No: 18. VIPAŞ A.Ş. Yayın No: 58, Bursa, Menke KH, Raab L, Salewski A, Steingass H, Fritz D, Schneider W: The estimation of the digestibility and metabolizable energy content of ruminant feedstuffs from the gas production when they are incubated with rumen liquor. J Agric Sci, 93, 17-, Van Soest PJ: Nutritional Ecology of the Ruminant. nd ed., Ithaca, N.Y., Cornell University Press Rohweder DA, Barnes RF, Jorgensen N: Proposed hay grading standards based on laboratory analyses for evaluating quality. J Anim Sci, 47, , Hackmann TJ, Sampson JD, Spain JN: Comparing relative feed value with degradation parameters of grass and legume forages. J Anim Sci, 86, , Moore JE, Undersander DJ: Relative forage quality: An alternative to relative feed value and quality index. Proceedings 13th Annual Florida Ruminant Nutrition Symposium, 11-1 January, 00, pp. 16-3, Association of Official Analytical Chemists (AOAC): Official Method of Analysis. 15 th ed., Washington, DC. USA. pp , Van Soest PJ, Robertson JB, Lewis BA: Methods for dietary fiber, neutral detergent fiber and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci, 74, , Menke KH, Steingass H: Estimation of the energetic feed value obtained from chemical analysis and in vitro gas production using rumen fluid. Anim Res Dev, 8, 7-55, Ørskov ER, McDonald P: The estimation of protein degradability in the rumen from incubation measurements weighed according to rate of passage. J Agric Sci, 9, , Blümmel M, Ørskov ER: Comparison of in vitro gas production and nylon bag degradability of roughages in predicting of food intake in cattle. Anim Feed Sci Technol, 40, , Van Dyke NJ, Anderson PM: Interpreting a forage analysis. Alabama cooperative extension. Circular ANR-890, Statistica: Statistica for Windows (Release 4.3) Sat Soft, Inc Tulsa OK, Snedecor GW, Cochran W: Statistical Methods. The Iowa State Univ Press Amer, IA, USA, Filya I, Sucu E: The effect of bacterial inoculants and a chemical preservative on the fermentation and aerobic stability of whole-crop cereal silages. Asian Australas J Anim Sci, 0, , Adıyaman E: Broiler altlığı ile bazı buğdaygil yem bitkilerinin silolanma olanakları. Yüksek Lisans Tezi, Süleyman Demirel Üniv. Fen Bil. Enst., Lekgari LA, Stephen Baenziger P, Vogel KP, David D, Baltensperger DD: Identifying winter forage triticale ( Triticosecale Wittmack) strains for the central great plains. Published in Crop Sci, 48, , Van Soest PJ: Nutritional Ecology of the Ruminant. nd ed., Ithaca, N.Y., Cornell University Press, Kılıç Ü: Ruminant beslemede kullanılan bazı yem hammaddelerinin in vitro gaz üretim tekniği kullanılarak bazı fermentasyon ürünlerinin ve enerji içeriklerinin belirlenmesi. Doktora Tezi, Ondokuz Mayıs Üniv. Fen Bil. Enst., Cone JW, Van Gelder AH: Influence of protein fermentation on gas production profiles. Anim Feed Sci Technol, 76, 51-56, Blümmel M, Karsli A, Russell JR: Influence of diet on growth yields of rumen micro-organisms in vitro and in vivo: Influence on growth yield of variable carbon fluxes to fermentation products. Br J Nutr, 90, , Canbolat O, Karaman Ş: Bazı baklagil kaba yemlerinin in vitro gaz üretimi, organik madde sindirimi, nispi yem değeri ve metabolik enerji içeriklerinin karşılaştırılması. Tarım Bilim Derg, 15 (): , Canbolat Ö, Karaman Ş, Filya İ: Farklı kekik yağı dozlarının mısır silajının sindirimi ve rumen fermantasyonu üzerine etkileri. Kafkas Univ Vet Fak Derg,16 (6): , Ozturk D, Kizilsimsek M, Kamalak A, Canbolat O, Ozkan CO: Effects of ensiling alfalfa with whole maize crop on the chemical composition and nutritive value of silage mixtures. Asian Australas J Anim Sci, 19 (4): 56-53, Karabulut A, Canbolat O, Kalkan H, Gurbuzol F, Sucu E, Filya I: Comparison of in vitro gas production, metabolizable energy, organic matter digestibility and microbial protein production of some legume hays. Asian Australas J Anim Sci, 0 (4): 517-5, Canbolat O, Kamalak A, Ozkan CO, Erol A, Sahin M, Karakas E, Ozkose E: Prediction of relative feed value of alfalfa hays harvested at different maturity stages using in vitro gas production. Livest Res Rural Dev, 18 (6): /lrrd18//canb1807.htm, Accessed: Aydın R, Kamalak A, Canbolat O: Effect of maturity on the potential nutritive value of bur medic (Medicago polymorha) hay. J Biolog Sci, 7 (): , 007.

54 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Investigation of Relationship Between Bovine Herpesvirus-1 (BHV-1) Infection and Fertility in Repeat Breeding Dairy Cows in Family-Type Small Dairy Farms Ayhan ATA * Mesih KOCAMÜFTÜOĞLU ** Sibel HASIRCIOĞLU *** Mehmet KALE *** Mehmet Şükrü GÜLAY **** * Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Deparment of Theriogenology and Artificial Insemination, TR Burdur - TURKEY ** Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Deparment of Gynaecology and Reproduction, TR Burdur - TURKEY *** Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Deparment of Virology, TR Burdur - TURKEY **** Mehmet Akif Ersoy University, Faculty of Veterinary Medicine, Deparment of Physiology, TR Burdur - TURKEY Makale Kodu (Article Code): KVFD Summary The aim of this study was to determine the seroprevalence of Bovine Herpesvirus-1 (BHV-1) and investigate the relationship between BHV-1 infection and fertility in Repeat Breeding (RB) dairy cows in Burdur province, Turkey. In this study, blood serum was collected from 108 RB dairy cows and tested by enzyme linked immunosorbent assay (ELISA) against BHV-1 antibodies (Ab). The prevalence of BHV-1 among RB dairy cows was 9.5% (10/108). The average days open (DO) for BHV-1 seropositive RB dairy cows was significantly longer than that of BHV-1 seronegative RB dairy cows (P<0.01). However, neither the age (P=0.053) nor conception rate (CR) (P=0.361) of the animals were significantly affected due to BHV-1 infection. The average time intervals between calving and the fourth insemination in non-pregnant seropositive BHV-1 dairy cows were higher than that of non-pregnant BHV-1 seronegative dairy cows (P<0.01). In addition, the average ages of pregnant BHV-1 seropositive and seronegative RB dairy cows differed significantly (P<0.05). Thus, results of the current study concluded that there is a close negative relationship existed between BHV-1 infections and DO in family type small dairy farms in Burdur. BHV-1 infection increased the calving interval and possibly caused economic losses in RB dairy cows. Moreover, further prospective studies with more number of RB dairy cows are needed to evaluate the relationship between BHV-1 infections and fertility in family type small dairy farms. Keywords: BHV-1, Dairy cow, Repeat breeding, Fertility Özet Küçük Ölçekli Aile İşletmelerindeki Repeat Breeding Sütçü İneklerde Bovine Herpesvirus-1 (BHV-1) Enfeksiyonunun Fertilite İle İlişkisinin Araştırılması Bu çalışmanın amacı Burdur ilindeki Repeat Breeding (RB) sütçü ineklerde Bovine Herpesvirus-1 (BHV-1) enfeksiyonunun seroprevalansını tespit etmek ve fertilite ile ilişkisini araştırmaktır. Çalışmada 108 RB sütçü inekten kan serumu toplandı ve BHV-1 e karşı şekillenen antikorlar yönünden enzyme linked immunosorbent assay (ELISA) ile test yapıldı. BHV-1 in prevalansı RB sütçü ineklerde %9.5 (10/108) olarak tespit edildi. Ortalama servis periyodu (SP) BHV-1 seropositive RB ineklerde, BHV-1 seronegative RB ineklerden istatistiksel olarak daha uzun (P<0.01) bulundu. Bununla beraber RB ineklerde ne yaş (P=0.053) ne de gebelik oranı (P=0.361) BHV-1 enfeksiyonundan etkilenmedi. Gebe olmayan gruptaki BHV-1 seropositive RB ineklerin doğum dördüncü tohumlama tarihi arasındaki zaman aralığı, gebe olmayan gruptaki BHV- 1 seronegative RB ineklerden daha yüksek (P<0.01) olarak bulundu. İlave olarak, gebe gruptaki BHV-1 seropositive RB ineklerin ortalama yaşı ile gebe gruptaki BHV-1 seronegative RB ineklerin yaşı arasındaki farklılık önemli (P<0.05) olarak bulundu. Bulgulara göre Burdur yöresindeki aile tipi işletmelerdeki RB ineklerde BHV-1 enfeksiyonu ile SP arasında önemli bir ilişki bulunmaktadır. Bu işletmelerde BHV-1 enfeksiyonun RB ineklerde iki buzağılama arası sürenin uzamasına yol açarak ekonomik kayba neden olmaktadır. Ayrıca aile tipi küçük sütçü işletmelerde BHV- 1 enfeksiyonu ile fertilite arasındaki ilişkinin ayrıntılı değerlendirilebilmesi için daha fazla hayvanı kapsayan çalışmalara ihtiyaç bulunmaktadır. Anahtar sözcükler: BHV-1, Sütçü inek, Repeat breeding, Fertilite İletişim (Correspondence) ayhana@mehmetakif.edu.tr

55 580 Investigation of Relationship... INTRODUCTION Repeat Breeding (RB) has been described as a major concern in dairy cattle throughout the world 1. There are many diseases and disturbances held responsible for RB. The causes can be management, nutritional, genetic origin, and hormonal as well as infectious agents. All cows with RB share an almost equal increase in fertilization failure and an increase in embryonic loss. Moss et al (00) 3 reported that days to first recorded heat were associated negatively with RB syndrome in multiparous cows. In Sweden about 10% of the dairy cows are culled annually because of reproductive failure, the main reason for this being RB 4. Bovine Herpesvirus-1 (BHV-1) is a member of the genus Varicellovirus within the subfamily Alphaherpesvirinae, which belongs to the family Herpesviridae 5. This virus causes respiratory disease (Infectious Bovine Rhinotracheitis, IBR) in cattle, genital diseases (Infectious Pustular Vulvovaginitis, IPV) in females or in males (Infectious Pustular Balanoposthitis, IPB) and other clinical syndromes such as conjunctivitis, metritis, mastitis, encephalitis, abortion, enteritis, loss in milk production and generalized systemic infections. Many infections run with a subclinical course 6. Bovine Herpesvirus-1, like other alpha-herpesviruses, can cause a latent infection in the neurons of the sensory ganglia 7. Latent BHV-1 can be reactivated and re-excreted at irregular intervals due to stressful conditions or corticosteroid treatment. Therefore, cattle latently infected with BHV 1 can also be a source of infection 8. Bovine Herpesvirus-1 infections cause substantial economic losses such as weight loss, decrease in milk production, abortion, neonatal and embryonic death, stillbirth and fertility disorders such as endometritis and RB cow 9,10. The most important reproductive disorders that the genital form of disease causes in infected cows are necrotizing endometritis and necrotizing oophoritis. Also, these disorders can lead to the problems of RB and infertility in infected cows 11. Researchers reported that infertility problems have been associated with BHV-1 infections 10,1. The virus may be spread within cattle populations via contact, aerosol, fomites and via infected semen, ova or embryos 13. Miller 10 reported that the use of semen contaminated with BHV-1 for natural/artificial insemination would probably cause temporary infertility, lasting one to two weeks. Bovine Herpesvirus-1 may result in various clinical consequences, including severe respiratory disease, venereal disease with reduced reproductive performance and abortion 14. There are about small family operated dairy farms and Holstein dairy cows were present in Burdur provenance. Number of dairy cows per dairy farms is between and 00. Although, there are number of studies describing the relationship between BHV-1 infection and fertility in large dairy operations, limited data is available the effect of BHV-1 infection in small family dairy farms. Thus, the aim of this study was to determine the serological prevalence of BHV-1, and describe whether natural subclinical infections would lead to fertility losses BHV-1 infections on RB dairy cows in small family operated dairy farms of Burdur province. MATERIAL and METHODS Animals A total of 108 ( to 10 year old) Holstein-Freisian RB dairy cows were selected from 30 different dairy farms in the province of Burdur, Turkey. Numbers of animals in these dairy farms were between and 10. The current definition of the RB animal is despite being inseminated three times or more they did not become pregnant (but returning to oestrus within normal intervals); they had no apparent pathologies explaining the RB, neither at palpation per rectum or at ultrasound examination of the genital tract 15,16. Annual average milk yields and mean body condition score (BCS) RB dairy cows were 5.10±180. kg, 3.10±0.15, respectively. Body Condition Score of the dairy cattle was evaluated following the guidelines for grading the cattle on a 5 point basis 17 and animals with BCS lower than.5 were not included in the study. Blood samples were collected from all animals. All RB dairy cows were examined per rectum by an experienced veterinarian and were determined to be healthy and free of anatomical abnormalities of the reproductive tract. No animals in the trial had been vaccinated against BHV-1 prior to the sampling period. All serum samples were tested by enzyme linked immunosorbent assay (ELISA; Institut Pourquier, France) for the presence of BHV-4 antibodies (Ab) (Bio-X Diagnostics, Belgium), Bovine Viral Diarrhea Virus (BVDV) Ab (IDEXX BVDV Total Ab Test, USA), BVDV antigen (Ag) (IDEXX BVDV Ag Test, USA), Bovine Leukosis Virus (BLV) Ab (IDEXX Leukosis Serum Screening Ab Test) and all samples were free from BHV-4, BVDV and BLV. Oestrus Detection, AI, and Pregnancy Checks The RB dairy cows were checked for the signs of the oestrus: excitement, vocalization, licking, lordosis, oedema and redness of the vulva, and the presence of cervical mucus discharge (CMD). Artificial insemination (AI) dates were recorded by the inseminator and pregnancy diagnosis was performed by rectal palpation and ultrasonography 6-8 weeks after AI. The AI was performed for the fourth time postpartum in all cows. All inseminations were performed by the same experienced veterinarian using BHV-1 free frozen-thawed semen containing at least ten million of motile spermatozoa (Vanzetti Valent Raul Et, Consorzio Semenzo-Italy via Masaccio, Mancasale/Italy) obtained from a single bull with proven fertility. The stage of the estrus was determined by rectal palpation and observation of the secondary signs of estrus. The

56 581 ATA, KOCAMÜFTÜOĞLU HASIRCIOĞLU, KALE, GÜLAY insemination coincided with mid-estrus, as evidenced by CMD and high myometrial tone and contractility. The semen was placed in the corpus uteri. Breeding day (day 0) was accepted as equal to the day of onset of clear estrus signs. When AI led to a positive pregnancy check, it was defined as successful. If an animal was declared non-pregnant by rectal palpation or if it returned to heat, AI was coded as unsuccessful. Days open (DO) was calculated as the time period between calving and conception in a given cow. Antibody Detection in Serum Samples The presence of antibodies to BHV-1 in serum samples was detected by a BHV-1 ELISA kit (Institut Pourquier, France). Statistical Data Analysis The differences between BHV-1 seropositive and BHV-1 seronegative cows with respect to the average number of DO and ages were compared using the Proc Mixed procedure of SAS. The conception rate (CR) for cows was compared using the FREQ and LOGISTIC procedures of SAS. Risk estimation among BHV-1 and conception was evaluated using odds ratio (OR). RESULTS Bovine Herpesvirus-1 seroprevalence was 9.5% (10/108) in RB dairy cows in Burdur province. Bovine Herpesvirus-1 positivity was detected only in four out of 30 herds and antibody values in those farms were 40.00% (/5), % (/), 5.00% (/8), and 57.14% (4/7). Conception rate was higher in BHV-1 serologically negative cows (55.10%) than BHV-1 serologically positive RB dairy cows (40.00%) but was not statistically significant (P>0.05). The average for DO of BHV-1 serologically positive RB dairy cows (344.00±35.11 d) was different from those of BHV-1 serologically negative cows (184.37±5.96 d) and was statistically significant (P<0.01). The difference for the averages calving to fourth insemination date interval between seropositive and seronegative non-pregnant RB dairy cows was significant (P<0.01). Days open of seropositive and seronegative pregnant RB dairy cows was not statistically different (P=0.114). Moreover, no significant difference was detected between ages of seropositive and seronegative RB dairy cows. However, this difference between seropositive and seronegative pregnant RB dairy cows was significant (P<0.001). The difference between the ages of seropositive and seronegative non-pregnant animals was statistically insignificant (P=0.091). Reproductive parameters of BHV-1 seropositive and seronegative RB dairy cows are presented in Table 1. DISCUSSION Bovine Herpesvirus-1 is a threatening disease affecting the genital tract and causing infertility in cows. Consequently, it causes substantial production and economic loss in the livestock/dairy cattle industry. Up to now, several studies have been conducted detecting the relationship between BHV-1 infections and infertility problems in cows (especially RB cows). Çabalar and Akça 18 collected 64 serum samples from cows with infertility problems (Repeat Breeding, metritis, abortion) and tested for the presence of BHV-1 Ab by microneutralization assay. They reported that 45 (68.1%) of them positive for antibodies to BHV-1, and BHV-1 virus Table 1. Reproductive parameters of RB dairy cows with BHV-1 (seropositive and seronegative) Tablo 1. BHV-1 (seropozitif ve seronegatif) RB sütçü ineklerin üreme parametreleri Parameters BHV-1 (seropositive) n=10 BHV-1 (seronegative) n=98 P COWS DO a ± ±5.96 P<0.001 Age (day) ± ±58.57 P=0.053 NS* CR b P=0.361 NS Parameters n=4 n=54 PREGNANT COWS DO a 319.5± ±8.61 P=0.114 NS Age (day) ± ±55.91 P<0.001 Parameters n=6 n=44 NON-PREGNANT COWS CFIDI c 373.8± ±9.00 P<0.01 Age (day) ± ± P=0.091 NS a Day s open (DO) (day), b Conception rate (CR) (%), c Calving to fourth insemination date interval (CFIDI), * NS= Not significant. Mean values were expressed as mean ± SE

57 58 Investigation of Relationship... may be an etiological agent in infertility problems of cows since high incidence against BHV-1 had been detected in the herds. Özkul et al. 19 collected 538 serum samples from cows with infertility problems (Repeat Breeding, abortion, metritis) which were housed in 19 closed dairy herds and tested by serum neutralisation (SN) for the presence of neutralizing antibodies against BHV-1. They found that 113 of the 58 (1%) serum samples tested for BHV-1 were seropositive. They reported that the BHV-1 virus might cause infertility in cows produced in closed dairy herds. Bulut et al. 0 collected serum samples from 10 RB cows and 85 healthy cows to investigate the frequency of BHV-1 infections in RB cows and test by ELISA. They found that 85 (70.8%) of 10 RB cows and 59 (73.7%) of 85 healthy cows were seropositive for BHV-1. In another study, 10 out of 139 cows (7.%) were reported as BHV-1 antibody positive in RB dairy cows, and there was no significant relation between seropositivity of BHV-1 and RB 1. Biuk-Rudan et al. investigated the prevalence of antibodies to BHV-1 and BVDV in dairy cows (mostly RB cows) with reproductive disorders in four different farms. For this purpose, they collected serum samples from 73 cows with reproductive disorders and 47 cows without reproductive disorders and examined them for BHV-1 and BVDV by SN. They found that the seroprevalance of BHV-1 was 8.% (6/73) in cows with reproductive disorders whereas seroprevalance of BHV-1 was 14.9 (7/47) in cows without reproductive disorders. In all cows tested, they found that seroprevalance of BHV-1 was 85.8%. In addition, they reported that 80.8% of cows with reproductive disorders and 46.8% cows without reproductive disorders had antibodies to both BHV-1 and BVDV. They stated that differences in antibody prevalance among groups with/without reproductive disorders was significant and suggested a connection between reproductive disorders and simultaneous infections with BHV-1 and BVDV in dairy cows. In the current study, the seroprevalence of BHV-1 in RB dairy cows was 9.5% (10/108). Although this rate agreed with another roport, it was lower than the other findings reported by Çabalar and Akça 18. That is why the sensitivity of tests used as well as other factors such as the structure and size of herd sampled, individual and regional differences. Magana-Urbina et al. 3 investigated the risk factors affecting serological prevalence such as age, flooring type, origin of replacement heifers (same location, different location), herd size, and abortion history. They reported that the highest risk of BHV-1 positive serology was in animals >4 years, in herds with >10 cows and in herds that replacement heifers come from other locations. However, they concluded that BHV-1 serological prevalence increased as animal age increased. The results of the current study did not agree with the findings of Magana-Urbina et al. 3. We found that ages of seropositive and seronegative cows was insignificant (P=0.053). Similar to the reports of Magana- Urbina et al. 3 all seropositive cows were aged 4 years and older in our study. Another reason for lower BHV-1 seroprevalence in the current study could be attributed to the smaller herds with low population densities (generally herds with <10 cows) and very low cow transfers among the herds. Miller et al. 4 and Chiang et al. 5 have described a decrease in the CR of initially seronegative animals after experimental BHV-1 infection. Elazhary et al. 1 reported that the reason of the low CR and the high number of services per pregnancy in a herd having abortion and infertility problems could be due to the virus infection of the embryo resulting in its death and absorption in the early stage of pregnancy. However, Hage et al. 9 reported that it was doubtful that early pregnancies were terminated by BHV-1 infection although they detected a significant decrease in the number of successful insemination in seronegative and seropositive dairy cows in their study. Allan et al. 6 concluded that BHV-1 infection had no effect on pregnancy. In another study, the difference for CR among these groups was statistically insignificant although CR was higher in BHV-1 serologically negative cows than BHV-1 positive cows in Burdur province 7. They also concluded that BHV-1 seropositivity had no effect on CR of cows 7. In the same study, there was a difference for DO between seropositive and seronegative cows and BHV-1 serologically positive cows required a longer time to conceive 7. It has been reported that the Holstein cow is profitable if she has a calving interval of 1 to 13.5 months, if milk yield exceeds kg milk per lactation and the ideal number of DO is Among animals examined herein, the number of DO in seropositive and seronegative cows was longer than 90 days. Similarly, the average DO in RB cows reported by Al-Hassan 9 and Ata 16 were 183. and 199 days, respectively. In conclusion, the results of this study showed that there was a close relation between BHV-1 infections and reproduction in RB cows. Seropositivity for BHV-1 in these animals affected the calving interval negatively. The DO period was longer in seropositive RB dairy cows than seronegative RB dairy cows. Seropositivity for BHV-1 also prolongs the age at pregnancies in seropositive RB dairy cows for more than 00 days. Thus, BHV-1 infections can cause substantial economic losses due to a prolonged calving interval. However, further studies with more number of RB dairy cows are merited to better understand the relationship between BHV-1 infection and reproduction in family operated small dairy farms. REFERENCES 1. Lucy MC: Reproductive loss in high-producing dairy cattle: Where will it end? J Dairy Sci, 84, , Casida EL: Present status of the Repeat Breeding cow problem. J Dairy Sci, 44, 33-39, Moss N, Lean IJ, Reid SWJ, Hodgson DR: Risk factors for Repeat Breeding syndrome in New South Wales dairy cows. Prev Vet Med, 54, , Gustafsson H, Emanuelsson U: Characterisation of the Repeat Breeding

58 583 ATA, KOCAMÜFTÜOĞLU HASIRCIOĞLU, KALE, GÜLAY syndrome in Swedish dairy cattle. Acta Vet Scand, 43, , Murphy FA, Gibbs EPJ, Horzinek MC, Studdert MJ: Herpesviridae. In, Murphy FA, Gibbs EP, Studdert MJ, Horzinek MC (Eds): Veterinary Virology. 3rd ed., pp , San Diego, Academic Press, Straub OC: Infectious bovine rhinotracheitis virus. In, Dinter Z, Morein B (Eds): Virus Infections of Ruminants. pp , Elsevier Science Publishers, Ackermann M, Wyler R: The DNA of an IPV stain of bovid herpesvirus-1 in sacral ganglia during latency after intravaginal infection. Vet Microbiol, 9, 53-63, Pastoret PP, Thiry E, Brochier B, Derboven G, Vindevogel H: The role of latency in the epizootology of infectious bovine rhinotracheitis. In, Witteman, G, Gaskell RM, Rziha HJ (Eds): Latent Herpes Virus Infections in Veterinary Medicine. pp. 11-7, Nijhoff Martinus, Dordrecht, Hage JJ, Schukken YH, Dijkstra TH, Barkema HW, Van Valkengoed PHR, Wentink GH: Milk production and reproduction during a subclinical bovine herpesvirus 1 infection on a dairy farm. Prev Vet Med, 34, , Miller JM: The effects of IBR virus infection on reproductive function of cattle. Vet Med, 86, 95-98, Kendrick JW, McEntree K: The effect of artificial insemination with semen contaminated with IBR/IPV virus. Cornell Vet, 57, 3-11, Elazhary M, Lamothe P, Silim A, Roy RS: Bovine herpes virus type 1 in the sperm of a bull from a herd with fertility problems. Can Vet J, 1, , Muylkens B, Thiry J, Kirten P, Schyntsb F, Thirya E: Bovine herpesvirus 1 infection and infectious bovine rhinotracheitis. Vet Res, 38, , Yıldırım Y, Yılmaz V, Kalaycıoğlu AT, Bilge-Dağalp S, Majarashin Faraji RA, Çelebi Ö, Akça D: An Investigation of a possible involvement of BVDV, BHV-1 and BHV-4 infections in abortion of dairy cattle in Kars district of Turkey. Kafkas Univ Vet Fak Derg, 17, , Båge R: On Repeat Breeding in dairy heifers with special focus on follicular dynamics, ovulation and oocyte quality. Doctoral Thesis, ISBN X, SLU, Uppsala Ata A: Fertility and application of GnRH in Repeat Breeding cows. Doktora Tezi, Ankara Üniv. Sağlık Bil. Enst., Ankara, Loeffler SH, de Vries MJ, Schukken YH, de Zeeuw AC, Dijkhuizen AA, de Graaf FM, Brand A: Use of technician scores for body condition, uterine tone and uterine discharge in a model with disease and milk production parameters to predict pregnancy risk at first AI in Holstein dairy cows. Theriogenology, 51, , Çabalar M, Akça Y: Fertilite problemli ineklerde enfeksiyöz bovine rhinotracheitis enfeksiyöz pustular vulvovaginitis (IBR/IPV) virus izolasyonu ve seropidemiyolojisi. Ankara Üniv Vet Fak Derg, 41, , Özkul A, Çabalar M, Bilge S, Akça Y, Burgu İ: Süt sığırcılığı işletmelerinde rastlanan IBR ve BVD virus enfeksiyonlarının infertilite olgularındaki rolü. Ankara Üniv Vet Fak Derg, 4, , Bulut H, Rısvanlı A, Tonbak S, Gulactı I, Azkur K, Bolat Y: Döl tutmayan ineklerde bovine virus 1 infeksiyonlarının sıklığı. FU Saglik Bil Derg, 17, 3-6, Gur S: Prevalence of bovine viral diarrhoea, bovine herpesvirus type 1 and 4 infections in Repeat Breeding cows in Western Turkey. Braz J Vet Res Anim Sci, 48, 8-33, Biuk-Rudan N, Cvetníc S, Madic J, Rudan D: Prevalence of antibodies to IBR and BVD viruses in dairy cows with reproductive disorders. Theriogenology, 51, , Magana-Urbina A, Rivera JLS, Segura-Correa JC: Infectious bovine rhinotracheitis in dairy herds in the Cotzio-Tejaro region of Michoacan, Mexico. Tec Pecu Mex, 43, 7-37, Miller JM, Van der Maaten MJ, Whetstone CA: Effects of a bovine herpes virus 1 isolate on reproductive function in heifers: Classification as a type- infectious pustular vulvovaginitis virus by restriction endonuclease analysis of viral DNA. Am J Vet Res, 49, , Chiang BC, Smith PC, Nusbaum KE, Stringfellow DA: The effect of infectious bovine rhinotracheitis vaccine on reproductive efficiency in cattle vaccinated during oestrus. Theriogenology, 33, , Allan PJ, Dennett DP, Johnson RH: Studies on the effects of infectious bovine rhinotracheitis virus on reproduction in heifers. Aust Vet J, 51, , Ata A, Kale M, Yavru S, Bulut O, Buyukyoruk U: The Effect of subclinical bovine herpesvirus 1 infection on fertility of cows and heifers. Acta Vet Beo, 56, 67-73, Jainudeen MR, Hafez ESE: Cattle and buffalo. In, Hafez ESE, Hafez B (Eds): Reproduction in Farm Animals. 7th ed., pp , Lippincott Williams Wilkins. Maryland, USA, Al-Hassan MJ: Assessment of the reproductive performance of a holstein dairy herd as affected by the efficiency of the inseminator. J King Saud Univ Sci, 15, 79-88, 003.

59 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Evaluation of the Serum Lipid Profiles in Dogs with Symptomatic Visceral Leishmaniasis Ramazan DURGUT * Doğan DALKILINÇ * Murat GÜZEL ** * Mustafa Kemal University, Veterinary Faculty Department of Internal Medicine, TR Antakya/Hatay - TURKEY ** Ondokuz Mayıis University, Veterinary Faculty Department of Internal Medicine, TR Samsun - TURKEY Makale Kodu (Article Code): KVFD Summary The aim of this study was to investigate the serum lipid profile in naturally infected symptomatic dogs with visceral leishmaniasis (VL). A total of 0 owned dogs, comprising 10 healthy controls and 10 infected dogs with L. infantum were enrolled in this study. The clinical history and physical examination were performed in all dogs. Infected dogs showed one or more signs of canine leishmaniasis such as skin lesions, loss of weight, conjunctivitis, alopecia, scaling, onychogryphosis, lymphadenopathy, weakness, anorexia, and epistaxis. The diagnosis of canine visceral leishmaniasis (CVL) was confirmed by the immunofluorescence antibody test (IFAT) with an antibody titer over or equal to 1:18. None of the healthy dogs had clinical signs consistent with any of the disease and were all seronegative for leishmaniasis. In this study, serum cholesterol, very low density lipoprotein (VLDL) and low density lipoprotein (LDL) levels were significantly higher (P<0.01) in symptomatic dogs when compared to control animals. However, triglyceride and high density lipoprotein (HDL) levels were lower (P<0.01) than those of the controls. In conclusion, it was determined that CVL induce significant changes in serum lipid profile. Keywords: Visceral leishmaniasis, Lipid, Cholesterol, Dog Semptomatik Leishmaniasisli Köpeklerde Serum Lipit Profilinin Değerlendirilmesi Özet Bu çalışmanın amacı doğal enfekte visseral leishmaniasisli semptom gösteren köpeklerde lipit profilindeki değişiklikleri araştırmaktır. 10 sağlıklı ve 10 L. infantum ile enfekte toplam 0 sahipli köpek bu çalışmaya dahil edildi. Bütün köpeklerin anamnez bilgileri alındı ve fiziksel muayeneleri yapıldı. Enfekte köpeklerde visseral leishmaniasisin (VL) deri lezyonları, ağırlık kaybı, konjiktivitis, alopesi, kepeklenme, tırnaklarda uzama, lenfadenopati, güçsüzlük, iştahsızlık, epistaksis semptomlarından bir veya birkaçı tespit edildi. Canin visseral leishmaniasisin (CVL) teşhisi immunofluoresens antikor testi (IFAT) ve antikor titresinin 1:18 e eşit veya üzerinde belirlenmesi ile doğrulandı. Sağlıklı köpeklerin hiç birinde klinik semptom yoktu ve leishmania antikoru tespit edilmedi. Bu çalışmada semptomatik köpeklerde serum kolesterol, çok düşük dansiteli lipopretein (VLDL) ve düşük dansiteli lipopretein (LDL) seviyelerinin kontrol grubu verileriyle karşılaştırıldığında yüksek bulundu (P<0.01). Fakat trigliserit ve yüksek dansiteli lipopretein (HDL) seviyeleri kontrol hayvanlarından daha düşük belirlendi (P<0.01). Sonuçta CVL in serum lipit profilinde önemli değişikliklere neden olduğu belirlendi. Anahtar sözcükler: Visseral leishmaniasis, Lipit, Kolesterol, Köpek INTRODUCTION Canine visceral leishmaniasis (CVL) is a zoonotic, potentially fatal, systemic disease caused by a protozoan of the genus Leishmania in tropical and sub tropical climate zone of the world. Leishmania spp. is an intracellular protozoan that spends part of their life between sand fly vectors and the vertebrate host s macrophage 1,. VL can show different clinical manifestations from asymptomatic to symptomatic dogs, where a wide spectrum of clinical signs are evident such as skin lesions, weight loss, local and generalized lymphadenopathy, epistaxis, and lameness 3. The appearance and severity of clinical signs depend upon dog s immunological response and the stage of the disease. İletişim (Correspondence) /131 muratguzel05@gmail.com

60 586 Evaluation of the Serum... Characteristic clinical signs of visceral leishmaniasis may detect infection, however; ancillary laboratory data in canine visceral leishmaniasis is helpful for contributing to diagnosis of the infection. The common clinical pathologic findings in CVL are the presence of hyperproteinemia, hyperglobulinemia, and thrombocytopenia. Proteinuria and azotemia are associated with glomerulonephritis. Liver failure occurs less commonly than renal failure and elevations in liver enzymes are not uncommon 4. Different clinical pathologic findings may require establishing an early and accurate diagnosis/prognosis of CVL. There are few studies reporting an alteration in serum lipid profiles of leishmaniasis in humans 5-8. Plasma lipid and cholesterol alterations have been demonstrated in naturally infected or experimental protozoan disease such as malaria, trypanosomiasis, giardiasis, toxoplasmosis, and babesiosis The aim of the present study was to evaluate lipid profile (triglyceride, total cholesterol, VLDL, LDL, HDL levels) in naturally infected symptomatic dog with VL. MATERIAL and METHODS A total of 0 owned dogs, comprising 10 clinically healthy control and 10 naturally infected owned dogs with VL from Hatay province in Turkey, were enrolled in this study. The dogs were between 1 and 8 years old and 1-40 kg body weight in different breed and sex. For all dogs, the clinical history and physical examinations were performed. The clinical status of each dog was carefully evaluated and defined according to weight loss, anorexia, enlarged lymph nodes, fever, epistaxis, conjunctivitis, dermatitis, skin ulcerations, alopecia, and onychogryphosis. None of the healthy dogs had clinical signs consistent with any of the disease. A total of 8 ml blood sample was collected from the cephalic vein into the silicone gel coated tubes. All the dogs were fasted for eight hours before blood sample collecting. Serum samples were separated by centrifugation at 3000 rpm for 10 min at room temperature and kept at -0 C until processing. To detect anti-leishmania antibodies in dog sera, the indirect immunofluorescence assay (IFAT) was performed by using standard procedures. The IFAT was carried out using promastigotes from local Leishmania infantum stocks (L. infantum zymodeme MON-1). Briefly, following an incubation at 37 C for 30 min, slides were washed and stained with FITC-labeled anti-dog IgG conjugate (Sigma, A904) diluted 1:00 in PBS. Slides were covered and examined under a fluorescence microscope. Antibody titer over or equal to 1:18 was scored as positive 1. All healthy control animals were seronegative for CVL. Serum samples were analyzed for triglycerides, total cholesterol, VLDL, HDL, and LDL- cholesterol. The analyses were performed on an automated analyzer (XL-600, Erba, India) using commercial test kits (Teco Diagnostics, California, USA) and VLDL levels were calculated by the following formula: triglycerides/5. The Student t-test was used to compare serum triglyceride, cholesterol, VLDL, LDL, and HDL levels between the controls and CVL group. Data will be presented as mean ± standard error and a p value of less than 0.05 will be considered as significant. RESULTS Clinical signs of the infected dogs had typical clinical signs of CVL such as, skin lesions (9/10), loss of weight (8/10), conjunctivitis (7/10), alopecia (6/10), scaling (6/10), onychogryphosis (5/10), lymphadenopathy (4/10), weakness (3/10), anorexia (3/10), and epistaxis (/10). A clinical diagnosis of the all infected dogs was confirmed by serologically by a positive (between 1:18 and 1:4096) indirect fluorescent antibody test (IFAT) for the CVL. Control dogs did not show any clinical signs and serologically positive titer. Concentrations of serum triglyceride, cholesterol, VLDL, LDL and HDL levels and protein profiles in the dogs infected by leishmaniasis and the healthy controls were summarized in Table 1. Statistically significant increases in serum cholesterol, VLDL and LDL levels were observed Table 1. Concentrations of serum lipid and protein parameters in the dogs infected by leishmaniasis and the healthy controls Tablo 1. Leishmaniasisle enfekte ve sağlıklı kontrol köpeklerinde serum lipit ve protein parametreleri konsantrasyonları Parameters Healthy Control (n=10) Visceral Leishmaniasis (n=10) Triglyceride (mg/dl) 16.8± ±6.0 P<0.01 Cholesterol (mg/dl) 43.9± ±6.4 P<0.01 LDL (mg/dl) 7.9± ±6. P<0.01 HDL (mg/dl) 70.8± ±4. P<0.01 VLDL (mg/dl) 8.7± ±1.8 P<0.01 Total Protein (mg/dl) 5.5± ±0.8 P<0.05 Albumin (mg/dl) 3.6±0.3.0±0. P<0.01 Globulin (mg/dl) 1.9± ±0.9 P<0.01 P

61 587 DURGUT, DALKILINÇ GÜZEL in leishmania infected group when compared to controls. There was, however, a statistically significant decrease in serum triglyceride and HDL level (P<0.01) in CVL. In leishmania infected group, serum total protein (P<0.05) and globulin (P<0.01) levels were significantly raised. However, a significant decrease in albumin concentrations in dogs was observed when compared to healthy control (P<0.01). DISCUSSION In this study, clinical signs of infected dogs were similar to those reported in a previous study. Infected dogs showed mostly skin lesions, loss of weight, conjunctivitis, alopecia, scaling, onychogryphosis, lymphadenopathy, weakness, anorexia, and epistaxis, respectively. The clinical diagnosis of CVL is relatively easy in dogs with symptomatic dogs. Serodiagnosis and laboratory findings such as hyperproteinemia, hypoalbuminemia and hyperglobulinemia are helpful markers of the disease 4. In this study, we observed that serum total protein and globulin levels were significantly higher in dogs with CVL than the healthy dogs. Most dogs affected with CVL show hyperproteinemia in advance stages due to increased production of β and γ globulins 1. This can be observed by an increase of the total serum proteins with hyperglobulinemia and hypoalbuminemia, with decreased albumin/globulin ratio 13. Plasma lipoproteins (VLDL, LDL, and HDL) function primarily in lipid transport among tissues and organs 14. Besides their primary role in lipid transport, lipoproteins participate in innate immunity, since they have broad preventive effects against bacterial, viral and parasitic infections 15. Changes in lipid profile occur in patients having active infections with most of the parasite. It has been reported that parasites are able to metabolize cholesterol, but the underlying mechanism has not fully been understood yet 10. During the acute-phase response to infection and inflammation, it is well known that some alterations in lipoprotein metabolism occur and result in a variety of changes in the plasma concentrations and composition of lipids and lipoproteins 16. It was reported that plasma lipid and lipoproteins could play important role in the development or maintenance of the immune response in human VL 8. One of the responsible mechanisms for the altered lipid profile in patients with visceral leishmaniasis might be sequestration and/or degradation of lipoproteins in the enlarged spleen and liver 17. In addition to several types of acute conditions are associated with a marked decrease in HDL cholesterol 18. In this study, statistically significant increases in cholesterol, VLDL and LDL levels (P<0.01) were observed in the leishmania infected group when compared to control group. There were, however; a significant decrease in triglyceride and HDL levels (P<0.01). The decrease in serum cholesterol, HDL, and LDL levels and high levels of triglycerides and VLDL were observed in human patients with VL by Soares et al. 8. These results are in disagreement with our findings. However, significant increases in cholesterol, LDL levels and decrease in HDL levels were observed in leishmania infected dogs by Nieto et al. 19 as observed in our study. Trypanosoma brucei infection in rabbits results in an increase in cholesterol and VLDL, and decrease in HDL due to lipoprotein lipase hypoactivity 14. The significant alteration of lipid profile may be attributed to the consumptive evolution of the disease, hepatic disorders, interactions between the parasite and the normal cholesterol metabolism of the host 19, and lipoprotein lipase hypoactivity 14. In conclusion, these results suggest that VL induced significant changes in serum lipid profile in the dog. The changes in lipid profile may be help in diagnosis in dog symptomatic visceral leishmaniasis. REFERENCES 1. Abranches P, Silva-Pereira MC, Conceicao-Silva FM, Santos-Gomes GM, Janz JG: Canine leishmaniasis: Pathological and ecological factors influencing transmission of infection. J Parasitol, 77, , Atasoy A, Pasa S, Toz SO, Ertabaklar H: Seroprevalence of Canine Visceral Leishmaniasis Around the Aegean Cost of Turkey. Kafkas Univ Vet Fak Derg, 16 (1): 1-6, Ciaramella P, Oliva G, Luna, RD Gradoni L, Ambrosio R, Cortese L, Scalone A, Persechino A: A retrospective clinical study of canine leishmaniasis in 150 dogs naturally infected with Leishmania infantum. Vet Rec, 141, , Baneth G: Leishmaniasis: A Global Zoonosis, Proceedings of the World Small Animal Veterinary Association, Sydney, Australia, Bekaert ED, Dole E, Dubois DY, Bouma ME, Lontie JF, Kallel R, Malmendier CL, Ayrault-Jarrier M: Alterations in lipoproteindensity classes in infantile visceral leishmaniasis: Presence of apolipoprotein SAA. Eur J Clin Invest,, , Liberopoulos E, Alexandridis G, Bairaktari E: Severe hypocholesterolemia with reduced serum lipoprotein (a) in a patient with visceral leishmaniasis. Ann Clin Lab Sci, 3, , Secmeer G, Cengiz A, Gurgey B, Kara A, Cultu O, Tavil B, Devrim I: Hypertriglyceridemia and decreased high-density lipoprotein could be a clue for visceral leishmaniasis. Infect Dis Clin Pract, 14, , Soares NM, Leal TF, Fiuza MC, Reis EA, Souza MA, Dos-Santos WL, Pontes-de-Carvalho L: Plasma lipoproteins in visceral leishmaniasis and their effect on Leishmania-infected macrophages. Parasite Immunol, 3, 59-66, Adamu S, Ige AA, Jatau ID, Neils JS, Nicodemus M, Useh NM, Bisalla M, Ibrahim NDG, Nok AJ, Esievo KAN: Changes in the serum profiles of lipids and cholesterol in sheep experimental model of acute African trypanosomosis. African J Biotech, 7, , Askar TK, Salmanoglu B, Cakmak A, Baskaya A: Relative changes in serum lipid-lipoprotein and trace element levels in cattle babesiosis. Medycyna Weterinary, 64, , Bansal D, Bhatti HS, Sehgal R: Role of cholesterol in parasitic infections. Lipids Health Dis, 9, 10, Palacio J, Liste F, Gascon M: Urinary protein/creatinine ratio in the evaluation of renal failure in canine leishmaniasis. Vet Rec, 137, , Strauss-Ayali D, Baneth G: Canine visceral leishmaniasis. In, Carmichael (Ed): Recent Advances in Canine Infectious Diseases. Ithaca, NY, Nakamura Y: Alterations of serum lipid, lipoprotein and inflammatory cytokine profiles of rabbits infected with Trypanosoma brucei brucei. Vet

62 588 Evaluation of the Serum... Parasitol, 80, , Han R: Plasma lipoproteins are important components of the immune system. Microbiol Immunol, 54, 46-53, Khovidhunkit W, Memon RA, Feingold KR, Grunfeld C: Infection and inflammation-induced proatherogenic changes of lipoproteins. J Infect Dis, 181, 46-47, Liberopoulos E, Alexandridis G, Bairaktari E, Elisaf M: Severe hypocholesterolemia with reduced serum lipoprotein(a) in a patient with visceral leishmaniasis. Ann Clin Lab Sci, 3, , Carpentier Y, Scruel A: Changes in the concentration and compositionof plasma lipoproteins during the acute phase response. Curr Opin Clin Nutr, 5, , Nieto, CG, Barrera R, Habela MA, Navarrete I, Molina C, Jimenez A, Serrera JL: Changes in the plasma concentrations of lipids and lipoprotein fractions in dogs infected with Leishmania infantum. Vet Parasitol, 44, , 199.

63 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Determination and Pharmacokinetics of Recombinant Human Growth Hormone in Rabbit Plasma by Spectrofluorometry Method [1] Bilal YILMAZ * Yucel KADIOGLU * Kadem MERAL ** Fikret CELEBI *** Yavuz ONGANER** [1] This study was supported by a Grant from Ataturk University Research Foundation (Project no: 007/55) * Department of Analytical Chemistry, Faculty of Pharmacy, Ataturk University, TR-540 Erzurum - TURKEY ** Department of Chemistry, Faculty of Science, Ataturk University, TR-540 Erzurum - TURKEY *** Department of Physiology, Faculty of Veterinary Medicine, Ataturk University, TR-540 Erzurum - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, a new spectrofluorometry method was developed for the determination of human growth hormone (somatotropin) in rabbit plasma. The validation was assessed under a variety of conditions (FDA, Bioanalytical Method Validation Guidline). Calibration curves were linear between the concentration range of μg/ml. Intra- and inter-day precision values for somatotropin in plasma were less than 13.5, and accuracy (relative error) was better than 1.0%. The recoveries for all samples were >84.0%. The limits of detection (LOD) and quantification (LOQ) of somatotropin were and 0.10 μg/ml, respectively. The described spectrofluorometry method has adequate sensitivity and specificity to study pharmacokinetics of somatotropin in rabbits, and could be adapted also to clinical pharmacokinetic study. Keywords: Human growth hormone, Spectrofluorometry, Liquid-liquid extraction, Rabbit, Pharmacokinetic study Özet Spektroflorometri Yöntemi Kullanarak Tavşan Plazmasında Rekombinant İnsan Büyüme Hormonunun Tayini ve Farmakokinetiği Bu çalışmada, insan büyüme hormonunun (somatotropin) tavşan plazmasında tayini için yeni bir spektroflorometri yöntemi geliştirildi. Geçerlilik FDA nın Bioanalitik Yöntem Validasyonu rehberinde belirtildiği koşullarda yapıldı. Kalibrasyon eğrileri μg/ml derişim aralığında doğrusaldır. Plazmada somatotropin için gün içi ve günler arası kesinlik değerleri %13.5 den küçüktü ve doğruluk (bağıl hata) %1.0 dan daha iyiydi. Bütün örnekler için geri kazanım >%84.0 idi. Somatotropinin belirlenebilen (LOD) ve ölçülebilen (LOQ) en düşük değeri sırasıyla and 0.10 μg/ml dir. Tanımlanan spektroflorometri yöntemi tavşanlarda somatotropinin farmakokinetiğini incelemek için yeterli duyarlılığa ve özgüllüğe sahiptir ve klinik farmakokinetik çalışmalara da uyarlanabilir. Anahtar sözcükler: İnsan büyüme hormonu, Spektroflorometri, Sıvı-sıvı ekstraksiyon, Tavşan, Farmakokinetik çalışma INTRODUCTION Synthetic human growth hormone (somatotropin) is manufactured by recombinant DNA technology. It is a 191 amino acid polypeptide (MW kda) with an amino acid sequence and two internal disulphide bridges identical to that of the major component of human pituitary growth hormone. Therapeutically, it is used in children to treat growth retardation, for example short stature due to insufficient growth hormone secretion, Turner s syndrome or chronic renal insufficiency. In adults, it is used as a treatment for growth hormone deficiency and for İletişim (Correspondence) yilmazb@atauni.edu.tr

64 590 Determination and Pharmacokinetics... management of HIV-related wasting and cachexia 1. Several analytical methods for the quantitative and qualitative estimation of somatotropin have been described, such as sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) frequently combined with immunoblotting -4, capillary zone electrophoresis 5, size-exclusion 6, hydrophobic-interaction 7,8, reversed phase 9,10 highperformance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC-MS) 11 and enzymelinked immunosorbent assay (ELISA) 1,13. The pharmacokinetics and the quantitation of somatotropin has been described in sheep 1, rabbit 13 human plasma 14 and dog serum 15 by chemiluminescent immunometric assay, ELISA, RIA, immunoradiometric assay, respectively. But, pharmacokinetics of somatotropin has not been described in rabbits by spectrofluorometry in the literature. As we known, non-immune method for somatotropin detection had insufficient sensitivity compared with immune method because of the interferences from the sample matrix. However, the fluorescence spectroscopy 16 has excellent sensitivity in determining many fluorescence compounds (pharmaceutical, biomedical, etc.), including aromatic aminoacides that exhibit particularly intense fluorescence. Therefore, the aim of this work was to develop a method using a sensitive and specific spectrofluorometry method, and to validate the whole analytical method, according to international guidelines 17 in order to obtain an efficient tool for further pharmacokinetic studies in rabbit plasma. MATERIAL and METHODS Spectrofluorometry System All fluorescence measurements were done on a SHIMADZU RF-5301 PC spectrofluorometer equipped with a 150 W Xenon lamp. Experimental parameters were: slit width; 5.0 nm, l exc =75 nm, l em =330 nm. Chemicals and Reagents Somatotropin was provided by Eli Lilly & Co. (Indianapolis, USA). Humatrope (1.33 mg somatropin) was obtained from Department of Endocrinology and Metabolism, Faculty of Medicine, Ataturk University. Water was Milli-Q grade and all other chemicals and solvents used were of analytical grade. Buffer solution (potassium dihydrogen phosphate, KH PO 4 ) was prepared with deionised water. Preparation of Plasma Standards and Controls A standard stock solution containing somatotropin was prepared in 5 mm phosphate buffer solution. Phosphate buffer was prepared in double distilled filtered water and its ph was adjusted to 7.4±0.0 with sodium hydroxide solution. Final concentration of somatotropin is 100 μg/ ml. Standard calibration solutions were prepared by spiking drug-free rabbit plasma with stock standard solutions, which were then further diluted to achieve final concentrations of between μg/ml (0.15, 0.5,, 4, 6, 8 μg/ml) of somatotropin. Somatotropin plasma control samples were prepared from a separate stock solution at concentrations of, 5, 7 μg/ml. Extraction Procedure Rabbit plasma (0.5 ml) was placed in a 1 ml capacity glass tube. Standard solution (1 ml) was added into the plasma and the solution was thoroughly vortexed. Then,.5 ml acetic acid was added into the plasma and the solution was vortexed for min. The sample was centrifuged for 5 min at rpm. The supernatant was transferred into another glass tube and evaporated to dryness at 60 C under a stream of nitrogen. The dried residue was reconstituted in 4 ml of 5 mm buffer solution. All samples were filtered through a Phenomenex membrane of 0.45-μm pore size (5 mm filter). Animal Material The study was conducted in accordance with the Animal Ethical Guidelines for Investigations in Laboratory Animals and was approved by the Ethical Committee for Medical Experimental Research and Application Centre of Ataturk University (006/1). The rabbits are female which is.-.5 kg weight. Five rabbits were housed with free access to food and water, except for the final h before experiment. After placing the animals in a restraining box, cannulations of the auricular artery and vein in the opposite ears were done. This validated method was then applied to determination of somatotropin concentrations in five rabbits after intravenous administration of 0.1 mg/ kg of Humatrope. 1 ml volume of blood was obtained from the artery at time zero and at 5, 10, 15, 0, 30, 45 and 60 min after 0.1 mg/kg intravenous administration of somatotropin to rabbits. The blood was collected into EDTA tubes. The blood was immediately centrifuged 6000 g for 10 min at ambient temperature. The plasma was separated and analyzed for somatotropin concentrations as described above. RESULTS Linearity Fluorescence emission intensity was measured immediately at 330 nm exciting at 75 nm. The linearity of calibration graphs was demonstrated by the good determination coefficients (r ) obtained for the regression line (Fig. 1).

65 591 YILMAZ, KADIOGLU, MERAL CELEBİ, ONGANER samples at three different concentrations. All samples for these purposes were freshly prepared including preparing the standard solution from the same stock solution (100 μg/ml). Three replicates from each pool were assayed on each of days so that both intra- and inter-day precision and accuracy could be determined. The results for somatotropin in rabbit plasma are shown in Table 1. Precision and accuracy studies in plasma showed an acceptable the RSD values and the relative errors were <13.5% and high accuracy for both intra- and inter-day (n = 3) studies ( 1%). Limits of Quantitation and Detection Fig 1. Calibration curve for plasma somatotropin standards Şekil 1. Plazma somatotropin standartları kalibrasyon eğrisi The mean regression equation is y=8.9435x (0.9914). The regression equations were calculated from the calibration graphs, along with the standard deviations of the slope (S b ) and intercept (S a ) on the ordinate. S a, standard deviation of intercept of regression line is and S b, standard deviation of slope of regression line is Precision and Accuracy Precision and accuracy were determined on spiked rabbit plasma samples at six concentrations with respect to a calibration graph prepared every day. The precision of the method was evaluated as the intra- and inter-day RSD of the measured peak intensity by assaying spiked plasma The limit of quantitation (LOQ) is defined as the lowest plasma concentration in the calibration curve that could be measured routinely with acceptable precision and accuracy (RSD<0%). The limit of detection (LOD) is the lowest amount of analyte in a sample which can be detected but not necessarily quantitated as an exact value. The LOQ and LOD values for somatotropin in rabbit plasma were determined 0.10 μg/ml and μg/ml, respectively. Recovery The extraction recovery of somatotropin in rabbit plasma was determined by comparing with precision and accuracy studies. The one-step extraction procedure was fairly rapid. Acetic acid solvent was selected for our liquid-liquid extraction method. The solvent acetic acid gave good recovery and the absolute recoveries of somatotropin from plasma were between 84 and 11 % as shown in Table. Table 1. Intra-day and inter-day precision and accuracy of somatotropin in plasma (n=6) Tablo 1. Plazmada somatotropinin gün-içi ve günler-arası kesinlik ve doğruluğu (n=6) Added (μg/ml) Found (Mean±SD a ) Intra-day Precision %RSD Accuracy b Found (Mean±SD a ) Inter-day Precision %RSD Accuracy b Plasma c.03± ± ± ± ± ± SD a : Standard deviation of six replicate determinations, RSD: Relative standard deviation, Accuracy b : (% relative error) (found-added)/addedx100, c : Plasma volume (0.5 ml) Table. Recovery of somatotropin in plasma (n=3) Tablo. Plazmada somatotropinin geri kazanımı (n=3) Added (μg/ml) Found±SD Recovery Ratio a (%) Accuracy Relative Error (%) %RSD.4± ± ± a Mean values

66 59 Determination and Pharmacokinetics... Stability For the determination of the stability of somatotropin in plasma at room temperature, +4 o C and -0 o C refrigeration temperature, low (.0 μg/ml) and high (6.0 μg/ml) somatotropin concentrations were kept for 4 h and 3 days. Then the stability measurements were carried out. Plasma sample were found to be stable after 4 h with no significant change in concentration when stored at +4 and -0 o C. The results of these stability studies are given in Table 3. Application of the Method The new method had been successfully applied to the analysis of samples from a pharmacokinetic study consisting of five rabbits (Fig. ). In particular, the data obtained from rabbits were satisfactorily fitted to a linear one-compartment open model. Fig. 3 represents the mean plasma concentrationtime profile of five rabbits. Table 3. Stability of somatotropin in plasma (n=3) Tablo 3. Plazmada somatotropinin stabilitesi (n=3) Concentration (μg/ml) Room Temperature 4 h Room Temperature 7 h Refrigaratory +4 C, 4 h Refrigaratory +4 C, 7 h Frozen -0 C, 4 h Frozen -0 C, 7 h 109.6± ± ± ± ± ± ± ± ± ± ± ±8.76 Fig. Excitation and emission spectra of a plasma sample collected from rabbit after intravenous administration of 0.1 mg/kg of Humatrope (d) rabbit sample prior to infusion, (a) rabbit sample at 5 min postinfusion, (b) rabbit sample at 15 min postinfusion, (c) rabbit sample at 30 min postinfusion Şekil. Humatrope un 0.1 mg/kg intravenöz verilmesinden sonra tavşandan alınan plazma örneğinin uyarma ve yayılma spektrumları (d) infüzyondan önceki tavşan örneği, (a) infüzyondan 5 dakika sonraki tavşan örneği, (b) infüzyondan 15 dakika sonraki tavşan örneği, (d) infüzyondan 30 dakika sonraki tavşan örneği In the developed method, C max for somatotropin was 8.94 μg/ml. Somatotropin was well tolerated after a single intravenous infusion. Plasma somatotropin concentration was declined rapidly after 30 minutes somatotropin infusion. Somatotropin began to disappear from plasma after 1 h. The AUC 0 1 h and t 1/ were μg h/l and h, as different from that of previous report 13. The major pharmacokinetic parameters are reported in Table 4. DISCUSSION Fig 3. Mean plasma somatotropin concentration-time profile for five rabbits after a intravenous injection of 0.1 mg/kg somatotropin Şekil 3. Beş tavşan için 0.1 mg/kg somatropinin tek intravenöz verilmesinden sonra ortalama plazma somatotropin derişim-zaman profili For spectrofluorometry method, various solvent systems (water, methanol and phosphate buffer) were investigated. The final decision for using phosphate buffer as the solvent was based on sensitivity, suitability for drug content determination and stability studies. It has good precision and accuracy that this sensitive

67 593 YILMAZ, KADIOGLU, MERAL CELEBİ, ONGANER Table 4. Mean pharmacokinetic parameters of somatotropin for five rabbits after intravenous injection of 0.1 mg/kg somatotropin Tablo 4. Beş tavşan için 0.1 mg/kg somatotropin intravenöz verilmesinden sonra somatotropinin ortalama farmakokinetik parametreleri Parameter Mean SD % RSD C max (μg/ml) AUC 0-1 h (μg h/l) t 1/ (h) Cl (L/h) k el (h -1 ) V d (L) C max: Maximum concentration, AUC 0-1h: Area under the plasma concentration-time curve, t 1/: Half-life, Cl: Clearance, k el: Elimination constant, V d: Volume of distribution method has been studied in plasma. Plasma samples were extracted with acetic acid in a one-step liquid-liquid extraction. And only one-step extraction procedure was fairly rapid and advantage. In the developed method, 0.5 ml of plasma was used in the sample preparation. Pharmacokinetic parameters such as half-life (t 1/ ), apparent distribution volume (V d ), clearance (Cl) and area under the plasma concentration-time graph (AUC) were calculated by standard formulas 18. Somatotropin elimination after a single intravenous injection was regarded a first-order reaction kinetic following the equation C = C 0 e kt, where C represents somatotropin concentration in any time points, C 0 is the concentration when time (t) equals zero and elimination rate constant (k el ) is the firstorder rate constant expressed in units of concentration per hour. Kel and t 1/ were calculated from the slope of the linear regression line in the elimination phase of the semi-logarithmic plot of plasma concentration versus time as log C = log C 0 - k el t/.3. Results were expressed as V d, Cl, k el, t 1/ and AUC as they apply to one-compartment open linear model. t 1/ was calculated as 0.693/k el. The area under the plasma concentration-time curve AUC 0 1 h was calculated on the experimental values (trapezoidal rule) with extrapolation to infinity, obtained by the elimination rate constant. V d and Cl were calculated as D/C 0 and V d k el, respectively. In previous reports, chemiluminescent immunometric assay 1, ELISA 13, RIA 14 and immunoradiometric assay 15 methods were developed for the pharmacokinetics of somatotropin in sheep, rabbit, human plasma and dog serum, respectively. Pharmacokinetic application with intravenous somatotropin in dogs revealed that somatotropin followed a two-compartment open model with one distribution phase and one elimination phase. Elimination half-life in sheeps was h 15. In conclusion, we have developed a rapid, sensitive, precise and accurate spectrofluorometry method for determination of somatotropin in rabbits. To our knowledge, this is the first description of somatotropin pharmacokinetics in rabbit plasma by spectrofluorometry method in the literature. It can be very useful and an alternate to performing pharmacokinetic studies in determination of somatotropin for clinical use. REFERENCES 1. Cheng YH, Dyer AM, Jabbal-Gill I, Hinchcliffe M, Nankervis R, Smith A, Watts P: Intranasal delivery of recombinant human growth hormone (somatropin) in sheep using chitosan-based powder formulations. Eur J Pharm, 6, 9-15, Ikehara M, Ohtsuka E, Tokunaga T, Taniyame Y, Iwai S, Kitano K, Miyamoto S, Ohgi T, Sakuragawa Y, Fujiyama K, Ikari T, Kobayashi M, Miyake T, Shibahara S, Ono A, Ueda T, Tanaka T, Baba H, Mıkı T, Sakurai A, Oishi T, Chisaka O, Matsubara K: Synthesis of a gene for human growth hormone and its expression in Escherichia coli. Proc Natl Acad Sci USA, 81, , Chang CN, Key M, Bochner B, Heyneker H, Gray G: High-level secretion of human growth hormone by Escherichia coli. Gene, 55, , Becker GW, Hsiung HM: Expression, secretion and folding of human growth hormone in Escherichia coli. FEBS Lett, 04, , McNerney TM, Watson SK, Sim JH, Bridenbaugh RL: Separation of recombinant human growth hormone from Escherichia coli cell pellet extract by capillary zone electrophoresis. J Chromatogr, 744, 3-9, Riggin RM, Shaar CJ, Dorulla GK, Lefeber DS, Miner DJ: Highperformance size-exclusion chromatographic determination of the potency of biosynthetic human growth hormone products. J Chromatogr, 435, , Gellerfors P, Eketorp G, Fhölenhag K, Pavlu B, Johansson S, Fryklund L: Characterisation of a secreted form of recombinant derived human growth hormone, expressed in Escherichia coli cells. J Pharm Biomed Anal, 7, , Wu S, Hancock WS, Pavlu B, Gellerfors P: Application of high-performance hydrophobic-interaction chromatography to the characterization of recombinant DNA-derived human growth hormone. J Chromatogr, 500, , Riggin RM, Dorulla GK, Miner DJ: A reversed-phase high-performance liquid chromatographic method for characterization of biosynthetic human growth hormone. Anal Biochem, 167, , Teshima G, Canova-Davis E: Separation of oxidized human growth hormone variants by revesed-phase high-performance liquid chromatography. Effect of mobile phase ph and organic modifier. J Chromatogr, 65, 07-15, Hepner F, Cszasar E, Roitinger E, Lubec G: Mass spectrometrical analysis of recombinant human growth hormone (Genotropin ) reveals amino acid substitutions in % of the expressed protein. Proteome Science, 3, 1-1, Charman SA, Segrave AM, Edwards GA, Porter CJH: Systemic availability and lymphatic transport of human growth hormone administered by subcutaneous ınjection. J Pharm, 89, , Vermehren C, Hansen HS, Thomsen MK: Time dependent effects of two absorption enhancers on the nasal absorption of growth hormone in rabbits. Int J Pharm, 18, 39-50, Vahl N, Jensen SB, Rasmussen MH, Susgaard S, Jorgensen JOL, Christiansen JS, Rasmussen UF, Hilsted J: Bioavailability of recombinant human growth hormone in different concentrations and formulations. Pharmacol-Toxicol, 79, , Katakam M, Ravis WR, Golden DL, Banga AK: Controlled release of human growth hormone following subcutaneous administration in dogs. Int J Pharm, 15, 53-58, 1997.

68 594 Determination and Pharmacokinetics Mzoughi N, Dachraoui M, Villeneuve JP: Evaluation of aromatic hydrocarbons by spectrofluorometry in marine sediments and biological matrix: What reference should be considered. CR Chimie, 8, 97-10, FDA guideline for submitting samples and analytical data for method validations, Rockville, MD, USA, February Yilmaz B, Kadioglu Y: Determination of insulin in rabbit plasma using high-performance liquid chromatography. Kafkas Univ Vet Fak Derg, 18 (1): 31-36, 01.

69 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Comparison of Swarming Tendency and Defensive Behavior of Yığılca Local and Other Commonly Used Honeybee Genotypes in Turkey [1] Ayhan GÖSTERİT * Yakup ÇIKILI ** Meral KEKEÇOĞLU *** [1] This study was supported by grant TUBITAK TOVAG-110 O 43 from the Scientific and Technological Research Council of Turkey * Süleyman Demirel University, Faculty of Agriculture, Department of Animal Science, TR-360 Isparta - TURKEY ** Düzce University, Çilimli Vocational School, TR Düzce - TURKEY *** Düzce University, Faculty of Science, Department of Biology, TR-8160 Düzce - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, swarming tendency and defensive behavior of Yığılca local honeybee were determined and compared with other commonly used honeybee genotypes in Turkey. Colonies were headed by naturally mated queens and 10 colonies of Yığılca local honeybee, 1 colonies of of Apis mellifera caucasica cross and 1 colonies of of Apis mellifera anatoliaca cross were used in the experiment. In swarming season, Yığılca honeybee colonies constructed more queen cells (49.86±18.00) than both A.m. anatoliaca cross (13.00±7.00) and A.m. caucasica (8.00±1.15) cross colonies. Similarly, according to results of sting test, the highest number of stings was determined in Yığılca honeybee colonies (18.38±4.4), followed by A.m. anatoliaca (5.50±.15) and A.m. caucasica (3.75±0.6) crosses. Results showed that Yığılca local honeybee genotype has a more swarming tendency and is more defensive than A.m. anatoliaca and A.m. caucasica crosses. Keywords: Yığılca honeybee, Swarming, Defensive behavior, Genetic conservation Özet Yığılca Yerel Bal Arısının Oğul Verme Eğilimi ve Savunma Davranışı Bakımından Türkiye de Yaygın Olarak Kullanılan Diğer Genotipler ile Karşılaştırılması Bu çalışmada, Yığılca yerel bal arısının oğul verme eğilimi ve savunma davranışının belirlenmesi ve Türkiye de yaygın olarak kullanılan diğer bal arısı genotipleri ile karşılaştırılması amaçlanmıştır. Araştırmada, doğal çiftleşmiş ana arılar ile oluşturulan Yığılca bal arısı genotipinden 10 koloni, Anadolu ve Kafkas ırkı melezlerinden ise 1 şer koloni olmak üzere toplam 34 adet bal arısı kolonisi kullanılmıştır. Oğul verme mevsimi süresince Yığılca bal arısı kolonilerinin (49.86±18.00) hem Anadolu ırkı melezi kolonilerinden (13.00±7.00) hem de Kafkas ırkı melezi kolonilerinden (8.00±1.15) daha fazla ana arı yüksüğü yaptıkları belirlenmiştir. Benzer şekilde sokma testi sonuçlarına göre, en yüksek iğne sayısı Yığılca bal arısı kolonilerinde (18.38±4.4) belirlenirken, bu grubu Anadolu ırkı melezi (5.50±.15) ve Kafkas ırkı melezi (3.75±0.6) koloniler takip etmiştir. Araştırma sonuçları Yığılca yerel bal arısı genotipinin Anadolu ve Kafkas ırkı melezlerine göre daha fazla oğul verme eğilimi gösterdiği ve daha hırçın olduğunu ortaya koymuştur. Anahtar sözcükler: Yığılca bal arısı, Oğul, Savunma davranışı, Genetik koruma INTRODUCTION The honeybee (Apis mellifera L.), the most economically important beneficial insect, has proven to be highly adaptive to a wide variety of ecosystems in its native range of Africa, Europe, and Central and Western Asia. Across this range, numerous subspecies and ecotypes of A. mellifera have been described based upon behavior, morphology and molecular evidence. While some subspecies inhabit large geographic areas, some subspecies and all ecotypes İletişim (Correspondence) ayhangosterit@sdu.edu.tr

70 596 Comparison of Swarming... inhabit relatively small geographic areas with smaller population size 1-5. Specific behavioral and phenological adaptations to local environment conditions are known for some honeybee populations 1,6,7. The survival of these locally adapted populations or ecotypes results from a number of traits conferred selective advantage to the population within an ecologically distinct area 8. Each honeybee genotypes that genetically different have their own peculiar behavior traits. Within the endemic range of the honeybee, the variation between the behavioral traits, such as swarming and defensive, provides the basis for subspecific classification 9,10. Several honeybee races and native ecotypes have been adapted to different ecological regions of Turkey. They have some differences in their morphology, behavior and physiology according to the environmental conditions. Based on multivariate analysis of morphometric data, Ruttner 1 suggested that three subspecies exist in Turkey: A.m. caucasica in the northeast, A.m. meda in the southeast and A.m. anatoliaca throughout the rest of the country including Thrace (European part of Turkey). Also some researches studied the honeybee populations using different approach and reported that there are another A. mellifera subspecies in Turkey: A.m. carnica in Thrace and A.m. syriaca in the southeast A.m. anatoliaca and A.m. caucasica are used intensively for commercial queen bee rearing in Turkey. For this reason, it is presumed that these two honeybee genotypes and their crosses constitute the majority of honeybee population in the country. Gentle and productive A.m. caucasica also has been used in beekeeping in many places around the world especially in higher elevations 15,16. The Anatolian honeybees, A.m. anatoliaca, have many ecotypes and local populations that differ from each other morphologically, physiologically and behaviorally 17. One of the local populations inhabits in Yığılca, a small geographic area in Western Black Sea Region in Turkey. Morphometric and genetic studies reported that Yığılca local honeybee population differed from other populations of A.m. anatoliaca Despite the wide spread efforts for genetic conservation of this population and great demand for queen and colony from beekeepers, there is no data about its behavioral, colony development and production characteristics. Therefore, the aim of the present study was to determine the swarming tendency and defensive behavior of Yığılca honeybee and compare with A.m. caucasica and A.m. anatoliaca crosses which are the most common genotypes in honeybee population of Turkey. MATERIAL and METHODS The experiment was carried out in Düzce, Turkey. Thirty four colonies headed by naturally mated queens were used in the experiment; 10 colonies of Yığılca local honeybee, 1 colonies of A.m. caucasica and 1 colonies of A.m. anatoliaca. Queens of A.m. caucasica and A.m. anatoliaca were reared in apiaries where queens are reared commercially at Central Anatolia Region. Yığılca honeybee queens were reared from original breeder colonies of this genotype in Yığılca (Düzce), according to Laidlaw 1. In all groups, queens were reared from different breeder colonies selected by randomly for representation of the population. Each mated queen was introduced into 6-frame colonies. These colonies were managed the same way for a period of 60 days prior to the beginning of the experiments to allow time for workers in the colony to be replaced by daughters of the new queens. The experimental colonies were equalized with regard to adult bee, brood and food stocks. They were kept in Langstroth hives in the same apiary and evaluated for swarming tendency and defensive behavior for a reproduction season. In swarming season from April to July, all colonies in the genotype groups were controlled every week under normal colony management conditions. During the observation period, the numbers of colony had a swarming tendency and the numbers of queen cell in these colonies were recorded to assay the swarming tendency of genotypes. All sealed and unsealed queen cells were counted and destroyed in queenright colonies 6. To quantify defensive behavior, black coloured suede target attached to the end of a one meter stick was waved for one minute by hand in a rhythmic way approximately 10 cm from the entrance of the hive to stimulate the defensive response of colonies. The numbers of the stings in the target were recorded in order to measure the defensive trait of each colony. This process was repeated 8 times at different dates and two colonies which were equal with regard to worker population from each genotype were tested simultaneously in each repetition 6,3. For statistical analysis, SPSS statistical program was used. Chi-square test was performed to analyze the data of swarming tendency. Swarming tendency of genotype groups was also compared by t-test. Defensive behavior trait data of the three genotype groups were analyzed by ANOVA and the means were compared using the Duncan multiple comparison test. RESULTS The swarming tendency and the number of queen cells constructed in groups were given in Table 1. Results of χ analyses showed that there was significant difference in the swarming tendency between the genotype groups. According to the results, Yığılca local honeybee colonies constructed more queen cells than other genotypes (P<0.05). In swarming season from April to July, of 11 colonies (18.18%) in Anatolian group, 3 of 10 colonies (30.00%) in Caucasican group and 7 of 9 colonies (77.77%) in Yığılca group constructed queen cells known as swarm marker. According to results of sting test, defensive behavior of genotypes (the numbers of sting) were significantly

71 597 GÖSTERİT, ÇIKILI, KEKEÇOĞLU Table 1. Swarming tendency and number of queen cells in genotype groups (n = number of colonies had a swarming tendency) Tablo 1. Genotip gruplarında oğul verme eğilimi ve ana arı yüksük sayıları (n= oğul verme eğilimi gösteren koloni sayısı) Number of Queen Cells Swarming Genoypes n X±Sx Min Max Tendency (%) A.m. anatoliaca 13.00± b A.m. caucasica ± b Yığılca Local Honeybee ± a Means followed by different letters (a,b) in the same column are different (P<0.05) Table. Number of stings (results of sting test) in genotype groups (n = number of colonies) Tablo. Genotip gruplarında belirlenen iğne sayıları (n = koloni sayısı) Genotypes n X±Sx Min Max A.m. anatoliaca ±.15b 1 18 A.m. caucasica ±0.6b 6 Yığılca Local Honeybee ±4.4a 6 40 Means followed by different letters (a,b) in the same column are different (P<0.01) different eachother (P<0.01). In the present study, A.m. caucasica was the gentlest genotype and Yığılca local honeybee was the most defensive genotype. Although Yığılca local honeybee was significantly different from A.m. caucasica and A.m. anatoliaca in terms of defensive behavior, there was no significant difference between the A.m. caucasica and A.m. anatoliaca (Table ). DISCUSSION The honeybee population show a great genetic variation and this variation provide some advantages to improve the honeybee culture in Turkey 4. Several honeybee subspecies and ecotypes have been adapted to different ecological regions 1,1,14,17. A.m. anatoliaca and A.m. caucasica subspecies, and their reciprocal crosses constitute the majority of honeybee population in the country. There are several local populations of the A.m. anatoliaca, such as Muğla bees, Yığılca bees and Giresun bees. However, these local genotypes were not isolated in their geographical range, less well defined and need further investigation 5. The survival of local or native honeybee populations results from a number of traits commonly perceived as adaptive, many of which are related to reproductive swarming and defensive behavior 6,10,5. This present study clearly showed that Yığılca genotype is more inclined to swarm and is more defensive than A.m. anatoliaca and A.m. caucasica crosses. Yığılca honeybee colonies constructed more queen cells (49.86±18.00) than both A.m. anatoliaca (13.00±7.00) and A.m. caucasica (8.00±1.15) crosses. Genç et al. 6 reported that Erzurum honeybee genotype had more defensive behavior but had not more swarming tendency than A.m. anatoliaca and A.m. caucasica. Similarly, Yücel and Kösoğlu 5 found that Muğla ecotype showed better performance for adaptation to environmental conditions and had more defensive behavior than Italian cross. The variation in swarming tendency and defensive behavior can be used for classification of honeybee population 9,10. Morphometric and genetic studies also suggested that endemic honeybee in Yığılca provience of Düzce distinct from the other population and the conservation of this genotype in its native range may be worthwhile The importation of foreign queens and the practice of moving hives several times in a year are factors that can affect the genetic structure of a local honeybee population through genetic introgression 6. It is known that the migratory beekeeping is practiced extensively in Turkey. However, local beekeepers claimed that neither foreign honeybee colonies nor queens were introduced into Yığılca location and colonies have been managed traditionally. Therefore, it should be considered that endemic honeybee population may exist in Yığılca location. In many countries of Europe, there is a kind of certification for local honeybee populations and official conservation programme have been managed 5. Although conservation of Yığılca local honeybee is also proposed, its adaptive characteristics have not been studied making it difficult to rapidly implement conservation efforts. Identify the other characteristics of this local genotype in both their native location and other region, for this reason, need to be examined in future studies. Acknowledgements This study was supported by grant TUBITAK TOVAG- 110O43 from the Scientific and Technological Research Council of Turkey (Project coordinator: Dr. Ayhan GÖSTERİT). REFERENCES 1. Ruttner F: Biogeography and taxonomy of honeybees. Springer-Verlag, Berlin, 1988.

72 598 Comparison of Swarming.... Sheppard WS, Arias MC, Grech A, Meixner MD: Apis mellifera ruttneri, a new honey bee subspecies from Malta. Apidologie, 8, 87-93, Sheppard WS, Meixner MD: Apis mellifera pomonella, a new honey bee subspecies from Central Asia. Apidologie, 34, , Strange JP, Garnery L, Sheppard WS: Morphological and molecular characterization of the Landes honey bee (Apis mellifera L.) ecotype for genetic conservation. J Insect Conserv, 1, , Bouga M, Alaux C, Bienkowska M, Büchler R, Carreck NL, Cauia E, Chlebo R, Dahle B, Dall Olio R, De la Rua P, Gregorc A, Ivanova E, Kence A, Kence M, Kezic N, Kiprijanovska H, Kozmus P, Kryger P, Le Conte Y, Lodesani M, Murilhas AM, Siceanu A, Soland G, Uzunov A, Wilde J: A review of methods for discrimination of honey bee populations as applied to european beekeeping. J Apicult Res, 50 (1): 51-84, Genç F, Dülger C, Kutluca S, Dodoloğlu A: Comparison of some behavioural characteristics of Caucasian, Central Anatolian and Erzurum honeybee (Apis mellifera L.) genotypes in the conditions of Erzurum. Turk J Vet Anim Sci, 3, , Andere C, Palacio MA, Rodriguez EM, Figini E, Dominguez MT, Bedascarrasbure E: Evaluation of the defensive behavior of two honeybee ecotypes using a laboratory test. Genet Mol Biol, 5 (1): 57-60, Strange JP, Garnery L, Sheppard WS: Persistence of the Landes ecotype of Apis mellifera mellifera in southwest France: Confirmation of a locally adaptive annual brood cycle trait. Apidologie, 38, 59-67, Guzman-Novoa E, Hunt GJ, Uribe-Rubio JL, Prieto-Merlos D: Genotypic effects of honey bee (Apis mellifera) defensive behavior at the individual and colony levels: the relationship of guarding, pursuing and stinging. Apidologie, 35, 15-4, Villa JD: Swarming behavior of honey bees (Hymenoptera: Apidae) in Southeastern Louisiana. Ann Entomol Soc Am, 97 (1): , Kandemir I, Kence A, Allozyme variability in a Central Anatolian honeybee (Apis mellifera L.) population. Apidologie, 6, , Smith DR, Slaymaker A, Palmer M, Kaftanoglu O: Turkish honey bees belong to the east Mediterranean mitochondrial lineage. Apidologie, 8, 69-74, Kandemir I, Kence M, Kence A: Genetic and morphometric variation in honeybee (Apis mellifera L.) populations of Turkey. Apidologie, 31, , Palmer MN, Smith DR, Kaftanoglu O: Turkish honeybees: Genetic variation and evidence for a fourth lineage of Apis mellifera mtdna. J Hered, 91, 4-46, Adl MBF, Gençer HV, Firatli Ç, Bahreini R: Morphometric characterization of Iranian (Apis mellifera meda), Central Anatolian (Apis mellifera anatoliaca) and Caucasian (Apis mellifera caucasica) honey bee populations. J Apicult Res Bee World, 46 (4): 5-31, Güler A: A morphometrics model for determining the effect of commercial queen bee usage on the native honeybee (Apis mellifera L.) population in Turkish province. Apidologie, 41, 6-635, Güler A, Kaftanoğlu O: Türkiye deki önemli balarısı (Apis mellifera L.) ırk ve ekotiplerinin morfolojik özellikleri-i. Turk J Vet Anim Sci, 3, , Kekeçoğlu M: Honey bee biodiversity in Western Black Sea and evidence for a new honey bee ecotype in Yığılca province. Res J Biol Sci, (1): 73-78, Kekeçoğlu M, Soysal Mİ: Genetic diversity of bee ecotypes in turkey and evidence for geographical differences. Rom Biotech Lett, 15 (5): , Güler A, Bıyık S, Güler M: Morphological characteristics of the honey bee (Apis mellifera) population of the Western Black Sea Region. 7th National Animal Science Congress, Sep 14-16, Adana, Turkey, Laidlaw HH: Contemporary queen rearing. A Dadant Publication, Dadant and Sons, Hamilton, Illinois, U.S.A., Arechavaleta-Velasco ME, Hunt GJ: Genotypic variation in the expression of guarding behavior and the role of guards in the defensive response of honey bee colonies. Apidologie, , Guzman-Novoa E, Page RE: Selective breeding of honeybees (Hymenoptera: Apidae) in Africanized areas. J Econ Entomol, 9, 51-55, Akyol E, Şahinler N, Özkök D: Honeybee (Apis mellifera) races, ecotypes and their general characteristics in Turkey. J Anim Vet Adv, 5 (9): , Yücel B, Kösoğlu M: Comparisons of Mugla ecotype and Italian cross honey bees for some performances in Aegean Region (Turkey). Kafkas Univ Vet Fak Derg, 17 (6): , Garnery L, Franck P, Baudry E, Vautrin D, Cornuet JM, Solignac M: Genetic diversity of the west European honey bee (Apis mellifera mellifera and Apis m. iberica), II Microsatellite loci. Genet Sel Evol, 30, 49-74, 1998.

73 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE İstanbul da Çalışan Veteriner Hekimlerin İş Doyumu ve Tükenmişlik Düzeyleri Ülken T. BABAOĞLU * Sibel CEVİZCİ ** Murat ARSLAN *** * Ahi Evran Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR Kırşehir - TÜRKİYE ** Çanakkale Onsekiz Mart Üniversitesi, Tıp Fakültesi, Halk Sağlığı Anabilim Dalı, TR Çanakkale - TÜRKİYE *** İstanbul Üniversitesi, Veteriner Fakültesi, Fizyoloji Anabilim Dalı, TR İstanbul - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Günümüzde iş sağlığını olumsuz yönde etkileyen düşük iş doyumu ve yüksek tükenmişlik düzeyleri, farklı mesleklerden çok sayıda çalışanı tehdit etmektedir. Bu çalışmada İstanbul da çalışan veteriner hekimlerin iş doyumu ve tükenmişlik düzeylerini ve bununla ilişkili faktörleri belirlemek amaçlandı. Kesitsel tipteki bu çalışmaya 145 kişi katıldı. Verilerin toplanmasında web tabanlı anket formu kullanıldı. Anket formunun ilk bölümünde sosyo-demografik özellikleri inceleyen sorular, ikinci bölümünde Minnesota iş doyumu ile Maslach tükenmişlik düzeyini ölçen sorular yer aldı. Elde edilen verilerin istatistiksel analizinde bağımsız gruplar arasında t testi, Tukey testi ve tek yönlü varyans analizi uygulandı. Katılımcıların yaş ortalaması 36.8 idi (min:4-maks:57). Katılımcıların %73.8 i (n:107) erkek, %73.1 i (n:106) evli, %57. sinin (n:83) çocuğu vardı. Cinsiyet ve mesleğini kendi isteği ile seçenler ile iş doyumu ve tükenmişlik puanları arasında anlamlı bir ilişki saptanmadı. Düşük iş doyumu ve tükenmişlik gözlenen bireylerde, medeni durum, yaş grubu, şimdi olsa yine aynı mesleği seçerim ve şu anda çalıştığım yerden ayrılmayı düşünüyorum ifadeleri ile ölçek puanları arasında istatistiksel anlamlı bir fark vardı. Çalışma grubunda veteriner hekimler arasında iş doyumu orta düzeyde, tükenmişlik ise alt düzeyde saptandı. İşe bağlı risk faktörlerinin de inceleneceği çalışmaların aydınlatıcı olacağı düşüncesindeyiz. Anahtar sözcükler: İş doyumu, İş sağlığı, Tükenmişlik, Veteriner hekim Summary Job Satisfaction and Burnout Level of Veterinarian Working at Istanbul Low job satisfaction and high levels of job burnout which is a threat to occupational health is affecting a large number of professions. In the present study, it was aimed to identify factors associated with job satisfaction and burnout levels. 145 people participated in this cross-sectional study. Data was obtained using a web based questionnaire including questions about socio-demographic variables, Minnesota satisfaction questionnaire and the Maslach burnout inventory. The mean age of the participants was 36.8 (min: 4 - max: 57). 73.8% (n=107) were male, 73.1% (n=106) were married and 57.% (n=83) had children. Choosing the profession with his own request and gender showed no relation with job satisfaction and burnout. Marital status and age group significantly contributed to the answers of the survey questions: I would choose the same profession again if I had another chance and I think to resign from my current workplace in terms of job satisfaction and burnout. In the present study, moderate levels of job satisfaction and lower levels of burnout among veterinarians was found. We believe that further studies evaluating work-related risk factors can be useful. Keywords: Occupational health, Job satisfaction, Burnout, Veterinarian GİRİŞ Son yıllarda, davranış bilimcilerin üzerinde en çok durduğu davranışsal konulardan birisi iş doyumudur. İlk kez 190 lerde sözü edilmeye başlanan iş doyumu, işyerindeki topluluk etkinliklerini, isteklendirme ve verimliliği olumlu ya da olumsuz yönde etkileyen bir kavramdır 1,. İş doyumunun varlığı, bir işletmenin başarısı ile sonuçlanacak karlılık ve pazar payı kadar önemlidir 3. Bugüne kadar yapılan çalışmaların çoğunda, çalışanların iş doyumu ile İletişim (Correspondence) ulkentunga@yahoo.com

74 600 İstanbul da Çalışan Veteriner... ruhsal ve fiziksel sağlıkları arasında yakın bir ilişki saptanmıştır 4,5. İş doyumunu olumlu veya olumsuz olarak etkileyen farklı etmenler bireylere göre değişmektedir 6. Bu faktörlerden başlıcaları, ücret, yükselme olanakları, iş arkadaşları, işin kendisi, gelişme olanakları, alt-üst ilişkisi, kararlara katılma, çalışma ortamı ve olanakları gibi etmenlerdir 7,8. İş doyumsuzluğunun sonuçları hem bireyi hem de kurumu fiziksel, sosyal ve ruhsal yönden etkilemektedir. İş doyumu düşük olan bireylerin çalıştıkları işyerlerinde sergiledikleri başlıca tepkiler, işe gelmeme, geç gelme oranlarının artması, yavaş çalışma, sık sık iş değiştirme, erken emeklilik, disiplinsizlik gibi sonuçlara yol açabilmektedir 6. Freudenberger tarafından 1974 yılında tanımlanan tükenmişlik kavramı, başarısızlık, yıpranma, enerji ve güç kaybı veya insanın iş kaynakları üzerinde, karşılanamayan istekler sonucunda ortaya çıkan tükenme durumu olarak tanımlanmıştır 9. Daha sonra Maslach ve Jackson tükenmişliği; insanda ortaya çıkan fiziksel bitkinlik, uzun süren yorgunluk, çaresizlik ve umutsuzluk duyguları, yaptığı işe, hayata ve diğer insanlara karşı gösterdiği olumsuz tutumları kapsayan fiziksel ve psikolojik boyutlu bir sendrom olarak tanımlamışlardır 10. Günümüzde tükenmişlik düzeyi ile ilgili araştırmalarda en çok Maslach Tükenmişlik Ölçeği (MTÖ) kullanılmaktadır. Maslach, tükenmişliği üç alt boyutta incelemektedir. Maslach Tükenmişlik Ölçeği (MTÖ), Duygusal Tükenme (DT), Duyarsızlaşma (D) ve Kişisel Başarı Noksanlığı (KBN) olmak üzere üç alt bölümden oluşmaktadır. DT, kişinin mesleği ya da işi tarafından tüketilmiş ve aşırı yüklenilmiş olma duyguları, D bölümü kişinin hizmet verdiklerine karşı duygudan yoksun bir şekildeki davranışlarını içerir. KBN bölümü ise işteki yeterlilik ve başarı duygularını tanımlamaktadır 11,1. Gelişmiş ülkelerde yapılan çalışmalar tükenmişlik sendromunun yaygın olarak görüldüğünü ortaya koymaktadır Literatürde tükenmişliğin en önemli nedeninin stres olduğu vurgulanmaktadır. Ayrıca işe yeni başlayan bireylerin, ilk heyecanlarını çabuk tüketmeleri, hızlı ilerleme ve büyük başarılar yakalayacaklarına inanmaları nedeniyle fazla enerji harcayarak çabuk tükendikleri gösterilmiştir. Diğer yaygın tükenmişlik nedenlerini sosyo-demografik özellikler, çalışma şartları, iş yükünün ağırlığı, kişilik yapısı gibi değişkenler oluşturmaktadır 13,15. İş doyumu ve tükenmişlik arasındaki hassas dengenin bozulması, iş stresini de artırarak çalışanların fiziksel, ruhsal ve sosyal sağlık durumlarını olumsuz etkilemekte, sağlık hizmetlerinin de kalitesini düşürmektedir. Bu nedenle, sağlık hizmetleri sunumunda, çalışanların düzenli olarak iş doyumu, tükenmişlik ve iş stresi düzeylerinin ölçülmesi, risk faktörlerinin tanımlanması, birey ve toplum sağlığının korunması açısından önemlidir Veteriner Hekimlikte İş Doyumu ve Tükenmişlik Düzeyi Tükenmişlik sendromunun, günümüzde özellikle sağlık çalışanları arasında büyük bir sorun olduğu bilinmektedir. Ülkemizde doktorlar 0, hemşireler 7, ebeler 7 ve diğer sağlık sektörü çalışanlarının 6 iş doyumu ve tükenmişlik düzeyi üzerine yapılan çeşitli çalışma mevcut olmasına rağmen bu konuda veteriner hekimler 1 üzerine yapılmış çalışma sayısı yok denecek kadar azdır. Türkiye de veteriner hekimlerin kronikleşmiş birçok sorunu bulunmaktadır. Bu sorunların en önemlileri arasında serbest veteriner hekimlerin meslek etiğine ve deontolojisine aykırı uygulamalarda bulunması, asgari ücret tarifesine sadık kalmamaları, mezuniyet sonrası zorunlu stajın olmaması, mesleki yayın organlarının takip düzeyinin düşük olması ve meslek içi eğitim programlarının yeterli düzeyde olmaması sayılabilir. Bunlara ek olarak; fakülte sayısı ve kontenjanların fazla olması nedeniyle eğitim ve öğretim kalitesinin düşmesi de hem istihdam sorunlarının baş göstermesine hem de veteriner hekimlerin mesleklerine olan saygılarının azalmasına neden olmaktadır -4. Literatür incelemesinde iş doyumu ve tükenmişlik düzeyleri üzerine yurtdışında veteriner hekimlerle yapılan çalışmalar 16,5,6 olmasına rağmen ülkemizde bu konudaki çalışmaların az olduğu gözlenmiştir 1. Bu araştırmanın temel amacı, İstanbul da çalışan veteriner hekimlerin iş doyumu ve tükenmişlik düzeylerinin incelenmesidir. Ayrıca çalışma grubunda yer alan bireylerin iş doyumu ve tükenmişlik düzeyleri ile sosyo-demografik ve işe bağlı faktörler (günlük çalışma süresi, haftalık çalışma süresi, mesleki çalışma süresi, yıllık izin süresi) arasındaki ilişki de araştırılmıştır. MATERYAL ve METOT Bu çalışmada konuyla ilgili literatürlere uygun olarak hazırlanan web-tabanlı anket, tarihleri arasında e-posta ile İstanbul Veteriner Hekimler Odası (İVHO) üyelerine gönderilmiştir. Anket içeriği iki ayrı bölümden oluşmaktadır. İlk bölüm sosyo-demografik ve işe bağlı faktörleri sorgulayan 8 madde içermektedir. İkinci bölümde tükenmişlik düzeyini ölçmek için maddeden oluşan Maslach Tükenmişlik Ölçeği (MTÖ) ve iş doyumunu ölçmek için 0 maddeden oluşan Minnesota İş Doyumu Ölçeği (MİDÖ) uygulanmıştır. MTÖ geçerlilik ve güvenirlilik çalışması Hacettepe Üniversitesi nden Canan Ergin 11 tarafından yapılmıştır. MTÖ, Duygusal Tükenme (DT), Duyarsızlaşma (D) ve Kişisel Başarı Noksanlığı (KBN) olmak üzere üç alt bölümden oluşan maddelik kendini değerlendirme ölçeğidir. DT alt bölümünde dokuz madde (Madde no: 1,,3,6, 13,14,16,0), D alt bölümünde beş madde (Madde no: 5,10,11,15,) ve KB alt bölümünde sekiz madde (Madde no: 4,7,1,17,18,19,1) yer almaktadır. Seçenekler beş dereceli (Hiçbir zaman, çok nadir, bazen, çoğu zaman, her zaman) Likert tipi sorulardan oluşmaktadır. MTÖ nin DT

75 601 BABAOĞLU, CEVİZCİ ARSLAN ve D alt bölümlerine ait sorular olumsuz, KBN alt bölümüne ait sorular ise olumlu yöndedir. Bu nedenle, DT ve D puanlarının yüksek, KBN puanının düşük olması tükenmişliği göstermektedir. MİDÖ geçerlilik ve güvenirlilik çalışması 1985 yılında Baycan tarafından yapılmıştır 7. MİDÖ, 1-5 arasında puanlanan beşli Likert tipi bir ölçektir. Her sorunun cevabı için Hiç memnun değilim 1 puan, memnun değilim puan, kararsızım 3 puan, memnunum 4 puan, çok memnunum 5 puan olarak değerlendirilir. Tüm puan ortalamaları 1,0 ile 5,0 arasında bir değer olarak hesaplanmaktadır. Yüzdelik değer olarak; %5 ve altı düşük iş doyumunu, %6-74 arası orta iş doyumunu, %75 ve üzeri ise yüksek iş doyumunu ifade etmektedir 0,9,30. Elde edilen veriler SPSS 15.0 programı ile değerlendirilmiştir. Normal dağılıma uyumlu görüldüğünden dolayı kişilerin MİDÖ ve MTÖ ye göre aldıkları DT, D ve KBN puanlarının çeşitli değişkenlerle karşılaştırılmasında bağımsız gruplarda t testi, Tukey testi ve ANOVA kullanılmıştır. BULGULAR Anket 145 veteriner hekim tarafından yanıtlanmıştır. Katılımcıların yaş ortalaması 36.8 dir (min: 4 - maks: 57). Katılımcıların %73.8 i (n=107) erkek, %73.1 i (n=106) evli, %57. sinin (n=83) çocuğu bulunmaktadır. Araştırmada yer alanların bazı sosyo-demografik özellikleri Tablo 1 de gösterilmiştir. Anketi yanıtlayanların çalışma alanları şöyleydi: Pet hayvanları %31.7 (n=46), karışık (pet hayvanları ve büyük- Tablo 1. Araştırmaya katılan veteriner hekimlerin bazı sosyodemografik özelliklerine göre dağılımları Table 1. Some social-demographic characteristics of the participating veterinarians Cinsiyet Sayı (n) Oran (%) Erkek Kadın Toplam Medeni Durum Bekar Evli Dul/Boşanmış Toplam Eşiniz Çalışıyor mu? Evet Hayır Toplam Çocuk Durumu Evet Hayır Toplam baş) %8.3 (n=41), büyük baş %13.8 (n=0), gıda %13.1 (n=19), ilaç sektörü %4.1 (n=6), akademisyen %4.1 (n=6), kanatlılar, yem ve mama toplam %.1 (n=3). Katılımcıların çalıştığı kurumlar: veteriner kliniği/hayvan hastanesi %40 (n=58), özel şirket %1.4 (n=31), Tarım Bakanlığı %18.6 (n=7), üniversite %1.4 (n=18), belediye %6. (n=9), mezbaha %0.7 (n=1), ordu %0.7 (n=1) idi. Katılımcıların %37.9 unun (n=55) kendi işyerine sahip olduğu belirlenmiştir (Tablo ). Katılımcılar günde ortalama 10. saat, haftanın da 5.8 günü çalışmaktaydı. Mesleki çalışma süresinin ortalama 1.0 (min: 1 - maks: 3) yıl olduğu görülmüştür. Katılanların kullandığı yıllık izin süresi ortalama 11.11±6.98 gün olarak tespit edilmiştir (Tablo 3). Tablo. Araştırmaya katılan veteriner hekimlerin çalışma alanları ve kurumlarının dağılımı Table. Some of the occupational characteristics of the participating veterinarians Çalışma Alanı Sayı (n) Oran (%) Pet Hayvanları Karışık Büyük Baş Gıda İlaç Sektörü Akademisyen Kanatlılar 1.4 Yem ve Mama Yanıtlamayan 4.8 Toplam Çalıştığı Kurumları Veteriner Kliniği/Hayvan Hastanesi Özel Şirket Tarım Bakanlığı Üniversite Belediye 9 6. Mezbaha Ordu Toplam Kendi İşyerinde Çalışanlar Evet Hayır Toplam Çalışma Süresi 5 yıl ve Altı Yıl Yıl Yıl Yıl Üstü Toplam

76 60 İstanbul da Çalışan Veteriner... Ankete yanıt verenlerin %73.1 i (n=106) mesleklerini kendi istekleriyle seçtiklerini, %53.8 i (n=78) şimdi olsa yeniden aynı mesleği seçeceklerini, %37. si (n=54) çocuklarının veteriner hekim olmasını istediklerini ve %33.1 i (n=48) de kurumlarındaki işlerinden ayrılmayı düşündüklerini belirtmiştir (Tablo 4). Veteriner hekimlerin iş doyumu puan ortalaması 65.9, duygusal tükenme puan ortalaması 14., duyarsızlaşma puan ortalaması 5.7, kişisel başarı noksanlığı puan ortalaması 0.0 olarak hesaplanmıştır. Tablo 3. Araştırmaya katılan veteriner hekimlerin çalışma durumları ile ilgili bazı özellikleri Table 3. Some of the occupational requirements of the participating veterinarians Bağımsız Değişkenler (n) Ort±SS Günde Kaç Saat Çalışıyorsunuz? (145) 10.6±3.00 Haftada Kaç Gün Çalışıyorsunuz? (145) 5.81±0.75 Mesleki Çalışma Yılı (145) 1.01±7.9 Yıllık İzin Günü (14) 11.11±6.98 Tablo 4. Araştırmaya katılanların meslekleriyle ilgili bazı düşüncelerine göre dağılımları Table 4. Distribution of the participants based on some thoughts about their profession Değişkenler Sayı (n) Yüzde (%) Mesleğinizi Kendi İsteğinizle Mi Seçtiniz? Evet Hayır Toplam Şimdi Olsa Yeniden Seçer Miydiniz? Evet Hayır Yanıtlamayan Toplam Çocuğunuzun Veteriner Hekim Olmasını İster Misiniz? Evet Hayır Yanıtlamayan 3.1 Toplam Şu An Çalıştığınız Yerden Ayrılmayı Düşünüyor Musunuz? Evet Hayır Yanıtlamayan 1.4 Toplam Cinsiyetler arasında her dört ölçek puanları açısından istatistiksel olarak anlamlı bir fark saptanmazken bekâr olanların D puanları diğer gruplara göre daha yüksek olarak hesaplanmıştır. Yaş gruplarına göre 51 yaş ve üstü D puanları diğer yaş gruplarına göre daha düşük olarak bulunmuştur. Veteriner hekimlerin toplam mesleki çalışma süreleri ile ölçek puanları arasında anlamlı bir ilişki saptanmamıştır (Tablo 5). Veteriner hekimlerin meslekleriyle ilgili çeşitli düşünceleriyle alt ölçeklerden aldıkları puan ortalamaları karşılaştırılmıştır. Mesleği kendi isteği ile seçme durumuna göre puan ortalamaları karşılaştırıldığında, İş doyumu, DT, D ve KBN puanları açısından istatistiksel olarak önemli bir fark görülememiştir. Şimdi olsa aynı mesleği seçerim şıkkını seçen katılımcıların İD puanları daha yüksek, DT ve D puanları daha düşük olduğu saptanmıştır. Ancak KBN açısından anlamlı bir farklılık gözlemlenmemiştir. Çocuğunun veteriner hekim olmasını isteyenlerin İD puanları daha yüksek DT ve D puanları daha düşük olduğu görülmüştür. Şu anki işinden ayrılmayı düşünenlerin İD puanları düşük, DT ve D puanları daha yüksek olarak bulunmuştur (Tablo 6). Tablo 5. Araştırmaya katılanların bazı sosyo-demografik özelliklerine göre İD, DT, D, KBN puan ortalamalarının dağılımları Table 5. Distributions of ID, DT, D, KBN scores according to some sociodemographic characteristics Değişkenler Cinsiyet n TARTIŞMA ve SONUÇ Puan Ortalamaları (Standart Sapmaları) İD DT D KBN Kadın (13.6) 14.5 (5.3) 5. (3.3) 19. (3.7) Erkek (13.3) 14. (6.4) 5.9 (4.0) 0. (3.7) Medeni Durum Bekar (16.3) 14. (6.7) 7.1 (4.3)* 19.4 (4.4) Evli (1.5) 14.3 (6.0) 5.3 (3.7) 0.0 (3.6) Dul/Boşanmış 5 56 (13.4) 16.0 (5.9) 4.8 (.7).6 (.7) Yaş Grupları 30 Yaş ve Altı (15.9) 14.5 (6.3) 6.9 (4.) 19.7 (3.9) Yaş (13.0) 15.0 (6.) 5.9 (3.7) 19.7 (3.5) Yaş (14.0) 14. (5.8) 5.3 (3.8) 0.1 (4.0) 51 Yaş ve Üstü (5.9) 9.8 (4.5).7 (.3)* 1 (4.4) Mesleki Çalışma Süresi 5 Yıl ve Altı (17.6) 15.7 (6.7) 7.3 (4.1) 18.9 (4.0) 6-10 Yıl (11.6) 14,8 (5.9) 5.9 (3.8) 0.4 (3.3) Yıl 68.1 (11.7) 13.4 (6.1) 4.4 (.8) 18.9 (3.3) 16-0 Yıl (15.1) 14. (6.) 5.6 (4.) 0.7 (4.5) 1 Yıl ve Üstü (11.1) 1.3 (5.4) 4. (3.3) 0.7 (3.8) * P<0.05, ID: İş doyumu, DT: Duygusal tükenme, D: Duyarsızlaşma, KBN: Kişisel başarı noksanlığı İstanbul da çalışan veteriner hekimlerin, iş doyumu ve tükenmişlik düzeylerinin araştırıldığı bu çalışmada İş Doyumu puan ortalaması 65.9, DT puan ortalaması 14., D puan ortalaması 5.7, KBN puan ortalaması 0.0 olarak bulunmuştur. Farklı sağlık meslek gruplarında ya-

77 603 BABAOĞLU, CEVİZCİ ARSLAN Tablo 6. Araştırmaya katılanların meslekleriyle ilgili bazı düşüncelerine göre İD, DT, D, KBN puan ortalamalarının dağılımları Table 6. Distributions of scores of ID, DT, D, KBN according to some thoughts about the professions of the participants Değişkenler n Mesleği Kendi İsteği ile Seçme Durumu Puan Ortalamaları (Standart Sapmaları) İD DT D KBN Evet (13.8) 14.1 (6.1) 5.7 (4.0) 0.1 (3.5) Hayır (1.9) 14.8 (6.) 5.6 (3.4) 19.5 (4.3) Şimdi Olsa Aynı Mesleği Seçmeyi İsteme Durumu Evet (1.5)*** 1.3(6.0) 4.9 (3.7) 1.0(3.6) Hayır (1.9) 16.7 (5.4)*** 6.5 (3.8)** 18.7 (3.6)*** Çocuğunun Aynı Mesleği Seçmeyi İsteme Durumu Evet (13.0)*** 11.7 (6.1) 4.7 (3.7) 0.7 (3.7) Hayır (1.9) 15.9 (5.7)*** 6.3 (3.9)* 19.6 (3.8) Şuan Çalıştığı Yerden Ayrılma İsteği Durumu Evet (13.9) 17.5 (6.7)*** 7.0 (4.0)** 19.7 (4.4) Hayır (11.6)*** 1.6 (5.) 5.0 (3.6) 0.1 (3.5) * P<0.05, ** P<0.01, *** P<0.001, ID: İş doyumu, DT: Duygusal tükenme, D: Duyarsızlaşma, KBN: Kişisel başarı noksanlığı pılan çalışmalarla karşılaştırıldığında bu çalışmaya katılanların İD puan ortalamasının düşük, tükenmişlik puan ortalamalarının ise benzer olduğu görülmektedir Literatürde yer alan bilgiler cinsiyetin tükenmişlik düzeyi açısından önemli bir değişken olduğunu ortaya koymaktadır. Yapılan çalışmaların bir kısmında kadınların erkeklere oranla daha fazla duygusal tükenme yaşadıkları ve bunun nedeni olarak kadınlarda tükenmeyi iş hayatı ve sosyal hayata dair etmenlerin; erkeklerde ise yalnızca iş ile ilgili etmenlerin belirliyor olması gösterilmiştir 34,35. Buna karşın bazı çalışmalarda cinsiyetler arası fark bulunmadığı saptanmıştır 30,31. Bu çalışmada da tükenmişlik ölçekleri ile cinsiyet değişkeni arasında fark bulunamamıştır. Hayran ve Aksayan ın tıp hekimleri üzerine yaptıkları çalışmada İD düzeyinin evli bireylerde daha yüksek olduğu saptanmıştır 36. Bu çalışmada da evli bireylerde İD düzeyi diğer gruplara oranla yüksek çıkmıştır. Özbek ve Girgin 37 çalışmalarında DT puanları bekâr bireylerde daha düşük çıkmıştır. Bu çalışmada, bekar veteriner hekimlerin, duyarsızlaşma puanı evli ve dul/boşanmış olanlara oranla daha yüksek çıkmıştır. Bekâr veteriner hekimler, iş dışı yaşamlarındaki toplumsal sorumluluklarını tek başlarına yerine getirmek zorundadırlar. Bu durum bekâr veteriner hekimlerin iş ve sosyal hayatlarında karşılaştıkları sorunlar konusunda çözümleyici tavır sergilemelerini olumsuz yönde etkileyebilir. Bu nedenle kişinin hizmet verdiklerine karşı duygudan yoksun bir şekildeki davranışları ifade eden duyarsızlaşma bekâr veteriner hekimlerde daha yüksek çıkabilir 30. Genç yaştaki veteriner hekimlerin daha yaşlı olan veteriner hekimlere oranla tükenmişlik açısından daha fazla risk altında olduğu gözlenmektedir. 51 yaş ve üstü, duyarsızlaşma puanına göre en düşük yaş grubu olarak görülmektedir 30,34,37. Bu çalışmada da duyarsızlaşma puanları açısından 5 yıl ve altı ile 1 yıl ve üstü grupları arasında anlamlı fark saptanmıştır. Bunun nedeni kişinin yaşının ilerlemesiyle iş tecrübesinin artması ve birçok durumu kabullenir hale gelmesi olabilir. Benzer çalışmalarda da bu tarz sonuçlar saptanmıştır 1,30,31,34. İş yaşamındaki süre ile ölçekler arasında bu çalışmada istatistiksel olarak anlamlı sonuç bulunmamıştır. Çalışmada veteriner hekimlerin haftada 5.81±0.75 gün, günde 10.6±3.00 saat çalıştıklarını bildirilmiştir. Literatüre göre, haftalık çalışma saatinin yüksek olması bireyin fiziksel ve ruhsal sağlığını olumsuz yönde etkileyebilmektedir. Avustralya da bir sağlık personelinin günlük çalışma saatinin üst sınırı 10 olarak belirlenmiştir 38. Almanya da 778 veteriner hekimle yapılan bir çalışmada haftada 48 saatten fazla çalışanlarda iş stresinin yüksek ve iş doyumunun düşük olmasına paralel olarak araba kazası geçirme riskinin de yüksek olduğu bildirilmiştir 39. Çalışmamızda günlük ve haftalık çalışma süreleri ile İD ve tükenmişlik arasında bir ilişki saptanmamıştır. Özyurt tarafından yapılan çalışmada mesleğini kendi isteği ile seçmiş olanların İD yüksek, DT ve D puanları düşük, KBN puanları yüksek olarak bulunmuştur 0. Bu çalışmada istatistiksel olarak anlamlı bir fark saptanmamıştır. Şimdi olsaydı yine veteriner hekim olurdum diyenlerin ve çocuklarının da aynı mesleği seçmesini isteyenlerin İD puanları daha yüksek, tükenmişlik puanları ise daha düşük çıkmıştır. Bu sonuç, veteriner hekimlerin çalışırken işleriyle bütünleştiklerini ve işlerini severek yaptıklarını göstermektedir. Bu çalışmada işten ayrılmayı düşünenlerin tükenmişlik düzeylerinin daha yüksek, İD puanının ise daha düşük olduğu bulunmuştur. Tıp hekimleri ve sağlık personeli ile yapılan diğer çalışmalarda da benzer sonuçlar elde edilmiştir 3,4. Özen ve ark ilde klinisyenlik yapan 19 veteriner hekimle yaptıkları anket çalışmasında cinsiyet, yaş, çalışma süresi ve yıllık gelirin iş doyumu düzeyleri ile anlamlı bir ilişkisi olmadığını, buna karşılık sosyal statü, Türkiye de veteriner hekimliğin durumu ve profesyonel doyum ile ilişkili olduğunu tespit etmişlerdir. Aile yönlendirmesi ve bilinçsizce veteriner fakültesini tercih edenlerde yaşam doyumu konusunda tatminsizlik olduğu saptanmıştır. Bu çalışmanın bazı sınırlılıkları mevcuttur. Bireylere yönelik kendini değerlendirme yöntemi ile uygulanan ölçeklerde karşılaşılabilecek biaslar bu çalışma için de geçerli olmaktadır. Ayrıca web-tabanlı anket çalışması olması nedeniyle internet kullanmayan veteriner hekimlere ulaşılamamıştır. Bu sınırlılıklarına karşılık, çalışmamızın İstanbul da veteriner hekimler arasında iş doyumu ve tükenmişlik düzeylerini inceleyen ilk ve tek çalışma olması nedeniyle önemli bir kaynak olacağı düşüncesindeyiz.

78 604 İstanbul da Çalışan Veteriner... Sonuç olarak, çalışma grubunda yer alan veteriner hekimler arasında iş doyumu orta düzeyde, tükenmişlik ise alt düzeyde saptanmıştır. Ayrıca çalışmamızdaki ölçek puanlarını literatürde karşılaştırma yapabilmek için Türkiye de veteriner hekimler arasında tükenmişlik ve iş doyumunu standart ölçeklerle inceleyen başka bir çalışmaya ulaşılamadı. Bu nedenle, bu çalışmadan hareketle farklı illerde veya Türkiye genelinde veteriner hekimlerin iş doyumu, tükenmişlik ve stres düzeylerini inceleyecek araştırmalar için çalışma sonuçları da yol gösterici olacaktır. Bu çalışmanın, araştırmaya katılan veteriner hekimlerin tespit edilmiş sorunları doğrultusunda yapılacak çalışmalara ve literatüre katkı sağlayacağı düşüncesindeyiz. Teşekkür Çalışmamıza yanıt veren tüm meslektaşlarımıza ve İVHO yönetim kuruluna katkılarından dolayı teşekkür ederiz. KAYNAKLAR 1. Dağ H: Örgütlerde iş tatmini ve askerlik mesleğine yönelik eğitimin iş tatmini üzerine etkisine ilişkin bir araştırma. Uzmanlık Tezi, İstanbul Üniv. Sosyal Bil. Enst., İstanbul, Özaltın H, Kaya C, Demir C, Özer M: Türk silahlı kuvvetlerinde görev yapan muvazzaf tabiplerinin iş doyum düzeylerinin değerlendirilmesi. Gülhane Tıp Derg, 44 (4): 43-47, Özyurt A, Hayran O, Sur H: Predictors of burnout and job satisfaction among Turkish physicians. QJM, 99 (3): , Çelik S: İş doyumu ve güdümün verimlilik üzerine etkileri. Yüksek Lisans Tezi, Marmara Üniv. Sosyal Bil. Enst., İstanbul, Faragher EB, Cass M, Cooper CL: The relationship between jop satisfaction and health: A meta-analysis. Occup Environ Med, 6, , Söylemez D: Sağlık personelinin iş doyumu ile ilgili bir meta analizi çalışması. Yüksek Lisans Tezi, Marmara Üniv. Sağlık Bil. Enst., İstanbul, Gözüm S: Koruyucu sağlık hizmetlerinde görev yapan hemşire ve ebelerin iş doyumu, tükenmişlik ve işe devamsızlığı etkileyen faktörlerin araştırılması. Doktora Tezi, Atatürk Üniv. Sağlık Bil. Enst., Erzurum, Çetinkanat C: Örgütlerde Güdülenme ve İş Doyumu. 1. Baskı, Anı Yayıncılık. Ankara Freudenberger NJ: Staff burnout. J Soc Issues, 30, , Maslach C, Jackson SE: Maslach Burnout Inventory. nd ed/, Consulting Psychologists Press, Palo Alto, CA, Ergin C: Doktor ve hemşirelerde tükenmişlik ve maslach tükenmişlik ölçeğinin uyarlanması. VII. Ulusal Psikoloji Kongresi Bilimsel Çalışmaları, Türk Psikologlar Derneği Yayını, s , Ankara, Panagopoulou E, Montgomery A, Benos A: Burnout in intenal medicine physicians: Differences between residents and specialists. Eur J Intern Med, 17 (3): , Ahola K, Hakanen J: Job strain, burnout, and depressive symptoms: A prospective study among dentists. J Affect Disord, 104 (1-3): , Lacovides A, Fountoulakis KN, Kaprinis G: The relationship between jop stres, burnout and clinical depression. J Affect Disord, 75 (3): 09-1, Ersoy F: Tükenmişlik sendromu. STED,, 11-17, Gardner DH, Hini D: Work-related stress in the veterinary profession in New Zealand. New Zealand Vet J, 54, , Gabel C, Gerberich G: Risk factors among veterinarians. Veterinary Injury Risk, 13, 80-86, Visser MR, Smets EM, Oort FJ, De Haes HC: Stress, satisfaction and burnout among Dutch medical specialists. CMAJ, 168 (3): 71-75, Tabolli S, Ianni A, Renzi C, Di Pietro C, Puddu P: Job satisfaction, burnout and stress amongst nursing staff: A survey in two hospitals in Rome. G Ital Med Lav Ergon, 8 (1 Suppl 1): 49-5, Özyurt A: İstanbul hekimlerinin iş doyumu ve tükenmişlik düzeyleri. Yüksek Lisans Tezi, Marmara Üniv. Sağlık Bil. Enst., İstanbul, Özen A, Yüksel E, Özen R, Atıl E, Yaşar A, Yerlikaya E: A sudy on life satisfaction of Turkish Veterinary Practitioners. FU Sağlık Bil Derg (Veteriner), 1 (1): 05-10, Özen A, Kalın R, Yerlikaya H, Şeker İ, Çetinkaya B: Evaluating the curriculum of the veterinary school of Firat University, Turkey, in terms of professional and technical skills. J Vet Med Educ, 31 (3): 81-88, Özen A, Özen R, Yüksel E, Yaşar A, Yerlikaya H: Veteriner hekimliği kliniklerinin ticari performansı üzerine etkili bazı faktörler: I. bilgi edinme eğilimi ve deontolojik tutum. FU Sağlık Bil Derg (Veteriner), 19 (): , Yüksek N, Altuğ N, Özkan C, Küçük M: Doğu ve Güneydoğu Anadolu Bölgelerinde çalışan serbest veteriner hekimlerin mesleki değerlendirmeleri: Bir anket çalışması, YYÜ Vet Fak Derg, 19 (): 57-59, Hansez I, Schins F, Rollin F: Occupational stres, work-home interference and burnout among Belgian veterinary practitioners. Ir Vet J, 61 (4): 33-41, Hatch PH, Winefield HR, Christie BA, Lievaart JJ: Workplace stress, mental health and burnout of veterinarians in Australia. Aust Vet J, 89 (11): , Baycan A: An analysis of several aspects of job satisfaction on between different occupational groups, Yüksek Lisans Tezi, Boğaziçi Üniv. Sosyal Bil. Enst., İstanbul, Serinkan C, Haybat A: Pamukkale Üniversitesi öğretim elemanlarının iş tatmini ve tükenmişlik düzeylerinin belirlenmesi. ozet/104.html, Erişim Tarihi: Sevimli F, İşcan ÖF: Bireysel ve iş ortamına ait etkenler açısından iş doyumu. Erişim Tarihi: Aslan D, Kiper N, Karaağaoğlu, Topal F, Güdük M, Cengiz ÖS: Türkiye de tabip odalarına kayıtlı olan bir grup hekimde tükenmişlik sendromu ve etkileyen faktörler. TTB yayınları, Ağustos, Ankara, Yavuzyılmaz A, Topbaş M, Çan E, Çan G, Özgün Ş: Trabzon il merkezindeki sağlık ocakları çalışanlarında tükenmişlik sendromu ile iş doyumu düzeyleri ve ilişkili faktörler. TSK Koruyucu Hekimlik Bülteni, 6 (1): 41-50, Ebrinç S, Açıkel C, Başolu C, Çetin M, Çeliköz B: Yanık merkezi hemşirelerinde anksiyete, depresyon, iş doyumu, tükenme ve stresle başa çıkma. Karşılaştırmalı bir çalışma. Anadolu Psikiyatri Derg, 3, , Tözün M, Çulhacı A, Ünsal A: Aile hekimliği sisteminde birinci basamak sağlık kurumlarında çalışan hekimlerin iş doyumu (Eskişehir). TSK Koruyucu Hekimlik Bülteni, 7 (5): , Serinkan M, Ergör A, Çımrın AH, Ersoy G: İzmir ilindeki acil servis hekimlerinin tükenme düzeyleri. Toplum ve Hekim Derg, Temmuz-Ağustos, 18 (4): 93-99, Budak G, Sürgevil O: Tükenmişlik ve tükenmişliği etkileyen örgütsel faktörlerin analizine ilişkin akademik personel üzerinde bir uygulama. D.E.Ü.İ.İ.B.F. Derg, 0 (): , Hayran O, Aksayan S: Pratisyen hekimlerde iş doyumu. Toplum ve Hekim Derg, 16-17, Özbek K, Girgin G: Pratisyen hekimlerde meslekte tükenmişlik (burnout) sendromu (İzmir örneklem çalışması). IV Ulusal Halk Sağlığı Kongre Kitabı, s , Didim, Özdemir M: Sağlık çalışanlarının sorunları. Toplum ve Hekim Derg, Kasım - Aralık, 16 (6): 40-41, Trimpop R, Kirkcaldy B, Athanasou J, Cooper C: Individual differences in working hours, work perceptions and accident rates in veterinary surgeries. Work Stress, 14 (): , 000.

79 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Türkiye de Veteriner Hekimliği Üzerine Araştırmalar: I. Veteriner Hekimliği Eğitim-Öğretimi [1] Abdullah ÖZEN * Özlem DOĞAN * Raziye Tamay BAŞAĞAÇ GÜL ** Türel ÖZKUL *** Erhan YÜKSEL **** [1] Bu çalışma TÜBİTAK tarafından (Proje No: TOVAG-106 O 153) desteklenmiştir * Fırat Üniversitesi, Veteriner Fakültesi, Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı, TR-3119 Elazığ - TÜRKİYE ** Ankara Üniversitesi, Veteriner Fakültesi, Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı, TR Dışkapı, Ankara - TÜRKİYE *** Uludağ Üniversitesi, Veteriner Fakültesi, Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı, TR Görükle Kampüsü, Bursa - TÜRKİYE **** Erciyes Üniversitesi, Veteriner Fakültesi, Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı, TR Melikgazi, Kayseri - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Türkiye de veteriner hekimliği eğitim-öğretiminin genel durumu, sorunları ve bunlara ilişkin çözüm önerileri üzerine sınırlı sayıda çalışma bulunmakla birlikte, Türkiye ölçekli kapsamlı bir araştırma yapılmamıştır. Bu çalışma, Türkiye deki veteriner hekimlerin ve veteriner fakültesi öğrencilerinin, veteriner hekimliği eğitiminin verimliliği ile eğitimde yaşanan olası sorunları ve bu sorunlara ilişkin çözüm önerilerini belirlemek amacıyla gerçekleştirildi. Bu amaçla, veteriner hekimler ve veteriner fakültesi öğrencileri için hazırlanan iki ayrı anket formu, yedi coğrafi bölgede veteriner fakültesi bulunan birer ilden toplam 1176 kişiye yüz yüze görüşme tekniği ile uygulandı. Verilerin analizinden; veteriner fakültelerindeki eğitimin az verimli bulunduğu; eğitimin şekli ve süresinin yeterliliğinin eğitimin güçlü yanları arasında; uygulamalı eğitimin yetersizliğinin ise eğitimin zayıf yanları arasında kabul edildiği belirlendi. Sonuç olarak, katılımcı görüşleri doğrultusunda, Türkiye de veteriner hekimliği eğitiminde yaşanan sorunların; uygulamaların arttırılması, fakülte sayısının ve öğrenci kontenjanlarının azaltılması ile giderilebileceği söylenebilir. Anahtar sözcükler: Türkiye, Lisans eğitimi, Veteriner hekimliği, Veteriner hekimliği eğitimi Summary Researches on Veterinary Medicine in Turkey: I. Veterinary Education Although there are limited number studies on general condition of veterinary education and its problems and solution offers of these problems in Turkey, any comprehensive studies in Turkey were not made. This study was carried out with the aim of determining veterinary education efficiency of veterinarians and veterinary faculty students and possible problems in education and the solutions of these problems. For this aim two questionnaires were developed for collecting data and one was applied to veterinary students and the other was applied to veterinary practitioners. The questionnaires applied by interviewing with 1176 participants individually in cities of seven geographical regions of Turkey that have a veterinary faculty. The data were analyzed: the efficiency of the education of veterinary faculties was evaluated as low. While the sufficiency of structure and duration were accepted as the strong sides of education, the insufficiency of practical training was considered as the weakness. In conclusion, in accordance with the opinions of participants it can be said that the problems in veterinary education in Turkey can be solved by increasing practices and decreasing faculty number and student quota. Keywords: Turkey, Undergraduate education, Veterinary medicine, Veterinary education İletişim (Correspondence) /3991 ozlemdogan0@gmail.com

80 606 Türkiye de Veteriner Hekimliği... GİRİŞ Türkiye de veteriner hekimliği eğitim-öğretiminin genel durumu, sorunları ve bunlara ilişkin çözüm önerileri 1998, 00 ve 010 yıllarında düzenlenen üç kurultayda 1-3 ve sınırlı sayıda çalışmada 4,5 ele alınmış; ancak bilindiği kadarıyla, bu konuda Türkiye ölçekli kapsamlı bir araştırma yapılmamıştır. Veteriner hekimliğine ilişkin genel sorunları, sektörel değişimleri ve istihdam yönelimlerini belirlemek ve geleceğe yönelik stratejileri geliştirmek amacıyla Avrupa daki 0 ülkede yürütülen bir projenin 6 benzerinin Türkiye için planlanmasıyla gerçekleştirilen bu çalışmada; Türkiye de veteriner hekimliği eğitim-öğretiminin güncel sorunlarının ve gelecek beklentilerinin belirlenmesi amaçlandı. MATERYAL ve METOT Çalışmanın evrenini, Türkiye deki veteriner hekimler ve veteriner fakültesi öğrencileri oluşturdu. Evreni temsil edecek örneklem, Türkiye nin yedi coğrafi bölgesinde veteriner fakültesi bulunan iller esas alınarak, Ankara, Burdur/Antalya, Aydın, Elazığ, İstanbul, Samsun ve Şanlıurfa olarak belirlendi. Evrende yer alan katılımcılar, sayıca yoğunlaştıkları alanlar dikkate alınarak kamuda çalışan veteriner hekimler, özelde çalışan veteriner hekimler ve veteriner fakültesi öğrencileri olmak üzere üç gruba ayrıldı. Grupların örneklem büyüklüklerinin belirlenmesinde, Krejcie ve Morgan 7 tarafından önerilen çizelgeden yararlanıldı. Çizelgeye göre; adı geçen illerde görevli 116 kamu çalışanından 91; 1034 özel sektör çalışanından 85 ve 3314 öğrenci kütlesinden 346 örnek alınması yeterli iken; temsil gücünü artırabilmek ve istatistiksel yanılmaları olabildiğince önlemek amacıyla yaklaşık 400 er kişilik örneklem grupları oluşturuldu. Dağılımların belirlenmesinde, orantılı-tabakalı örneklem tekniği kullanıldı. Bu teknik çerçevesinde belirlenen örneklemin sektörlere, kurumlara ve illere göre dağılımları ile toplam öğrenci sayıları Tablo 1 de sunuldu. Tablo 1. Ana kütlenin iller ve sektörlere göre dağılımı (N), oransal değerleri (%), beklenen frekans (e i ) ve gözlenen frekans (o i ) değerleri Table 1. Distribution of main mass by cities and sectors (N), proportional values (%), values of expected (e i ) and observed (o i ) frequency Sektör Kamu Sektörü Özel Sektör Öğrenci Bakanlık Üniversite Belediye Klinik Diğer* Ankara Burdur/ Antalya İller Aydın Elazığ İstanbul Samsun Şanlıurfa Toplam N % e i o i N % e i o i N % e i o i N % e i o i N % e i o i N % e i o i N: Araştırmanın uygulandığı sektörlerdeki veteriner hekimlerin ve veteriner fakültelerindeki öğrencilerin illere göre dağılımları; %: İlgili istihdam alanındaki katılımcıların toplam sektör katılımcıları içerisindeki oranı ile veteriner fakültelerindeki öğrenci sayılarının, araştırmanın uygulandığı illerdeki toplam öğrenci sayılarına oranı; e i : Beklenen frekans = % x 400; o i : Gözlenen frekans; *: Market, kesimhane ve entegre tesislerde çalışan veteriner hekimler

81 607 ÖZEN, DOĞAN, BAŞAĞAÇ GÜL ÖZKUL, YÜKSEL Araştırma verilerinin toplanması amacıyla, VET 00 Current Aspect of Veterinary Profession and Education in Europe adlı projede 6 kullanılan anketten; ayrıca, Türkiye de gerçekleştirilen sosyal bilimler araştırmaları 8-10 ile bu alanda yapılan benzer çalışmalardan yararlanılarak; biri veteriner fakültesi öğrencilerine, diğeri ise veteriner hekimlere yönelik iki ayrı anket formu hazırlandı. Hazırlanan anketlerin pilot uygulaması 10 veteriner hekim ve 10 veteriner fakültesi öğrencisine yapılarak uygulama sonucunda saptanan aksaklıklar ve hatalar düzeltilerek anket formuna son hali verildi. Anket formları, 405 i veteriner fakültesi öğrencisi, 398 i kamu veteriner hekimi ve 373 ü özel sektörde çalışan veteriner hekim olmak üzere toplam 1176 kişiye yüz yüze görüşme tekniği ile uygulandı (Tablo 1). Araştırmada kullanılan anket formu dört bölümden oluşturuldu. Birinci bölüm bağımsız değişkenler, ikinci bölüm veteriner hekimliği eğitim-öğretimi, üçüncü bölüm veteriner hekim olmaya karar verme süreci, dördüncü bölüm ise iş fırsatları ve sektörel yönelimlere ilişkin sorulardan oluştu. Bu makalede, projenin veteriner hekimliği eğitim-öğretimine ilişkin verileri kullanıldı. Veriler, SPSS istatistik programı ile analiz edildi. Anket uygulamaları, Ocak - 31 Aralık 007 tarihleri arasında gerçekleştirildi. BULGULAR Katılımcıların, günümüz şartlarında Türkiye de veteriner hekimliği eğitiminin verimliliğini sorgulamak amacıyla yöneltilen soruya verdikleri yanıtlara ilişkin veriler Tablo de sunuldu. Buna göre, Türkiye de veteriner hekimliği eğitiminin az verimli olduğunu düşünen veteriner hekimlerin oranının %63.; öğrencilerin oranının ise %59.9 olduğu tespit edildi. Kamuda, özel sektörde ve her iki sektörde (kamu-özel sektör) çalışan veteriner hekimlerin seçenekler üzerindeki görüşlerinin, genel dağılım ile uyumlu olduğu belirlendi (Tablo ). Katılımcıların, veteriner hekimliği eğitiminin güçlü ve zayıf yanlarına ilişkin görüşlerini belirlemek amacıyla yönel- tilen sorulara verdikleri yanıtlar ele alındığında, veteriner hekimliği eğitiminin güçlü yanları konusunda, veteriner hekimler arasında en büyük grubu %.6 ile eğitimin şekli ve süresinin yeterliliği parametresini seçenler; öğrenciler arasında en büyük grubu ise %.7 ile klinik uygulamaların verimliliği parametresini seçenler oluşturdu (Tablo 3). Veteriner hekimliği eğitiminin zayıf yanları konusunda ise, gerek veteriner hekimler arasında (%38); gerekse öğrenciler arasında (%41.3) uygulamalı eğitimin yetersizliği ni seçen katılımcıların en büyük grubu oluşturduğu belirlendi (Tablo 4). Katılımcıların, Size göre Türkiye deki veteriner fakültelerinde eğitim nasıl daha kaliteli hale getirilebilir? sorusuna verdikleri yanıtlardan, hem veteriner hekimlerin (%9.9) hem de öğrencilerin (%39.9), laboratuvar ve klinik dersler açısından eğitimin güçlendirilmesi seçeneğine öncelik verdikleri belirlendi. Yine her iki grupta, fakülte sayısının azaltılması (çalışanların %18.8 i, öğrencilerin %5.7 si) ve öğrenci kontenjanlarının azaltılması (çalışanların %7.9 u, öğrencilerin %5.5 i) ile eğitimin daha kaliteli hale geleceğini düşünen katılımcı oranlarının da diğer parametrelere oranla yüksek olduğu tespit edildi (Tablo 5). TARTIŞMA ve SONUÇ Her iki katılımcı grubunun yarısından fazlasının, veteriner hekimliği eğitimini az verimli bulmaları (Tablo ); bu konuda olumsuz bir durumun varlığına dikkat çekmektedir. Saha şartlarını daha yakından tanıdıkları ve eğitim sürecine dışarıdan baktıkları için çalışanların, öğrencilere kıyasla daha nesnel bir yaklaşım sergileyecekleri kabul edildiğinde, çalışanların eğitimin verimliliği konusunda daha olumsuz bir yaklaşım içerisinde olmalarının, veteriner hekimliği eğitiminin, mezunları sahaya hazırlama konusunda yetersiz kaldığına işaret ettiği ileri sürülebilir. Diğer yandan, Avrupa ülkelerinde yürütülen araştırmada 6, katılımcıların %50.9 unun veteriner hekimliği eğitimini verimli olarak değerlendirdiği, eğitimi az verimli bulanların oranının %31.6 da kaldığı dikkate alınarak; Türkiye deki veteriner hekimlerin ve öğrencilerin veteriner hekimliği eğitimine yönelik beklentilerinin karşılanması konusunda Avrupa dakilere kıyasla daha karamsar oldukları söylenebilir. Çalı- Tablo. Katılımcıların veteriner hekimliği eğitiminin verimliliği konusundaki görüşlerine göre dağılımı Table. Distribution of participants according to their views on the efficiency of veterinary education Katılımcılar Verimlilik Düzeyi KS ÖS HKHÖS TVH Öğrenci n % n % n % n % n % Oldukça verimli Verimli Az verimli Verimsiz Toplam n: Frekans; KS: Kamu sektörü; ÖS: Özel sektör; HKHÖS: Hem kamu hem özel sektör; TVH: Tüm veteriner hekimler

82 608 Türkiye de Veteriner Hekimliği... Tablo 3. Katılımcıların veteriner hekimliği eğitiminin güçlü yanları konusundaki görüşlerine göre dağılımı Table 3. Distribution of participants according to their views on the strengths of veterinary education Katılımcılar Güçlü Yanları KS ÖS HKHÖS TVH Öğrenci n % n % n % n % n % Hayvancılık sektörünün stratejik olması Genç idealist akademisyenler Hayvansal gıda üretiminde ve tüketiminde etkin olması Eğitim şekli ve süresinin yeterli olması Öğretim elemanı kadro ve yeterlilikleri Dünya ile eş güdümlü ders verilmesi Eğitim alt yapı ve imkânlarının yeterliliği Halk sağlığına hizmet etmesi Uygulama imkânlarının yeterli olması Sürekli gelişen ve geniş bir alana hitap eden meslek oluşu Diğer * Teorik ve uygulama derslerinin uyumlu verilişi İş bulma imkânı sunması Hayvanlarla iç içe olmak Zor bir eğitim döneminin olması Diğer ** Toplam n: Frekans; KS: Kamu sektörü; ÖS: Özel sektör; HKHÖS: Hem kamu hem özel sektör; TVH: Tüm veteriner hekimler; Diğer*: Öğrencilerin kalitesi ve niteliği, kliniklere gelen hasta sayısının yeterli olması, hayvan hastanelerinin etkinliği, öğrencilerin kişisel merak ve becerileri, mesleki etik konusunda yeterli eğitim verilmesi, öğrenciyi çalışmaya sevk etmesi, sınavların sözlü şeklinde yapılması, topluma hizmet eden göz önünde olan bir meslek olması, mezuniyet sonrasında lisansüstü eğitim imkânlarının yeterliliği, veteriner fakültesi sayısının fazla olması, veteriner fakültelerinin hayvan varlığının olduğu yerlerde olması, fakültelerin branşlaşmaya yönelmesi, araştırma geliştirmeye önem verilmesi; Diğer**: Derslerin devam zorunluluğu, bilimsel bir eğitim olması, rekabetin başarıyı tetiklemesi, Avrupa nın veteriner hekime önem vermesi, staj yapılması, koruyucu hekimliğin ön plana çıkması, öğrenim süresinin beş yıl olması, fakültelerin münferit kalitesi, öğrencilerde ortaöğretimden kaynaklanan eksikliklerin giderilebilmesi, az sayıda öğrenci olan sınıflarda eğitimin iyi olması, eğitimin güncel hayatla uyumlu olması, gıda tüketiminde bilinç oluşturması, bilimsel toplantıların yapılıyor olması, her hastalığa çare bulma iddiası, yaygın bir etkinlik olan hayvancılığa yönelik olması, uygulamaların kişisel verimliliği ön plana çıkarabilmesi, verimi arttıracak kaliteli elemanların olması ve yetiştirilmesi, gelir düzeyinin yüksek olması, hekimlik sıfatının başarıyı tetiklemesi, köklü ve oturmuş bir yapıya sahip olması, hayvan sağlığına hizmet etmesi şan katılımcıların, veteriner hekimliği eğitiminin güçlü yanı olarak en yüksek oranda eğitimin şekli ve süresinin yeterliliği ni ifade etmeleri (Tablo 3); başka bir deyişle, ders sayısı, öğrenim süresi ve ders saatleri ile ilişkilendirilebilecek nicel parametreleri işaret etmeleri; Türkiye deki veteriner hekimliği eğitim-öğretiminin özellikle kalitatif parametrelerden çok kantitatif parametrelere göre yapılandırıldığını akla getirmektedir. Nitekim veteriner fakültelerinde eşgüdümü sağlamak amacıyla 1989 yılında kurulan Üniversitelerarası Kurul Veteriner Bilimleri Eğitim Konseyinin 1995 yılında aldığı veteriner hekimliği eğitimi için verilecek olan derslerin toplamı 5000 ders saatinden az olmamalıdır şeklindeki niceliksel içeriğiyle dikkat çeken kararının, uzunca bir süre neredeyse tüm veteriner fakülteleri tarafından kabul görerek uygulanması 1,14 bu kanıyı destekler niteliktedir. Bir veteriner fakültesinin açılmasında asgari koşulları belirleyen Avrupa Veteriner Hekimliği Eğitim Kurumları Birliğinin (EAEVE), akreditasyon sürecini yaşayan Türkiye deki veteriner fakültelerine ilişkin değerlendirmelerinde 14,15 bu fakültelerin altyapı, insan gücü ve eğitim-öğretimin niteliği ile ilgili eksiklerine yer vermesi de yukarıdaki şüpheyi doğrulayan bir diğer kanıt olarak değerlendirilebilir. Ankete katılan öğrencilerin, veteriner hekimliği eğitiminin güçlü yanı olarak klinik uygulamaların verimliliği ni seçmesi (Tablo 3); yine her iki katılımcı gurubun, veteriner hekimliği eğitiminin zayıf yanı olarak en yüksek oranlarda uygulamalı eğitimin yetersizliği ni işaret etmeleri (Tablo 4); uygulamaların, veteriner hekimliği eğitim-öğretiminde önemini gösteren geribildirimler olarak kabul edilmelidir. Veteriner hekimliği eğiminde uygulama oranlarının %60 lara ulaştığı Avrupa da yürütülen çalışmada 6 katılımcıların, veteriner hekimliği eğitiminin zayıf yanı olarak yine uygulamalı eğitimin yetersizliği parametresinde yoğunlaşmaları; Türkiye deki veteriner fakültelerinde eğitim-öğretimin yetersizliğini göstermesi açısından dikkat çekmektedir.

83 609 ÖZEN, DOĞAN, BAŞAĞAÇ GÜL ÖZKUL, YÜKSEL Tablo 4. Katılımcıların veteriner hekimliği eğitiminin zayıf yanları konusundaki görüşlerine göre dağılımı Table 4. Distribution of participants according to their views on the weaknesses of veterinary education Katılımcılar Zayıf Yanları KS ÖS HKHÖS TVH Öğrenci n % n % n % n % n % Uygulamalı eğitimin yetersizliği Fakülte sayısının fazlalığı Öğrenci sayısının fazlalığı Veteriner fakültesi eğitiminin yetersizliğikalitesizliği (4.) Ortaöğretimden başarısız gelen öğrenciler Öğretim elemanlarının yetersizliği Eğitim sisteminin yanlışlığı Teorik bilgi çokluğu-ezberci eğitim Alt yapı yetersizliği Branşlaşma-uzmanlaşmanın olmaması Öğrencilerin ilgisizliği Eğitim süresinin müfredat için yetersizliği Diğer * Diğer ** Toplam n: Frekans; KS: Kamu sektörü; ÖS: Özel sektör; HKHÖS: Hem kamu hem özel sektör; TVH: Tüm veteriner hekimler; Diğer*: Toplumun veteriner hekimin öneminin farkında olmaması, verilen derslerin ve anlatılanların ütopik kalması, eğitimin tüm hayvanları kapsaması, öğrencilerin isteksizliği, eğitimin zor olması, yabancı dil eğitiminin yetersizliği, ders geçme sistemindeki aksaklıklar, öğrencilerin laboratuvar ve klinikleri istedikleri zaman kullanamamaları, okumayı sevmemek, eğitim-öğretim süresinin yetersizliği, özel sektörde işe ticari yaklaşılması, üniversite yerleştirme sistemi, ders verilişinde bilimler arası koordinasyon kopukluğu, veteriner fakültelerinin interaktif eğitime uygun olmaması, ülke gerçeklerine yönelik özgün eğitim verilmemesi, ders sayısı ve saatlerinin fazlalığı, saha ile kamu kurumları arasındaki kopukluk, bölgesel farklılıkların eğitime kötü etkisi, eğitmenlerin maddi kaygıları, tedavi-teşhis birlikteliğinin verilememesi, hayvan sevgisinin olmayışı, öğretim görevlilerinin öğrencileri rakip olarak görmesi, klinik işletmeciliği eğitiminin yetersizliği, eğitime ayrılan ödeneğin yetersizliği, veteriner hekimliği mesleğinin anlatılamaması, öğretim elemanı seçimindeki yetersizlik, hayvancılığın azalması, istihdam alanının azlığı, veteriner hekim odalarının mesleğe yön vermedeki yetersizlikleri, uzman veteriner hekim yetiştirilememesi, eğitimin modernteknolojik araçlarla yapılmaması, öğrencilere danışmanlık yapılmaması, deontoloji ve etik derslerinin yeterli olmaması, veteriner fakültesi eğitiminin güncel olmaması, veteriner fakültelerinin asosyal yapısı, bünyesindeki bazı bölümleri diğer meslek guruplarına kaptırması, temel bilgilerin yetersiz verilmesi, Avrupa Birliği uyum sürecinde ülke gerçeklerinin ve eğitimin göz ardı edilmesi, akademisyenlerin eğitim-öğretim görevlerini ikinci plana atmaları, ders kitabı ve kaynak yetersizlikleri, araştırmaların az olması, müfredatın eşit ve düzenli dağıtılmaması, eski hocaların emekli olmaması, öğrencilerin güven-motivasyon eksiklikleri, hocaların kaprisleri, eğitim performans göstergesinin belirlenememesi, pratik ve teorik ders uyumunun olmaması; Diğer**: Mezunların iyi yetişememeleri, branşlaşma olmaması, müfredatın fakülteler arasında farklılık göstermesi, fakültelere düşük puanla öğrenci alınması, kitap ve kaynakların yetersizliği-güncel olmaması, öğretim elamanlarının sınavlarda sürekli aynı soruları sormaları, ders geçme sistemi, sınıf ve ders uygulamaları arasındaki uyumsuzluk, eğitimin, mesleğin uygulama alanlarına yanıt verme anlamında yetersizliği, istihdam olanaklarının yetersizliği, bilimsel çalışmaların azlığı, fakültelerin yeterli teknolojiye sahip olmaması, teşhis-tedavi ilişkisinin, semptom-ilaç birlikteliğine dayandırılması, veteriner hekimlerin ilaç satma eğilimlerinin fakülteden başlayarak oluşması, eğitimin tam bir sistematiğe oturtulamaması, öğrencilerin sadece üniversite bitirmiş olmaya önem vermeleri, veteriner hekimlerin mesleğine ve hayvan sağlığına önem vermemesi, derslerin sınıflara dağılımındaki yanlışlıklar, öğrencilere değer verilmiyor olması, etik kuralların yok sayılması, Avrupa kalitesinde eğitim verilememesi, büyükbaş hayvancılığın yetersizliği, mesleki İngilizce-İngilizce derslerinin yetersizliği, fakülte sayısının fazlalığı, Latince bilgisinin yetersizliği, veteriner hekime önem verilmeyişi, zorunluluk baskısı, veteriner hekimliğin sadece para için yapılıyor olması, öğrencilere eşit davranılmaması, bilmeden biliyormuş gibi halkın kandırılması, öğrenci ve öğretim elemanlarının yetersizlikleri, sürekli eğitim programlarının yetersizliği, sahadaki veteriner hekimlerin ampirik çalışması, akademik çalışmaların bilimsellikten uzak olması, doktora öğrencisi ve asistan alımında liyakatin esas alınması, öğrenciyi kendini geliştirmeye sevk etmemek, veteriner fakültesinin sıkıcı bir okulmuş gibi gösterilmesi, eğitimin neden sonuç ilişkisine bağlı olarak verilmemesi, sosyalleşme problemleri, karma eğitim Veteriner hekimliği eğitiminin daha kaliteli hale getirilmesi için yapılması gerekenler konusunda, her iki katılımcı grubunun verdikleri yanıtların (Tablo 5); veteriner hekimliği eğitiminin zayıf yanları konusunda işaret ettikleri problemlere çözüm niteliği taşıdığı görülmektedir. Örneğin, eğitimin zayıf yanı olarak en yüksek oranda uygulamalı eğitimin yetersizliği ni gören her iki katılımcı grubu, yine en yüksek oranda, laboratuvar ve klinik dersleri açısından eğitimin güçlendirilmesi; başka bir deyişle uygulamalı eğitimin arttırılması ile eğitimin daha kaliteli hale getirilebileceğini bildirmektedirler. Aynı durumun diğer seçenekler için de geçerli olması, gerek veteriner hekimlerin, gerekse öğrencilerin ortaya sundukları problemler ve çözüm önerileri konusunda tutarlı bir yaklaşım sergilediklerini göstermektedir. Türkiye de özellikle akreditasyon sürecini yaşayan fakültelerde uygulamalı eğitimin süre ve içerik açısından geliştirilmesi ve desteklenmesi yönünde çalışmaların yürütülmesi 15 ; katılımcıların, veteriner hekimliği

84 610 Türkiye de Veteriner Hekimliği... Tablo 5. Katılımcıların Türkiye de veteriner hekimliği eğitiminin daha kaliteli hale getirilmesi için yapılması gerekenler konusundaki görüşlerine göre dağılımı Table 5. Distribution of participants according to their views on the needs to be done to improve veterinary education in Turkey Katılımcılar Eğitimin İyileştirilmesi İçin Yapılabilecekler KS ÖS HKHÖS TVH Öğrenci n % n % n % n % n % Veteriner fakültelerine giriş puanı yükseltilerek Öğrenci kontenjanları azaltılarak Veteriner fakültesi sayısı azaltılarak Laboratuvar ve klinik dersleri açısından eğitimi güçlendirerek Üretici-yetiştirici-üniversite-özel sektör işbirliğini sağlayarak Öğrenim süresince uzmanlaşmayı sağlayarak Öğrenciler arasında eşitliği sağlayarak Öğrenim süresini ihtiyaca göre düzenleyerek Öğretim kadrolarının kalitesini artırarak Avrupa-dünya kalitesinde eğitim vererek Fakültelerde alt yapıyı destekleyerek Gereksiz derslerin azaltılmasıyla Diğer * Diğer ** Toplam n: Frekans; KS: Kamu sektörü; ÖS: Özel sektör; HKHÖS: Hem kamu hem özel sektör; TVH: Tüm veteriner hekimler; Diğer*: Ders kitapları ve kaynaklar zenginleştirilerek, klinik bölümleri birleştirilerek, veteriner hekimin yetki ve sorumluluklarını bilmesiyle, müfredatta akreditasyon sağlanarak, her fakültenin hastanesinin olmasıyla, öğrencinin katılımcı olduğu bir eğitim sistemiyle, fakültelerin eğitim ortamı açısından yenilenmesi ve kalitesinin arttırılmasıyla, okurken öğrenciye istihdam alanı yaratarak, gezici araçlarla klinik yapılarak, sürekli eğitim programları düzenleyerek, lisans ve lisansüstü eğitim yapan fakülteleri ayırarak, ders geçme kriterlerini yeniden düzenleyerek, yurtdışı eğitime önem vererek, öğretim üyesinin çabalarını takdir ederek, ayırıcı tanıya önem verilerek, öğrencilerin sosyal yaşam kalitesini arttırarak, geleceği gören yöneticilerle, probleme dayalı eğitimle, diğer veteriner fakülteleriyle dönem içinde öğretim görevlisi değişimiyle, veteriner fakültelerinin şehir merkezinden taşınmasıyla, mezun olmadan önce iki bitirme ödevi hazırlatarak, öğrenciye meslek sevdirilerek, teknolojiyi kullanamayan hocalar emekli edilerek, mesleğin toplumdaki saygınlığının arttırılmasıyla, veteriner fakültesi eğitimi verimli hale getirilemez, hasta kayıtları ve istatistiklerini tutarak, araştırmacı ve öğretim görevlisi kadrosunun arttırılmasıyla, fazla fakültelerin enstitüaraştırma merkezi haline dönüştürülmesiyle, TBMM deki veteriner hekim kökenli milletvekili sayısının arttırılmasıyla, coğrafi bölgeye göre ihtisaslaşma sağlanarak, derslerin hayvan türlerine göre ayrılmasıyla, hayvancılığın iyileştirilmesiyle, öğrenciye halkla ilişkiler-iletişim becerisi verilerek, gereksiz derslerin azaltılmasıyla, YÖK ü kaldırarak, teorik ve pratik derslerin aynı ortamda verilmesiyle, eğitimin modern ve teknolojik aletlerle yapılmasıyla, kaliteli ve istekli öğrenci alınmasıyla, veteriner fakültelerine ayrılan kaynakların arttırılmasıyla, veteriner hekimliği ile ilgili dalların diğer fakültelerin müfredatından çıkarılmasıyla, derslerin öğrencinin ilgi alanına göre seçilmesiyle, deontoloji ve etik dersleri önemsenerek, veteriner hekimliği ile ilgili insan kaynakları planlamalarıyla, akademisyenlerin çabalarının ödüllendirilmesiyle, yabancı dil eğitimine önem verilmesiyle, akademisyenlerin görev ihlalinde uyarılmasıyla, hocaların serbest piyasadan uzaklaşmasıyla; Diğer**: Eğitimde akreditasyon sağlanmalı, hayvan sağlığının önemi kavratılmalı, fakültelerde uygulama materyali olarak çeşitli ırk ve türden çok sayıda hayvan bulundurulmalı, eğitim teknolojik gereçlerle yapılmalı, mesleki İngilizce ders sayısı arttırılmalı, teorik ve uygulamanın birlikte verilmesiyle, öğrenciler ortaöğretim aşamasında veteriner hekimliğine yönlendirilmeli, topluma veteriner hekimin değeri anlatılmalı, veteriner fakültesi giriş puanları yükseltilmeli, fakültelere daha fazla kaynak aktarılmalı, kanatlı eğitimine önem verilmeli, eğitimde üç yıl temel bilimler, iki yıl intörnlük ve staj olmalı, ezberci eğitimden uzaklaşmalı, öğretim elamanları fakülteler arasında dönüşümlü olarak ders vermeli, bilinçli danışmanlık-bilinçli yetiştiricilik alt yapısı oluşturulmalı, eğitimde Avrupa Birliği standartları oluşturulmalı, veteriner fakültelerinin bireysel eğitime yönelmesiyle, gezici muayene aracı bulunmalı, yurtdışı öğrenci değişimine önem verilmeli, fakültelere sadece hayvan sevgisi olanların gelmesi sağlanmalı, veteriner hekimliği tıp hekimliği kadar önemsenmeli, öğrenciler not ile korkutulmamalı, iş bulma olanakları arttırılmalı, eğitim dili değişmeli, öğrenciye güvenildiği hissettirilmeli, fakültelerin araştırma olanakları arttırılmalı, Doktora öğrencisi ve araştırma görevlisi alınımında merkezi sınav olmalı, veteriner fakültesine alınacak öğrencilere ÖSS aşamasında mülakat yapılmalı, veteriner fakülteleri şehir dışında olmalı, eğitim Türkiye şartları ve sorunlarına yönelik olarak planlanmalı, hayvancılık politikaları düzenlenmeli, sınavlar adil olmalı, öğrencinin hasta sahibiyle iletişimini güçlendirmeye yönelik eğitim verilmesiyle, her dönem başı bir önceki dönemle ilgili sınav yapılmalı, özel şirket ve kliniklerle işbirliği içinde olmalı, öğrenciler bilimsel çalışmalara katılmalı, öğrencilere daha fazla ilgi gösterilmelidiyalog tarzında ders işlenmeli, deontoloji-etik aşılanmalı, öğrenciler ilk sınıflardan başlayarak yönlendirilmeli, veteriner hekimliğe faydası olacak dersler arttırılmalı, veteriner fakültesi çiftlikleri ve hastaneleri kurulmalı, sınav sistemi değişmeli, veteriner fakültelerine ve veteriner hekimlere önem verilmeli, müfredat fakültelerin bulunduğu şehrin potansiyeline göre şekillendirilmeli, veteriner hekimliği ile ilgili konferanslar ve seminerler arttırılmalı, eğitim süresi azaltılmalı, halkla birlikte çalışılmalı, günümüz şartlarında kaliteli eğitimin zorluğu, dersler daha anlaşılır hale getirilmeli, mesleği öğrenirken samimiyet ve özverinin olması, eğitim yelpazesi biraz daha genişletilmeli, veteriner fakültesi imajı değiştirilmeli, öğrenci ders geçmek için değil öğrenmek için çalışmalı, sektör ihtiyacına göre öğrenci alınmalı, öğretim elamanı-öğrenci ilişkisi güçlendirilmeli, kuruluşlarla odalar işbirliği içinde olmalı, geleceğe yönelik meslek stratejileri belirlenmeli

85 611 ÖZEN, DOĞAN, BAŞAĞAÇ GÜL ÖZKUL, YÜKSEL eğitiminin daha kaliteli hale getirilmesi için yapılması gerekenler konusundaki beklentileri açısından olumlu bir gelişme olarak değerlendirilebilir. Diğer yandan, katılımcıların fakülte sayısının ve öğrenci kontenjanlarının azaltılması yönündeki beklentilerinin en azından bir süre daha gerçekleşmeyeceği tahmin edilmektedir. Türkiye de veteriner fakültelerinin ve öğrenci kontenjanlarının fazlalığı; yaklaşık son otuz yıldır veteriner hekimliğin en önemli sorunları arasında gösterilmekte ve bu durumun yarattığı olumsuzluklara dikkat çekilmektedir 1-3. Fakülte sayısının fazlalığının, veteriner hekimliği eğitiminin kalitesi üzerindeki olumsuz sonuçlarına ilişkin öngörülere, sınırlı sayıda bilimsel çalışmada 5,16,17 da yer verilmiştir. Ancak bütün bu çabalar, yeni veteriner fakültesi kurulması girişimlerini engelleyememiş; 1980 li yıllara gelindiğinde dört olan fakülte sayısı 16, yılı itibariyle 19 u aktif olmak üzere toplam 1 e ulaşmıştır 18. Veteriner fakültelerinin sayısında yaşanan bu kontrolsüz artışın yanı sıra özellikle 1995 yılından itibaren öğrenci kontenjanlarında da aşırı bir artış gözlenmiştir. Uzunca bir süredir veteriner fakülteleri tarafından bildirilen kontenjanların üstünde öğrenci kontenjanı belirleyen Yüksek Öğretim Kurulunun, özellikle son yıllarda veteriner fakültelerinden fiziki koşullar dikkate alınmaksızın kontenjan artırımına gidilmesini istemesinin 14,15 ; Türkiye de veteriner hekimliği eğitim-öğretimine ilişkin mevcut tabloyu daha da sorunlu hale getireceği düşünülebilir. Sonuç olarak, Türkiye de veteriner hekimler ve veteriner fakültesi öğrencileri, veteriner fakültelerindeki eğitimi az verimli bulmakta; eğitimin şekli ve süresinin yeterliliği ni eğitimin güçlü yanları arasında; uygulamalı eğitimin yetersizliği ni ise eğitimin zayıf yanları arasında kabul etmektedirler. Katılımcılar, eğitimin daha kaliteli hale gelmesinin; uygulamaların arttırılması, fakülte sayısının ve öğrenci kontenjanlarının azaltılması ile sağlanabileceğini bildirmektedirler. KAYNAKLAR 1. Anonim: 1. Türk Veteriner Hekimliği Kurultayı Ön Rapor. Veteriner Hekimler Derneği, Ankara, Anonim:. Türk Veteriner Hekimliği Kurultayı Komisyon Raporları. Medisan Yayınevi Ltd. Şti., Ankara, Anonim: 3. Türk Veteriner Hekimliği Kurultayı Komisyon Raporları. Türk Veteriner Hekimleri Birliği, Ankara, Dinçer F: Türkiye Cumhuriyetinin 75. Yılında Veteriner Hekimliğinin Bilimsel Bilançosu. In, Türkiye Cumhuriyeti nin 75. Yılında Bilim Bilanço Ulusal Toplantısı. I. Kitap, I. Cilt. TÜBİTAK Matbaası, Ankara, , Özen R, Özen A: Veterinary education in Turkey. JVME, 33, , Tito F: VET 00 Current Aspect of Veterinary Profession and Education in Europe. SOCRATES Thematic Network Project 1004-CP-1-(99)000-1-PT-ERASMUS-ETN. VET 00 Development of European Educational Strategies: Design of Veterinarian Profiles Identified by Market Needs for the Year 00, Krejcie RV, Morgan DW: Determining sample size for research activities. Educational and Psychological Measurement, 30, , Bilgin N: Sosyal Psikolojide Yöntem ve Pratik Çalışmalar. Sistem Yayıncılık, İstanbul, Kasapoğlu A: Tıp Eğitimi Uygulamalı Sosyolojik Bir Araştırma. Ankara Üniversitesi Basımevi, Ankara, Savaşır I, Şahin NH: Bilişsel-Davranışçı Terapilerde Değerlendirme: Sık Kullanılan Ölçekler. Türk Psikoloji Derneği Yayınları, Ankara, Özen A, Ateş BK: Sosyo-kültürel değişkenler ışığında veteriner hekimliğin profili: I. Sınıf bilinci ve iş doyumu. Veteriner Bil Derg, 19 (1-): 39-48, Özen A, Ateş BK: Sosyo-kültürel değişkenler ışığında veteriner hekimliğin profili: II. Mesleki örgütlenme. Veteriner Bil Derg, 19 (1-): 49-56, Özen A, Yüksel E, Özen R, Atıl E, Yaşar A, Yerlikaya H: A study on life satisfaction of Turkish veterinary practitioners. FÜ Sağ Bil Derg, 1, 5-10, Başağaç Gül RT: Veteriner Tarihi Ders Notları. Ankara Üniversitesi Veteriner Fakültesi Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı, Ankara, Anonim: Akreditasyon Dosyası. Ankara Üniversitesi Veteriner Fakültesi Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı Arşivi, Ankara, Dodurka T: Yeni Veteriner Fakülteleri Açılmasın! abveteriner.org/default.asp?sayfa=133&bolum=1&altbolum=133, Erişim tarihi: Yerlikaya H: Artan Fakülte Sayısı ve Veteriner Hekimliği Üzerine Etkileri. In, Yaşar A, Yiğit A, İzmirli S (Eds): II. Ulusal Veteriner Hekimliği Tarihi ve Mesleki Etik Sempozyumu Bildiriler Kitabı. ME-SA Digital Kopyalama Merkezi, s , Konya, Anonim: Veteriner fakülteleri kliniklerinde türe yönelik yapılanma. Erişim tarihi:

86 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Prevalence of Salmonella in Edible Offal in Afyonkarahisar Province, Turkey Levent AKKAYA * Halil İbrahim ATABAY **&*** Veli GÖK **** Hilmi YAMAN ***** * Department of Food Hygiene and Technology, Faculty of Veterinary Medicine, Balıkesir University, TR Balıkesir - TURKEY ** Department of Medical Microbiology, Faculty of Medicine, Sifa University, TR Bornova, İzmir - TURKEY *** Department of Food Engineering, Izmir Institute of Technology, TR Urla, İzmir - TURKEY **** Department of Food Engineering, Faculty of Engineering, Afyon Kocatepe University, TR Afyonkarahisar - TURKEY ***** Department of Food Hygiene and Technology, Faculty of Veterinary Medicine, Afyon Kocatepe University, TR Afyonkarahisar - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, the prevalence of Salmonella sp. was examined using a total of 05 edible bovine offal samples collected from different abattoirs (n=105) and butcheries (n=100) by immunomagnetic separation (IMS) method. The isolation rate of Salmonella was found to be 8.57%, 5.71% and 5.71% for the liver, kidney and tripe samples collected from the abattoir, respectively. Of the offal samples obtained from the butcheries, the detection rate of Salmonella sp. was 16% in the liver and 4% in the kidney, tripe and brain samples. Overall, it was found that 8.9% of all the offal samples obtained from the abattoirs and butcheries were determined to be contaminated with Salmonella sp. The results of this study shows that edible offal are cross-contaminated by Salmonella sp. at the abattoirs and retail sale points until they reach to the consumer. It is recommended that adequate hygienic and sanitary measures be taken in these kind of places in order to protect public health. Keywords: Salmonella, Edible offal, Abattoir, Butcher, IMS Özet Afyonkarahisar İlindeki Yenebilir Sakatatlarda Salmonella nın Prevalansı Bu çalışmada, farklı kesimhane (105 adet) ve kasaplardan (100 adet) temin edilen toplam 05 adet yenebilir sakatat örneği, Salmonella türlerinin prevalansını belirlemek amacıyla immunmanyetik ayırma tekniği (IMS) kullanılarak incelendi. Salmonella izolasyon oranı kesimhaneden alınan karaciğer, böbrek ve işkembe örnekleri için sırasıyla %8.57, %5.71 ve %5.71 olarak saptandı. Kasaplardan temin edilen sakatat örneklerinde ise Salmonella saptama oranı karaciğerde %16, böbrek, işkembe ve beyin örneklerinde ise sırasıyla %4 olarak belirlendi. Genel olarak, bu çalışma kapsamında kesimhane ve kasaplardan temin edilen tüm sakatat örneklerinin %8.9 oranında Salmonella ile kontamine olduğu belirlenmiştir. Bu çalışmanın bulguları, yenebilir sakatatların tüketiciye ulaşıncaya kadar kesimhane ve perakende satış noktalarında Salmonella ile çarpraz kontaminasyona maruz kaldığını göstermektedir. Halk sağlığını korumak amacıyla bu gibi yerlerde yeterli hijyen ve sıhhi önlemlerinin alınması tavsiye olunur. Anahtar sözcükler: Salmonella, Yenilebilir sakatat, Kesimhane, Kasap, IMS INTRODUCTION Salmonella cause a variety of zoonotic infections in humas and animals. Salmonella spp. are naturally present in the intestines of humans and animals and contracted by humans through ingestion of contaminated foods and water 1,. Salmonellosis is manifested by enteric fever (typhoid), septicemia and gastroenteritis in humans 3. The İletişim (Correspondence) halil.atabay@sifa.edu.tr

87 614 Prevalence of Salmonella in... micro-organisms are disseminated by the carrier animals which do not manifest any clinical sign and therefore the infected animals can not readily be detected at the abattoirs 4. Salmonellosis is reported as one of the leading causes of foodborne diseases in most countries such as Germany, France, Spain, Sweden, England, the US and Canada 3,5-8, which also cause increasing big economic losses 5. Animal offal which are edible parts of internal organs such as liver, kidneys and spleen are widely consumed in Turkey by tradition 9. Although the offal are rich at mineral and vitamin contents they have high loads of micorganisms 10. They can be contaminated more frequently than animal carcasses by Salmonella. It has been repoted that offal samples (36%) were more frequently contaminated with Campylobacter and Salmonella than muscle tissue (7%) 11. Sinell 1, found very high Salmonella contamination of raw offal meat sold in retail concluding that a health risk may arise due to consumption or direct contact or inadequately heat process. This was confirmed by Cornell and Neal 13, who reported an food poisoning outbreak of Salmonella typhimurium related to tripe and chitterlings in UK. This investigation was instigated by the scarcity of the published information at determining the prevalence of Salmonella sp. in edible bovine offal obtained from different abattoirs and butcheries in Afyonkarahisar province of Turkey. MATERIAL and METHODS Samples A total of 05 edible bovine offal (liver, kidney, brain and tripe) samples were collected from 5 abattoirs (n=105) and from 5 different butcheries (n=100) present in Afyonkarahisar province of Turkey. The samples were examined by immunomagnetic separation method (IMS). The abattoir samples consisted of liver, kidney and tripe (35 of each) and the samples obtained from butcheries included liver, kidney, brain and tripe samples (5 of each). The samples were kept in cool environment (+4 C) and immediately transported to laboratory for analyses. Detection of Salmonella sp. For the isolation of Salmonella sp., 5 g of each sample was homogenised in 5 ml of Buffered Peptone Water (BPW) (Oxoid, CM0509) and incubated at 37 o C for 4 h. All the samples enriched in BPW were subjected to IMS technique in order to concentrate Salmonella sp. The IMS technique was performed according to manufacturer s instructions 14. Briefly, 1 ml of the enriched culture and 0 µl of Dynabeads 14 were mixed in an eppendorf tube, and incubated with continuous mixing for approx. 10 min at room temperature and rotated about 3 min using a vortex 14. A magnetic field was applied to the side of the tube for about 3 min, and the beads with any adherent of Salmonella sp. were drawn to the side of the tube. The supernatant was carefully removed by aspiration and the beads were re-suspended in 1 ml phosphate-bufferedsaline-tween (PBS, Sigma) by mixing for a few min. This washing step was repeated twice. After the final washing, the beads were re-suspended in 100 µl of washing diluent and resuspended bead-bacteria complexes were transferred into Rapoport Vasilliadis Soya Peptone Broth (RVSB, Oxoid, CM866) and incubated at 4 o C for 18-4 h. After post selective enrichment of the bead-bacteria complexes, 50 µl of the Dynabeads-Salmonella complexes were streaked onto Modified Brillant Green Agar (MBGA, Oxoid, CM039) plates and Xylose-Lysine-Desoxycholate (XLD, Oxoid, CM469) agar plates and incubated at 37 o C for 18-4 h. Three suspected colonies per plate were picked up and re-streaked onto Tryptone Soya Agar (TSA, Oxoid, CM131) in order to purify the colonies. The isolated colonies were biochemically characterized by inoculating into Urea Broth (Oxoid, CM0071), Lysine Decarboxylase Broth (Oxoid, CM0308) and Triple Sugar Iron (TSI, Oxoid, CM077) slants. Microbact TM 4E Gram-Negative Identification System (Oxoid, MB1074A) was employed for further characterization of the isolates according to manufacturers instructions 15. RESULTS Out of 105 edible bovine offal samples examined, seven (6.66%) of them were found positive for Salmonella sp. The prevalence of Salmonella sp. was determined to be 8.75%, 5.71% and 5.71% in the liver, kidney and tripe samples, respectively. The recovery rate of Salmonella sp. was 10% (10 of the 100 examined) for the samples obtained from the butcheries. The contamination rates of Salmonella spp. were found to be 16% in the liver and 4% in each of the kidney, tripe and brain samples obtained from the local butcheries. In total, the overall prevalence of Salmonella sp. was 8.9% (17 positive out of the 05 examined) for all the samples examined in this study. The contamination level of the liver was determined slightly higher than that of the other samples (see Table 1 for details). DISCUSSION It is reported that consumption of meat and meat products constitutes 54.7% of all food poisining cases 5. The existence of Salmonella in foods are not permitted and their presence in foods pose a significant risk for public health 16,17. Animal carcasses and their offal are unavoidably contaminated during evisceration from the intestinal tracts of the slaughtered animals and the extent of microbial contamination of the meat and meat products also depend on a number of other factors such as the level of implementation of hygienic standards during slaughter, dressing, transport, storage and further processing, and other environmental 18. The prevalence of Salmonella sp. in various types of meat and meat products was found to be very common in studies conducted in different countries 4,11,18-0

88 615 AKKAYA, ATABAY GÖK, YAMAN Table 1. Prevalence of Salmonella sp. in edible bovine offal Tablo 1. Yenebilir sığır sakatatlarda Salmonella sp. varlığı Abattoirs Liver Kidney Rumen Brain Total A A A A A Total A 8.57% (35/3) 5.71% (35/) 5.71% (35/ ) % (105/ 7) Butcheries B B B B B Total B 16% (5/4) 4% (5/) 4% (5/) 4% (5/) 10% (100/10) Total (A+B) 11.66% (60/7) 6.66% (60/4) 6.66% (60/4) 4% (5/) 8.9% (05/17) A: Abattoir Sample; B: Retail Butcheries Sample as well as in Turkey 1,. The incidence of Salmonella sp. in edible offal was also investigated by many researchers. Samuel et al. 3 detected 3% of the liver samples colected from the abattoirs to be positive for this organism. The level of Salmonella contamination was reported to be 68.9% and 8.9% in bovine lung and tripe samples, respectively, in Germany 4. Fifty-three percent of the calf liver were found positive for Salmonella by Van Klink et al. 5. The level of contamination was 6.1, 3.1 and 3.6% in bovine, sheep and pig offal samples, respectively, in a study conducted by Little et al. 11. In a study performed by Uluturk 6, in Turkey, none of the liver and tripe samples collected from abattoirs were determined to be positive, however, the contamination level of Salmonella was 33.3% in the liver and tripe samples obtained from the local markets. Keven and Ay 7, also reported the same findings from Turkey that none of the liver, tripe and brain samples from abattoirs were found positive, however,.%,.1% and 3.3% of the liver, tripe and brain samples, respectively, obtained from markets were positive and 3.3%,.% and 7.7% of the liver, tripe and brain samples obtained from local butcheries were positive for Salmonella sp. The recovery rates of Salmonella sp. were 10% for the liver and tripe samples and 0% for the brain samples obtained from local butcheries in another study performed in Turkey 8. The highest level of contamination of Salmonella sp. was reported from the brain samples in some studies conducted by Ulutürk 6, Keven ve Ay 7 and Oflaz 8 and from the lung samples by Sinell et al. 4 and from the liver samples by Samuel et al. 3 and Van Klink et al. 5. The highest recovery rate of Salmonella sp. was from the liver samples obtained both from the abattoirs (8.57%) and butcheries (16%) in the current study. In the present study, the prevalence of Salmonella sp. was determined to be slightly higher in the samples collected from the local butcheries (10% versus 6.66%) than that of the samples from abattoirs. The presence of Salmonella sp. in the samples from two places indicates that there are multiple sources of contamination that cross-contamiante the offal during handling and processing post-slaughter and also reflects the intestinal bacterial load of slaughtered animals and hygienic standards of the premises. The level of microbial contamination at abattoirs varies depending on the aplication of quality control systems such as HACCP (Hazard Analysis and Critical Control Point) and GMP (Good Manufacturing Practice). In a study conducted at five different abattoirs in the same area, the prevalence of Salmonella was 11.4, 16.0 and 3.4 % in samples taken from abattoir workers, equipments and abattoir environment, respectively 7. A relatively lower level of contamination encountered in the current investigation implies better application of hygienic procedures from slaughter to retail trade until it reaches to consumer in this area. In another study undertaken by Akkaya et al. 9,30 in Afyonkarahisar province, processes such as slaughter, cooling and transport play important roles on the cross contamination of cattle carcasses. Studies performed on butcher personnel and their equipments revealed that hygiene principles are not followed properly by the personnel and the equipments used by those people have important effect on cross contamination of meat, which pose a significant risk for human health 31,3. In conclusion, it is essential that HACCP systems and Good Manufacturing Practice (GMP) involving the whole processes from farm to table should be introduced and properly implemented in order to control Salmonella

89 616 Prevalence of Salmonella in... infections of humans that result from edible offal. In this regard, control strategies such as prevention of contamination of animal feed and abattoir environment by Salmonella, strict implementation of antemortem and postmorten analyses in abattoirs and application of proper hygienic conditions by personnel working in meat industry and cleaning/disinfection of the equipments and machines used for prosessing are important to minimize and/or prevent infections caused by these pathogenic microorganisms. REFERENCES 1. Van Netten P: Decontamination of fresh meats: pitfalls and opprtunities. In, Amgar A (Ed): Food Afety 96. Proceedings of Fourth Asept International Conferance. pp , Wells SJ, Fedorka-Cray PJ, Dargartz DA, Ferris K, Gren A: Feceal shedding of Salmonella spp. by dairy cows on farm and at cull caw markets. J Food Prot, 64, 3-11, Miller S, Hohmann E, Pegues D: Salmonella (Including S typhi). In, Maldell GL, Bennett JE, Dolin R (Eds): Principles and Practice of Infectious Diseases. pp , Churchill Livingstone, Philadelphia, US McEvoy JM, Doherty AM, Sheridan JJ, Blair IS, Mcdowell DA: The Prevalance of Salmonella spp. in bovine faecal, tripe and carcass samples at a commercial abattoir. J App Microbiol, 94, , Cliver OD: Foodborne Disease. pp. 4-8 Academic Press Ltd, Oval Road, Londan, D Aoust JY: Salmonella Species. In, Doyle MP, Beuchat LR, Montville TJ (Eds): Food Microbiology Fundamentals and Frontiers. pp , ASM Press, Washington DC, Eley AR: Microbiological Food Poisoning. Champmann & Hall, London Todd ECD: Foodborne Disease in Canada- a 10 year summary from J Food Prot, 5 (): Nazlı B, Çolak H, Hampıkyan H: İstanbul piyasasında satışa sunulan sakatatlarda bazı anabolizan kalıntılarının mevcudiyeti üzerine bir çalışma. İstanbul Üniv Vet Fak Derg, 31 (1): 83-9, Oztan A: Et Bilimi ve Teknolojisi, TMMOB-Gıda Mühendisleri Odası Yayınları, Ankara, Little CL, Richardson JF, Owen RJ, De Pinna E, Threlfall EJ: Campylobacter and Salmonella in raw red meats in the United Kindom: Prevalence, characterization and antimicrobial resistance pattern, Food Microbiol, 5, , Sinell H J: Microflora of edible offal with particular referance to Salmonella. In, Kiss I, Deak T, Incze K (Eds): Microbial Associations and Interactions in Food. 1 th International IUMS-ICFMH Symposium, Budapest, Hungary, pp. 37-4, Cornell J, Neal KR: Protracted outbreak of Salmonella typhimurium definitive phage type 170 food poisining related to tripe, pig bag, and chitterlings. Communicable Disease and Public Health, 1, 8-30, Dynal: Biotech Inc., Norway, Accessed: Anonymous: International organisation for standardisation ISO. Switzerland, 15, Foster FJ, Fowler LJ, Ladiges WC: A bacterological survey of raw ground beef. J Food Prot, 40 (11): , Anonymous: Advisory committee on the microbiological safety of food. Report on verocytotoxin-producing Escherichia coli. London: HMSO, Soner A, Ertaş AH, Uzumcuoglu U: Effect of processing conditions on the quality of naturally fermented Turkish sausages (sucuks). Meat Sci, 69, , Stolle FA: Salmonella contamination of equipment and beef carcasses in the Berlin slaughterhouse evaluated by various enrichment procedures. J Food Safety, 8, 11-18, Mrema N, Mpuchane S, Gashe BA: Prevalence of Salmonella in raw minced meat, raw burger patties from retail outlets in Gaborone, Botswana. Food Control, 17, 07-1, Sırıken B, Pamuk S, Özakın C, Gedikoğlu S, Eyigör M: A Note on the incidence of Samonella spp., Listeria spp. And Escherichia coli O157:H7 Serotypes in Turkish Sausage (Soudjouk). Meat Sci, 7, , Akkaya L, Alisarli M, Cetinkaya Z, Telli R, Gok V: The prevalence of Escherichia Coli O157/O157:H7, Listeria Monocytogenes and Salmonella spp. on bovine carcasses in Afyonkarahisar province, Turkey. J Muscle Foods, 19 (4): 40-49, Samuel JL, O Boyle AD, Mathers JW, Frost AJ: The Contamination with Salmonella of bovine livers in an Abattoir. Aust Vet J, 56, 56-58, Sinell HJ, Klingbell, Benner M: Microflora of edible offal with particular reference to Salmonella. J Food Prot, 47 (6): , Van Kink GM, Smulders JM: A comparison of different enrichment media fort he isolation of Salmonella Dublin from livers, kidneys and muscles of Salmonella-psitive veal calves. Int J Food Mic, 10, , Ulutürk O: Ankara piyasasında tüketime sunulan sakatatın Salmonella kontaminasyonu yönünden incelenmesi. Yüksek Lisans Tezi, Ankara Üniv. Sağlık Bil. Enst., Keven F, Ay S: Çiğ ve pişmiş sakatatta Salmonella kontaminasyonu. İnfeksiyon Dergisi, 17 (): , Oflaz M: Çiğ ve pişmiş sakatatta Salmonella görülme sıklığı. Yüksek Lisans Tezi, Cumhuriyet Üniv. Sağlık Bil. Enst., Akkaya L, Alısarlı M, Cetinkaya Z, Kara R, Telli R: Occurrence of Escherichia Coli O157:H7/O157, Listeria Monocytogenes and Salmonella spp. in beef slaughterhouse environments, equipment and its workers, Afyonkarahisar province, Turkey. J Muscle Foods, 19 (3): 61-74, Akkaya L, Kenar B, Alısarlı M, Gurler Z: Sığır karkaslarının yüzeysel mikroflorasına mevsimin ve kesim sonrası işlemlerin etkisi. Veterinarium, 16 (1): 15-3, Turan G: Bursa yöresinde bulunan değişik gıda işletmelerinin hijyenik durumları üzerine araştırmalar. Yüksek Lisans Tezi, Uludağ Üniv. Sağlık Bil. Enst., Alemdar S: Van ili et satış yerlerinde çevre ve personel hijyeni üzerine araştırmalar. Yüksek Lisans Tezi, Yüzüncü Yıl Üniv. Sağlık Bil. Enst., 1999.

90 Kafkas Univ Vet Fak Derg 18 (4): 617-6, 01 DOI: /kvfd RESEARCH ARTICLE Detection of Brucella spp. in Vaginal Swab Samples of Aborting Cattle: Comparison of Immunoperoxidase to Bacteriological Culture Technique [1] Serpil DAĞ * Fatih BÜYÜK ** Hasan ÖZEN * Özgür ÇELEBİ ** Musa KARAMAN * Doğan AKÇA *** Mitat ŞAHİN ** [1] This study was supported by Kafkas University BAP (Project No: 010-VF-38) * Department of Pathology, Faculty of Veterinary Medicine, Kafkas University, TR Kars - TURKEY ** Department of Microbiology, Faculty of Veterinary Medicine, Kafkas University, TR Kars - TURKEY *** School of Health, Kafkas University, TR Kars - TURKEY Makale Kodu (Article Code): KVFD Summary Brucellosis is an important disease in terms of economic losses in cattle breeding. Brucella spp. associated abortion is common in Kars, Turkey. Determination of Brucellosis cases therefore poses great importance. In this study, an immunochemical staining technique was tested in detecting cattle with Brucellosis and compared to bacteriological culture technique. Post-abortion, total of 61 vaginal swab samples were collected from cows. Brucella spp. were isolated from 5 animals by cultural method. All Brucella isolates were identified as Brucella abortus field strain and biotyped as B. abortus biotype 3. Smears prepared from culture positive vaginal samples were stained by immunoperoxidase technique, and out of 5 animals were detected as Brucella-positive. Sensitivity and specificity of the immunoperoxidase technique were calculated as 88% and 9%, respectively. Keywords: Brucella, Immunoperoxidase, Bacteriology, Cattle Abort Yapan Sığırların Vajinal Sıvap Örneklerinden Brucella spp. Tespit Edilmesi: İmmunoperoksidaz ve Bakteriyolojik Kültür Yönteminin Karşılaştırılması Özet Brusellozis sığır yetiştiriciliğinde ekonomik kayıplara neden olan önemli bir hastalıktır. Kars ta Brucella spp. nedenli abortlar oldukça yaygındır. Bu nedenle Brusellozis olgularının tespiti büyük önem arz etmektedir. Bu çalışmada; Brusellozisin tespiti amacıyla immunokimyasal boyama yöntemi test edildi ve bakteriyolojik kültür yöntemi ile karşılaştırıldı. Abortu takiben toplam 61 vajinal svap örneği ineklerden toplandı. Kültür yöntemi ile 5 hayvanda Brucella spp. izole edildi. Tüm Brucella izolatları Brucella abortus saha suşu olarak identifiye edildi ve B. abortus biyotip 3 olarak tiplendirildi. Kültür pozitif vajinal örneklerden hazırlanan sürme preparatlar immunoperoksidaz yöntemi ile boyandı ve 5 hayvandan si Brucella pozitif tespit edildi. İmmunoperoksidaz yönteminin duyarlılığı ve özgüllüğü sırasıyla %88 ve %9 olarak hesaplandı. Anahtar sözcükler: Brucella, İmmunoperoksidaz, Bakteriyoloji, Sığır INTRODUCTION Brucellosis is an important and highly contagious zoonotic disease worldwide 1,. It causes prominent economic losses due to abortion, stillbirth, infertility, drop in milk and meat production and loss in breeding capacity in cattle. The etiologic agent of cattle brucellosis is Brucella abortus, which is the number one cause of bacteriological İletişim (Correspondence) serpildag06@hotmail.com

91 618 Detection of Brucella spp. in... abortions, though B. melitensis and B. suis might also be responsible for infection 3-7. The spread of the infection is mostly via aborted fetus, fetal membranes, lochia, urine, non-pasteurized milk and milk products 8. Brucella spp. are Gram negative, aerobic, coccobacilli shaped, non-motile, non-spore forming, facultative intracellular pathogens with low metabolic activity and size of 0.5x0.7x1.5 µm 9. Brucella spp. are as well the most important bacterial agent of abortion in cattle in Turkey 5,10. Prevalence of Brucellosis in serological surveys was recorded as 1% in Kırıkkale 11, 15% in Kayseri 1, % in Van 13, % in Burdur 14, and 53.8% in Kars 15. In Northeastern Turkey, Brucella spp. in aborted fetuses were determined as 4.5% and 74.4% in Erzurum 5,10 and 40%, 41.3%, and 59.7% in Kars 5,6,16 by bacteriological technique. Bacteriological and serological means are widely used in determination of Brucellosis. However, bacteriological culture technique, which is accepted as the unequivocal method in detection of Brucella spp., takes long time, and serological tests give cross reactions and false readings due to vaccinated animals 17,18. The purpose of this study is to apply immunoperoxidase staining technique, and to compare the results of it to that of bacteriological culture technique in diagnosis of Brucellosis in smears prepared from vaginal swab samples collected post-abortion in cattle. Therefore, the current investigation is aimed to rapid and reliable detection of Brucellosis, which is the major cause of abortion in Kars province, Turkey. MATERIAL and METHODS Vaginal Swab Samples This research (Study No: 06/9) was approved by the animal local ethics committee, Kafkas University. The study materials of vaginal swab samples were collected on February to May 008 and March 009 to March 010 in Kars province from those aborting cows that were known to be non-vaccinated against Brucella. For bacterial isolation total of 61 vaginal swab samples were cultured. Total of 75 smear samples of which 5 from Brucella culture positive vaginal swab samples, 5 from randomly chosen Brucella culture negative swab samples and 5 from Brucella culture were used for immunoperoxidase staining. Sample collection sites and number of Brucella positive and negative vaginal swab samples were listed in Table 1. Bacterial Isolation and Identification Vaginal swab samples were collected and then inoculated onto 7% defibrinated sheep blood agar (Oxoid, CM071) and onto Brucella Medium Base (Oxoid, CM0169) containing Brucella Selective Supplement (Oxoid, SR083). The inoculated plates were incubated at 37 C in aerobic and microaerobic environment for 4 to 7 days. Following incubation, Brucella spp. suspected colonies were characterized by colony morphology, Gram staining, oxidase, catalase and urease activities. Agglutination test using A and M monospecific antisera, H S activity, stain susceptibility tests and Tbilisi phage typing were also performed for identification and biotyping. Identification of isolates as field or vaccine strains were made based on growing in the presence of penicillin and I-erythritol 19. As control strains, B. abortus biotype 1, B. abortus biotype, B. abortus S19 and B. melitensis biotype 1, B. melitensis biotype obtain from Pendik Veterinary Control and Research Institute were used. Immunoperoxidase Technique A total of 75 smear samples prepared from 5 Brucella culture-positive and 5 Brucella culture-negative vaginal swab samples and 5 Brucella culture medium were used in immunoperoxidase technique. All smear samples were stained by avidin-biotin immunoperoxidase staining method as follow; smears were fixed in alcohol and then treated with 3% H O for 30 min to block endogenous peroxidase activity. Antigen retrieval was succeeded by application of 1% Trypsin solution at 37 C for 5 min. Following three times washes in 0.1 M Phosphate Buffered Saline (PBS), ph 7.4, non-specific staining was blocked by 10% non-immune goat serum for 30 min. Then, smears were incubated for 30 min with rabbit anti-brucella polyclonal antibody (Becton Dickinson, Cat No: 40934) diluted 1:50 with PBS. Biotinylated secondary antibody and Streptavidin peroxidase complex (Zymed Histostain- Plus Bulk Kit, Cat No: ) were consecutively applied for 30 min each, and three times PBS washes were performed between the applications. Antibody binding was visualized by color development using 3,3 diaminobenzidine/h O. Finally, the sections were counterstained with Harris hematoxylin, rinsed with tap water, immune-mounted and observed under a light microscope. Negative controls of the staining were done by replacing primer antibody with PBS. As positive control, smears prepared from B. abortus standard strain were used. Quantitative Assessment of Immunoperoxidase Technique Findings A semi-quantitative grading scale was applied. Smears stained with immunoperoxidase technique were observed in 5 randomly chosen fields under x 100 objective and the numbers of stained bacteria were counted and the means were calculated. The results were scored as follow; (-) No bacteria, ( +) 1-10 bacteria, ( ++) 11-5 bacteria, ( +++) >5 bacteria. Sensitivity and specificity of the immunoperoxidase technique were determined based on the formula described by Moore et al. 0.

92 619 DAĞ, BÜYÜK, ÖZEN, ÇELEBİ KARAMAN, AKÇA, ŞAHİN RESULTS Results of the bacterial isolation were summarized in Table 1. In cultural method, Brucella spp. were isolated in 5 (9.57%) out of 61 vaginal swab samples. Brucella spp. Table 1. Number of vaginal swab samples, locations and number of Brucella isolation Tablo 1. Vajinal sıvap örnek sayısı, örnek odakları ve Brucella izolasyon sayısı Location Number of Samples Collected Number of Brucella Isolation Digor 0 Kağızman 1 Kars/Merkez Selim Susuz 5 0 Total 61 5 isolation from the vaginal swab samples were succeeded by both Brucella selective agar and Sheep blood agar. The most successful bacterial isolation was accomplished in those samples that were collected 3-30 days postabortion, and less were from the samples collected longer than 91 days post-abortion. Suspected colonies were characterized as Brucella spp. by microscopic morphology, positive oxidase, catalase and urease activities. All Brucella isolates were identified as B. abortus by their CO requirement at initial growth, positive H S activity, and Tbilisi phage susceptibility. All B. abortus strains were biotyped as B. abortus biotype 3 by positive reaction with antiserum A and negative reaction with antiserum M via slide agglutination test and growth in the presence of basic Fuchsin and Thionin. The results of the immunoperoxidase technique were detailed in Table. All of the smears prepared from Brucella culture media gave positive results by immunoperoxidase. Out of 5 Brucella culture positive vaginal Table. Data about abortion time, sample collection time post-abortion, and results of immunoperoxidase technique with bacterial intensities in smears prepared from Brucella culture positive vaginal samples Tablo. Abort zamanı, abortu takiben örnek toplamaya kadar geçen süre ve Brucella kültür pozitif vajinal örneklerden hazırlanan sürme preparatlarda bakteri yoğunluğu ile immunoperoksidaz yönteminin sonuçları Case No Estimated Abortion Time (m) in Gestation Time past Post-abortion until Collection of Samples Immunoperoxidase Technique Bacterial Intensity in Smear m m d d m m d m m m d ND m ND m ND 10 d ND 1 m m d d m m m d Stillbirth d d Stillbirth 40 d + ++ ND: Not determined, d: day, m: month

93 60 Detection of Brucella spp. in... swab samples, showed positive immunoreactivity for Brucella (Fig. 1a,b,c). These positive stained bacteria were observed as single or mostly in aggregates. In smears prepared from Brucella culture negative samples, false positive immunoreactivities were detected. Brown stained coccobacilli shaped bacteria in smears prepared from the culture media were observed mostly in large groups and less as single or groups of 3 to 5 (Fig. ). All of the smears Fig 1. Low (a), moderate (b), and high (c) intensity immunopositive reactions for Brucella spp. in smears prepared from vaginal swab samples Şekil 1. Vajinal sıvap örneklerinden hazırlanan sürme preparatlarda Brucella spp. için düşük (a), orta (b) ve yüksek (c) yoğunlukta immunopozitif reaksiyonlar prepared from Brucella culture positive vaginal samples showed positive immunostaining. No immunostained bacteria were observed in negative controls. Out of 5 Brucella culture positive samples, 1 were determined to have abortion within the first two months. These animals, with only one exception, also showed great bacterial intensity in vaginal samples. Two samples collected from animals 3 months post-abortion showed positive immunostaining with low to moderate bacterial intensity. Total of 3 samples, two collected from animals aborted within the two months and one collected at 4 months post-abortion, did not show positive immunoreactivity. Fig. Positive immunoreactivity in a smear prepared from Brucella positive bacteriologic culture Şekil. Brucella pozitif bakteriyolojik kültürden hazırlanan sürme bir preparatta pozitif immunoreaktivite Compared to the bacteriological culture technique, immunoperoxidase staining showed 1% false negative and 8% false positive immunoreactivity. According to these results, sensitivity and specificity of the technique were calculated as 88% and 9%, respectively.

94 61 DAĞ, BÜYÜK, ÖZEN, ÇELEBİ KARAMAN, AKÇA, ŞAHİN DISCUSSION Kars province is an important location for cattle breeding in Turkey. As in most other cities in Turkey, Brucellosis is an endemic disease in Kars 1,. Abortion in cattle in this location is the most devastating breeding problem in terms of economic losses. Brucella spp. are long known to be the most causative bacterial agents of abortion in cattle. Bacterial isolation of Brucella spp. in aborted fetuses at high levels in previous surveys indicates that the agent is the most important abortion cause in this city 5,6,16. Besides abortion especially in the last trimesters of gestation, Brucella spp. might cause stillbirth and birth with low survival chance in cattle. In accordance with the literature, animals surveyed in this study mostly had abortion in the last part of gestation and few had stillbirth. Spread of Brucella agents in cattle mostly occurs through aborted fetus, fetal membranes, urine, uteral and vaginal secretions 8,3. It has been reported that the agent could be shed in vaginal excretions for 6 weeks post-abortion 19. Brucella agents could also be present in the uterus for 00 days post-abortion 4. In the present study, the highest bacterial isolation was detected in vaginal swab samples of animals that had abortion within months. Similarly, smears prepared from these samples showed the highest bacterial presence. We have shown that the bacteria can be isolated from the vaginal swabs up to 4 months postabortion, however no immunopositive reactivity were able to be detected in smears at that time. Based on the results, up to 3 months, Brucella agents were detectable in smears by immunoperoxidase technique. These findings prove that the vaginal secretions at least 3 to 4 months pose big risk for the spread of disease. In the current investigation, isolation of bacteria from vaginal swab sample in an animal that had abortion 1 year ago was thought to be due to presence of metritis in the animal. False positive immunoreactivity in two samples that were negative by bacteriological mean was related to possible contamination of the samples. Abortion in cattle especially in the last trimesters of gestation in endemic locations could be greatly related to Brucella spp., however final diagnosis is still required. Diagnosis of Brucellosis is generally based on direct or indirect laboratory techniques 19,5. Direct diagnosis of the agent could be made by microscopic investigation of stained smears by modified Ziehl-Neelsen and Köster methods. However, bacterial morphology of Brucella spp. in these techniques might be confused with Chlamydophila abortus and Coxiella burnetii 5,6. Bacterial isolation and identification is the golden standard in determining Brucella spp. Although bacteriological technique is quite a specific method its sensitivity might vary greatly depending on the agent s survival within the sample, type of sample, and the number of samples tested. The technique also has some other drawbacks such as, it is time consuming; might result with no bacterial isolation from samples with low bacteria and in chronic disease cases; requires a special laboratory environment; and poses risk for zoonotic spread to laboratory personal 17,19. Polymerase chain reaction (PCR) has become a commonly used method for identification of a variety of agents including Brucella spp. 7. PCR has high sensitivity; however it might have a great variation in specificity. Although the technique could detect those agents that are difficult to determine with conventional techniques, it takes time and money. Requirements for a special laboratory equipment and skilled personal are some other disadvantages of PCR technique. In addition, false positive and false negative results might be seen in varying degrees due to need for standardization 8. Although commercial kits are greatly standardized for Brucella spp., they are quite expensive and, therefore they could be used in limited samples. Moreover, since PCR technique also detects DNA segments from death bacteria the results might not be useful in post-treatment studies. Indirect detection of Brucella spp. could be made by serological techniques. Agglutination test, complement fixation test and ELISA are often the methods used for this purpose 9,30. These methods are mostly useful in vast surveillance or in eradication studies. However, low sensitivity and specificity due to vaccinations, previous infections and cross reactions with other Gram negative bacteria might hamper its use 18. Immunoperoxidase technique has become a widely used technique in many areas, including cancer and bacterial disease research. Due to problems mentioned above in direct and indirect detection methods value of this technique in use increases. Especially in fixed tissue samples immunoperoxidase renders good results. The technique could detect not only live microorganisms but also bacterial parts and microorganisms with broken wall. Immunoperoxidase technique has shown to give better results compared to direct or acid-fast staining methods in determining many bacteria in samples with low presence 31. Although histochemical detection of Brucella spp. in tissue sections were reported to be difficult and nonspecific 3, sensitivity and specificity of immunoperoxidase in determining B. abortus in lochia of infected cows were reported as 8% and 94%, respectively 33. In the last investigation 36% false positive and.3% false negative reactions were recorded. In the current investigation, immunoperoxidase staining on smears prepared from vaginal swab samples gave satisfactory results. The sensitivity and specificity of the technique in this study were found as 88% and 9% with 1% false negative and 8% false positive, respectively, which are similar to the previous research.

95 6 Detection of Brucella spp. in... In conclusion, we have shown that immunoperoxidase technique could be used in search of Brucella spp. in vaginal swab samples. Smears prepared from vaginal swabs that would be collected from animals post-abortion could be quickly stained and give result in the same day. Best results might be obtained in samples collected months post-abortion. The results of this investigation have shown that bacterial isolation and identification method is still the golden standard, however, where it is not possible immunoperoxidase technique might be used with high confidence. The technique might also find usage in other sample types such as fetal membranes and fetus itself. Based on the encouraging results, smears prepared from abomasal content and/or mucosa of the aborted fetus could be tested for detecting Brucella spp. in future studies. REFERENCES 1. Taleski V, Kantardjiev T, Cretnic Z: An overview of the epidemiology and epizootology of Brucellosis in selected countries of Central and South East Europe. Vet Microbiol, 90 (1-4): , 00.. WHO: Brucellosis in human and animal. World Health Organization for Animal Health and FAO. Geneva, Aydın F, Leloğlu N, Şahin M, Otlu S: Kars yöresinde sığır ve koyunlarda görülen abortların bakteriyolojik yönden araştırılması. 1. Ulusal Veteriner Mikrobiyoloji Kongresi, 7-9 Ekim, Ankara, Türkiye, s Peter AT: Abortions in dairy cows: New insights and economic impact. Adv Dairy Technol, 1, 33-44, Sağlam YS, Türkütanıt SS, Taştan R, Bozoğlu H, Otlu S: Kuzeydoğu Anadolu Bölgesinde görülen bakteriyel sığır ve koyun abortlarının etiyolojik ve patolojik yönden incelenmesi. Vet Bil Derg, 14 (): , Büyük F, Şahin M: Kars yöresinde atık yapan ineklerin çeşitli örneklerinden Brucella etkenlerinin kültürel ve moleküler yöntemlerle araştırılması ve olguların epidemiyolojik analizi. Kafkas Univ Vet Fak Derg, 17 (5): , Fensterbank R: Brucellosis in cattle, sheep and goats. OIE Technical Series, No: 6, pp. 9-35, Bercovich Z: The use of skin delayed-type hypersensitivity as an adjunct test to diagnose brucellosis in cattle: A review. Vet Quart, (3): , Al Dahouk S, Tomaso H, Nöckler K, Neubauer H, Frangoulidis D: Laboratory-based diagnosis of brucellosis - A review of the literature. Part I: Techniques for direct detection and identification of Brucella spp. Clin Lab, 49 (9-10): , Temur A, Dinler U, Seyitoğlu Ş, Kılınç Ü, Yalçın E: Erzurum ve çevre illerde bulunan sığırlarda chlamydial abortların bakteriyolojik, histopatolojik ve immunohistokimyasal yöntemlerle araştırılması. fao.org/aos/records/tr Accessed: Apan T, Yıldırım M, İstanbulluoğlu E: Seroprevalence of brucellosis in human, sheep, and cattle populations in Kırıkkale (Turkey). Turk J Vet Anim Sci, 31 (1): 75-78, Hodul M, Gümüşsoy KS: Develi yöresinde sığır brusellozunun serolojik testlerle (RBPT, SAT, C-ELISA, CFT) teşhisi. Erciyes Üniv Sağlık Bil Derg, 18 (3): , Ceylan E, Irmak H, Buzğan T, Karahocagil MK, Evirgen Ö, Sakarya N, Akdeniz H, Demiröz AP: Van iline bağlı bazı köylerde insan ve hayvan populasyonunda bruselloz seroprevalansı. Van Tıp Derg, 10 (1): 1-5, Pehlivanoğlu F, Öztürk D, Günlü S, Güldalı Y, Türütoğlu H: Prevalence of brucellosis in dairy herds with abortion problems. Kafkas Univ Vet Fak Derg, 17 (4): , Güllüce M: Kars ve çevresinde sığırlarda Brucella abortus a karşı oluşan antikorların ELISA ve diğer serolojik yöntemlerle (RBPT, SAT, MRT) saptanması ve sonuçların karşılaştırılması. Doktora Tezi, Kafkas Üniv. Sağlık Bil. Enst., Ünver A, Erdogan HM, Atabay HI, Şahin M, Güneş V, Çitil M, Gökçe HI: Sığır atıklarından izole edilen Brucella türlerinin RAPD-PCR ile genotiplendirilmesi. Kafkas Univ Vet Fak Derg, 1 (): 11-17, Hornitzky M, Searson J: The relationship between the isolation of Brucella abortus and serological status of infected, nonvaccinated cattle. Aust Vet J, 63 (6): , MacMillan A: Conventional serological tests In, Nielsen K, Duncan JR (Eds): Animal Brucellosis. pp CRC Press Inc., Alton GG, Jones LM, Angus RD, Verger JM: Techniques for the brucellosis laboratory. INRA (Institut National de la Recherche Agronomique), Paris, France, Moore FM, Petrak ML, McMillian MC: Diagnosis of chlamydial infection in pet birds: comparison of cloacal-swab culture and peroxidaseantiperoxidase methods. Avian Dis, 3 (1): , Şahin M, Atabay Hİ, Otlu S, Ünver A, Çelebi Ö: Kars ve çevresinde bulunan insan, sığır ve koyunlarda Brusellosisin prevalansının serolojik ve kültürel metotlarla araştırılması. VI. Ulusal Mikrobiyoloji Kongresi, Elazığ, 7-9 Eylül, Çelebi Ö, Otlu S: Kars yöresinde atık yapmış inek sürülerinden alınan süt ve vajinal sıvap örneklerinden Brusella etkenlerinin bakteriyolojik ve moleküler tanımlanması. Kafkas Univ Vet Fak Derg, 17 (1): 53-58, Stringfellow DA, Scanlan CM, Hannon SS, Panangala VS, Gray BW, Galik PA: Culture of uterine flushings, cervical mucosa, and udder secretions collected post-abortion from heifers artificially exposed to Brucella abortus. Theriogenology, 0 (1): 77-83, Arda M, Minbay A, Leloğlu N, Aydın N, Karaman M, Akay Ö, Ilgaz A, İzgür M, Diker KS: Özel Mikrobiyoloji. 4. Baskı, Medisan, Ankara, Aydın N: Brucella infeksiyonları. In, Aydın N, Paracıkoğlu J (Eds): Veteriner Mikrobiyoloji (Bakteriyel Hastalıklar). s İlke-Emek Yayınları, Ankara, Garin-Bastuji B, Blasco JM, Marin C, Albert D: The diagnosis of brucellosis in sheep and goats, old and new tools. Small Rumin Res, 6 (1-): 63-70, Tuzcu M, Özmen M, Tuzcu N, Yoldaş A, Topçuoğlu H: Atık sığır fetüslerinde Brusellozisin patolojik, immunohistokimyasal, mikrobiyolojik yöntemlerle ve gerçek zamanlı PZR ile teşhisi. AVKAE Derg, 1, 8-14, Durmaz R: Nükleik asit amplifikasyon yöntemlerinde sorunlar ve standardizasyon. In, Durmaz R (Ed): Uygulamalı Moleküler Mikrobiyoloji. s Baskı, Nobel Tıp Kitabevleri, İstanbul, Fidancı HA, Akın S, Alabay M, Güvener N: Sığırlarda Brucella abortus a karşı oluşan antikorları saptamada ELISA ve diğer serolojik tekniklerin karşılaştırılması. Ankara Üniv Vet Fak Derg, 4, , Radostits OM, Gay CC, Hinchcliff KW, Constable PD: Veterinary Medicine. 10th ed., pp Saunders Elsevier, UK, Brees DJ, Reimer SB, Cheville NF, Florance, Thoen CO: Immunohistochemical detection of Mycobacterium paratuberculosis in formalinfixed, paraffin-embedded bovine tissue section. J Vet Diagn Invest, 1, 60-63, Meador VP, Deyoe BL: Intracellular localization of Brucella abortus in bovine placenta. Vet Pathol, 6 (6): , Alberts JN, Erasmus JA: Detection of Brucella abortus antigens by immunoperoxidase histochemical staining of lochia smears. Onderstepoort J Vet Res, 6 (): , 1995.

96 Kafkas Univ Vet Fak Derg 18 (4): 63-66, 01 DOI: /kvfd RESEARCH ARTICLE * ** Leylek (Ciconia ciconia) Dili Üzerine Morfolojik Bir Çalışma Şerife TÜTÜNCÜ * Burcu ONUK ** Murat KABAK ** Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Histoloji ve Embryoloji Anabilim Dalı, TR Kurupelit/Samsun - TÜRKİYE Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Anatomi Anabilim Dalı, TR Kurupelit/Samsun - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada leylek dilinin morfolojik olarak ayrıntılı bir şekilde incelenmesi, diğer kanatlı türleri ile karşılaştırılması ve olabilecek benzerlik ve ayrımların saptanması amaçlanmıştır. Çalışma materyali olarak altı adet leylek kullanıldı. Leylek dilinin apex linguae, corpus linguae ve radix linguae olmak üzere üç kısımdan oluştuğu ve ventral den ağız tabanına frenulum linguae ile bağlandığı belirlendi. Leylek dilinde en kalın epitel katman ve en fazla keratinizasyon apex linguae ve radix linguae nin dorsalindeydi. Makroskobik bakıda dilde herhangi bir papillaya rastlanılmazken mikroskobik bakıda radix linguae de filiform tarzda papillalar mevcuttu. Dilin submukoza katmanında ise dil bezlerine rastanılmadı. Sonuç olarak bu çalışma ile leylek dilinin morfolojik yapısı detayları ile ortaya konulmuştur. Anahtar sözcükler: Dil, Leylek, Morfoloji The Morfological Study of The Lingua in Stork (Ciconia ciconia) Summary In this study, we morphologically investigated storks tongue and compared with other avian species for the similarities and differences. Six storks were used in the study. Stork tongue composed of three parts; apex linguae, corpus linguae and radix linguae and were connected with frenulum linguae in the ventral of the mount. The most thick epithelial layer and the most keratinization were located on the apex linguae and the dorsal part of the radix linguae in stork tongue. Although, macroscopically papillae was not seen, on microscopical examination filiform papillae was observed on the dorsal part of the radix linguae. Lingual glands were not present in the submucosal layer. In conclusion, it is the first time that morphological structure of tongue in the storks have been investigated. Keywords: Tongue, Stork, Morphology GİRİŞ Sulak alanların çevresinde ve karada yaşayan leylek (Ciconia ciconia), Ciconiiformes takımının, Ciconiidae familyasının, Ciconia alt familyasına ait bir canlıdır. Leylekler kurbağa, fare, köstebek, kertenkele, solucan, böcek, balık gibi hayvanlarla beslenirler 1. Aldıkları besinlerin sindiremediği kısımlarını ise yumak halinde ağızdan dışarı çıkarırlar. Kanatlılar, morfolojik olarak memelilerden oldukça farklıdır. Aynı zamanda kanatlı hayvanların kendi aralarında da türe ve beslenme alışkanlıklarına göre yapısal olarak birçok farklılık gösterdiği bildirilmektedir. Sindirim sisteminin giriş kısmında yer alan ve gıdanın ağızdan alımında rol oynayan dil, günümüze kadar çeşitli kategorilerde sınıflandırılmıştır. Gardner, kanatlı dillerini fonksiyon ve adaptasyonlarına göre iki; Harrison 3 yeme, tat alma, dokunma, yutma ve yiyecekleri toplamak için özelleşmelerini göz önüne alarak beş; King ve Mclelland 4 ve O Malley 5 ise gıdaları toplama, işleme ve yutma şekline göre üç grupta incelemiştir. Dilin caudal inde aynı zamanda pharynx in cranial sınırını oluşturan papilla linguae caudales bulunmaktadır 6,7. Histolojik olarak yapılan incelemelerde dilin dorsal inin, lateral ve ventral ine göre daha kalın yapıdaki çok katlı yassı keratinize epitele sahip olduğu, median hat boyunca apex kısmında kıkırdak ile başlayan ve devamında kemik doku ile sonlanan dil kemiğinin bulunduğu bildirilmiştir 8. Ayrıca penguen 9, keklik 10, balıkçıl kuşu 11, deve kuşu 1 ve ibibik kuşu 13 ile yapılan çalışmalarda dilin yapısının genel olarak en dıştan çok katlı yassı keratinize bir epitel ile döşeli olduğu, epitelin hemen altında kompakt bir bağ doku ile altında içerisinde dil bezlerinin bulunduğu bir submukoza ve dil kaslarının bulunduğu tunica muscularis in İletişim (Correspondence) /3891 serife.tutuncu@omu.edu.tr

97 64 Leylek (Ciconia ciconia)... olduğu bildirilmiştir. Ancak bu kaslar memelilerde olduğu gibi gelişmediğinden dilin hareketi dil kemiğinin kasları tarafından gerçekleşmektedir 7,8. Günümüze kadar birçok kanatlı türünde dilin makroanatomik yapısı, elektron ve ışık mikroskobik yapısı incelenmiş 9,1,13, mısır kazında 14 ise cinsiyet farklılığının dil yapısı üzerinde herhangi bir farklılığının olup olmadığı araştırılmıştır. Yapılan detaylı literatür taramalarına rağmen leyleğe ait herhangi bir veriye rastlanılmamıştır. Bu çalışma ile leylek dilinin morfolojik olarak ayrıntılı bir şekilde incelenmesi, diğer kanatlı türleri ile karşılaştırılması ve olabilecek benzerlik ve ayrımların saptanması amaçlanmıştır. MATERYAL ve METOT Bu çalışmanın materyalini, Ondokuz Mayıs Üniversitesi Veteriner Fakültesi Klinikleri ne çeşitli nedenlerle gelen ve kurtarılamayan (ölü) 6 adet leylek oluşturdu. Hayvanları seçme şansı bulunmadığı için cinsiyet göz ardı edilmiştir. Leyleklere ait diller diseksiyonla belirgin hale getirildikten sonra morfometrik veriler Mitutoyo Dijital Kumpas ile alındı. Sonrasında materyaller rutin histolojik doku takibi prosedürlerinden geçirilerek parafinde bloklandı. Parafin bloklardan 5 μ luk kesitler alındıktan sonra normal histolojik yapının incelenmesi için Crossmon ın üçlü boyama tekniği kullanıldı 15. Makroanatomik fotoğraflar Olympus C-5060 marka dijital fotoğraf makinasında, histolojik fotoğraflar ise Nikon SMZ 1500 Binoküler steromikroskop altında Nikon digital-sight görüntüleme sistemi ve Nikon E-600 araştırma mikroskobu ile fotoğraflandı. İsimlendirmede Nomina Anatomica Avium kullanıldı 6. BULGULAR Leylek dilinin apex linguae, corpus linguae ve radix linguae olmak üzere üç kısımdan oluştuğu (Şekil A) ve ventral den ağız tabanına frenulum linguae ile bağlandığı belirlendi. Dil şekil itibariyle apex i rostral de sivri, radix e doğru genişleyen üçgen şeklinde bir oluşumdu. Bu yapının uzunluğu ortalama olarak 0.±0.9 mm, kalınlığı ortalama olarak 1.97±0.16 mm, genişliği dilin apex inde ortalama olarak 3.96±0.34 mm, radix inde ise ortalama olarak 10.37±0.44mm olarak ölçüldü. Dilin dorsal yüzünde sulci linguae ile torus linguae ye, radix inde ise papilla linguales caudales e rastlanılmadı. Leylekte gaganın uzunluğu ise ortalama olarak 14.70±0.43cm idi. Gaga ile dilin uzunluk oran grafiği Şekil 1 de gösterildi. Dilden alınan kesitler Crossmon ın üçlü boyama yöntemi ile boyanıp incelendiğinde; dilin tüm yüzeyinin kutan mukoza ile kaplı olduğu ve kutan mukoza nın lamina epiteliyalis inde güçlü bir keratinize katmanın yer aldığı gözlendi (Şekil B, Şekil C). Dilin dorsal kısmının apex ve corpus unda herhangi bir papillaya rastlanılmazken, radix linguae de yönleri apikale doğru uzanan filiform tarzda papillara rastlanıldı (Şekil D). Dilin apikal inin, caudal ine göre oldukça kıvrımlı, girintili-çıkıntılı bir yapıya sahip olduğu belirlendi (Şekil E). Bu bölgedeki epitelin içersinde çok sayıda mikroskobik papilla tespit edildi (Şekil C). Mukoza nın lamina propriya sı, bol miktarda kollagen iplik, sinir pleksusları ve damar içeren kompakt bağ doku yapısındaydı (Şekil E). Bağ dokunun hemen altında dilin uzunlamasına seyreden bir hiyalin kıkırdak olduğu belirlendi (Şekil B, Şekil E, Şekil F) ve kıkırdakta herhangi bir kemikleşmeye rastlanılmadı. Kıkırdak dokunun alt ve üst bölümlerindeki submukoza katmanı; yağ hücreleri ve bol miktarda kan damarları içermekteydi. Ayrıca bu katman radix liguae de daha geniş ve belirgindi. Submukozanın hemen altında radix liguae ye yakın olan ventral bölümünde hiyalin kıkırdağın altında bulunan bağ dokuda, iskelet kası özelliğinde olan dil kasları gözlendi (Şekil F). TARTIŞMA ve SONUÇ Kanatlıların morfolojik olarak memelilerden farklı olduğu, aynı zamanda kanatlı hayvanların kendi aralarında da türe ve beslenme alışkanlıklarına göre yapısal olarak birçok farklılık gösterdiği bildirilmektedir,8. Gaga kanatlılarda hayvanların yaşam şekline ve beslenme alışkanlığına bağlı olarak farklılık göstermektedir. Dilin şeklide, gaga ya göre adapte olduğu için kuşlarda çeşitlidir 8. Dilin güvercinde dar iken tavukta geniş olduğu ve bistürü ucu şeklindeki dilin gaga ucuna kadar ulaş Seri 1 Şekil 1. Leylekte gaga uzunluğu ile dil uzunluğu oran grafiği (mm) Fig 1. Ratio of the lenght of the tongue with beak lenght in stork (mm) 0 gaga uzunluğu dil uzunluğu

98 65 TÜTÜNCÜ ONUK, KABAK Şekil. A: Leylekte linguae nın dorsal görünümü; B: Dilin longitudinal kesiti; C: Dil apeksi; D: Dilde papilla filiformis; E: Dilin apeksinin kıvrımlı görüntüsü; F: Dilin kauda-ventralinin görünümü. a: hiyalin kıkırdak, b: dilin apeksi, c: dil kasları, d: keratinize katman, e: mikroskobik papilla, f: çok katlı yassı epitel, g: lamina propriya, yıldız: hiyalin kıkırdak, ok: dil kasları, Bar: 50 µm Fig. A: Dorsal view of stork tongue; B: Longitudinal cross section of tongue; C: The apex of the tongue; D: Tongue papillae filiformis; E: Apex of the curved image of the tongue; F: Kaudo-ventral view of the tongue. a: hyaline cartilage, b: the apex of the tongue, c: muscles of the tongue, d: keratinized layer, e: microscopic papillae, f: Squamous epithelium, g: Lamina propria, star: hyaline cartilage, arrow: muscles of the tongue, Bar: 50 µm madığı, kaz ve flamingo gibi türlerde ise tamamen ağız boşluğunun tabanını doldurduğu bildirilmektedir 8. Dilin şeklinin penguende 9 ikizkenar üçgen, ağaç kakanda mızrak, akbabada 16 ise elek biçiminde olduğu ifade edilmiştir. İbibikde 13 dilin uç kısmının çok sivri olduğu, yüzücü kuşlarda 7 ise sivriliğin daha az olduğu bildirilmektedir. Yapılan çalışmada ise dil in şekli ve konumu yukarıda bahsedilen türlerle uyumludur. Günümüze kadar yapılan çalışmalarda dil ile gaga arasındaki uzunluk oranı keklikte 1/5 olarak ifade edilmiştir 10. Leylekte ise bu oranın 1/7 olduğu belirlenmiştir. Evcil kanatlılarda 8, penguen 9, keklik 10, balıkçıl kuşu 11, deve kuşu 1 ve ibibik kuşunda 13 dilin mukozasının lamina epiteliyalis inin en dıştan çok katlı yassı keratinize bir epitel ile döşeli olduğu bildirilmiştir. Literatürlerde dilin mukozası incelenmiş ve epitelin keratinizasyon derecesi ile yeri hakkında farklı görüşler belirtilmiştir 6,8,17. Tavukta dilin ventro-lateral indeki epitelin diğer bölgelerdeki epitele göre daha kalın olduğu bildirilmiştir 17. Baumel ve ark. 6 kümes hayvanlarında dilin ventral inde daha güçlü olarak şekillenen bu keratinizasyonu cuticula cornifacata linguae olarak tanımlamıştır. Nickel ve ark. 8 ise dildeki keratinizasyonun dilin dorsal inde daha yoğun olduğunu belirtmiştir. Leylekte ise diğer kanatlılardan farklı olarak bu keratinizasyonun, apex linguae nin tamamında (dorsallateral-ventral) ve radix linguae nin ise yalnızca dorsal inde olduğu gözlendi. Bir çok kanatlı türünde, dilin dorsal inin rostral kısımda median bir oluktan ve dil kökü kaidesinde makroskobik transversal papilla sırasından sözedilmektedir 4,6,18. Yapılan çalışmada leylek dilinin dorsal den düz bir yüzey şeklinde görülmesi ve herhangi bir oluşumu içermemesi keklikte bildirilenle uyumludur 10. Diğer yandan yapılan histolojik incelemelerde ise apex linguae ve corpus linguae nin dorsal bölgesinde herhangi bir papillaya rastlanılmazken, radix linguae de yönleri apikale doğru uzanan filiform tarzda papilların belirlenmesi, evcil kanatlılarda 8 ve balıkçıl kuşu nda 11 bildirilen ile uyumludur. Bu bulgular ışığında dilde sadece mikroskobik papilla nın varlığına rastlanılması, bize leyleklerin gıdayı aldıktan sonra sindiremediği kısmını kusma yoluyla dışarı atarken bir engel oluşturmaması nedeniyle makroskobik papillaların körelmiş olabileceğini düşündürdü. Yapılan çalışmada dilde çok katlı yassı keratinize epitelin hemen altında içersinde sinir pleksusları, kollagen iplikler ve damarların bulunduğu kompakt bir bağ dokunun (lamina propriya) varlığı literatürde bildirilen ile uyumluydu 10,11,13. Ancak penguen 9, keklik 10, balıkçıl kuşu 11, deve kuşu 1 ve ibibik kuşunda 13 lamina propriya nın altında yer alan submukoza katmanında bildirilen dil bezlerine (glandula lingualis) leylekte rastanılmadı. Evcil kanatlılarda submukoza nın altında apex linguae - den radix linguae ye doğru uzanan bir hiyalin kıkırdağın varlığından ve bu kıkırdak yapının dilin radix ine doğru gittikçe kemikleştiğinden bahsedilmektedir 8. Yapılan çalışmada ise bu bölgenin tamamen hiyalin kıkırdaktan meydana gelmesi ve submukoza nın altında kıkırdağın arka kısmında bulunan kas tellerinin varlığı literatüre benzerdi 7,9-11.

99 66 Leylek (Ciconia ciconia)... Sonuç olarak, leylek dilinde en kalın epitel katmanının ve en fazla keratinizasyonun dilin apex linguae ve radix linguae nin dorsal inde olması, makroskobik bakıda herhangi bir papillaya rastlanılmazken mikroskobik bakıda radix linguae de filiform tarzdaki papillaların varlığı ve submukoza katmanında gl. lingualis lere rastanılmaması bu çalışmanın en belirgin bulgularıydı. Yapılan çalışmayla bugüne kadar hiç incelenmemiş olan leylek dili morfolojik olarak ayrıntılı bir şekilde incelenmiş ve diğer türlerle benzer ve farklı yönleri ortaya konularak literatüre katkı sağlanmıştır. KAYNAKLAR 1. Demirsoy A: Yaşamın Temel Kuralları, Omurgalılar (Sürüngenler, Kuşlar ve Memeliler). Cilt III, Birinci Baskı, s. 79-8, Meteksan A.Ş, Ankara, Gardner LL: The adaptive modifications and the taxonomic value of the tongue in birds. Proceedings of the United States National Museum, 67, Article 19, Harrison JG: Tongue. In, Thomson AL (Ed): A New Dictionary of Birds. pp , London, King AS, McLelland J: Birds, Their Structure and Function. nd ed., pp , Bailliere Tindall, London, O Malley B: Clinical Anatomy and Physiolojy of Exotic Species, Structure and Function of Mammals, Birds, Reptiles, and Amphibians. 1st ed., pp , Elsevier Saunders, Toronto, Baumel JJ, King SA, Breazile JE, Evans HE, Berge JCV: Handbook of Avian Anatomy: Nomina Anatomica Avium, nd ed., pp , Nuttall Ornithological Club. Cambridge, Karadağ H ve Nur İH: Sindirim Sistemi. In, Dursun N (Ed): Evcil Kuşların Anatomisi. Birinci Baskı, s , Medisan Yayınevi, Ankara, Nickel R, Schummer A, Seiferle E: Anatomy of the Domestic Birds. pp , Verlag Paul Parey, Berlin, Taşbaş M, Özcan Z, Hazıroğlu RM: Penguenin dili ve ön solunum yollarının (larynx cranialis, trachea, syrinx) anatomik ve histolojik yapısı üzerinde bir çalışma. Ankara Üniv Vet Fak Derg, 33 (): 40-61, Rossi JR, Baraldi-Artoni SM, Oliveira D, Cruz da C, Franzo VS, Sagula A: Morphology of beak and tongue of partrigde Rhynchotus rufescens, Cienc Rural, 35 (5): , Almansour MI, Jarrar BM: Morphological, histological and histochemical study of the lingual salivary glands of the Little Egret, Egretta garzetta. Saudi J Biol Scis, 14 (1): 75-81, Crole MR, Soley JT: Morphology of the tongue of the emu (Dromaius novaehollandiae). II. Histological features, Onderstepoort. J Vet Res, 76, , El-Bakary NER: Surface morphology of the tongue of the hoopoe (Upupa Epops), ACS Comb Sci, 7 (1): , Hassan SM, Moussa EA, Cartwright AL: Variations by sex in anatomical and morphological features of the tongue of Egyptian Goose (Alopochen aegyptiacus). Cells Tissues Organs,191, , Crossman G: A modification of Mallory s connective tissue stain with a discussion of the principles involved. Anat Rec, 69, 33-34, Kristin A: Family Upupidae (Hoopoes). In, del Hoyo J, Elliott A; Jordi S (Eds): Handbook of the Birds of the World. Vol 6, pp , Barcelona Lynx Edicions, Susi FR: Keratinization in the mucosa of the ventral surface of the chicken tongue. J Anat, 105 (3): , Getty R: Sisson and Grossman s the Anatomy of the Domestic Animals, 5th ed., pp , W.B. Saunders Co, London, 1975.

100 Kafkas Univ Vet Fak Derg 18 (4): 67-63, 01 DOI: /kvfd RESEARCH ARTICLE [1] * ** *** Predicting Breeding Values in Animals by Kalman Filter: Application to Body Condition Scores in Dairy Cattle [1] Burak KARACAÖREN * Luc L.G. JANSS ** Haja N. KADARMIDEEN *** Dr Karacaören acknowledges funding from Akdeniz University and Eidgenössische Technische Hochschule Department of Animal Science, Faculty of Agriculture, University of Akdeniz, TR Antalya - TURKEY Department of Genetics and Biotechnology, Research Centre Foulum Blichers Alle 0, University of Aarhus, DENMARK Section of Quantitative and System Genetics, Department of Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, DENMARK Makale Kodu (Article Code): KVFD Summary The aim of this study was to investigate usefulness of Kalman Filter (KF) Random Walk methodology (KF-RW) for prediction of breeding values in animals. We used body condition score (BCS) from dairy cattle for illustrating use of KF-RW. BCS was measured by Swiss Holstein Breeding Association during May 004-March 005 for 7 times approximately at monthly intervals from dairy cows (n=80) stationed at the Chamau research farm of Eidgenössische Technische Hochschule (ETH), Switzerland. Benefits of KF were demonstrated using random walk models via simulations. Breeding values were predicted over days in milk for BCS by KF-RW. Variance components were predicted by Gibbs sampling. Locally weighted scatter plot smoothing (LOWESS) and KF-RW were compared under different longitudinal experimental designs, and results showed that KF-RW gave more reasonable estimates especially for lower smoother span of LOWESS. Estimates of variance components were found more accurate when the number of observations and number of subjects increased and increasing these quantities decreased standard errors. Fifty subjects with 10 observations each, started to give reasonable estimates. Posterior means for variance components were found (with standard errors) 0.03 (0.006) for animal genetic variance 0.04 (0.007) for permanent environmental variance and 0.1 (0.0) for error variance. Since KF gives online estimation of breeding values and does not need to store or invert matrices, this methodology could be useful in animal breeding industry for obtaining online estimation of breeding values over days in milk. Keywords: Kalman filter, Body condition score, Bayesian methods Özet Damızlık Değerlerinin Kalman Süzgeci ile Tahmini: Süt Sığırlarından Toplanan Vücut Kondüsyon Puanları İçin Bir Uygulama Bu çalışmanın ana amacı; rassal yürüyüş taslamını kalman süzgeci (RY-KS) ile kullanarak çiftlik hayvanlarında zamana dayalı damızlık değerlerinin tahmin edilebilmesinin uygunluğunun araştırılmasıdır. Veri seti Chamau enstitüsündeki süt ineklerinden, İsviçre Holştayn birliği tarafından elde edilmiştir (n=80). Yerel ağırlıklı uzanım tahmincisi (LOWESS) yöntemi ve RY-KS benzeşim yolu ile farklı deneme desenleri için karşılaştırıldı, sonuçlar benzer bulunsa da, bazı şartlar altında RY-KS daha uygun sonuçlar verdi. Birey ve gözlem sayılarının varyans unsurları ve üreteç tahminine olan etkileri incelendi ve her ikisinin arttırılmasının daha doğru tahminleri daha küçük standart hatalarla verdiği saptandı. Varyans unsurları gibbs örneklemesi ile tahmin edildi. Soncul ortalamalar genetik varyans için 0.03 (0.006), kalıcı çevre için 0.1 (0.0) ve hata varyansı için 0.1 (0.0) olarak hesaplandı. Kalman Süzgeci damızlık değerlerinin güncel tahminlerini vermesi ve matrislerin devrilmesine ihtiyaç göstermemesi nedeni ile büyük veri setlerinden zamana dayalı damızlık değerlerinin tahmin edilmesinde faydalı olabilir. Anahtar sözcükler: Kalman süzgeci, Vücut kondüsyon puanları, Bayesçi yöntemler İletişim (Correspondence) burakkaracaoren@akdeniz.edu.tr

101 68 Predicting Breeding Values... INTRODUCTION A filter is a device that is used for example to separate water from particles. By analogy this idea was extended to separation of signals from noise 1 in engineering context. Kalman Filter (KF) was defined with Bayesian features by Harrison and Stevens as Bayesian Dynamic Linear Model 3 although West and Harrison 4 quoted as Bayesian forecasting is Kalman Filtering is akin to saying that statistical inference is least squares. Migon et al. 5 described some special characteristics of KF as following; i) all relevant information s are used, including history, factual or subjective experiences, and knowledge of forthcoming events ii) routine forecasting is produced by a statistical model and exceptions can be considered as an anticipation or in a retrospective base iii) prospective (what happened) and retrospective (what if) analysis are easily accommodated iv) model decomposition, a full Bayesian forecasting model may be decomposed into independent dynamic linear models, each one describing particular features of the process under analyses. More details about some of literatures about Kalman Filter could be found in 6. KF methodology could be useful in animal breeding industry when analyzing very big time series data sets since it does not need store or invert matrices. In addition online estimation of breeding values could be useful for selection schemes over time. As was shown by Van Bebber et al. 7 KF could also be used for detecting false measurements in experimental farms. We investigated the possible application of KF-RW in field conditions. In this context, we chose body condition score (BCS) in dairy cows 8,9. Body weight, feed (dry matter) intake and milk production level together form an important cluster of functional traits that determines the amount of fat reserves stored in the body; this is now recorded in many countries as body condition score or BCS 8,9. A common body condition scoring system has been developed to estimate the BCS of cows in a herd. This system provides producers a relative score based on an evaluation of fat deposits in relation to skeletal features. The scoring method involves a manual assessment of the thickness of fat cover and prominence of bone at the tail head and loin area. The most widely used body condition scoring system for dairy cattle assigns scores from 1 to 9 in North America and from 1 to 5 in most European countries, with the lowest score meaning emaciated and carrying virtually no fat and the highest score meaning excessively fat. Veerkamp and Brotherstone 10 estimated variance components for BCS at calving and for average BCS over the first 6 wk of lactation; they reported heritability estimates for BCS ranging between 0.4 and Jones et al. 11 reported for Holstein Friesian heifers moderate heritability estimates of BCS, varying with stage of lactation from 0.3 to 0.8. Sallas and Harville 1 suggested to use KF for prediction of breeding values for consecutive lactations. Forni et al. 13 used dynamic linear model via KF to modeling of cattle growth data. The main aim of this study was to provide theoretical developments of KF-RW in the context of adapting it to analysis of animal breeding data with an emphasis on application of KF-RW in predicting breeding values over DIM for BCS. This would be the first use of KF-RW for predicting breeding values over DIM. Simulations are performed to check the validity of methods and comparison of different sub-models. MATERIAL and METHODS Statistical Models and Analyses Random Walk Model: For demonstration purposes we used random walk model and it is given below. e yt = a t + ε t, ε t N( 0, σ e ) a + t+1 = a t ηt, t N( 0, σ n ) η (1) In (1) the first equation is called the observation equation and the second equation is called the state equation. We assumed that observations y t, depends on unobservable quantity a t, and our aim was to do statistical inference on a t (states). We assumed constant variances for ε t and η t as σ and σ respectively with independent, identically and n normally distributed random variables with zero means. LOWESS 14 smoother was used to make comparisons with random walk model (1) in recursive form (KF-RW). Parameter values assumed were σ n =100 and σ e =5 for simulating observations, y, from random walk model. A total of 1000 Gibbs cycles with first 50 cycles used as burn in period used to obtaining estimates of states, θˆ, and variance components σ n, σ e. For genetic analyses of traits following mixed model is normally used in animal breeding; y = Xâ + Z a + Z p e () a p + where y is the vector of observations, â is the vector of fixed effects, a is the vector of breeding values, p is the vector of random permanent environmental effects, X, Z a, Z p are design matrices and e is the vector of random residual effects. For the random effects it was assumed that a 0 A a Var p 0 ~ N 0; 0 e I 0 p 0 0 I e

102 69 KARACAÖREN, JANSS KADARMIDEEN where a σ, p σ, and e σ ; are genetic, permanent environment and error variances. A is the additive genetic relationship matrix for the animals; I is an identity matrix. In the following, we show general assumptions used in KF-RW method, based on Bayesian principles. Proportional joint posterior distribution without constant terms given in (3) using () based on following recursive relationship (4); LOWESS: The LOWESS model 1 was used to capture the local variability by weighted least square regression using different smoother spans. Implementation All computations were made in R 14, using the package called MASS 15 implemented in R, for sampling from multivariate Normal distributions. We compared KF-RW and LOWESS approach. We investigated effect of different number of subjects and different number of observations per subject on estimation of both states and variance components. Finally we applied the theory to animal breeding data to predict breeding values over DIM. Application of KF-RW Method to BCS Data BCS was measured by the Swiss Holstein Breeding Association as described by Trimberger 16 using 1 to 5 scale, during May 004-March 005 for 7 times approximately at monthly intervals from multiparous dairy cows (n=80) stationed at the Chamau research farm of the Swiss Federal Institute of Technology, Switzerland. The experimental procedures of the farm followed the Swiss Law on Animal Protection and were approved by the Committee for the Permission of Animal Experiments of the Canton of Zug, t t t Var e p a ~ ; e p a t t t N I I A e p a 1 1 1,,,, t t t n Y Y p Y p Y p Y p t t t 1 t 1 t t t t θ θ θ θ θ θ θ (3),,,,, e p a p a y b f 1 / 1 exp e N e p Z a Z Xb y p Z a Z Xb y p a p a x a N a 1 1 / 1 exp / 1 exp a T t N a a a σ 1 t t 1 1 t t a a A a a a A a x p N p 1 1 / 1 exp / 1 exp p T t N p e p 1 t t 1 1 t t 1 1 p p I p p p p x 1 exp e e e v e S v e 1 exp a a a v a S v a 1 exp p p p v p S v p t t t e p a t y p a b,,,,, ~ 1 1, e N X X p Z a Z y X X X t p a t t t e p a t y p b a,,,,, , A Z Z A p Z b X y Z A Z Z t t t t t a a t p a t a a a e t a t e a e a N t t t t e p a t y p b a p,,,,,, , I Z Z I a Z b X y Z I Z Z t t tt t t p p t p a t p p p e t p t e p e a N t t t t t e p a y p b a p,,,,,, ~ DF a a a S v Q t t t t t e a p y p b a p,,,,,, ~ DF p p p S v Q t t t t t p a e y p b a p,,,,,, ~ DF e e e S v Q Last line of (3) are product of density of scaled inverted chi-square distributions assumed prior for variance parameters. After algebraic manipulations conditional distributions could be written as following, where in the last lines Q stands for quadratic form of the respective error terms and DF degrees of freedoms. ~ ~

103 630 Predicting Breeding Values... Zug, Switzerland. Results of 7 BCS sessions split into 4 periods over DIM to reduce number of missing values. Missing values filled in with subject specific averages. A summary of the dataset used for BCS analysis is given in Table 1. The pedigree file included 637 animals. For genetic analyses of BCS following mixed model was used; y Xβ Z a Z p e a where y is the vector of observations included 30 (80 animals, with 4 repeated measurements each) observations, β is the vector of fixed effects including breed (n=80; b 1 =Holstein-Friesian, n 1 =4, b = Brown Swiss, n =38) age at calving, and year-season interaction, a is the vector of breeding values, p is the vector of random permanent environmental effects, X, Z a, Z p are design matrices and e is the vector of random residual effects. RESULTS p (4) Random Walk Model for Simulated Data Sets We compared predictions of simulated observations from random walk model with different smoother spans for LOWESS and KF-RW (Table ). Predictions were found to be both reasonable by KF-RW models and LOWESS approach. We also investigated effect of different sampling sizes to state and variance components estimates (Table 3) from KF-RW. Lowest number of observations (n=5) with lowest number of subjects (n=50) gives reasonable predictions of the states but incearesing both sampling sizes also decrease the standard errors of the estimates of the states. However prediction of variance components was found far from their parameters values with the lowest number of observations (n=5) and this effect gradually decreased by increasing the number of subject holding the number of observations as fixed. Standard errors of predicted variance components were found decreased by increasing the both number of observations and number of subjects. Prediction of Breeding Values for Body Condition Scores by Kalman Filter We analyzed BCS data for permanent environmental variance without genetic effects in order to decide number of Gibbs cycle and burn in period. Repeated runs of the same analyses for the same priors showed that monte carlo errors were small. Two thousand Gibbs cycles with 00 burn-in period were found reasonable. However, probably, since each cow consisted of small number of repeated measurements (n=4) different prior values gave different estimates, especially for smaller values of scaling factors, s, (Table 4). Increasing the scaling factor, s, gave more stable estimates, hence v=5 with s=0.5 chosen for parameters of scaled inverted chi-square prior distribution for genetic analyses of the BCS dataset. Scatter plots of gibbs samples Table 1. Number of records, means, and standard errors for body condition scores for some selected days of first lactation Tablo 1. Vücut puanları için bazı günlere ait gözlem sayıları, ortalamalar ve bunlara ait standart hatalar Body Condition Score DIM n X SE Table. Means of predictions of observations simulated from random walk model by different smoother spans for LOWESS and Kalman Filter random walk methodologies Tablo. Kalman Süzgeci rassal yürüyüş taslamı ve LOWESS (farklı üreteçler için) yöntemlerinin rassal yürüyüş benzeşimini tahmin ortalamaları Smoother Span Observations LOWESS Kalman Filter f= (0.1) 0.96 (0.0) 0.78 (0.08) f= (0.11) 01.3 (0.06) (0.07) f= (0.5) 64.4 (0.1) (0.3) f= (0.17) (0.1) (0.15) f= (0.13) 0.93 (0.06) (0.09) f= (0.15) (0.11) (0.13) f= (0.16) (0.13) (0.14) f= (0.18) (0.15) (0.17)

104 631 KARACAÖREN, JANSS KADARMIDEEN were visually investigated (figures are not shown), since no patterns were observed for all variance components; it was decided that sample size was reasonable. Posterior means for variance components found 0.1 (0.0) for error variance, 0.03 (0.006) for animal genetic variance and 0.04 (0.007) for permanent environmental variance. In this data set variation was found quite small within and between animal. DISCUSSION In the simulation study predictions of observations were found to be both reasonable by KF-RW models and LOWESS approach. However mostly KF-RW estimates were found better than those of LOWESS estimates (Table ). It is difficult to compare two methodologies directly, since each of them has their own specifications, but KF-RW model does not need any tuning parameters. However predicting variance components needs additional computing power in KF-RW. We also investigated effect of different sampling sizes to state and variance components estimates (Table 3) from KF- RW. Estimates of states were getting closer to observations as number of observations and number of subjects increased. Also it was observed that increasing both quantities decreased associated standard errors. Variance components estimates were found to be more accurate when number of observations and number of subjects increased. Again increasing these quantities decreased standard errors. Fifty subjects with 10 observations each, started to gave reasonable estimates. In real biological dataset, different from simulated dataset, number of observations per animals was low (n=4) and this was in effect for predicting variance components (Table 4). Different prior values gave very different variance component predictions especially for smaller values of scaling factors, however it was stabilized by increasement of both degree of belief and scaling factors. Based on various runs we decided to use v=5, s=0.5 for genetic analyses of the BCS dataset. We used 000 Gibbs cycles with 00 burn in period, based on results of different runs (results not shown). Since dataset were obtained under homogenized, controlled experimental farm; small amount of variances predicted for both within and between animals. Visual inspection showed that predictions of observations were agreed with actual observations. We provided a general theoretical framework for use of KF-RW in the analyses of animal breeding data, with an emphasis on application of KF-RW in predicting breeding values for BCS measured as a longitudinal trait. Simulations Table 3a. Means of estimates of states θˆ, observations y. Standard errors given in bracets Tablo 3a. Durumların θˆ ve gözlemlerin y tahminlerinin ortalamaları. Standart hatalar parantez içinde verilmiştir Number of Subjects Number of Observations θˆ y θˆ y θˆ y θˆ y (0.04) (0.05) (0.0) 01.0 (0.0) (0.0) (0.01) (0.009) (0.001) (0.0) (0.03) (0.01) 00.4 (0.01) 00.0 (0.008) (0.009) (0.005) (0.005) (0.01) (0.0) (0.006) (0.07) (0.004) (0.004) 00.7 (0.00) (0.00) (0.004) (0.005) (0.003) (0.00) (0.001) (0.00) (0.0009) (0.001) (0.00) (0.00) (0.001) (0.001) (0.0009) (0.0007) (0.0005) (0.0005) Table 3b. Means of predictions of variance components ( σ σ n ). Standard errors given in bracets Tablo 3b. Varyans unsurlarının tahminlerinin ortalamaları σ σ. Standart hatalar parantez içinde verilmiştir Number of Subjects ˆ e ˆ e ˆ e n Number of Observations σ n σˆ e (0.13) 40.5 (0.1) 6.01 (0.03) (0.07) 9.43 (0.0) (0.01) 6.07 (0.004) (0.01) (0.10) (0.11) 5.4 (0.01) (0.04) (0.01) (0.0) 6.39 (0.003) 9.6 (0.007) (0.05) 33.9 (0.05) 7.91 (0.01) (0.0) 3.44 (0.003) (0.009) 6.9 (0.001) (0.003) (0.0) 36.0 (0.0) 5.47 (0.003) (0.009) 3.18 (0.001) (0.001) 5.10 (0.0005) 99.3 (0.001) (0.007) 0.94 (0.01) 3.16 (0.001) (0.004) 3.71 (0.0007) (0.00) 4.47 (0.0003) (0.0008) σ : Estimates of error variance σ : Estimates of states variance n σ n σˆ σ e n σˆ e σ n σˆ e

105 63 Predicting Breeding Values... Table 4. Estimates of state ( σ n ) and error variances ( ˆ σ e ) for different parameter values of scaled inverted chi-square prior distributions (v degree of belief, s scaling factors) Tablo 4. Durumların ( σ ) ve hata varyanslarının ( n σ ) ölçeklenmiş tersinir kikare öncül dağılışı ile tahmini (v inanç derecesi, s ölçekleme faktörü) ˆ e v=0.01 v=1 v= v=3 v=4 v=5 s σ n σˆ e σ n σ n σ σˆ n σ e σˆ e σˆ e n σˆ e σ n σˆ e s= s= s= Standard errors varied between were also performed to check the validity of methods and comparison of different sub-models. Although we used random walk model; model choice depends on the variability and prior information about dataset, different models could be more realistic in different applications. Since random walk model is not stationary it may not be suitable for animal breeding data under certain conditions. We assumed constant variances for state and error components over DIM, however this assumptions could be extended for time dependent variance components models, and it could be claimed that it would give more realistic results. Since KF gives online estimation of breeding values and does not need to store or invert matrices, this methodology could be useful in animal breeding industry for obtaining online estimation of breeding values over DIM. Acknowledgements The authors thank to anonymous reviewers for useful comments. Authors thank all personnel in the research station of Swiss Federal Institute of Technology in Chamau, Zug, Switzerland for their help in data collection over number of years. Authors thank Swiss Holstein Association, Patrick Rüttiman and Dr Silvia Wegmann for providing BCS data. REFERENCES 1. Grewal MS, Andrews AP: Kalman Filtering: Theory and practice using MATLAB. JohnWiley&Sons, Harrison PJ, Stevens C: A Bayesian approach to short term forecasting. Oper Res Quart,, , Meinhold RJ, Singpurwalla ND: Understanding the Kalman Filter. Am. Stat, 37, 13-17, West M, Harrison PJ: Bayesian forecasting and dynamic models. Springer Migon H, Gamerman D, Lopes H, Ferreira M: Dynamic models. In Dey D, Rao C (Eds): Handbook of Statistics. p. 5. Elsevier, Karacaören B: Phenotypic and genetic analysis of functional traits in dairy cattle under experimental management system. PhD Thesis. Swiss Federal Institute of Technology Zurich, Van Bebber J, Reinsch N, Junge W, Kalm E: Monitoring daily milk yields with a recursive test day repeatability model (Kalman Filter). J Dairy Sci, 8, 41-49, Kadarmideen HN, Wegmann S: Genetic parameters for body condition score and its relationship with type and production traits in Swiss Holsteins. J Dairy Sci, 86, , Kadarmideen HN: Genetic correlations among body condition score, somatic cell count, production, reproduction, and conformation traits in Swiss Holsteins. Anim Sci, 79, , Veerkamp RF, Brotherstone S: Genetic correlations between linear type traits, food intake, live weight and condition score in Holstein Friesian dairy cattle. Anim Sci, 64, Jones HE, White IMS, Brotherstone S: Genetic evaluation of holstein friesian sires for daughter condition-score changes using random regression model. Anim Sci, 68, , Sallas WM, Harville DA: Best linear recursive estimation for mixed linear models. J Amer Statist Assoc, 76, , Forni S, Gianola D, Rosa GJM, de los Campos G: A dynamic linear model for genetic analysis of longitudinal traits. J Anim Sci, 87, , R Development Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria Venables WN, Ripley BD: Modern Applied Statistics with S. Fourth ed,. Springer, New York, Trimberger GW: Dairy Cattle Judging Techniques. Prentice-Hall, Prospect Heights, Waveland Press, 1977.

106 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Determination of Various Mycotoxin Concentrations in the Feedstuffs and Feed Produced by A Feed Manufacturer in Turkey * ** *** Hasan Hüseyin ORUÇ * Ali SORUCU ** İbrahim İsmet TÜRKMEN *** Erdem ARSLAN ** Uludağ Üniversitesi Veteriner Fakültesi, Farmakoloji ve Toksikoloji Anabilim Dalı, TR Nilüfer, Bursa - TÜRKİYE Uludağ Üniversitesi Sağlık Bilimleri Enstitüsü, Farmakoloji ve Toksikoloji Anabilim Dalı, TR Nilüfer, Bursa - TÜRKİYE Uludağ Üniversitesi Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı, TR Nilüfer, Bursa - TÜRKİYE Makale Kodu (Article Code): KVFD Summary The aim of this study was to determine aflatoxin B 1 (AFB 1), T- toxin, fumonisin, deoxynivalenol (DON) and zearalenone (ZEN) levels in various feedstuffs (local and imported feed materials) and feed produced in a feed manufacturer. In addition, aflatoxin M 1 (AFM 1) levels were determined in raw cow milks (n = 4) collected from 10 certain dairy cattle farms. The samples consisted of dairy cattle (n = 6), fattening (n = 4), and calf starter (n = 4) feed, as well as feedstuffs (n = 40). All of the samples were analysed by ELISA. In the analysed samples, the incidence of AFB 1, AFM 1 and T- toxins, fumonisin, DON and ZEN were 100%, 80%, 75% and 33%, respectively. The results of this study in feedstuffs and feed revealed that the mycotoxin levels were lower than the mycotoxin limits of the European Union (EU) and Turkey. In previous studies, high concentrations of mycotoxins, especially AFB 1 and AFM 1, were identified in feedstuffs, feeds and milk in Turkey. In contrast, the mycotoxin levels in the current study were lower than that from the previous studies. The mycotoxin concentrations in imported feed materials (except fumonisin) were lower than those in feed materials obtained from Turkey. The results of this study indicate that the mean mycotoxin levels in feedstuff and feeds do not cause toxic effects in animals, and humans for AFM 1. Keywords: Feedstuffs, Feed, Feed manufacturer, Mycotoxin levels, Multiple mycotoxin Bir Yem Fabrikası Tarafından Türkiye de Üretilen Yem ve Yem Hammaddelerinde Çeşitli Mikotoksinlerin Miktarlarının Belirlenmesi Özet Bu çalışmanın amacı bir yem fabrikası tarafından üretilen yemlerde ve çeşitli yem hammaddelerinde (yerli ve ithal) aflatoksin B 1 (AFB 1), T- toksin, fumonisin, deoksinivalenol (DON) ve zearalenone (ZEN) düzeylerinin belirlenmesidir. Ayrıca, seçilen 10 farklı süt işletmesinden toplanan inek sütlerinde (n = 4) aflatoksin M 1 (AFM 1) miktarlarının belirlenmesi amaçlanmıştır. Numuneler, süt yemi (n = 6), besi yemi (n = 4) ve buzağı başlangıç yemi (n = 4), ile yem hammaddelerinden (n = 40) oluşmaktadır. Mikotoksin miktarları ELISA ile analiz edildi. Mikotoksinlerin tespit edilme oranı AFB 1, AFM 1 ve T- toksin, fumonisin, DON ve ZEN için sırasıyla %100, %80, %75 ve %33 tür. Yem ve yem hammaddelerinde bulduğumuz mikotoksin miktarlarının Türkiye ve Avrupa Birliği nde uygulanan limitlerin altında olduğu görüldü. Türkiye de süt, yem ve yem hammaddelerinde daha önce yapılan çalışmalarda özellikle AFB 1 ve AFM 1 limitlerin üzerinde tespit edilmiştir. Bu çalışmanın sonuçları benzer olan önceki çalışmaların sonuçlarının aksine daha düşüktür. İthal yem hammaddeleri Türkiye den sağlanan yem hammaddelerinden (fumonisin hariç) daha düşük miktarlarda mikotoksin içermektedir. Bu çalışmanın sonuçlarına göre, yem ve hammaddelerindeki ortalama mikotoksin düzeylerinin hayvan sağlığı; sütlerdeki AFM 1 miktarlarının da insan sağlığı açısından toksik bir etkiye neden olamayacağı görüldü. Anahtar sözcükler: Yem hammaddesi, Yem, Yem fabrikası, Mikotoksin düzeyleri, Multiple mikotoksin İletişim (Correspondence) oruc@uludag.edu.tr

107 634 Determination of Various Mycotoxin... INTRODUCTION Mycotoxins are toxic metabolites that are produced by certain types of fungi genera such as Aspergillus, Penicillium and Fusarium, which invade crops in fields and may grow on foods and feedstuffs during storage under favourable conditions of temperature and humidity. The contamination of feed materials and feed with mycotoxins is a major problem of animal health concerns. Toxicological, environmental and epidemiological studies have addressed the health and economical problems of individual mycotoxins; however, more than one mycotoxin is usually found in the same contaminated commodities. The best-known mycotoxins are aflatoxins, trichothecenes, ochratoxin, zearalenone and fumonisin. Aflatoxin contamination in feedstuffs and feed is common in Latin America, Africa, Asia and Australia 1. Aflatoxins are toxic compounds that are produced by the fungi Aspergillus flavus and A. parasiticus. These fungi are known to be carcinogenic, mutagenic, teratogenic and immunosuppressive,3. In the aflatoxin group, approximately 16 compounds are known; however, only aflatoxin B 1, B, G 1, G and M 1 are routinely monitored. Aflatoxin B 1 (AFB 1 ) is the most prevalent and most toxic member of the group. When AFB 1 contaminates the feed of lactating animals, milk from these animals will contain aflatoxin M 1 (AFM 1 ), which is the principal metabolite that arises from the biotransformation of AFB 1 and is also a toxic compound. T- toxin, fumonisins (B 1 and B ), deoxynivalenol (DON) and zearalenone (ZEN), as well as toxins such as nivalenol and diacetoxyscirpenol, are trichothecenes. These toxins are produced by Fusarium moulds, which may develop in a variety of cereal grains, especially in cold climate regions or during wet storage conditions 4. Trichothecenes cause vomiting and refusal to feed. The immune system is the primary target of the toxins and inhibits protein synthesis in animals depending on the species 5. The effects of T- toxin include changes in leukocyte counts, delayed hypersensitivity, depletion of selective blood cell progenitors, depressed antibody formation and oral lesions in poultry 6. T- toxin has also been implicated in reproductive disorders in livestock. ZEN causes hyperoestrogenism, severe reproductive and infertility problems 7. Fumonisins are known to be the cause of equine leucoencephalomalacia and porcine pulmonary oedema syndrome, which are both associated with the consumption of corn-based feed 8. Mycotoxins are found in cereal crops, such as maize, wheat, barley, oats, rye and mixed feeds. Mycotoxins have a significant impact on the industry because they result in livestock loss and cause problems in rearing and breeding of animals 5. AFM 1 concentrations in milk and milk products are very important for human health, especially for babies and children that need milk and dairy products. Therefore, worldwide regulations were established for mycotoxins in food and feed 9. Although several countries routinely monitor certain mycotoxins depending on their climate conditions and imported feed materials, there is not enough monitoring of feedstuffs and feed in Turkey. In previous studies, high AFB 1 10,11 and AFM concentrations were identified in feedstuffs, feed and milk in Turkey. In addition, to the best of our knowledge, this is the first report to evaluate the ZEN and DON levels in feed materials in Turkey. The current study was performed to collect data on certain mycotoxins including AFB 1, T- toxin, fumonisin, ZEN and DON levels in local and imported feedstuffs and feed produced by a feed manufacturer. We also aimed to determine the AFM 1 concentrations in the certain raw milks of which the AFB 1 levels in the ration of cows were already determined by us. MATERIAL and METHODS The research materials consisted of dairy cattle, fattening and calf starter feed, and feed materials including wheat bran, rice bran, rice, barley, wheat, wheat middling, maize, maize gluten feed, maize gluten meal, sunflower meal, soybean meal, full fat soy, canola meal, dried distiller grains soluble (DDGS), beet pulp and biscuit samples. The samples were collected from a feed manufacturer, which obtained the samples from different regions of Turkey (n = 9) and from imported (n = 11) feed materials in Bursa province, which produced feed for all of Turkey. Imported materials were obtained from Ukraine (n = 6), USA (n = ), Bulgaria (n = ) and Russia (n = 1). Raw milk samples (n = 4) were collected from 10 certain dairy cattle farms. The analyses were usually performed after the samples arrived in laboratory. If necessary, feed and feedstuff samples were stored at 4 o C, and raw milk was stored at -0 o C. The samples involved the collection of approximately kilograms for feed materials and feed and ml for raw milk and were analysed between August and 1 September 010, the summer season in Turkey. The temperature was between 0 o C and 3 o C, and the humidity was between 50% and 75% in feedstuff storage facility for 4 h during sample collection. The number of research materials is presented in Table 1. AFB 1 (Aflatoxin B 1 30/15, Art. No. R111) in all of the samples, T- toxin (Fast T- toxin, Art. No. R530), fumonisin (Fast Fumonisin, Art. No. R560), DON (Fast DON, Art. No. R590) and ZEN (Fast Zearalenon, Art. No. R550) in all feed materials, and AFM 1 (Art. No. R1111) concentrations in milk were measured by competitive ELISA (EL 31e Biotek, Bio-Kinetics reader, USA) using Ridascreen test kits. The manufacturer procedures 16 were used to detect mycotoxins. Aflatoxin Clean-up Columns (R-Biopharm, P5) were used for dark coloured filtrates of samples. All of the statistical analyses were performed using the Minitab Statistical Program 17. AFB 1, AFM 1, T- toxin, fumonisin, DON and ZEN in local and imported feed

108 635 ORUÇ, SORUCU TÜRKMEN, ARSLAN materials were compared using the t-test. The differences were considered significant at P<0.05. Descriptive data were provided for AFB 1, T- toxin, fumonisin, DON and ZEN in all feed materials. RESULTS The determined levels of AFB 1 and AFM 1 as well as the determined levels of T- toxin, fumonisin, DON and ZEN in the samples are shown in Table 1 and Table, respectively. The incidence of each mycotoxin and multiple mycotoxins in feed materials is presented in Table 3. The incidence of AFB 1 in all samples (40 feedstuffs + 34 feed = 74) was 100%, and the incidence of AFM 1 in raw milk samples was also 100%. DISCUSSION Mycotoxin concentrations in feed and feed ingredients are very important for animal health and also imported for Table 1. AFB 1 (μg/kg) and AFM 1 (ng/kg) levels in feed, feedstuffs and raw milk, respectively Tablo 1. Yem ve yem hammaddelerinde AFB 1 (μg/kg) ve çiğ sütlerde AFM 1 (ng/kg) miktarları Feed and Feedstuffs n Mean SEM Min Max Dairy cattle Fattening Calf starter Wheat bran Wheat grain Wheat middling Rice bran Rice grain Maize grain Maize gluten feed Maize gluten meal DDGS Sunflower meal Barley grain Soybean meal Full fat soy Canola meal Beet pulp Biscuit Feedstuffs (total) Feedstuffs (local) Feedstuffs (imported) Raw milk (AFM 1 ) Table. T- Toxin, fumonisin, DON and ZEN levels in feedstuffs Tablo. Yem hammaddelerinde T- Toksin, fumonisin, DON ve ZEN düzeyleri * Mean±SEM Feed and feedstuffs n T- Toxin (μg/kg) Fumonisin (mg/kg) DON (mg/kg) ZEN (μg/kg) Feedstuffs (total) ± ± ± ±15.0 Feedstuffs (local) ± ± ± ±18.0 Feedstuffs (imported) ± ± ± ±4.50 * Mean levels were calculated according to number of positive samples

109 636 Determination of Various Mycotoxin... Table 3. Incidence of analysed samples for each and multi-mycotoxins in feedstuffs (%) Tablo 3. Yem hammaddelerinde mikotoksinlerin bireysel ve birlikte bulunma oranları (%) Feedstuffs n * B 1, T- ** F DON ZEN B 1 +T- Feedstuffs (T) Feedstuffs (L) Feedstuffs (I) Feedstuffs n B 1 +T-+F B 1 +T-+DON B 1 +T-+F+DON B 1 +T-+DON+ZEN B 1 +T-+F+DON+ZEN Feedstuffs (T) * B 1: AFB 1, ** F: Fumonisin, T: Total, L: Local, I: Imported human health because the presence of some mycotoxins such as AFM 1 in dairy animal milk. In the current study, the incidence of both AFB 1 and T- toxin was 100%, which is a very high ratio. The incidence of fumonisin (80%), DON (75%) and ZEN (33%) (Table 3) decreased, and the incidence of ZEN in feedstuffs was the lowest. The analysis of multi- mycotoxins in feed materials revealed that the incidences were high for AFB 1 + T- toxin (100%) and AFB 1 + T- toxin + fumonisin (80%), average for AFB 1 + T- toxin + DON (75%) and AFB 1 + T- toxin + fumonisin + DON (50%), and low for AFB 1 + T- toxin + DON + ZEN (0%), AFB 1 + T- toxin + fumonisin + ZEN (15%) and AFB 1 + T- toxin + fumonisin + DON + ZEN (15%). The results show that AFB 1, T- toxin and fumonisin incidence was high and ZEN and the multiple mycotoxin contamination with ZEN were low in the same feed materials. The speculation on the interaction between mycotoxins on the cellular level raises many questions, which remain unanswered. It is now understood that in humans and animals, toxicokinetic 18 and toxicodynamic interactions result from a simultaneous influence of the amount and type of mycotoxins 19. The incidence of AFB 1 and T- toxin in our current study were similar to the study in feed and feedstuffs that was reported by Oruc et al. 11. Although the incidence of AFB 1 in this study was higher than that reported by Sonal and Oruc 0 in poultry feed, AFB 1, T- toxin, fumonisin and ZEN incidences were lower than those reported in poultry feed by Sonal and Oruc 0 in Turkey. In the current study, the highest level of AFB 1, T- toxin, fumonisin and DON were usually found in maize and maize-based feed materials between 1.86 and μg/kg (Table 1). The highest level of AFB 1 was detected in a sample of DDGS (70.00 μg/kg). The highest T- toxin concentration was found in maize gluten feed (10.35 μg/kg). The highest level of fumonisin was identified in a maize grain (5.06 mg/kg). The highest DON concentration was found in maize gluten meal (.50 mg/kg), and the highest ZEN concentration was detected in wheat middlings ( μg/kg). The mean AFB 1 concentration (8.6±.19 μg/kg) in all of the feed materials was lower than the limits established by the European Union (EU) (0 μg/kg) 1 and by Turkey (50 μg/kg). However, a maize grain (58 μg/kg) and a DDGS (70 μg/kg) sample levels were higher than the Turkish and EU legal limit. The mean AFB 1 results do not support the previous study 11, which reported higher AFB 1 concentrations in the same region (Bursa region, Turkey). The AFB 1 levels were 1.87±6.5 μg/kg in rice bran, 1.00±1.67 μg/kg in sunflower meal, 58.40±8.15 μg/kg in DDGS and ±77.30 μg/kg in maize grain. Nevertheless, the mean AFB 1 level in the current study was similar to that in the maize samples (10.94±.3 μg/kg, total aflatoxin) reported by Oruc et al. 10. The mean AFB 1 concentration in the dairy cattle feed samples (3.37±0.90 μg/kg) was lower than the EU limit and the Turkish limit of 5 μg/kg. The legal limits fluctuate between 5 and 5 μg/kg in many countries 9. A dairy cattle feed sample value (5 μg/kg) was higher than the level of 5 μg/kg (Table 1). The mean AFB 1 level of the calf starter (3.47±0.57 μg/kg) and fattening (.8±0.8 μg/kg) feed samples were lower than the Turkish and EU legal limits (10 μg/kg). The mean T- toxin level in all of the feed materials groups was between 9.87±3.16 and 30.76±.37 μg/kg (Table ). Although the T- toxin level has not been regulated in EU and Turkey, these concentrations were lower than the toxic levels of T- toxin that have been reported as 100 μg/kg for animals by Mabbett 1 and 500μg/kg for growing pigs by Rafai et al. 3. One of maize gluten feed samples contained μg/kg of T- toxin, which is higher than 100 μg/kg. The mean levels of the samples were lower than those identified in poultry feeds (58.59 μg/kg), which was reported by Sonal and Oruc 0, and similar (between 1.10±0.80 and 37.70±10.39 μg/kg in feed materials) to those in Turkey, which was previously reported by Oruc et al. 11. The mean fumonisin (B 1 + B ) levels in all of the samples groups were between 0.3±0.16 and 0.85±0.60 mg/kg (Table ). Fumonisin limits have not been regulated by the EU and Turkey. However, we determined that fumonisin concentrations were lower than that provided by the EU Commission Recommendation 4. The EU Commission Recommendation for the products that are intended for animal feeding ranges from 5 to 60 mg/kg depending on feed and feedstuffs. Although the mean levels of the samples

110 637 ORUÇ, SORUCU TÜRKMEN, ARSLAN were higher than those in poultry feeds (0.18 mg/kg), which was reported by Sonal and Oruc 0, and considerably lower than those in local (88.4 mg/kg) and imported (74.15 mg/kg) maize samples in Turkey, which was reported by Oruc et al. 10. The mean DON concentrations were between 0.38±0.11 and 0.89±0.5 mg/kg (Table ). The DON limits have not been regulated by the EU and Turkey. However, DON levels were lower than that provided by the EU Commission Recommendation 4. The EU Commission Recommendation for the products that are intended for animal feeding ranges from 0.9 to 1 mg/kg depending on feed and feedstuffs. To the best of our knowledge, DON levels were studied for first time in feed materials in Turkey. The mean ZEN concentrations were between 9.50±4.50 μg/kg and 65.80±18.0 μg/kg (Table ). The ZEN limit has not been regulated in EU and Turkey; however the ZEN levels were lower than that provided by the EU Commission Recommendation 4. The EU Commission Recommendation for the products that are intended for animal feeding ranges from 0.1 to 3 mg/kg depending on feed and feedstuffs. Although ZEN levels were studied in poultry feeds 0, corn silage 5 and fresh grass silage 6, ZEN was studied for first time in all feed materials in Turkey. The AFM 1 levels ranged from.48 to ng/kg in raw milk samples that were obtained from dairy cattle farms (mean = 7.50±0.86) (Table 1). The mean AFM 1 concentration was lower than the Turkish 7 and EU limit of μg/kg 8, and the Codex Alimentarius 9 limit of 0.50 μg/kg. The AFB 1 levels in dairy cattle feed were usually low (between 0.87 and 6.5 μg/kg), which the cows that produced the raw milks fed with these feeds in their rations. Therefore, AFM 1 level were low in the milk samples. These results did not support several previous studies that were performed in the same region or other regions of Turkey 1-15, which reported that the milk samples contained more than 50 ng/kg of AFM 1. In the current study, the mean value of the samples from Turkey was usually (except fumonisin) higher than those of the imported samples (Table 1 and ). A statistically significant difference (P<0.05) was observed between the local and imported feedstuff samples for AFB 1 (P=0.07). A statistically significant difference (P>0.05) was not observed between the local and imported feedstuff samples for T- toxin, fumonisin, DON and ZEN. The mean mycotoxin levels in feed, feed material and raw milk samples were lower than the legal limits. Because of the low levels, there is no risk to animal and human health from AFM 1. Mycotoxin levels in feed, feed material and raw milk samples, especially AFB 1 and AFM 1 in raw milks, were usually lower than those reported in previous studies in Turkey. For multiple mycotoxin, the incidences of AFB 1, T- toxin and fumonisin in feed materials were high, while the incidence of ZEN was low. The mycotoxin levels (except for fumonisin) in imported feed materials were lower than those in the local feed materials. During the current study and in our routine analyses, we observed that the technical staffs of feed manufacturing and dairy cattle companies were usually well-informed about the factors influencing mycotoxin production in feed stuffs. Nevertheless, preventive measures should be taken to decrease the risk of mycotoxins, especially AFB 1 in feed materials such as maize and maize-based materials and AFM 1 in milk and dairy products. REFERENCES 1. Mabbett T: The mycotoxin menace. Feeding Times, 4, 4-5, Fink-Gremmels J: Mycotoxins: Their implications for human and animal health. Vet Quart, 1, , Bennet JW, Klich M: Mycotoxins. Clin Microbiol Rev, 16, , Bottalico A: Fusarium diseases of cereals: species complex and related mycotoxins in Europe. J Plant Pathol, 80, , Gajecki M, Zielonka Ł, Obremski K, Jakimiuk E, Gajecka M: Multimycotoxicosis. Environ Biotechnol, 3, 5-9, Creppy EE: Update of survey, regulation and toxic effect of mycotoxins in Europe. Toxicol Let, 17, 19-38, D Mello JPF, Placinta CM, Mc Donald AMC: Fusarium mycotoxins: A review of global implications for animal health, welfare and productivity. Anim Feed Sci Tech, 80, , Osweiler GD, Ross PF, Wilson TM, Nelson PE, Witte ST, Carson TL, Rice LG, Nelson HA: Characterization of an epizootic of pulmonary edema in swine associated with fumonisin in corn screenings. J Vet Diagn Invest, 4, 53-59, FAO Food and Nutrition: Worldwide regulations for mycotoxins in food and feed. Papers-81, Oruc HH, Cengiz M, Kalkanli O: Comparison of aflatoxin and fumonisin levels in maize grown in Turkey and imported from the USA. Anim Feed Sci Tech, 18, , Oruc HH, Cengiz M, Uzunoglu I: Occurrence of aflatoxin B 1 and T- toxin in feed and raw ingredients used for animal feeding stuffs. Uludag Univ J Fac Vet Med, 6, 1-5, Gunsen U, Buyukyoruk I: Aflatoxins in retail food products in Bursa, Turkey. Vet Hum Toxicol, 44, 89-90, Sarimehmetoglu B, Kuplulu O, Celik TH: Detection of aflatoxin M 1 in cheese samples by ELISA. Food Control, 15, 45-49, Oruc HH, Kalkanli O, Cengiz M, Sonal S: Aflatoxin M 1 in raw milks collected from plain and elevated mountain villages in Bursa, Turkey. Milchwissenschaft, 60, 71-7, Unusan N: Occurrence of aflatoxin M 1 in UHT milk in Turkey. Food Chem Toxic, 44, , R-Biopharm AG: Ridascreen Test kits, R-Biopharm AG, Darmstat, Germany, Minitab13: Minitab Inc. State College, PA, USA, Versantvoort CHM, Oomen AG, Van de Kamp E, Rompelberg CJM, Spis AJAM: Applicability of an in vitro digestion model in assessing the bioaccessibility of mycotoxins from food. Food Chem Toxicol, 43, 31-40, Tritscher AM, Page SW: The risk assessment paradigm and its application for trichothecenes. Toxicol Let, 153, , Sonal S, Oruç HH: Bursa bölgesindeki tavuk çiftliklerinden sağlanan yemlerde mikotoksin düzeyleri (Natural mycotoxin levels in mixed feed taken from poultry farm in Bursa province). YYU J Fac Vet Med,, 1-6, 000.

111 638 Classification Tree Method for Commission Directive 003/100/EC: Undesirable substances in animal feed (00/3/EC). O J, 85, 33-37, Turkish Feed Law: Maximum levels of contaminants in feed material and feeds. Official newspaper, 7449, Rafai P, Bata A, Vanyi A, Papp Z, Brydl E, Jakab L, Tubloy S, Tury E: Effect of various levels T- toxin in the immune system of growing pigs. Vet Rec, 136, , Commission Recommendation: On the presence of deoxynivalenol, zeralenone, ochratoxin A, T- and HT- and fumonisins in products intended for animal feeding (006/576/EC). O J, 9, 7-9, Aydin H, Oğuz H: Mısır silajında aflatoksin b 1 ve zearalenon kirliliklerinin yüksek performanslı ince tabaka kromatografisi (HPTLC)- florodansitometrik yöntemle belirlenmesi. Kafkas Univ Vet Fak Derg, 18 (1): , Arslan C, Essiz D: Establishing the optimum cutting date and additives for pasture grass silage and its mycotoxin levels. Kafkas Univ Vet Fak Derg, 15 (4): , Turkish Food Codex: Setting maximum levels for certain contaminants in foodstuffs (No: 009/). Official Newspaper, 7143, Commission Regulation: Setting maximum levels for certain contaminants in foodstuffs (No: 1881/006). O J, 364, 5-4, Codex Alimentarius: Codex general standard for contaminants and toxins in food and feed. Codex Standard, 193, 1-39, 1995.

112 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Social Factors that Affect the Hand Hygiene of Elementary and Highschool Students in İstanbul Turkey [1] Emek DÜMEN * N. Yakut ÖZGÜR ** Funda H. SEZGİN *** [1] This study was supported by the Istanbul University Scientific Researches Project Unit with Issue Nuber of 6477/010 * Istanbul University, School of Veterinary Medicine, Department of Food Hygiene and Technology, TR-3430 Avcılar, İstanbul - TURKEY ** Istanbul University, School of Veterinary Medicine, Department of Microbiology, TR-3430 Avcılar, İstanbul - TURKEY *** Istanbul University, School of Engineering, Department of Industrial Engineering, TR-3430 Avcılar, İstanbul - TURKEY Makale Kodu (Article Code): KVFD Summary Persons are the primary performers for all food security systems and public health procedures, but humans do not have a standard configuration. The personal variables like age, gender, economic positions, psychological conditions, educations given by the family, life style and environment are the factors that determine main personal differences of humans. This situation can cause implementation differences for standard procedures as food security performances and educations related with food hygiene. Especially individual hygiene procedures must be tought to individulas when they are in childhood and early adult period very effectively. In this study we aim to determine how the social factors (economic position, mother/father occupation, number of siblings/household, etc.) effect hand hygiene according to the chosen microbiological parameters statistically who are registered in elementary and highschool programs of different schools in Istanbul. For this purpose 0 schools were visited for 3 months (visits were monthly). From each school 50 students (5 male and 5 female students) were sampled. The samples were anaylzed for the chosen microbiological parameters the correlations were determined among the microbiological parameters and the social variables of the students. According to the results we got, it was determined that the social variables were very effective on the students hygiene habits and microbiological load of the hands. Keywords: Elementary school, Highschool, Lycee, Social factors, Hand Özet İstanbul daki İlköğretim ve Lise Öğrencilerinin El Hijyenini Etkileyen Sosyal Faktörler Tüm gıda güvenlik programları ve halk sağlığı prosedürlerinde birincil uygulayıcı insanlardır. Sosyal bir varlık olan insanın yapısındaki ana farklılıkların oluşmasında yaş, cinsiyet, sosyo-ekonomik pozisyonlar, psikolojik durumlar, aile içi eğitimler ve bakış açıları gibi bireye özgü değişkenler etkin bir rol oynamaktadır. Bu durum da, hem standart bir bilginin veya eğitimin verilmesindeki kişisel farklılıklara hem de standart bilgiyi ve eğitimin alınması takiben her bireyin alınan bilgileri hayata geçirmesinde kişisel farklılıklara neden olmaktadır. Özellikle çocukluk ve genç erişkinlik dönemini yaşayan bireylere hijyen prosedürleri çok bilinçli bir biçimde öğretilmeli, uygulattırılmalı ve söz konusu prosedürler çocuklarda ve genç erişkinlerde alışkanlık haline getirilmelidir. Bu araştırmada İstanbul bölgesindeki ilköğretim ve lise öğrencilerinin sosyal faktörlerinin (ekonomik pozisyon, annelerinin/ babalarının işi, kardeş/hane halkı sayısı vb) el hijyenlerini nasıl etkilediği tespit edilmiş ve analiz edilen mikrobiyolojik parametreler ile öğrencilerin sosyal faktörleri arasındaki korelasyon ilişkileri belirlenmiştir. Bu amaçla İstanbul bölgesinde toplam 0 adet okul 3 ay boyunca, aylık frekanslarda ziyaret edilmiştir. Her bir okuldan 50 adet örnekleme yapılmıştır (5 erkek, 5 kız öğrenci olmak üzere). Elde edilen sonuçlar sosyal faktörlerin öğrencilerin hijyen alışkanlıkları üzerinde çok önemli etkilere sahip olduğunu göstermiştir. Anahtar sözcükler: İlköğretim okulları, Lise, Sosyal faktörler, El İletişim (Correspondence) /17154 emekdumen@yahoo.com

113 640 Social Factors that Affect... INTRODUCTION The incidence of foodborne illnesses is increasing worldwide 1. In the United States of America, 76 million food poisoning cases are reported every year and cases of those cases are reported to be fatal. According to the laws related to the new hygiene regulations of European Community (EU), it is a compulsory process for all kinds of food plants to apply food security systems at the all steps of the production and selling practices since 005 3,4. Mass consumption points as schools, hotels, hospitals, business centers have important roles on contamination ways and food related surfaces, equipments, staff and even final consumers are evaluated as critical control points for food safety chain 5,6. Inadequate hygiene conditions and/ or microbiologically loaded hands can be the weakest ring of the food safety chains and these factors can risk public health seriously. Systematic hygiene applications and continuous hygiene education programs decrease the incidence of contamination of food pathogens originated from the critical control points explained above 6. In developed countries, one of the most important preventive factors for the public health is to provide healthy and qualified foods for balanced and correct diets to the consumers while eliminating the possible pathogens and producing all kinds of foods under sufficient hygienic conditions. Continuously increasing population of world, pollution of the natural sources, industry, lack of education the results were interpreted in the aspect of formed statistical models. Thus, the significant/non-significant differences of individual variables determined that were effective on contamination. MATERIAL and METHODS School Visit Programs To determine how the individual variables of the students effect the microbiological hand loads of the students, total of 0 schools were visited during one school term. Details of the school visit program are shown in Table 1. Student Samplings Hand swab samples of 50 students (5 male, 5 female) for each school were collected. Entire palm including fingers for each student was sampled by using double swab technique. All the hand swab samples were transported to the laboratory and analyzed in the same day of sampling for the chosen microbiological parameters. Same students were sampled in each school at every visit during the visiting period of the study. The rate of different student sampling because of the reasons such as changing schools, absence of the students because of illnesses and/or from individual excuses was less than 1% of total sampling process. Table shows the analyzed microbiological parameters and the individual variables of the students. Table 1. Details of the school visit programs Tablo 1. Okul ziyaret program detayları Number of School Type Schools Visited Economic Status Number Students Analyzed (Hand Swabs) Visiting Frequency Visiting Period Elementary 5 In low income regions 50 (5 male/5 female) Monthly September - January Elementary 5 In high income regions 50 (5 male/5 female) Monthly September - January High school 5 In low income regions 50 (5 male/5 female) Monthly September - January High school 5 In high income regions 50 (5 male/5 female) Monthly September - January due to economic reasons, complicates to provide hygienic and safe food products and enlarges nutrition problems and cause to increase the cases suffering from foodborne illnesses and toxications all over the world. Based on these reasons, it is very important to expose the contamination ways of the foodborne pathogens, and the risk factors especially in mass consumption points by using statistically and microbiologically based risk models and risk maps 3. In this study it was purposed to expose how individual variables (age, gender, income of the family, etc.) of the students who were included to primary, secondary and high school education programs of different schools located in Istanbul effect the microbiological loads of their hands according to the chosen microbiological parameters and Table. Analyzed microbiological parameters and the individual variables of the students Tablo. Analiz edilen mikrobiyolojik parametreler ve öğrencilerin kaydedilen bireysel değişkenleri Microbiological Parameters Analyzed Total Mesophilic Aerobic Bacteria Count Total Coliform Group Bacteria Count Escherichia coli Staphylococcus aureus Salmonella spp. Bacillus cereus Age Individual Variables of the Students Recorded Gender Number of Siblings Number of Household Occupation of the parents Hand washing frequency (number of hand washings/day)

114 641 DÜMEN, ÖZGÜR SEZGİN Microbiological Analysis All the microbiological analysis were performed according to the standards of FDA/BAM (Food and Drug Administration/Bacteriological Analytical Manual) (U.S. FDA) and double swab technique was used. All the swab samples were transported to the laboratories of Istanbul University, School of Veterinary Medicine, Department of Food Hygiene and Technology and the analysis were performed in the same day of the sample transportation for each visit program. During transportation period, tubes included Stuart Transport Medium (Oxoid, CM 0111) was used for each swab. Different swabs were used for each microbiological parameter would be analyzed. Total Mesophilic Aerobic Bacteria Count: Swabs were streaked onto PCA (Plate Count Agar) contained Petri dishes. Petri dishes were inoculated at 37ºC for 48 h and typical colonies were counted at the end of the incubation period 7. Coliform Group Bacteria Count: Swabs were streaked onto VRBA (Violet Red Bile Agar) contained Petri dishes. After inoculation an additional VRBA layer was poured to each dish. Petri dishes were inoculated at 37ºC for 4 h and typical colonies were counted at the end of the incubation period 7. Escherishia coli Count: Swabs were streaked onto TBX (Tryptone Bile X-glucuronide) agar contained Petri dishes. Petri dishes were inoculated at 44ºC for 4 h and typical colonies were counted at the end of the incubation period. Approximately 98% of E. coli serotypes include β - D glucuronidase enzyme. The enzyme is found extremely rare in other pathogens and breakdowns MUG (4 - Methylumbilliferyl-β-D glucuronid) substrate and the brokendown products form fluorescent radiation under U.V. light. Therefore, an additional chromogenic medium including MUG (E. coli Broth with MUG) was used for verifying 7. Staphylococcus aureus Count: Swabs were streaked onto BPA (Baird - Parker Agar) contained Petri dishes. Petri dishes were inoculated at 37ºC for 4 h. At the end of the incubation period, black colonies with white zones were passeged to DNAse Agar and incubated at 37ºC for 4 h. Coagulase test was applied to the suspected colonies and coagulase positive colonies were evaluated as S. Aureus 7. Salmonella spp. Count: Swabs firstly were pre - enriched in BPW (Buffered Peptone Water). After an incubation period at 37ºC for 4 h, isolates then enriched in Rappaport Vassiliadis Soy Broth which is a selective medium for Salmonella spp. Again enriched isolates were incubated at 37ºC for 4 h, then enriched cultures were streaked onto Brilliant Green Phenol Red Lactose Sucrose Agar, which is a solid specific media. Besides, XLD (Xylose Lysine Deoxycholate Agar) agar was also used for verification. Both XLD and Brilliant Green Phenol Red Lactose Sucrose Agar included Petri dishes were inoculated for 4 h at 37ºC and chemical tests were used to identify the suspected colonies. At this stage TSIA (Triple Sugar Iron Agar), urea broth and SIM (Semi Indol Motility) agar were used and identification procedure was completed 7. Bacillus cereus Count: Swabs were streaked onto B. cereus Selective Agar included Petri dishes. Petri dishes were incubated at 37ºC for 4 h. At the end of the incubation period typical colonies were counted 7. Statistical Analysis To expose the corelations between individual variables of the students and chosen microbiological parameters, MANOVA, t test, Friedman test, Mann Whitney U test, Pearson corelation analysis, Kendall s Tau relationship analysis, Chi square relationship analysis and logistic regression analysis were used RESULTS In this study, 0 schools (10 elementary schools and 10 high schools) were visited during one term (September - January) and from each school, the microbiological loads of 50 students hands (5 male students, 5 female students) were analyzed for the chosen microbiological parameters. Besides, to establish microbiological pollution models and to determine correlations between microbiological pollution and individual parameters 6 questions were asked to students which thought to be effective to microbiological pollution and total contamination. Table 3 shows the questionnaire of the students. According to the results we got, some individual variables of the students were directly effective on their hands microbiological loads. Both Significant and non-significant variables were evaluated as possible risk factors for total contamination at schools and the students health. Father Occupation and Age variables were not effective to any microbiological parameter analyzed. However, nonsignificant variables showed us insufficient general and hand hygiene habits that were acquired in the period of early childhood could not easily be changed during lifetime and it was evaluated as a serious immeasurable risk factor for the food and public health in the situation of employment of the children in food related occupations in the future years of their lifetime. Table 4 shows binary correlations between the individual variables of the students according to the analyzed microbiological parameters. DISCUSSION In this study, it was aimed to determine how the individual parameters and living habits (age, gender, economical status, etc.) of the students were interacted with the microbiological load of the students hand and

115 64 Social Factors that Affect... Table 3. Student questionnaire and the detailed data bases of the related questions Tablo 3. Öğrencilere yapılan anket ve ilgili sorulara ait veri dağılımları Individual Variables of the Students Investigated (n=1000) Age Number of Siblings Number of Households Occupation of Mothers Occupation of Fathers Hand washing Frequency (numbers/day) Sub-diffraction Topics and Values of the Related Individual Variables (Numbers and Percentage) 8 Years Old 9 Years Old 15 Years Old 16 Years Old 19 Years Old 19 (19.%) 38 (3.8%) 31 (3.1%) 46 (4.6%) 3 (0.3%) None 1 Sibling Siblings 3 Siblings 3+ Siblings 330 (33%) 34 (34.%) 181 (18.1%) 105 (10.5%) 4 (4.%) 3 people 4 people 5 people 6 people 6+ people 99 (9.9%) 345 (34.5%) 0 (%) 87 (8.7%) 49 (4.9%) Housewives Self - employed Private Sector Employees Governmental Employees Academics 37 (37.%) 13 (13.%) 178 (17.8%) 86 (8.6%) 3 (3.%) Unemployed Self - employed Private Sector Employees Governmental Employees Academics 61 (6.1%) 381 (38.1%) 38 (38.%) 80 (8%) 96 (9.6%) None 1 Time 1 to 5 Times 5 to 10 Times 10+ Times 5 (0.5%) 1 (1.%) 70 (7%) 130 (13%) 133 (13.3%) the role of explained parameters and habits on total contamination ways at schools of Istanbul by using statistical models. Multiple and binary correlations of the parameters were exposed and the effect of the parameters on contamination pathways on schools were investigated on the basis of selected groups. Thus, differences between schools and parameters were included into the statistical pollution models. Corelations of the chosen microbiological parameters due to economic status of the schools were analyzed and statistical differences were in favor of the schools located in the regions which had higher economical income levels relatively (the students of the schools located in the regions which had higher income level relatively were cleaner then the students of the schools located in the regions which had lower income level due to chosen microbiological parameters). It is thought that more effective hand hygiene education are both given and applied to the students in schools by their teachers and/or families. Besides, usage of more effective and high quality soaps/disinfectants may be one of the reasons of our results. Period and frequeny of handwashing is also very important for eliminating the pathogens. We observed that the students of the schools located in higher income level regions were spending approximately double time period for each handwashing process than the students of the schools located in lower econimic income level regions (data not shown). Medical literature indicates that it is very important to use effective chemicals (the chemicals which are non toxic, do not leave any residues and provide optimal antiseptic conditions) for minimizing cross contamination and eliminating the pathogens from hands 16. Applications of effective hygiene education programs by educational institutions and families from the begining of the childhood to the students are very important as well as the usage of correct chemicals for handwashing for both protecting food and public health 17. Microorganisms in the hands due to duration period are seperated into groups as permanent and temporary microorganisms 18. Soil and water originated permanent microorganisms as S. aureus. B. Cereus and coliforms may induce fatal food intoxications and the infections 19. Permanent pathogens generally use cross and animal/soilfood-human digestive system contamination ways and grow in the fat tissue of the hands and the agents are continiously spread by the hosts unless an effective and continious handwashing processes are applied 18. Because of the reasons discussed above, especially hand washing habits in children are very important for both food and public health. According to our results, ages of the students were not an effective individual parameter on microbiological pollution of hands. These findings cause to think us habits acquired in the childhood period do not change. Gaining hand and general hygiene habits for persons, especially for children and elementary school students is very important for permanent and continious hygiene applications. In the case of acquiring inadequate hygiene habits it may be very hard to change in the future years for a person, while a child or elementary school student can apply correct hygiene processes during his lifetime and can minimize the risk factors in case of gaining correct habits of hand and general hygiene. Another point that must not be forgotten is; an elementary school student with inadequate hygiene habits can be a serious risk factor if he/she works at any food related position when he/she is adult for the total plant in spite of the explained risk factors have not been evaluated in our study. It can be very difficult changing the habits acquired, no matter how the food hygiene training

116 643 DÜMEN, ÖZGÜR SEZGİN Table 4. Binary correlations between individual variables and the chosen analyzed microbiological parameters Tablo 4. Analiz edilen mikrobiyolojik parametreler ile öğrencilerin bireysel değişkenleri arasındaki ikili korelasyonlar Variables Microbiological Parameters P Value Significance School Type Age Number of Siblings Number of Household Mother Occupation Father Occupation Hand Washing Frequency Total Mesophilic Aerobic Count Total Coliform Group Bacteria Count E. coli S. aureus B. cereus Total Mesophilic Aerobic Count Total Coliform Group Bacteria Count E. coli S. aureus B. cereus Total Mesophilic Aerobic Count Total Coliform Group Bacteria Count E. coli S. aureus B. cereus Total Mesophilic Aerobic Count Total Coliform Group Bacteria Count E. coli S. aureus B. cereus Total Mesophilic Aerobic Count Total Coliform Group Bacteria Count E. coli S. aureus B. cereus Total Mesophilic Aerobic Count Total Coliform Group Bacteria Count E. coli S. aureus B. cereus Total Mesophilic Aerobic Count Total Coliform Group Bacteria Count E. coli S. aureus Salmonella spp. parameter was excluded from statistical model because of have not benn isolated from any of hand swabs sampled from students, Bold characters refer significant results between the related parameters at Significance column enterprises/applications are effective applied by the plants and/or institutions 0. This situation cause to think us it is so important to gain early students the veryfirst general and hand hygiene habits for public health and food security chains. Household and number of siblings parameters were effective on plate count, coliform group bacteria, E. coli and S. aureus values according to our findings. Dumen and Sezgin 0, investigated total of 100 franchise bakeries of same brand located in different geographic regions in Turkey during one year and they indicated that household parameter were effective to the microbiological hand loads of the staff for coliform group bacteria count. Because the number of siblings directly effects the number of household variable, both variables in our study were effective on the same microbiological parameters. The variables were also effective on total contamination ways of the schools due to our findings. As the number of siblings, and therefore the number of household increases, we think that microbiological risk factors may increase due to lack of quality

117 644 Social Factors that Affect... Table 5. Examination of the school groups (the schools located in the regions that had higher economic income level relatively and the schools located in the regions that had lower economic income level relatively) according to the economic status of the regions that they were located in Tablo 5. Ekonomik gelir düzeyine göre (ekonomik gelir seviyesi görece düşük bölgelerde bulunan okullar ile ekonomik seviyesi görece yüksek bölgelerde bulunan okullar olmak üzere) okulların analiz edilen mikrobiyolojik parametrelere göre grup bazındaki farklılıkları Microbiological Parameter Mean Standart Deviation 95% Confidence Interval of Lower 95% Confidence Interval of Upper t df Sig. (-tailed) Total Mesophilic Aerobic Count Total Coliform Group Bact. Count Escherichia coli Staphylococcus aureus Bacillus cereus time spent with children and/or economical reasons, and this situations cause to gain the children insufficient hygiene habits. Not applying the general and hand hygiene rules in the family can directly effect total cross - contamination pathways and food security in houses. This case may possibly risk the general hygiene of the plants such as workplaces, schools that the individuals (students, teachers, staff) spent their time during the day and also the foods that are consumed in the places declared above. According to a decleration published by UNICEF in 1998, it was indicated that household variable is the main risk factor for the food consumed in the houses and it was also declared that even the foods produced under hygienic conditions, they can become serious risk factors in a house/ place that general and hand hygiene procedures are not applied. The same decleration also points out that the most common reason of the diarrheas originated from different aetiologic reasons is the inadequate hygienic conditions in houses of the undeveloped/developing countries,14. In spite of it was not investigated in our study, according to us, an important point that must not be forgotten is, insufficient hygienic conditions would be very serious risk factors for the cases who have immature/depressed immune systems such as neonates, HIV/cancer patients and the cases suffering from metabolic diseases. Occupation of the mothers of the students analyzed in our study was another variable that effects the microbiological pollution of the hands. This variable was effective on plate count, coliform group bacteria, E. coli and S. aureus parameters according to the results we got. The significant differences of cleanliness was in favor of the mothers who were housewives and the mothers who worked at health sector. We think that housewife mothers can take care of personel hygiene of their children more effectively because they can spend more time in the house than the working mothers. It is also thought that the mothers who work at health sector can embrace the general and hand hygiene applications to their children because of professional consciousness about general and hand hygiene rules. Medeiros et al. 1, indicate that mothers are last ring of food security chians against the contamination of the pathogens to children. Rao et al., state that the most important factor for awareness of hygiene habits for the children who are under 5 years old are the mothers according to a study that they made in India in the year of 007. Also the same researchers pointed out that the hygiene habits settled to the children at the same age range do not change during the lifetime. In our study too, it was determined that the age variable was not effective on the microbiological pollution of the students hands according to the chosen parameters. This situation cause to think us maternal factors are very important for achild about awareness of hygiene habits and the recovery of basic hygiene applications are due to the very first education given to the children by the mothers. This situation can be very important for the public health and food security in case of employement of the children who are not acquired correct hygiene applications from their mothers in the future years of their lifetime. We also think that it is very hard to estimate and measure the qualitative, quantitative and economic effects of the individuals that did not acquired correct hygiene applications from their mothers in period of early childhood to the public health and this situation is evaluated as a very important hidden risk factor for both public health and food security. According to us, the results we got point out that correct hygiene habits of children acquired from their mothers can be an important factor for decreasing the risk incidences in food sector. Another important point that must be indicated is the permanence of the hygiene educations given by the professionals under the organization of governmental institutions by using the communication tools as televisions and radios. Besides, we think that it is very important to establish plot education centers related to the subjects for education of the public about hygiene applications especially in the regions which have lower economic income relatively. Father occupation variable was not effective on the microbiological pollution of students hands for the chosen microbiological parameters according to our results. This output supports the importance of the maternal factors on the hygiene habits of children. Fathers may not have sufficient effect for their children to acquire correct habits of hygiene because of economical (long hours of working) and traditional (less interests to the children relatively to the mothers) reasons.

118 645 DÜMEN, ÖZGÜR SEZGİN Handwashing frequency variable was effective on all the microbiological parameters. For all the microbiological parameters, all the students determined as clean stated thet they wash their hands at least 5 times a day. In spite of hand washing frequency variable was first degree decisive the microbiological hand loads of the students, it must not forgotten that the variable s effect may vary according to the some secondary related variables as the time of handwashing process, usage of effective chemicals and hygiene conditions of common areas. Japanese Ministry of Health declared that 37% of total food intoxication cases in Japan were inadequate handwashing processes oriented in the yaer ,3. Scott 4, inticates that this rate increase up to 80% in Europe. Unfortunately there is not an exact rate decleration in our country but we assume that inadequate hand washing processes is a very important factor in the total food intoxication cases. Handwashing applications are indicated as a very important preventive process for eliminating the pathogens which use faeceshand-mouth/food contamination pathway by the medical literatures 5-8. Because of the reasons discussed above correct handwashing applications decrease the incidence of cross contaminations and help to protect total hygiene of the plants. Economic income level was another variables that was investigated in our study. According to the results we got, the students of the schools which were located in the regions that had higher economic income level relatively were cleaner than the schools which were located in the regions that had lower economic income level relatively. All the chosen microbiological parameters showed a significant differences (P<0.005) according to the economic income variable. According to Dharod et al. 9, in United States America the hand mincrobiological loads of the individuals who earn less than USD/month were significantly higher than the individuals who earn more than USD/month. Our results, too, were parallel to Dharod et al. 9 and we observed that there is an inverse rate between the hand microbiological pollution of the students and economic income. Medical literature indicates that hand washing frequencies of the families that have very nominal economic income levels (300 USD and lower) are much more lower than it should be 9,30. According to the results we got, it was determined that the handwashing frequencies of the students in the schools that were located in the regions which had lower economic income relatively were lower than the studens in the schools that were located in the regions which had relatively higher economic income. Moreover, we observed that there were not soaps in the toilets of the schools included lower economic income group. We also observed that in all the schools included to the high income level had hand - washing instructions in their toilets while one school included to the low economic income group had the instruction. It is thought that usage of ineffective disinfectants and/or absence of disinfectants can seriously increase the existance of pathogens in the hands so the risk factors for the schools. Schools included to the both low economic and high economic income levels were also compared among themselves seperately and the significant differences was only determined for the S. aureus parameter at the students of high economic income level schools. There were no significant differences for the other microbiological parameters analyzed for the schools included to both low and high economic income levels. This situation cause us to guess that S. aureus is an indicator microorganism for the students of the high economic income level schools. S. aureus is the only permanent foodborne pathogen of the hand microflora 31. The agent can penetrate to the fat tissue of the hands and can be eliminated only by using effective disinfectants with high frequencies in long times 9. S. aureus can easily grow in almost all kinds of media however, generally, it can be found especially in the flora of nose, mouth and hands, and this situation facilitates of the cross contamination of the agent. According to the results we got, last hand loads of all investigated microbiological parameters except S. aureus were parallel for the students included into the similar economic income level group schools, however, the beginning flora of the hands of the students of different school groups were different. As a result, we can say that economical status is a very important and effective variable for the microbiological hand loads and cross contaminations of the foodborne pathogens. Foodborne infections and toxications are widely seen all over the world and risk the public health seriously 3. However production, transportation and selling of all kinds of foods under hygienic conditions by application food security systems is very important, consumer related variables can be significant for food security and public health as our investigated in our study. However different individual variables of children and adults seem to be unrelated with contamination and public health, it was determined that the explained variables were very decisive hidden risk factors on both public health and contamination pathways of foodborne pathogens. According to our thoughts it would be very useful to handle hygiene applications by considering individual variables of people for minimizing food related risk factors. REFERENCES 1. Mead P, Slutsker L, Dietz V, McCaig LF, Bresee JS, Shapiro C: Foodrelated illness and death in the United States. Em Inf Dis, 5, , Lechner SR, Mayr KP, Francis BM, Prub T, Kaplan E, Wieber - Gunkel GAS, Stewart B, Scherer S: Bacillus weihenstephanensis sp. now is a new psychrotolerant species of the B. cereus group. Int J Syst Bacteriol, 48, , Anonymus: Codex Alimentarius. Guidelines fort he application of the hazard analysis of critical control point system. ALINORM 93/131, Anonymus: International Comission on Microbiological Specification for Foods (ICMSF). Microorganisms in food 4: Applications of hazard analysis critical control point (HACCP) system to ensure microbiological safety and quality. Oxford, UK: Blackwell Scientific, 1988.

119 646 Social Factors that Affect Borch E, Arinder P: Bacteriological safety issues in red meat and ready to eat meat products as well as control measures. Meat Sci, 6, , Hitchins AD, Feng P, Watkins WD, Rippey SR, Chandler LA: Escherichia coli and the Coliform Bacteria. Food and Drug Administrations. 8 th ed.. pp , Washington, DC: AOAC International, Anonymus: U.S. Food and Drug Administration (FDA): Bacteriological Analytical Manual (BAM), Accessed: Agresti A: Categorical Data Analysis, J.Wiley & Sons Pbc., New York, Anderson TW: An Introduction to Multivariate Statistical Analysis. Third ed., New Jersey: Wiley-Interscience, Bluman AG: Elementary Statistics. McGraw-Hill Pbc., New York, Everitt B, Dunn G: Applied Multivariate Data Analysis., Oxford University Press Inc., New York, Glover T, Mitchell K: An Introduction to Biostatistics, McGraw-Hill, New York, Hair F, Joseph-Anderson RE, Tahtam RL, Black WC: Multivariate Data Analysis. Prentice-Hall International Inc, New York, Johnson RA, Wichern DW: Applied Multivariate Statistical Analysis. Charles Griffin & Company Ltd., London, Sokal RR, Rohlf FJ: Biometry. W.H. Freeman and Company, Newyork, Ayliffe GAJ, Babb JR, Quoraishi AH: A test for hygienic hand disinfection. J Clin Pathol, 31, 93-98, Sheena AZ, Stiles ME: Efficacy of germicidal hand wash agents in hygienic hand disinfection. J Food Protect, 45 (8): , Restaino L, Wind CE: Antimicrobial effectiveness of hand washing for food establishments. Dairy Food Environ Sanit, 10, , Worsfold D, Griyth CJ: Widening HACCP implementation in the catering industry. Food Ser Technol, 3, 113-1, Dümen E, Sezgin F: Microbiological Contamination Model of Staff Hands Employed at Bakeries Due to Staff s Life Style and Individual Parameters. Kafkas Univ Vet Fak Derg, 15 (4): , Medeiros LC, Hillers VN, Chen G, Bergmann V, Kendall P, Schroeder M: Design and development of food safety knowledge and attitude scales for consumer food safety education. J Am Diet Ass, 104, , Rao SGM, Sudershan RV, Rao P, Rao MVV, Polasa K: Food safety knowledge, attitudes and practices of mothers - Findings from focus group studies in South India. Appetite, 49, , Anonymus: Japanese Ministry of Health and Welfare, Report on food poisoning occurrence, Scott E: A review: Foodborne disease and other hygiene issues in the home. J Appl Bacteriol, 80, 5-9, Allwood PB, Jenkins T, Paulus C, Johnson L, Hedberg CW: Hand washing compliance among retail food establishment workers in Minnesota. J Food Prot, 67 (1): 85-88, Daniels NA, MacKinnon L, Rowe SM, Bean NH, GriYn PM, Mead PS: Food borne disease outbreaks in United States schools. Ped Inf Dis J, 1 (7): 63-68, Fry AM, Braden CR, GriYn PM, Hughes JM: Foodborne disease. In, Mandell GL, Bennett JE, Dolin R (Eds): Principles and Practices of Infectious Diseases. 6th ed., pp ). New York: Elsevier, Churchill Livingston, Sneed J, Strohbehn C, Gilmore SA, Mendonca A: Microbiological evaluation of foodservice contact surfaces in Iowa assisted-living facilities. J Am Diet Ass, 104 (11): , Dharod JM, Pe rez-escamilla R, Paciello S, Bermu dez-milla n A, Venkitanarayanan K, Damio G: Comparison between self-reported and observed food handling behaviors among Latinas. J Food Prot, 70, , Dharod JM. Pe rez-escamilla R, Paciello S, Venkitanarayanan K, Bermu dez-milla n A, Damio G: Critical control points for home prepared Chicken and Salad in Puerto Rican households. Food Prot Trends, 7, , Gorman R, Bloomfield S, Aley CC: A study of cross-contamination of food-borne pathogens in the domestic kitchen in the Republic of Ireland. Int J Food Microbiol, 76, , Anonymus: UNICEF. State of the World s Children. United Nations Children s Fund, New York, 1998.

120 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE The Determination of Oxidative Stress by Paraoxonase Activity, Heat Shock Protein and Lipid Profile Levels in Cattle with Theileriosis [1] Vecihe TURUNÇ * Tünay KONTAŞ AŞKAR ** [1] The study was summarized from the master thesis of the first author * Institute of Health Sciences, University of Mustafa Kemal, TR Hatay - TURKEY ** Department of Biochemistry, Faculty of Science, University of Karatekin, TR Çankırı - TURKEY Makale Kodu (Article Code): KVFD Summary Theileriosis is a common illness that cause large economic losses. The aim this study was to define the oxidative status by determining the changes in levels of malondialdehyde, heat shock protein, paraoxonase activity and lipid profile (triglycerides, total cholesterol, very low-density lipoprotein, low-density lipoprotein, high-density lipoprotein) in cattle with tropical theileriosis. In the study, 15 healty cattle and 15 cattle with tropical theileriosis, between 1-3 years old, were used. Plasma malondialdehyde (P<0.001) and heat shock protein 7 (P<0.01) levels were determined significantly higher in cattles with Theileriosis than the control group. On the other hand, serum paraoxonase level was significantly lower than the control group. According to lipid profile analyses, while serum trigliserid (P<0.001) and very low-density lipoprotein (P<0.01) levels were found significantly higher in cattles with theileriosis, serum total cholesterol (P<0.001), low-density lipoprotein (P<0.001) and high-density lipoprotein (P<0.001) levels were found significantly lower in cattles with theileriosis than the control group. In conclusion, serum lipid profile could play role in pathogenesis of theileriosis because of the biochemical changes, such as degeneration of liver and increased levels of lipolysis for compansate the energy requirement which was increased due to theileriosis. In addition, determination of serum paraoxonase activity and heat shock protein 7 levels may be useful tools in the determination of oxidative stress in tropical theileriosis. Keywords: Cattle, Theileriosis, Oxidative stress, Paraoxonase, Heat shock protein7, Lipid profile Theileriosisli Sığırlarda Oksidatif Stresin Paraoksonaz Aktivitesi, Isı Şok Protein ve Lipid Profili Düzeyleri ile Belirlenmesi Özet Theileriosis, yaygın olarak görülen ve büyük ekonomik kayıplara neden olan bir hastalıktır. Bu çalışmada; theileriosisli sığırlarda, akut dönemde oksidatif stres etkisinin ısı şok protein düzeyleri, paraoksonaz aktivitesi ve lipid profili analizi (trigliserid, total kolesterol, çok düşük dansiteli lipoprotein, düşük dansiteli lipoprotein, yüksek dansiteli lipoprotein) ile ortaya konulması amaçlanmaktadır. Çalışma, 1-3 yaş arasında 15 sağlıklı ve 15 theileriosisli sığırda gerçekleştirilmiştir. Theileriosisli sığırlarda plazma malondialdehit (P<0.001) ve ısı şok protein 7 (P<0.01) düzeyleri kontrol grubuna göre yüksek bulunmuştur. Serum paraoksonaz düzeyi ise, kontrol grubuna göre düşük (P<0.001) bulunmuştur. Yapılan lipid profili analizlerinde ise, Theileriosisli sığırlarda kontrol grubuna göre serum trigliserid (P<0.001) ve çok düşük dansiteli lipoprotein (P<0.01) düzeyleri yüksek bulunurken, total kolesterol (P<0.001), düşük dansiteli lipoprotein (P<0.001) ve yüksek dansiteli lipoprotein (P<0.001) düzeyleri ise düşük bulunmuştur. Sonuç olarak, Theileriosiste artan enerji ihtiyacının karşılanması için yağların lipolizinin artması ve karaciğer hasarının oluşması gibi çeşitli biyokimyasal değişimler nedeni ile plazma lipid profili theileriosisin patogenezinde rol oynayabileceği düşünülmektedir. Ayrıca serum paraoksonaz aktivitesi ve ısı şok protein 7 düzeyinin belirlenmesi, tropikal theileriosisde oksidatif stres etkisinin belirlenmesinde yararlı bir indikatör olabileceği kanısına varılmıştır. Anahtar sözcükler: Sığır, Theileriosis, Oksidatif stres, Paraoksonaz, Isı şok protein 7, Lipid profili İletişim (Correspondence) tunaykontas@yahoo.com

121 648 The Determination of Oxidative... INTRODUCTION Tropical Theileriosis which leads to high morbidity and mortality in cattle, is a disease caused by Theileria annulata. The disease has lympho-proliferative character and transmitted by acarid species of the genus Hyalomma. Tropical theileriosis is widespread in countries which located in subtropical climate such as South Europe, North Africa, Middle East, Middle Asia, India, South Russia and Turkey. It causes high level of mortality in culture breeds and high economic losses in animal breeding 1. Clinical symptoms of the disease appear as fever (in the first days, 41-4ºC), rise in pulse and respiration, irregular swelling of lymph node, sometimes haemoglobinuria, conjunctiva and petechial bleeding in mucosa. In the last period of disease, haemolytic anaemia, icterus and leucopaenia appear due to the destruction of lymphocytes. Membranes that cover the cells and cell organelles, contain large amount of unsaturated fatty acids. Oxygen molecule has high affinity to unsaturated fatty acids in cell membranes. Binding of oxygen molecules to double bounds of unsaturated fatty acids, causes lipid peroxidation 3. Lipid peroxidation is a very harmful chain reaction and is associated with oxidative stress in cells and lipoproteins. Oxidative stres directly damages the membrane structure and other cell compounds and indirectly produces reactive aldehydes like malondialdehyde (MDA) 4,5. Erythrocyte membrane is vulnerable to lipid peroxidation because of its richness for polyunsaturated fatty acids 6. Oxidative stress increrases the synthesis of heat shock proteins (HSPs), also called stress proteins. Heat shock proteins are a group of proteins that are present in all cells of all life forms. The synthesis of these proteins are induced when a cell undergoes various types of stresses like heat, cold, oxygen deprivation, etc. Heat shock proteins have many functions for the protection of cells under stres conditions 7. Paraoxonase (PON) [aryldialkylphosphatase (EC )] is a calcium-dependent esterase that was initially identified by its hydrolysis of aromatic carboxylic esters and organophosphorus insecticides 8. It has been suggested that PON may play a protective role under oxidative stress. Paraoxonase was found to use efficiently not only lipoproteinassociated peroxides (including cholesteryl linoleate hydroperoxides), but also hydrogen peroxide (H O ). Para oxonase also inhibits the accumulation of peroxynitritegenerated oxidized phospholipids by its ability to hydrolyze phosphatidylcholine (PC) core aldehydes and PC isoprostanes to yield lysophosphatidylcholine 9. Diagnosis of Theileria infection is done by clinical symptoms, microscopical examination and serological tests 10. However, it is important to determine the porter animals and the prognosis of disease with specific bio- chemical parameters for prevention of economic losses in country. Besides various studies related to theileriosis, the researchs concerning oxidative stress are limited. In the present study, the levels of heat shock protein 7 (HSP 7) and paraoxonase (PON) enzyme with high-density lipoprotein (HDL) besides MDA will be determined for the demonstration of the oxidative stress, occurs in acute infection of cattles with theileriosis. MATERIAL and METHODS In the summer periods of , 30 Holstein cattle, between 1-3 years old, referred to the clinic of Veterinary Medicine Faculty, Mustafa Kemal University, Turkey, were used as the material for this study. The animals were divided into groups: 15 healthy cattle (control group) and 15 cattle naturally infected with Theileria annulata (patient group). The animals were selected to proper groups after examination of Giemsa stained thin blood smears. The cows showed symptoms suggestive of T. annulata infection, including anorexia, anaemia, fever, icterus, and haemoglobinuria. The blood samples were collected from the control and patient group on the day of diagnosis into tubes with heparin for plasma and into tubes with coagulant free for serum. The blood samples were centrifuged for 10 min at rpm for the separation of plasma and 10 min at.000 rpm for the separation of serum samples. Then plasma and serum samples were kept frozen (-0ºC) in 1.5 ml microtubes until analysis. MDA analysis were done immediately after the separation of plasma. Samples were analyzed for MDA, HSP 7, PON1 enzyme activity and lipid profile (triglycerides, total cholesterol, VLDL, HDL and LDL). The determination of MDA in plasma samples were done with the method of Yoshoiko et al. 11. This method is based upon reaction of MDA, one of aldehyde products and thiobarbituric acid (TBA, Merck). In the study, plasma HSP 7 level was determined using Biosource (U.S.A) HSP- 7 enzyme-immunoassay kit. The determination of basic PON enzyme activity in serum samples were done with the method of Eckerson et al. 1. This method is based on the hydrolyses of paraoxon substrate enzymatically by PON1 enzyme to diethylphosphate and p-nitrophenol. Triglyceride, total cholesterol, HDL analyses in serum samples were performed on an automated analyzer (Roche, DP Moduler System, Tokyo, Japan) using commercial test kits and LDL and VLDL levels were calculated by Friedewald formulae (LDL = Total cholesterol [(HDL) + (Triglycerides /5)], and VLDL = Triglycerides/5) 13. For the statistical evaluation of the results, SPSS 11.0 for windows packet program was used. Statistical differences between groups were evaluated by using student t-test. Data were presented as mean ± standard error (± SE) and P<0.05 was considered as significant.

122 649 TURUNÇ KONTAŞ AŞKAR RESULTS Table 1 shows the changes in MDA, HSP7, PON activity and lipid profile (triglyceride, total cholesterol, VLDL, LDL, HDL) levels between the control and patient groups. Plasma MDA (P<0.001) and HSP 7 (P<0.01) levels in the patient group were found significantly higher than in the control group. On the other hand, serum PON activity in the patient group have been found significantly lower when compared to the control group (P<0.001) (Table 1). In the present study we also determined the lipid profile related with PON activity, which includes serum triglyceride, HDL, LDL, and VLDL cholesterol levels of cattle with theileriosis in the control group and in the patient group. The patient group exhibited a significant increase in serum triglyceride (P<0.001) and VLDL cholesterol levels (P<0.01), compared to the control group. On the other hand, the patient group had significantly lower total cholesterol, HDL cholesterol and LDL cholesterol levels when compared to the control group (P<0.001). High fever, inflammation, cellular injury conditions seen in most inflammatory diseases, like theileriosis, also leads to increase in stress protein expression 7. Heat shock protein 7 is a stress protein with antioxidant effects. Howewer, it was reported that increases in HSP7 production was seen in vascular diseases, hypertermia, apoptosis and various types of cancers 18, but we could not found in the literature any information about HSP7 values in cattle with theileriosis. Under stress conditions, HSP 7 takes role in protection of cells independent from ATP against oxidative stress. This protein shows it s antioxidant effect by increasing intracellular glutathion level, and decreasing iron quantity inside the cell 19,0. The increase in HSP7 levels in the patient group may be related with the increase in synthesis of the protein in host under stress factors, such as high fever, inflammation, etc. that occur by the stimulation of host immun system with parasite s heat shock proteins in this study. However, there is no information in literature about the alteration of PON level in parasitic diseases, recent studies Table 1. Changes in plasma MDA, HSP7 levels, serum PON activity and lipid profile levels in the control and patient groups Tablo 1. Kontrol ve hasta gruplarının MDA, HSP 7, PON aktivite ve lipid profili değişimleri Parameters Control Group (n=15) Patient Group (n=15) MDA (μmol/l) 15.3± ±.71 * HSP7 (ng/ml).5± ±0.35 PON (U/L) 66.65± ±9.77 * Triglyceride (mg/dl) 30.7± ±9.8 * Total cholesterol (mg/dl) 184.8± ±0.1 * VLDL (mg/dl) 5.± ±1.1 LDL (mg/dl) 114.3±.4 5.0±1.9 * HDL (mg/dl) 77.6±.0 4.8±1.1 * Data are expressed as mean ± standart error of the mean values *,, Significantly different from the control group (P<0.001, P<0.01 and P<0.05, respectively) DISCUSSION The present study confirmed and extended the results of preliminary studies that showed oxidative stress occurs depending on the increase of reactive oxygen species production in many infections and parasitic diseases. In tropical theileriosis high fever, inflammation, oxidative stress and cellular injury conditions occur, and these conditions lead to formation of compound structured aldehydes such as MDA 17. Rezaei and Dalir- Naghadeh 6 reported that the level of MDA which is one of the lipid peroxidation products was increased in cattle with theileriosis. In the present study, high MDA levels in the patient group is a result of lipid peroxidation and oxidative stress which occurs in damaged erythrocytes due to parasitaemia. reported PON as an antioxidant enzyme, that decreases oxidative stres by preventing the formation of free radicals like peroxides and aldehydes in many diseases 1,. Paraoxonase may act to hydrolyze specific lipid peroxide(s) or serve as a target for peroxides. The PON free sulfhydryl group cysteine 84 was shown to be required for its protection against lipid peroxidation 9. Paraoxonase1 is associated with HDL in plasma and the ability of HDLassociated PON to hydrolyze H O (in addition to peroxides) may thus play an important role in eliminating potent oxidants 3. In the present study, serum PON activity was found low in the patient group. The decrease in PON enzyme activity in cattle with theileriosis may be related with the oxidative stres occurs in disease depending on the erythrocyte disruption due to parasitaemia. Furthermore, related with PON, we also determined

123 650 The Determination of Oxidative... the levels of serum triglyceride, total cholesterol, VLDL, LDL and HDL cholesterol in cattle with theileriosis. In the present study, we determined that the serum triglyceride and VLDL levels were high in cattle with theileriosis. Serum triglyceride concentration may increase, remain unchanged, or decrease in different types of acute conditions 4. Singh et al. 5 and Çöl and Uslu 1 found decrease in levels of serum triglyceride and total cholesterol in cattle with theileriosis. Cunha et al. 6 and Aşkar et al. 7 reported that serum triglyceride level is high in cattle with babesiosis, however, total cholesterol levels is low. High triglyceride and VLDL cholesterol levels in the patient group may be associated with increased adipose tissue lipolysis stimulating hepatic production of triglycerides and VLDL cholesterol and a defect of triglyceride removal from circulation. In acute infections, blood parasites use host s blood glucose for their energy need, and this situation partially leads to formation of hypoglycemia in the host. Therefore body lipids are used for gluconeogenesis to provide host energy deficiency. It is an essential mechanism for provision of host high energy need, occurs in the acute phase response of the infection 8. But liver damage occurs with the usage of body lipids for gluconeogenesis. Therefore, cholesterol could not be synthesized enough, and this is the reason of low total cholesterol levels in cattle with theileriosis. Lipoproteins such as HDL and LDL include cholesterol in their structures. In normal conditions, LDL cholesterol transports cholesterol, phospholipids, and lipid-soluble vitamins from the liver to extra-hepatic tissues. And HDL cholesterol plays a major role in the reverse transport of cholesterol from peripheral tissues to the liver. Several types of acute conditions are associated with a marked decrease in HDL cholesterol 9. Furthermore, HDL is associated with PON enzyme and takes role in prevention of oxidative stress that occurs during infection. Paraoxonase was suggested to contribute to the antioxidant protection conferred by HDL on LDL oxidation 30. In the present study, we determined that the serum LDL and HDL cholesterol levels are low in the patient group. Low levels of LDL and HDL cholesterol in the patient group may be related with the decrease in synthase of total cholesterol levels because of liver damage occurs during acute infection. Also the decrease in HDL cholesterol levels with PON enzyme activity in the patient group can be an indicator of the antioxidant defence against oxidative stress. Similar changes in serum lipid profiles have also been reported in cattles with babesiosis 7, and in humans with severe leptospirosis 31. In the present study, we demonstrated the changes in MDA, HSP 7, PON enzyme activity and lipid profile in acute phase of theileriosis. Determined abnormalities in lipid profile suggest that plasma lipid profile could play role in patogenesis of theileriosis because of the biochemical changes, such as degeneration of liver and increased levels of lipolysis for compansate the energy requirement which was increased due to theileriosis. On the other hand, investigation of acute disease in vivo, using a natural process to show oxidative stres, supported the importance of HSP 7 and PON activity in the antioxidant defence against oxidative stres in theileriosis. Therefore, paraoxonase activity and heat shock protein 7 levels may be useful tools in the determination of oxidative stress in tropical theileriosis. REFERENCES 1. Çöl R, Uslu U: Changes in selected serum components in cattle naturally infected with Theileria annulata. Bull Vet Inst Pulawy, 51, 15-18, Osman SA, Al-Gaabary MH: Clinical, haematological and therapeutic studies on tropical theileriosis in water buffaloes (Bubalus bubalis) in Egypt. Vet Parasitol, 146, , Serarslan G, Altuğ E, Kontas T, Atik E, Avcı G: Caffeic acid phenetyl ester accelerates cutaneous wound healing in a rat model and decreases oxidative stress. Clin Exp Dermatol, 3, , Romero FJ, Bosch-Morell F, Romero MJ: Lipid peroxidation products and antioxidants in human disease. Environ Health Persp, 106, , Clarkson PM, Thompson HS: Antioxidants: What role do they play in physical activity and health? Am J Clin Nutr, 7, , Rezaei Asri S, Dalir-Naghadeh B: Evaluation of antioxidant status and oxidative stres in cattle naturally infected with Theileria annulata. Vet Parasitol, 14, , Aşkar TK, Ergün N, Turunç, V: Isı şok proteinler ve fizyolojik rolleri. Kafkas Univ Vet Fak Derg, 13 (1): , Juretic D, Tadijanovic M, Rekic B, Simean-Rudolf V, Reiner E, Baricic M: Serum paraoxonase activities in hemodialyzed uremic patients. Clin Sci, 4, , Aviram M, Rosenblat M, Bisgair CL: Paraoxonase inhibits high density lipoprotein (HDL) oxidation and preserves its functions: A possible peroxidative role for paraoxonase. J Clin Invest, 101, , Dumanlı N, Aktaş M, Çetinkaya B, Çakmak A, Köroğlu E: Prevalence and distribution of tropical theileriosis in eastern Turkey. Vet Parasitol, 17, 9-15, Yoshoiko T, Kawada K, Shimada T: Lipit peroxidation in maternal and cord blood and protective mechanism aganist actived-oxygen toxicity in the blood. Am J Obstet Gynecol, 135, , Eckerson HW, Romson J, Wyte C: The human serum paraoxonase polymorphism: Identification of phenotypes by their response to salts. Am J Human Genet, 35 (): 14-7, Friedewald WT, Levy RI, Frederickson DS: Estimation of the concentration of low- density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem, 18, , McCord JM: Human disease, free radicals and the oxidant/antioxidant balance. Clin Biochem, 6, , Grewal A, Ahuja CS, Singha SPS, Chaudhary KC: Status of lipid peroxidation, some antioxidant enzymes and erythrocytic fragility of crossbred cattle naturally infected with Theileria annulata. Vet Res Commun, 9 (5): , Ece A, Kelekçi S, Kocamaz H, Hekimoğlu A, Balık H, Yolbaş İ, Erel Ö: Antioxidant enzyme activies, lipid peroxidation, and total antioxidant status in children with Henoch-Schönlein purpura. Clin Rheumatol, 7, , Yagi K: Lipid peroxides and human diseases. Chem Phys Lipids, 45 (-

124 651 TURUNÇ KONTAŞ AŞKAR 4): , Ciocca DR, Oesterreich S, Chamness GC, McGuire WL, Fugua SA: Biological and clinical implications of heat shock protein (Hsp7). J Nation Cancer Instute, 85 (19): , Ferns G, Shams S, Shafi S: Heat shock protein 7: Its potential role in vascular disease. Int J Exp Pathol, 87 (4): 53-74, Ergönül S, Aşkar TK: Anaplasmosisli sığırlarda ısı şok protein (HSP), malondialdehit (MDA), nitrik oksit (no) ve interlökin (IL-6, IL-10) düzeylerinin araştırılması. Kafkas Univ Vet Fak Derg, 15 (4): , Aviram M, Rosenblat M: Paraoxonases and cardiovascular diseases: Pharmacological and nutritional influences, Curr Opin Lipidol, 16, , Çelik M, Gülcü F, Ozan G, Gürsu MF: Paraoksonaz 1 ve arilesteraz aktivite düzeyleri. Turk J Biochem, 30 (): , Aviram M: Does paraoxonase play a role in susceptibility to cardiovascular disease. Mol Med Today, 5, , Chiang AN, Hwang B, Shaw GC: Changes in plasma levels of lipids and lipoprotein composition in patients with Kawasaki disease. Clin Chim Acta, 60, 15-6, Singh A, Singh J, Grewal AS, Brar RS: Studies on some blood parameters of crossbred calves with experimental Theileria annulata infections. Vet Res Commun, 5, , Cunha BA, Crean J, Rosenbaum G: Lipid abnormalities in babesiosis. Am J Med, 108, , Aşkar TK, Salmanoğlu B, Çakmak A, Beşkaya A: Relative changes in serum lipid-lipoprotein and trace element levels in cattle babesiosis. Medycyna Weterinaria, 64 (9): , Adamu S, Ige AA, Jatau ID, Neils JS, Useh NM, Bisalla M, Ibrahim NDG, Nok AJ, Esievo KAN: Changes in the serum profiles of lipids and cholesterol in sheep experimental model of acute African trypanosomosis. Afr J Biotechnol, 7 (1): , Carpentier YA, Scruel O: Changes in the concentration and composition of plasma lipoproteins during the acute phase response. Curr Opin Clin Nutr, 5, , Gülcü F, Gürsu FM: Paraoksanaz ve aril esteraz aktivite ölçümlerinin standardizasyonu. Turk J Biochem, 8 (): 45-49, 003.

125 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Seroprevalence of Avian Reovirus Infections in Chickens in Western Provinces of Turkey Nural EROL * Serkan Süleyman ŞENGÜL ** * Adnan Menderes University, Faculty of Veterinary Medicine, Department of Virology, TR Aydin - TURKEY ** Ministry of Food, Agricultural and Livestock, Baliseyh District Directorate, TR Kirikkale - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, seroprevalence of avian reovirus (ARV) infections in broiler and broiler breeder chicken farms in Aydin, İzmir and Manisa provinces were investigated. Serum samples (n = 631) collected from 8 broiler breeder and 18 broiler flocks were tested for ARV antibodies using a commercially available ARV Enzyme Linked Immunosorbent Assay (ELISA) kit. The sampled flocks were not vaccinated against ARV. The blood samples were taken at the time of slaughtering. Antibodies were found in all flocks tested; 4 of the 95 samples (75.93%) collected from broiler and 3 of the 336 samples (95.83%) collected from the broiler breeder chickens were seropositive. In total, 546 of the 631 serum samples (86.53%) were seropositive. Lameness and respiratory system disorders were observed in all of the broiler flocks but none of the broiler breeder flocks. Seropositivity in Izmir province (91.48%) was higher than seropositivity in Manisa and Aydin provinces (74.59 and 70.58%, respectively). These results suggest that ARV infections which may cause lameness, serious respiratory system disorders, and decreased productivity in broilers are very common in chickens in the Aegian region of Turkey. The infection is often subclinical in broiler breeders. These results highlight the need for regular implementation of programs to combat the ARV infection in western Turkey. Keywords: Avian reovirus, Broiler, ELISA, Seroprevalance Özet Türkiye nin Batı İllerindeki Tavukçuluk İşletmelerinde Avian Reovirus Enfeksiyonunun Seroprevalansı Bu çalışmada, Aydın, İzmir ve Manisa illerindeki damızlık ve broiler yetiştiren tavukçuluk işletmelerinde Avian Reovirus (ARV) enfeksiyonunun seroprevalansı araştırıldı. Ticari Enzyme Linked Immunosorbent Assay (ELISA) kullanılarak, 18 broiler ve 8 broiler damızlık kümesine ait tavuklardan alınan toplam 631 serum örneği ARV antikorları yönünden test edildi. Kan örnekleri tavukların kesimi esnasında alındı. Örneklenen sürüler ARV enfeksiyonuna karşı aşısızdı. Bütün kümeslerde ARV antikorları bulunmuş olup, broiler kümeslerinden toplanan 95 örneğin 4 ü (%75.93) ve damızlık broiler kümeslerinden toplanan 336 örneğin 3 si (%95.83) seropozitif olarak saptandı. Test edilen toplam 631 serum örneğinden 546 sı (%86.53) pozitif olarak kaydedildi. Örnekleme esnasında, damızlık sürülerde solunum ve topallık belirtilerine rastlanmazken, broiler kümeslerinin tamamında bu problemler dikkati çekmekteydi. Seropozitiflik oranlarının İzmir ilinde (%91.48), Manisa ve Aydın illerine nazaran daha yüksek olduğu tespit edildi (sırasıyla %74.59 ve %70.58). Sonuç olarak, broiler yetiştiriciliğinde önemli solunum sistemi semptomlarına, topallığa ve verim düşüklüklerine yol açan reovirusların Ege Bölgesi nde çok yaygın olduğu görüldü. Özellikle damızlık sürülerde enfeksiyonun yüksek prevalansa sahip olduğu ve çoğu zaman semptom göstermeksizin, gizli bir şekilde devam ettiği belirlendi. Bu araştırmanın sonuçlarına dayanarak, söz konusu virus enfeksiyonuna karşı düzenli mücadele programlarının hazırlanması ve uygulanması gerektiği sonucuna varıldı. Anahtar sözcükler: Avian reovirus, Broiler, ELISA, Seroprevalans INTRODUCTION Avian reoviruses (ARV) are classified within the Orthoreovirus genus of Reoviridae family. There are 11 known serotypes 1 that differ substantially in their host specificity, and antigenic and biological properties,3. İletişim (Correspondence) /311 nuralerol@adu.edu.tr

126 654 Seroprevalence of Avian Reovirus... ARV infections cause serious economic losses in the poultry industry 4. They are the cause of viral arthritis syndrome, also known as tenosynovytis, characterized by joint swelling and lesions of the gastrocnemius tendon. Inflammatory changes in tarsometatarsal joints and nearby tendon sheaths results in joint swelling 4,5. Rupture of the gastrocnemius tendon and degeneration of the articular cartilage may occur in the course of serious forms of the disease and may cause bleeding within the joints resulting in greenish coloration of the skin. The poor appearance of the affected joints results in increased wastage in slaughterhouses 4,6. If both of the joints are affected, the sick animals can not move and reach the feed, resulting in reduction in feed intake and growth retardation and, in some cases, death. Viral arthritis is rarely seen in animals younger than 4 or 5 weeks. The disease is mainly seen in broiler chickens but turkeys and lighter poultry breeds are also susceptible 4-7. The avian reoviruses, either alone or in conjunction with other pathogenic bacteria, cause a range of additional disorders including enteric-respiratory diseases, myocarditis, hepatitis, malabsorbtion, helicopter disease, brittle bone disease, and femoral head necrosis 4,8. Reovirus infections suppress the immune system in the poultry and maybe clinically asymptomatic The ARV infections are common all over the world 4,7. The virus, as well as antibodies against it, has been isolated from poultry enterprises in various regions of Turkey either alone or along with other infectious agents but there are no recent studies to determinate prevalence with a reasonably large sample size The immune response raised against ARV is an important tool in diagnosis of the infection to determine proper time of vaccination which may prevent the disease and economic losses. Enzyme-Linked-Immunosorbent Assay (ELISA) has been reported as a sensitive and rapid test method for detection and quantification of antibodies against ARV by various investigators 17,18. In this study, seroepidemiology of the ARV infections in broiler and broiler breeder enterprises in Izmir, Aydin, and Manisa provinces of Turkey, were investigated. MATERIAL and METHODS Samples - Blood samples were collected, at the time of slaughtering, from 631 chickens randomly selected from 18 broiler and 8 broiler breeder flocks from different farms located in Aydin, Izmir, and Manisa provinces of Turkey in year 009. Broiler breeders were 13 and 66 weeks old whereas broiler chickens were days old. The chickens in farms where samples were taken were not vaccinated against ARV infection. Serum was obtained by centrifugation of blood samples at 1700 x g for 10 min. Enzyme Linked Immunosorbent Assay (ELISA) - Serum samples were screened for ARV antibodies using a commercially available ELISA kit (Avian Reovirus Antibody Test Kit, BioChek, Gouda, The Netherlands). The test was performed following the manufacturer s instructions in the Department of Microbiology, Faculty of Veterinary Medicine, Adnan Menderes University. In brief, the samples were diluted 1:500 in PBS and added on microtitre plates pre-coated with inactivated ARV-antigen. Antibodies present in the sample were captured by the antigen coated on the plate. Stringent washing was performed to wash away unbound antibodies and non-specific serum proteins. Anti-chicken IgG labelled with alkaline phosphatase was added on the wells to detect chicken anti-arv antibodies originally bound to the antigen. After another wash to remove excess conjugate, pnpp chromogen was added to develop a yellow color, intensity of which is directly related to the ARV antibody concentration in the sample. The antibody titers were measured at 405 nm using an ELISA reader (Biotek Absorbance Microplate Reader, ELx808). The relative amounts of antibodies in chicken samples were calculated in comparison to the positive control. Final antibody titers were obtained using BioChek Software programme (Gouda, The Netherlands). Results of antibody titers were analyzed using T-test in SPSS programm 19. RESULTS In this study, antibodies against ARV were found in all flocks tested (100%). Two hundred and twenty four of the 95 samples collected from the broilers (75.93%) and 3 of the 336 samples (95.83%) collected from broiler-breeder chickens were seropositive. The average coefficient of variation for seropositivity in broiler breeders and broilers were 53 and 4%, respectively. Seropositivity rates in the Aydin, Manisa, and Izmir provinces were 70.58% (36/51), 74.59% (91/1), and 91.48% (419/458), respectively. In total, 546 of the 631 serum samples tested (86.53%) were seropositive (Table 1). During sampling, lameness and respiratory system disorders were found in all of the broiler flocks but none of the broiler breeder flocks. Antibody titers in the positive samples collected from broiler pens ranged from 189 to 107 (average 388) whereas those collected from broiler breeders ranged from 1953 to (average 10699). Therefore the antibody titers were in broiler breeder flocks were significantly higher than those in broiler flocks (P<0.001) (Fig. 1). Antibody titers in broiler flocks were more variable. Ten of the 18 broiler flocks tested had lower antibody titers than the remaining 8 flocks. DISCUSSION Avian reoviruses have been implicated in a range of poultry diseases including viral arthritis/tenosynovitis,

127 655 EROL, ŞENGÜL Table 1. Seropositivity against avian reoviruses in broiler and broiler breeder chickens in Aydin, Izmir, and Manisa provinces Tablo 1. Aydın, İzmir ve Manisa illerindeki broiler ve broiler damızlık tavuklarda avian reovirusa karşı seropozitiflik oranları Broilers Broiler Breeders Total Province Samples Tested Seropositive Samples % Seropositivity Samples Tested Seropositive Samples % Seropositivity Samples Tested Seropositive Samples % Seropositivity Aydın İzmir Manisa TOTAL Fig 1. Mean antibody titers in samples taken from broiler and broiler breeder flocks Şekil 1. Broiler ve broiler damızlık kümeslerinden alınan örneklerin ortalama antikor titreleri respiratory disease, enteric disease and growth retardation/ malabsorption syndrome Avian reovirus infections are common all over the world, and may cause serious economic losses in the poultry industry. A seroprevalence study of egg-laying hens in China showed the presence of ARV infections in over 9% of unvaccinated chickens from different farms 0. In another study conducted in Iran, the authors used ELISA and detected antibodies against ARV in 98.3% of the 57 samples collected 1. Biswas et al. reported that 56% (55/99) of the pens and 47% (138/95) of chickens were seropositive in a study conducted in Bangladesh. Data on serological prevalence of ARV infections in various regions of Turkey, on the other hand, is very limited. Little research has been performed previously and there is no current and adequate scientific data in Turkey available. The extent of economic losses due to ARV infection is unknown. The virus had been identified, either alone or as a part of mixed infections but there are no current data on the prevalence of reoviruses. Çöven and Çarlı 14 isolated the virus, mixed with adenovirus and Newcastle disease virus, in a flock suspected of being infected with Gumboro disease in various provinces in Turkey. ARV was isolated from 105 of the 174 bursa of Fabricius samples (60.3%) after passages in chicken embryo fibroblast cultures. Öztürk and Çöven 15 detected ARV in 3 of the 81 samples collected from 30 to 36 day old chicks from four broiler enterprises suspected of being infected with infectious bursal disease virus (IBDV). Akalın and Ergün 1 investigated the presence of antibodies against adenovirus and ARV in 600 samples collected from 11 flocks of broiler chickens with malabsorption syndrome and 100 samples from a flock of broiler breeder chickens without clinical symptoms. The samples were tested using Agar Gel Precipitation Test (AGPT). No precipitating antibodies against neither of the viruses were found in any of the serum samples of 11 broiler flocks. However, precipitating antibodies against ARV and adenovirus were found in 11% and 9% of broiler breeders, respectively. Mutlu and Yiğit 16 reported that the antigenic characteristics of different ARV strains isolated in Turkey were very different and their antigenity did not resemble that of the S1133 strain that was frequently used for vaccination. In this study, seroprevalence ARV infections in broiler breeder and broiler enterprises in Izmir, Aydin and Manisa provinces of western Turkey were investigated using ELISA. Serum samples (n= 631) collected from chickens in 18 broiler and 8 broiler breeder flocks were tested for ARV antibodies. Five hundred forty six (86.53%) of the 631 serum samples tested were seropositive. ARV antibodies were found in all flocks sampled. Rates of seropositivity were higher in broiler breeders than the broilers (75.93 vs 95.83%). Seroprevalence was higher in Izmir province than the other two provinces but this could be due to the larger number of samples collected from the Izmir province. These data suggest that ARV infections are highly prevalent in chickens in the Aegean region of Turkey, especially in broiler breeder flocks which constitute a stock for poultry breeding. The seroprevalence of ARV found in this study was significantly higher than previously thought 11,1. The most significant disease directly caused by ARV in chickens and turkeys is arthritis/tenosynovitis. Swelling and inflammation of the tarsometetarsal joint and the tendon sheath nearby may result in lameness and acute paralysis 4. In addition, ARV infections may cause serious respiratory problems in poultry. Although a detailed clinical investigation was not performed in this study, it was observed lameness and respiratory problems in all broiler flocks, but not in broiler breeder flocks. It is possible that older animals develop

128 656 Seroprevalence of Avian Reovirus... age-related resistance to infection 3,4. Young animals are more susceptible to ARV infections probably because their immune system is not yet fully developed 5. In this study, antibody titers in samples taken from broiler breeders were higher than those taken from broilers. It is possible that the broiler breeders were being constantly re-infected with the virus subclinically, resulting in longterm production of antibodies. No signs of disease were noted in these older animals probably because they had higher antibody titers and fully developed immune systems. The fact that the ARV infection was found in all flocks tested shows the high virulence of the ARV infections. In summary, ARV infections that may result in significant economic losses in poultry industry are very common in chickens in western Turkey. The virus probably circulates in broiler breeder flocks subclinically but causes disease in broilers. Current data on the presence and prevalence of ARV infections in Turkey is limited and there are no regular combat programs against the infection. The effectiveness of vaccination is unknown. Results from this study highlight the urgent need for seroepidemiologic, virological, and molecular research to develop and implement programs to combat the ARV infections. REFERENCES 1. Wood GW, Nicholas NJ, Herbert GN, Thornten DH: Serological comparisons of avian reoviruses. J Comp Path, 90, 9-38, Mertens P: The dsrna viruses. Virus Res, 101, 3-13, Benavente J, Martinez-Costas J: Avian reovirus: Structure and biology. Virus Res, 13, , Rosenberger JK: Reovirus infections. In, Saif YM, Barnes HJ, Glisson JR, Fadly AM, McDougald LR, Swayne DE (Eds): Diseases of Poultry. pp , Ames, Iowa State Press, Blackwell Publ Comp, Van Der Heide L: Viral arthritis/tenosynovitis: A review. Avian Pathol, 6, 71-84, Kibenge FSB, Robertson MD, Wilcox GE, Pass DA: Bacterial and viral agents associated with tenosynovitis in broiler breeders in Western Australia. Avian Pathol, 11, , Jones RC: Avian reovirus infections. Rev Sci Tech, 19, 614=65, Jones RC: Other reovirus infections. In, Saif YM, Barnes, HJ, Glisson JR, Fadly AM, McDougald LR, Swayne DE (Eds): Diseases of Poultry. 11th ed., pp , Ames, Iowa State Press, Fahey JE, Crawley JF: Studies on chronic respiratory disease of chickens. II. Isolation of a virus. Can J Comp Med Vet Sci, 18, 13-1, Dutta SK, Pomeroy BS: Isolation and characterization of an enterovirus from baby chicks having an enteric infection I. Isolation and pathogenicity. Avian Dis, 11, 1-8, Çarlı KT, Çöven F, Şen A, Minbay A: Isolation of reoviruses from chicks showing runting syndrome in the northwestern Turkey. Pendik Hayv Hast Merk Aras Enst Derg, (1-): 41-6, Akalın N, Ergün A: Detection of antibodies against reo and adenoviruses in serum from chicks with growth retardation syndrome. Bornova Vet Kont ve Araşt Enst Müd Derg, 19 (33): , Çarlı KT, Şen A, Ülgen M, Kahraman M: Detection of anti-reovirus precipitating antibodies in serum of broiler breeders in Bursa province. Uludag Üniv Vet Fak Derg, 11, , Çöven F, Çarlı KT: Isolation of reovirus, adenovirus, and Newcastle disease virus in gumboro outbreaks. Pendik Vet Mikrobiyol Derg, 8 (): , Öztürk G, Çöven F: Broilerlerde infeksiyöz bursal hastalığı (IBD), reovirus infeksiyonu ve bursal cryptosporidiosis. Fırat Üniv Sağ Bil Derg Vet, 11 (): , Mutlu OF, Yiğit A: Identification and serological comparison of various reovirus strains isolated from chickens suspected of having hunting syndrome in Turkey. Bornova Vet Kont Araşt Enst Müd Derg, (36): 85-98, Islam MR, Jones RC: An enzyme-linked immunosorbent assay for measuring antibody titer against avian reovirus using a single dilution of serum. Avian Pathol, 17, , Lee LH, Wang YH, Shien JH: Comparison of the labeled avidin biotin and the conventional enzyme-linked immunosorbent assay for detecting antibody to reovirus in chicken. J Virol Methods, 48, , SPSS: Statistical Package for the Social Sciences, Release Chicago, IL, USA: SPSS Inc, Juan Pu, Xingli Liu, Youchun Guo, Yu Cao, Jixun Zhao, Guozhong Zhang A: Seroprevalence of avian reovirus in egg-laying chicken flocks in China. Avian Dis, 5 (4): , Bokaie S, Shojadoost B, Pourbakhsh SA, Pourseyyed SM, Sharifi L: Seroprevalence survey on reovirus infection of broiler chickens in Tehran province. Iran J Vet Res, 9, , Biswas PK, Barua H, Uddin GMN, Biswas D, Ahad A, Debnath NC: Serosurvey of five viruses in chickens on smallholdings in Bangladesh. Prev Vet Med, 88, 67-71, Kerr KM, Olson NO: Control of infectious synovitis. The effect of age of chickens on the susceptibility to three agents. Avian Dis, 8, 56-63, Jones RC, Georgiou K: Reovirus-induced tenosynovitis in chickens: The influence of age at infection. Avian Pathol, 13, , Forrest JC, Dermody TS: Reovirus receptors and pathogenesis. J Virol, 77, , 003.

129 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Hayvan Koruma Kavramı ve Biyoetik Çerçevesinde Yaban Hayatı Koruma ve Yaban Hayatı Geliştirme Sahaları [1] Gökhan ASLIM * Ali YİĞİT ** Serdar İZMİRLİ * Aşkın YAŞAR * [1] Bu çalışma The Wildlife Protection and Improvement Areas in Accordance with Animal Protection and Bioethics adlı başlıkla EACME 5th Annual Conference Bioethics from a Cross-Cultural Perspective September 15-17, 011, Istanbul-TURKEY Book of Abstracts ta özet olarak yayımlanmıştır * Selçuk Üniversitesi Veteriner Fakültesi, Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı, TR-4003 Konya - TÜRKİYE ** Kafkas Üniversitesi Veteriner Fakültesi, Veteriner Hekimliği Tarihi ve Deontoloji Anabilim Dalı, TR Kars - TÜRKİYE Makale Kodu (Article Code): KVFD Özet İnsan faaliyetleri sonucunda tehlikeye giren çevrenin geleceği, etik ve deontolojik boyutlar içeren, zamanımızın önemli bir sorununu oluşturmaktadır. Bu sorunların çözümünde konu ile ilgili mevzuatın yanı sıra etik yaklaşımlar yararlı araçlar olarak görülmektedir. Türkiye de 1966 yılında başlayan Yaban Hayatı Koruma ve Yaban Hayatı Geliştirme Sahaları çalışmaları günümüzde çeşitli yasal düzenlemelerle de temellendirilerek artmaktadır. Çalışmada, yaban hayatının korunmasında önemli yeri olan Yaban Hayatı Koruma ve Geliştirme Sahaları nın hayvanları koruma ve biyoetik yönden değerlendirilmesi amaçlandı. Çalışmanın materyalini, hayvanları koruma ve yaban hayatı ile ilgili yerel mevzuat (Hayvanları Koruma Kanunu, Kara Avcılığı Kanunu, Su Ürünleri Kanunu, Özel Çevre Koruma Alanları Hakkında Kanun Hükmünde Kararname, Milli Parklar Kanunu gibi) ile Türkiye nin taraf olduğu uluslar arası sözleşmeler (BERN, CITES, Ramsar ve Biyolojik Çeşitlilik Sözleşmeleri) oluşturdu. Türkiye de değişik statülerde (Milli Park, Tabiat Parkı, Tabiatı Koruma Alanı, Doğal Sit, Özel Çevre Koruma Bölgesi, Uluslararası Öneme Sahip Sulak Alanı, Yaban Hayatı Koruma Sahaları ve Yaban Hayatı Geliştirme Sahaları gibi) koruma alanlarının olduğu; bu alanlardan çalışma kapsamında incelenen Yaban Hayatı Koruma Sahaları nın 109, Yaban Hayatı Geliştirme Sahaları nın 79 adet olduğu ve bu sahalarda 11 hayvan türü ve su kuşlarının koruma altına alındığı belirlendi. Yapılan yasal düzenlemeler ile bu sahalarda, yaban hayatının korunmasına yönelik, mevzuat yönünden önemli adımlar atıldığı ve birçok yaban hayvanı sayısında önemli artışlar olduğu belirlendi. Kara Avcılığı Kanunu çerçevesinde soyu azalan ya da tükenme tehlikesi ile karşı karşıya olan yaban hayvan türleri, doğal alanlarında, ortamın ekosistem özellikleri bozulmadan, habitatları ile birlikte korunmaları amacıyla koruma altına alınmakta ve bazı türlerin de üretimi gerçekleştirilmektedir. Bu uygulamaların, doğal dengenin korunmasında ve biyoçeşitliliğin sağlanmasında gerekli olduğu söylenebilir. Sonuç olarak uluslar arası sözleşmeler de dikkate alınarak hazırlanan ulusal düzenlemelerin, yaban hayatı korunması konusunda önemli katkılar sağladığı ve Türkiye nin bu konudaki çalışmaları arttırarak devam etmesi gerektiği; canlı varlıkların değeri, önemi ve bu doğrultuda hakları bulunduğu görüşüne dayanan canlı-merkezci tutumun yaygınlaştırılmasının yararlı olacağı söylenebilir. Anahtar sözcükler: Biyoetik, Hayvan koruma, Yaban hayatı The Wildlife Protection and Improvement Areas in Accordance with Animal Protection and Bioethics Summary The future of environment run into risk by human activities is an important issue of present days which also covers ethics and deontological aspects. Related acts as well as ethical approaches concerning with topic will be beneficial to solve the above issue. The process of Wildlife Protection and Improvement Areas has been evolved with different arrangements since 1966, in Turkey. This study aimed to evaluate the Wildlife Protection and Improvement Areas in terms of bioethics and animal protection. The study materials consisted of animal protection and local acts of wildlife (Animal Protection Act, Land Hunting Law, Fisheries Law, Decree - Law Regarding Special Environment Protection Areas, and National Parks Law), as well as several Treaties Ratified by Turkey (BERN, CITES, Ramsar and Biodiversity). Turkey has too many protection areas in various statute, such as; National Park, Nature Park, Natural Reserve Area, Natural Protected Area, Special Environment Protection, Internationally Important Wetland, Wildlife Protection and Improvement Areas. In total, it was determined 109 Wildlife Protection Areas and 79 Wildlife Improvement Areas, as well. However, 11 animal species and waterfowls have been taken under protection in Wildlife Improvement Areas. It was also emerged that the numbers of wild animals has increased and remarkable improvements have been occurred at this period in the Wildlife Improvement Areas by launching new acts. The wild animal species which are face to face with reducing generation or die out, are taken protection and some are being breeding in their natural area without giving harm to their ecosystem in accordance with Land Hunting Act. To fulfill respective aims, a protection of delicate natural balance and warrant of biodiversity are both necessary measures. In conclusion, it may be expressed the national arrangements that takes into consideration the international conventions, contributes to wildlife protection. Moreover, Turkey needs to be increased concerning studies in this respect. As a result, it can be implied that zoo-centric approach which based on the value, importance and rights of the entities should be become widespread in the Turkish society. Keywords: Bioethics, Animal protection, Wildlife İletişim (Correspondence) vetaslim@gmail.com

130 658 Hayvan Koruma Kavramı ve... GİRİŞ Birçok medeniyete ev sahipliği yapmış olan Anadolu da, yüzyıllardır doğal kaynaklar aşırı derecede tahrip edilmiştir. Bu tahripten av ve yaban hayvanları da etkilenmiştir. Savaşlar, artan nüfus, plansız şehirleşmeler, bilinçsizce kullanılan pestisitlerin yanı sıra sel, kuraklık ve şiddetli kış gibi doğal afetler doğal kaynakların tahribini hızlandırmış; yaban hayvanlarının yaşam ortamlarını olumsuz yönde etkilemiştir. Buna aşırı ve bilinçsiz yapılan avcılığın eklenmesiyle birçok yaban hayvanı popülasyonunun azaldığı ya da neslinin tehlikeye düştüğü ifade edilmektedir 1. İnsan faaliyetleri sonucunda tehlikeye atılan çevrenin geleceği zamanımızın önemli bir sorunu olup, bu sorunun etik boyutu ile birlikte deontolojik bir boyutu da bulunmaktadır. Hadidian ve ark. 3, insan-hayvan-doğa ilişkisine nasıl tepki vermemiz gerektiğine dair rehberlik edecek etik bir yaklaşıma ihtiyaç duyulduğunu bildirmektedir. Etik alanında yapılan çalışmalar, hayvan hakları, canlı türleri vb konuları da kapsamış ve birer alt dal olarak gelişmiş; etik ve eko felsefe kavramı farklı yönlerde gelişme göstermiştir. Etik, çevresel değerleri iyi ve kötü nün ne olduğu, yanlış ve doğru nun nasıl anlaşılması gerektiği yönünden ele almaktadır. Eko felsefe ise etik değerler üzerinden toplum doğa ilişkisini ele alarak, toplumun politik, ekonomik ve sosyal yaşamını değiştirmek ve bu şekilde doğayı merkeze almak amacı yönünde çaba göstermektedir 4. Günümüzde, çevre sorumluluğu ve duyarlılığı ile sosyal değerler arasında paralel bir ilişkinin varlığı gözlenmektedir. Bu bakımdan toplumların ekonomik, siyasal, felsefî, etik, kültürel ve sosyal gelişmişlik düzeyleri, ülkelerin çevre politikalarını, duyarlılığını ve sorumluluğunu etkilemektedir 4. Dünya genelinde olduğu gibi Türkiye de de doğal yapısını koruyan ve yaban hayvanlarının barınabileceği, bozulmamış doğal alanların gün geçtikçe azalmasına rağmen doğaya sonradan inşa edilen baraj, sulama göletleri ve benzeri yapıların yaban hayvanları için ve özellikle de su kuşları açısından yeni habitatlar oluşturduğu bildirilmektedir 1. Türkiye de 1966 yılında başlayan Yaban Hayatı Koruma Sahaları (YHKS) ve Yaban Hayatı Geliştirme Sahaları (YHGS) çalışması 5 günümüzde farklı yasal düzenlemelerle de temellendirilerek gelişmekte ancak çevrenin, korunan alan statüsünde olsun olmasın gün geçtikçe tahrip edildiği görülmektedir. Doğanın, insan hizmetine sunduğu kaynakların korunması, acilen ele alınması gereken önemli bir konu olup, yaban hayatı da bu kaynaklar arasında ön sıralarda yer almaktadır 6. Yaban hayatı koruma alanları üzerine çeşitli çalışmalar bulunmakla birlikte, konunun hayvanları koruma ve biyoetik açısından ele alınmadığı belirlenmiş olup; çalışmada, yaban hayatının korunmasında önemli yeri olan Yaban Hayatı Koruma ve Geliştirme Sahaları nın bu yönleriyle değerlendirilmesi amaçlandı. MATERYAL ve METOT Çalışmanın materyalini, hayvanları koruma ve yaban hayatı ile ilgili yerel mevzuat (Kara Avcılığı Kanunu, Su Ürünleri Kanunu, Özel Çevre Koruma Alanları Hakkında Kanun Hükmünde Kararname, Milli Parklar Kanunu, Hayvanları Koruma Kanunu gibi) ile Türkiye nin taraf olduğu uluslararası sözleşmeler (BERN, CITES, Ramsar ve Biyolojik Çeşitlilik sözleşmeleri) oluşturdu. Yaban hayatı koruma ve geliştirme alanları açısından sözleşme ve mevzuat metinleri incelenerek hayvanları koruma ve biyoetik kapsamında değerlendirildi. BULGULAR Türkiye de biyolojik çeşitliliğin devam ettirilebilmesi, yaban hayatının korunabilmesi, geliştirilmesi ve gelecek kuşaklara aktarılabilmesi için çeşitli yasalar çıkartılmakta; doğanın korunabilmesi için kurumlar kurulmakta ve uluslararası sözleşmelere taraf olunmaktadır. Bu sözleşmelerin uygulama yönetmeliklerinin hazırlanması çalışmaları, Avrupa Birliği (AB) Direktifleri i (9/43/EEC) hükümleri de dikkate alınarak devam etmektedir. Direktifin temel amaçları, Avrupa daki doğal habitatların, yabani flora ve faunanın korunması yoluyla biyolojik çeşitlilik kaybının durdurulması; doğal habitat ve türlerin devamlılığının sağlanması ve gerektiğinde restore edilmesi olarak açıklanmıştır. Yaban hayatının korunmasına ilişkin olarak Türkiye nin taraf olduğu Uluslararası Sözleşmeler kronolojik olarak aşağıda sıralandı: Kuşların Himayesine Dair Milletlerarası Sözleşme ii (Paris Sözleşmesi, 17 Ocak 1963) Nesli Tehlike Altında Olan Yabani Bitki ve Hayvan Türlerinin Uluslararası Ticaretinin Düzenlenmesine Dair Sözleşme iii (CITES Sözleşmesi, 1 Temmuz 1975) Özellikle Su Kuşları Yaşama Alanı Olarak Uluslararası Önemde Sulak Alanlar Sözleşmesi iv (Ramsar Sözleşmesi, 1975) Avrupa nın Yaban Hayatı ve Yaşama Ortamlarını Koruma Sözleşmesi v (BERN Sözleşmesi, 1 Haziran 198) i 9/43/EEC sayılı Konsey Direktifi. Doğal yaşam alanları ile yabani fauna ve floranın korunmasına ilişkin olan Konsey Direktifi, kısa adıyla Habitat Direktifi, Çevre Faslı na uyumda önem taşıyan düzenlemelerden biridir ii Kuşların Himayesine Dair Milletlerarası Sözleşme, tarih ve 1480 sayılı Resmi Gazete iii Nesli Tehlike Altında Olan Yabani Bitki ve Hayvan Türlerinin Uluslararası Ticaretinin Düzenlenmesine Dair Sözleşme, tarih ve 67 sayılı Resmi Gazete iv Özellikle Su Kuşları Yaşama Alanı Olarak Uluslararası Önemde Sulak Alanlar Sözleşmesi, tarih ve 1937 sayılı Resmi Gazete v Avrupa nın Yaban Hayatı ve Yaşama Ortamlarını Koruma Sözleşmesi, (BERN Sözleşmesi tarih ve sayılı Resmi Gazete

131 659 ASLIM, YİĞİT İZMİRLİ, YAŞAR Yaban Kuşlarının Korunmasına Dair Avrupa Ekonomik Topluluğu Kararnamesi Biyolojik Çeşitlilik Sözleşmesi vi (Rio Konferansı, 9 Aralık 1993) Türkiye de yaban hayatı ve yaşam ortamlarının korunması ile ilgili olarak Çevre ve Orman Bakanlığı vii (ÇOB), Tarım ve Köyişleri Bakanlığı viii, Kültür ve Turizm Bakanlığı gibi birden fazla kurum yetkilidir. Her kurum kanunlarla belirlenmiş görev ve yetkileri dahilinde koruma alanları ilan etmekte, bu alanlar için plan yapmakta ya da koruma -kullanma ilkelerini belirlemektedir. Bu çalışmalar kapsamında Türkiye de değişik statülerde (Milli Park, Tabiat Parkı, Tabiatı Koruma Alanı, Doğal Sit, Özel Çevre Koruma Bölgesi, Uluslararası Öneme Sahip Sulak Alanı, Yaban Hayatı Koruma Sahaları ve Yaban Hayatı Geliştirme Sahaları vb) koruma alanları ilan edildiği; bugüne kadar farklı amaçlarla oluşturulmuş bu alanların yaklaşık 4,6 milyon hektara (ha) (ülke yüzölçümünün yaklaşık % 6 sı) ulaştığı belirlendi ix. Nesli azalmakta olan hayvanlar ile bunların yaşam ortamlarının korunması, günümüzde büyük bir önem taşımaktadır. Bununla ilgili olarak yürürlülüğe giren Kara Avcılığı Kanunu x, avlakların önemi üzerine önemli düzenlemeler içermekte; son yıllarda yapılan bazı yasal düzenlemeler ile önemli gelişmeler kaydedildiği gözlenmektedir. Yaban Hayatı Koruma ve Geliştirme Sahaları Yönetmeliği xi ile nesli tehlikeye düşen ve düşmekte olan türlerin yaşam alanlarının koruma altına alınarak YHKS ve YHGS olarak ilan edildiği; 011 yılı itibariyle (ha) alanı kapsayan toplam 109 YHKS ile 79 adet YHGS mevcut olduğu ve bu sahalarda 11 hayvan türü ve su kuşlarının koruma altına alındığı belirlendi (Tablo 1). Bu yönetmelik, Kara Avcılığı Kanunu kapsamında olan av ve yaban hayvanları ile birlikte bunların yaşama alanları korumak amacıyla yaban hayatı koruma ve yaban hayatı geliştirme sahalarının kuruluşu, yönetimi, denetimi ve bu alanlarda izin vi Biyolojik Çeşitlilik Sözleşmesi, tarih ve 860 sayılı Resmi Gazete vii Makalenin yayına hazırlandığı süre zarfında Bakanlığın adı Çevre ve Orman Bakanlığı olup, tarih ve 7984 sayılı Resmi Gazete de yayımlanan 645 sayılı Orman ve Su İşleri Bakanlığının Teşkilat ve Görevleri Hakkında Kanun Hükmünde Kararname ile Bakanlığın adı Orman ve Su İşleri Bakanlığı olarak değişmiştir viii Makalenin yayına hazırlandığı süre zarfında Bakanlığın adı Tarım ve Köyişleri Bakanlığı olup, tarih ve 7958 sayılı Resmi Gazete de yayımlanan Gıda, Tarım ve Hayvancılık Bakanlığının Teşkilat Yapısı ve Görevleri Hakkında Kanun Hükmünde Kararname ile adı Gıda, Tarım ve Hayvancılık Bakanlığı olarak değişmiştir ix ÇOB Doğa Koruma ve Milli Parklar Genel Müdürlüğü Doğa Koruma Dairesi Başkanlığı. Ulusal Biyolojik Çeşitlilik Stratejisi ve Eylem Planı (UBSEP), Ankara, 007 x 4915 sayılı Kara Avcılığı Kanunu, tarih ve 5165 sayılı Resmi Gazete xi Yaban Hayatı Koruma ve Geliştirme Sahaları Yönetmeliği, tarih ve 5637 sayılı Resmi Gazete verilecek ve yasaklanacak faaliyetlerle ilgili usul ve esasları düzenlemektedir. Bu yönetmeliğe göre YHKS, Yaban hayatı değerlerine sahip, korunması gerekli yaşam ortamlarının bitki ve hayvan türleri ile birlikte mutlak olarak korunduğu ve devamlılığının sağlandığı sahaları, YHGS ise Av ve yaban hayvanlarının ve yaban hayatının korunduğu, geliştirildiği, av hayvanlarının yerleştirildiği, yaşama ortamını iyileştirici tedbirlerin alındığı ve gerektiğinde özel avlanma plânı çerçevesinde avlanmanın yapılabildiği sahaları ifade etmektedir. Yönetmelikte, Yaban Hayatı Geliştirme Sahalarının Seçim Kriterleri (Madde 5) Av ve yaban hayvanlarının veya biyolojik çeşitliliğin korunması gereken alanların muhafazası veya göçmen türlerin göç yollarını güvence altına almak için, yaşama ortamlarının korunduğu, geliştirildiği, av hayvanlarının yerleştirildiği, yaşama ortamlarını iyileştirici tedbirlerin alındığı ve gerektiğinde özel avlanma planı çerçevesinde avlanmanın yapılması amacı ile içerisinde hedef tür veya türlerin doğal olarak bulunduğu veya yeniden yerleştirildiği, av ve yaban hayvanlarının barınma, beslenme ve uygun yaşama koşulları ile doğal peyzaja sahip alanlardan seçilir şeklinde belirtilmektedir. ÇOB den alınan YHGS de 003 yılından sonra yapılan envanter çalışmalarının (Tablo ) sonuçlarına göre birçok yaban hayvanı türünde önemli artışlar olduğu tespit edilmiştir. Türkiye de YHKS ve YHGS lerden sorumlu birim; ÇOB ye bağlı olan Doğa Koruma ve Milli Parklar Genel Müdürlüğü dür. Bu Genel Müdürlüğün, Doğa Koruma Daire Başkanlığı, Milli Parklar Daire Başkanlığı, Mesire Yerleri Daire Başkanlığı ve Av-Yaban Hayatı Daire Başkanlığı şeklinde yapılandırıldığı görülmektedir xii. Doğa Koruma ile Milli Parklar Av ve Genel Müdürlüğünce, yürürlükten kaldırılan Kara Avcılığı Kanunu xiii na göre, YHKS olarak ilan edilen 109 saha ve 4915 sayılı yasa hükümlerine göre yeniden incelenerek teklif edilen 57 sahanın 005/9453 sayılı Bakanlar Kurulu Kararı xiv ile YHGS olarak ilan edildiği belirlendi. Kararda ayrıca 4915 sayılı yasa ile hazırlanan YHKS ve YHGS ile ilgili yönetmeliğe göre, daha önce ilan edilen 109 YHKS den sahaların seçilmesi kriterlerine uymayan veya özelliğini yitirmiş olan sahaların koruma statüsünün iptal edilmesi gerektiği bildirilmiş; Karar sonrasında, İl Çevre ve Orman Müdürlüklerinin teklifi ve Genel Müdürlüğün görüşleri doğrultusunda, Kara Avcılığı Kanunu na göre ilan edilen 9 sahanın koruma statüsünün 3 sayılı ÇOB oluru ile iptal edildiği belirlenmiştir xv. xii ÇOB (011). Erişim adresi: aspx?sflang=tr Erişim tarihi: xiii 3167 sayılı Kara Avcılığı Kanunu, tarih ve 3603 sayılı Resmi Gazete xiv 005/9453 sayı, tarihli Bakanlar Kurulu Kararı xv tarih ve 3 sayılı Bakanlık oluru (Kara 010)

132 660 Hayvan Koruma Kavramı ve... Tablo 1. Türkiye de mevcut Yaban Hayatı Koruma ve Geliştirme Sahaları (11 Şubat 010) xvi Table 1. Wildlife protection and improvement areas in Turkey (010) xvi Korunan Tür İl a Saha Hektar Toplam Alan (ha) Alageyik - Yaban Keçisi Antalya Düzlerçamı Su Kuşları Samsun Kars Gaziantep Eskişehir Düzce Denizli Ankara Adana 1 Adana Adana 3 Afyonkarahisar Burdur 1 Burdur İzmir Sakarya Tokat Bafra Kızılırmak Deltası Kuyucuk Gölü Tahtaköprü Baraj Gölü Sivrihisar Balıkdamı Gölyaka Efteni Gölü Çardak Beylerli Gölü Nallıhan Davutoğulları Tuzla Gölü Akyatan Gölü Seyhan Baraj Gölü Dinar Karakuyu Gölü Burdur Gölü Karataş Gölü Selçuk Gebekirse Gölü Kaynarca Acarlar Gölü Kaz Gölü Toy Kütahya Merkez Aslantaş Dağ Horozu Ardahan Posof Ceylan Şanlıurfa Merkez Kızılkuyu Karaca - Yaban Keçisi Hatay İskenderun Arsuz Karaca - Geyik Yaban Koyunu Yaban Keçisi Çengel Boynuzlu Dağ Keçisi (ÇBDK) Karabük Zonguldak Bartın Konya Ankara Niğde Muğla 1 Muğla Mersin 1 Mersin Kayseri Erzurum Artvin Antalya 1 Antalya Antalya 3 Antalya 4 Antalya 5 Antalya 6 Antalya 7 Adana 1 Adana Gümüşhane Kars Mersin 3 Mersin 4 Mersin 5 Rize Erzurum 1 Erzurum Bitlis Bingöl Yenice Yeşilöz Ulus Sökü Bozdağ Nallıhan Emresultan Çamardı Demirkazık Köyceğiz Yılanlı Çakmak Mut Kestel Dağı Tarsus Kadıncık Vadisi Yahyalı Aladağlar Oltu Yusufeli Çoruh Vadisi Sivridağ Gündoğmuş Kaş Kıbrıs Çayı Cevizli Gidengelmez Dağı Alanya Dimçayı Sarıkaya Akseki İbradı Üzümdere Pozantı Karanfildağ Kahramanmaraş Hançerderesi Şiran Kuluca Sarıkamış Kağızman Tarsus Hopur Topaşır Hisardağ ve Gedikdağı Çamlıyayla Cehennem Deresi Çamlıhemşin Kaçkar Çat İspir Vercenik Dağı Adilcevaz Süphandağı Kığı Şeytandağları xvi Erişim adresi: 11/Yaban_Hayat%C4%B1_Geli%C5%9Ftirme_Sahalar%C4%B1. aspx?sflang=tr, Erişim tarihi:

133 661 ASLIM, YİĞİT İZMİRLİ, YAŞAR Tablo 1. Türkiye de mevcut Yaban Hayatı Koruma ve Geliştirme Sahaları (11 Şubat 010) (devam...) Table 1. Wildlife protection and improvement areas in Turkey (010) (continued...) Korunan Tür İl a Saha Hektar Toplam Alan (ha) Geyik Kütahya 1 Kastamonu 1 Kastamonu Kastamonu 3 Kastamonu 4 İstanbul Eskişehir Denizli Bolu 1 Ankara 1 Ankara Afyonkarahisar Bolu Balıkesir Bolu 3 Kütahya Tavşanlı Çakmak Tosya Gavurdağı Aydavaz Kartdağı Taşköprü Elekdağı Ilgazdağı Çatalca Çilingoz Mihallıçık Çatacık Çivril Akdağ Göynük Kapıormanı Nallıhan Saçak Beypazarı Kapaklı Sandıklı Akdağ Yedigöller Akdağ Burdur Gölü Merkez-Türkmenbaba Karaca Sinop Osmaniye Kocaeli Karabük İstanbul Çorum İzmir Bozburun Zorkun Yaylası Kandıra Seyrek Sırçalı Kanyonu Sarıyer Feneryolu Kargı Koşdağ Bayındır Ovacık Sırtlan Hatay Altınözü Sülün Samsun Bursa Terme Gölardı Simenlik Gölü Karacabey Karadağı-Ovakorusu a İl bölümünde bulunan indis, o ildeki korunan tür için birden fazla olan YHGS sayısını belirtmektedir Tablo yılları arası YHGS lerde yapılan envanter sonuçları xvii Table. The inventory results of wildlife improvement areas between xvii Korunan Tür Yıllar Alageyik Yaban Keçisi Toy Dağ Horozu Ceylan Karaca Geyik Yaban Koyunu ÇBDK Sırtlan Sülün Toplam xvii Çevre ve Orman Bakanlığı yılları arası YHGS lerde yapılan envanter sonuçları, tarihli belgegeçer TARTIŞMA ve SONUÇ Geleceklerini kurtarmak için çabalayan günümüz toplumları, özellikle bozulan ekolojik dengenin yol açtığı olumsuz etkileri asgariye indirmeye yönelik ciddi adımlar atmaktadır. Bu çabaların başarıya ulaşmasında yaban hayatı, yaban hayvanları ve insan üçlüsü arasındaki ilişki düzeylerinin önemli bir rol oynayacağı bildirilmektedir 7. Türkiye de konu ile ilgili yürürlüğe konulan yasal düzenlemeler, bu adımların temellendirilmesi ve sürekliliği açısından önem taşımaktadır. Bu bağlamda, Türkiye ve Dünya da mevcut yasal düzenlemeler ile ülkeler arasındaki işbirliğini ortaya koyan sözleşmelerin bu üçlü arasındaki ilişkileri dengelemek açısından önemli olduğu ve Boztepe nin 7 de belirttiği ortak yaşam perspektifiyle hayvan -insan çelişkilerini azaltmak; yaban hayatını düzenleme proje ve çalışmalarında nasıl bir yaban hayatı yönetimi? sorusunu yanıtlamak ve sorunları çözmek için YHKS ile YHGS lerin büyük önem taşıdığı söylenebilir. Bu çalışmada ele alınan Kara Avcılığı Kanunu ve uluslararası sözleşmeler incelendiğinde, Türkiye de avlanan türler bakımından yaban hayatının korunması için Kara ya 1 da paralel olarak tüm avlaklarda av ve yaban hayvanlarının korunması, avcılığın düzenlenmesi ve kontrolünün sağlan-

134 66 Hayvan Koruma Kavramı ve... ması, yaşama ortamlarını bozucu olumsuz etkilerin en aza indirilmesi, nesli tehlikeye düşen veya sayıları azalan av ve yaban hayvanı türlerinin yaşam ortamları ile birlikte korunarak sayılarının artırılması, envanterlerinin hazırlanması, doğal dengenin korunması ve biyoçeşitliliğin sağlanması ve bazı türlerin de üretiminin gerçekleştirilmesi ile sağlanabileceği ileri sürülebilir. Güder 8, doğa koruma ile ilgili mevzuatın hayata geçirilmesinin çok maliyetli olmasının, ekonomik faaliyetlerin çoğunlukla doğal değerler göz ardı edilerek planlanmış olmasından kaynaklandığını; doğru bir planlama ile hem doğanın hem de ekonomik faaliyetlerin birlikte var olduğu sistemlerin oluşturulabileceğini bildirmektedir. Doğru bir planlama ile hem doğanın hem de ekonomik faaliyetlerin birlikte var olduğu sistemlerin oluşturulabilmesi, bütüncül bir etik yaklaşım ile ele alınarak 4E Prensibi (Etik-Ekoloji- Etoloji-Ekonomi) 9 çerçevesinde bir planlamanın yapılması ile mümkün olabileceği; çalışmada üzerinde durulan YHKS ile YHGS ler aracılığıyla insanın da doğanın bir parçası olması ve doğal yaşama karşı taşıdığı sorumluluklar bağlamında bu alanların gelecek kuşaklara korunarak aktarılabileceği belirtilebilir. AB genelinde korunan alanların oranı %17 iken 8, çalışmada Türkiye de bu oranın %6 olduğu belirlendi. AB Türkiye 010 İlerleme Raporu nda 10 da belirtildiği gibi doğanın korunması konusunda ilerleme kaydedilememesi ve TBMM ye sevk edilen Tabiatı ve Biyolojik Çeşitliliği Koruma Kanunu Tasarısı xviii nın, Türk Natura 000 ağına katkılar sağlayabilecek birçok alanın mevcut koruma düzeyinin kaldırılmasına neden olması ihtimali; Türkiye de 1966 yılında başlayan YHKS ve YHGS çalışmalarının günümüzde çeşitli yasal düzenlemelerle de arttırılmasına rağmen yine de AB ülkelerindeki ortalamanın oldukça gerisinde olduğu ve geleceğe yönelik olarak bu alanlarla ilgili olumsuz bir tablonun varlığına işaret ettiği şeklinde değerlendirilebilir. Türkiye de yıllardır bilinen ve uzun süre yasaklama temeline dayanan koruma anlayışından 8 farklı bir anlayış gözeten AB Doğa Koruma Mevzuatı, doğayı koruma hedefi yanında insan topluluklarının sosyal ve ekonomik faaliyetlerini de dikkate alan bir anlayışı ortaya koymakta olup, yeterli sayıda olmamakla birlikte, çalışmada tespit edilen 109 YHKS ve 79 YHGS sahası ile birçok hayvan tü- rünün koruma altına alınmış (Tablo 1, ) olması, Türkiye de var olan doğal değerlerimiz ve hayvan varlığımızın gelecek kuşaklara ancak canlı merkezci ve çevre merkezci yaklaşım ve bunu destekleyen yasal düzenlemelerle aktarılabileceği şeklinde yorumlanabilir. Sonuç olarak uluslararası sözleşmeler de dikkate alınarak hazırlanan ulusal düzenlemelerin, yaban hayatı korunması konusunda önemli katkılar sağlamakla birlikte, Türkiye nin bu konudaki çalışmalarını arttırarak devam etmesi gerektiği; canlı varlıkların değeri, önemi ve bu doğrultuda hakları bulunduğu görüşüne dayanan canlımerkezci tutumun yaygınlaştırılmasının yararlı olacağı söylenebilir. KAYNAKLAR 1. Kara U: Kozan Baraj Gölü ve çevresi yaban hayatı koruma sahası üzerine incelemeler. Yüksek Lisans Tezi, Kahramanmaraş Sütçü İmam Üniv. Fen Bil. Enst., Uğurlu Ö, Çobanoğlu N: Biyoetik açıdan çevresel güvenlik kavramı. Türkiye Biyoetik Derneği Uluslararası katılımlı 3. Ulusal Tıp Etiği Kongresi, Kongre Kitabı Cilt 1, Bursa, s , Hadidian J, Fox CH, Lynn WS: The Ethics of Wildlife Control in Humanized Landscapes. Proc. nd Vertb. Pest. Conf. Published at Univ. Calif. pp , Mahmutoğlu A: Kırsal alanda çevre sorunlarına etik yaklaşım: Kırsal çevre etiği. Yüksek Lisans Tezi, Ankara Üniv. Sosyal Bil. Enst., Arda SS: Türkiye de doğa koruma alanı uygulamaları Avrupa Birliği mevzuatı ile karşılaştırılması. Yüksek Lisans Tezi, Ankara Üniv. Sosyal Bil. Enst., Gürdal MN: Türkiye nin yaban hayatı koruma ve geliştirme sahaları üzerine araştırmalar. Yüksek Lisans Tezi, Süleyman Demirel Üniv. Fen Bil. Enst., Boztepe R: Yaban hayatı, yabani hayvan, insan. akademie.com/archiv_010/v/m_a/yab_hay_insan.pdf, Erişim tarihi: Güder H: Habitat Direktifi ile Türkiye nin yasaklama temelli doğa korumacılık anlayışı değişecek. rec-turkiye-habitat-direktifi-ile-turkiyenin-yasaklama-temelli-dogakorumacilik-anlayisi-degisecek , Erişim tarihi: Işık K: Türlerin nesillerinin korunmasında beş büyük gemi. Çevre Sorunları ve Biyolojik Çeşitlilik Orman Gen kaynaklarımız. Türkiye Erozyonla Mücadele, Ağaçlandırma ve Doğal Varlıkları Koruma Vakfı Yayınları 5, İstanbul, Avrupa Birliği Genel Sekreterliği (ABGS): Türkiye İlerleme Raporları Erişim tarihi: xviii Tabiatı ve Biyolojik Çeşitliliği Koruma Kanunu Tasarısı, Başkanlığa Geliş tarihi, 1/964 Esas No

135 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE * ** *** **** ***** Halk Elinde Yetiştirilen Beyaz ve Alaca Kazlarda Karkas ve Et Kalitesi Özellikleri Akın YAKAN * Dilek AKSU ELMALI ** Mehmet ELMALI *** Tarkan ŞAHİN **** Sedat MOTOR ***** Yeşim CAN ***** Mustafa Kemal Üniversitesi, Veteriner Fakültesi, Zootekni Anabilim Dalı, TR Hatay - TÜRKİYE Mustafa Kemal Üniversitesi, Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı, TR Hatay - TÜRKİYE Mustafa Kemal Üniversitesi, Veteriner Fakültesi, Besin Hijyeni ve Teknolojisi Anabilim Dalı, TR Hatay - TÜRKİYE Kafkas Üniversitesi, Veteriner Fakültesi, Hayvan Besleme ve Beslenme Hastalıkları Anabilim Dalı, TR Kars - TÜRKİYE Mustafa Kemal Üniversitesi, Tıp Fakültesi, Biyokimya Anabilim Dalı, TR Hatay - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışma halk elinde yetiştirilen Beyaz ve Alaca kazlarda karkas ve et kalitesi özelliklerinin tespit edilmesi amacıyla yapılmıştır. Beyaz ve Alaca kazlarda karkas randımanları ve iç organların oranları bakımından farklılıklar önemli olmazken, karkas parçalarından göğüs, sırt ve kanat oranları bakımından önemli farklılıklar bulunmuştur. Varyeteler arasındaki fenotipte görülen renk farklılığının hem göğüs etine hem de deriye (kırmızılık indeksi hariç) yansıdığı tespit edilmiştir. Göğüs etinde doymuş yağ asidi ve tekli doymamış yağ asidi değerleri Beyaz kazlarda daha iyi iken aşırı doymamış yağ asidi değerleri Alaca kazlarda daha iyi olarak belirlenmiştir. Göğüs eti, deri ve abdominal yağda Besleyici Değer İndeksi nin Beyaz kazlarda Alaca kazlara göre daha yüksek olduğu saptanmıştır. Anahtar sözcükler: Kaz, Karkas, Et kalitesi, Yağ asidi Summary Carcass and Meat Quality Characteristics of White and Multicolor Geese under Local Breeder Conditions The purpose of this study was to define the meat quality characteristics of White and Multicolor geese under local breeder conditions. While carcass and edible offal percentages were similar breast, back and wing ratios were statistically different between White and Multicolor geese. Phenotypic color differentiation between geese varieties was reflected on both breast meat and skin (except a* value). While White geese had better values than Multicolor geese for saturated fatty acid and monounsaturated fatty acid, Multicolor geese were higher than White geese for polyunsaturated fatty acid. Nutritive value of White variety was higher than Multicolor variety in breast meat, skin and abdominal fat. Keywords: Goose, Carcass, Meat quality, Fatty acid GİRİŞ Artan nüfusla birlikte protein ihtiyacının da artması hayvansal kökenli protein kaynaklarında arayışlara neden olmuştur. Bu durum yetiştiricileri kısa sürede protein ihtiyacının karşılanması bakımından alternatif olarak kanatlı yetiştiriciliğine yöneltmiştir. Kazlar diğer kanatlılara kıyasla hastalıklara ve soğuk iklim koşullarına daha dayanıklı olup, tavuklar gibi özel kümeslere ihtiyaç duymazlar 1. Kaz yetiştiriciliği yoğun olarak Kars ve Ardahan çevresinde yapılmaktadır. Bu illerde köylülerin et ve yağ ihtiyaçlarının önemli bir kısmı kazlardan sağlanmaktadır,3. Ancak Türkiye de birçok bölgede az da olsa halk elinde kaz yetiştiriciliği yapılmaktadır. İletişim (Correspondence) /1544 yakanakin@hotmail.com

136 664 Halk Elinde Yetiştirilen Beyaz... Kazlar lezzetli ve yüksek kalorili et vermeleri ile tanınmışlardır. Enerji değerinin yüksek olması ise, kaz etinin oldukça yağlı olmasından ileri gelmektedir 3. TUİK 4 verilerine göre 006 yılında 490 adet kaz kesildiği ve 9 ton et elde edilmiştir. Ülkemizde kaz yetiştiriciliğinin sistemli yapılmaması ve aile işletmeciliği şeklinde geleneksel yöntemlerle sürdürülmesi kaz eti üretiminin sınırlı kalmasına neden olmuştur 5. İnsanların beslenmesinde tüketilen hayvansal gıdaların kalitesiyle sağlık arasında doğrudan bir ilişki vardır. Dünya Sağlık Örgütü insanlarda ölüm sebebi olarak birinci sırada koroner kalp hastalıklarını göstermektedir. Koroner kalp sağlığı üzerine, diyetteki doymuş yağ asitleri (DYA) olumsuz etki yaparken, aşırı doymamış yağ asitleri (ADYA) ve tekli doymamış yağ asitleri (TDYA) olumlu etki yapmaktadır. Dolayısıyla insanların koroner kalp sağlığı bakımından, diyetlerinde yer alan etlerin yağ asidi kompozisyonunun bilinmesi önem taşımaktadır 6. Kanatlılarda et kalitesi hem hayvana bağlı hem de hayvana bağlı olmayan birçok faktör tarafından etkilenebilmektedir. Özellikle broilerlerde et kalitesi özelliklerinin tespiti için çok sayıda çalışmaya 7-14 ulaşılabilirken kazlarda sınırlı sayıda çalışma bulunmaktadır. Bu çalışma halk elinde yetiştiriciliği yapılan farklı kaz varyetesinde (Beyaz ve Alaca) karkas ve et kalitesi özelliklerinin belirlenmesi amacıyla yapılmıştır. MATERYAL ve METOT Hayvan Materyali Çalışmanın hayvan materyalini Hatay ili Serinyol beldesindeki bir aile işletmesinde yetiştirilen Beyaz ve Alaca kazlar oluşturmuştur. Kazlar kesimden 3 ay öncesine kadar sabahtan akşama kadar merada serbest olarak otlatılmıştır. Yetiştirmenin son 3 ayında ise gündüz merada olan kazlara akşamları mera dönüşü arpa ve mısır verilmiştir. Kazlar ortalama 8-9 aylık yaşa ulaştıklarında her bir varyeteden 5 er baş kesilmiştir. Karkas Özellikleri Kesimden 1 saat önce tüm kazlar aç bırakılmış ancak su içmelerine imkân verilmiştir. Kesimden sonra sıcak karkas ve yenilebilir iç organların (kalp, karaciğer, taşlık) ağırlıkları tespit edilmiştir. Karkaslar +4 C de 4 saat bekletildikten sonra soğuk karkas ve karkas parçalarının (boyun, but, göğüs, sırt, kanat ve abdominal yağ) ağırlıkları ile bu ağırlıklara ait oranlar belirlenmiştir. Et Kalite Analizleri Et kalite özelliklerinin tespitinde her bir soğuk karkasın sağ yarımından diseke edilen göğüs eti (M. Pectoralis major) kullanılmıştır. ph, su tutma kapasitesi (STK), pişirme kaybı (PK) ve renk analizleri taze ette; kimyasal kompozisyon (kuru madde, ham kül, ham protein ve ham yağ) ve yağ asidi analizi ise -18 C de saklanan örneklerde yapılmıştır. Malondialdehit (MDA) düzeylerinin tespitinde örnekler +4 C de 4 ve 7 saat bekletildikten sonra analiz yapılana kadar -18 C de saklanmıştır. Ette ph, kesimden hemen sonra (ph 0 ), 45 dakika sonra (ph 45 ) ve 4 saat sonra (ph 4 ) olmak üzere 3 defa göğüs etinden cam elektrotlu (Inlab 47) portatif ph metre (Metler Toledo SG) ile tespit edilmiştir. Kesimden sonra 4. ve 7. saatlerde STK basınç metodu kullanılarak (5 g numuneyi 50 g ağırlığa 5 dk maruz bırakarak) 18, PK ise Honikel in 19 önerdiği metot ile (80 C deki su banyosunda 1 saat) tespit edilmiştir. MDA analizi Esterbauer ve Cheeseman ın 0 bildirdiği yöntem ile yapılmıştır. Renk analizi kesimden sonraki 4. saatte göğüs eti ve bu bölgenin derisinden Kolorimetre (Konica Minolta CR- 400) ile parlaklık (L*), kırmızılık (a*) ve sarılık koordinatı (b*) olarak tespit edilmiştir. Etin kimyasal kompozisyonu AOAC nin 15 bildirdiği yöntemler ile yapılmıştır. Yağ asidi analizi için numunelerden AOAC nin 1 bildirdiği yöntemle yağ ekstraksiyonu yapılmış, ardından Boron Trifluoride ile metil esterleri oluşturulmuştur. Yağ asidi metil esterleri azot gazı altında yoğunlaştırıldıktan sonra GC-MS (HP 6890/597) de analiz edilmiştir. Analizde Agilent HP mikro-m 50 mm kolon kullanılmıştır. Kolon başlangıç sıcaklığı 10 C, son sıcaklığı 30 C, enjektör ve dedektör sıcaklığı ise 50 C olarak belirlenmiştir. Enjeksiyon hızı 50:1 olarak ayarlanmıştır. Taşıyıcı gaz olarak Helyum kullanılmıştır. İstatistik Analizler Tüm istatistik analizler SPSS 14.0 (Lisans no: ) paket program kullanılarak yapılmıştır. Varyeteler arası farklılığın önem kontrolü Mann-Whitney U testi ile yapılmıştır. Yağ asidi kompozisyonu için farklı kaynaklardan elde edilen yağlar arasındaki farklılığın önem kontrolü Tek Yönlü Varyans Analizi ile test edilmiştir. Gruplar arasındaki farklılıkların önem kontrolü Duncan testi ile yapılmıştır. Karkas özelliklerinin birbirleri arasındaki fenotipik korelasyonları Spearman katsayısı ile hesaplanmıştır. BULGULAR Karkas, karkas parçaları ve iç organların ağırlıkları ile bu ağırlıklara ait oranlar ve median değerleri Tablo 1 de verilmiştir. Beyaz ve Alaca kazların, karkas parçalarından göğüs, sırt ve kanat oranları bakımından aralarında farklılıklar önemli (P<0.05) tespit edilmiştir. Beyaz ve Alaca kazlarda kesim ağırlıkları sırasıyla 3840 ve 30 g olurken sıcak karkas randımanı aynı sırayla %7.49 ve olmuştur. Tablo de kesim ağırlığı, karkas ağırlıkları ve karkastaki parçaların ağırlıkları arasındaki fenotipik korelasyon katsayıları sunulmuştur. Kesim ağırlığı ile sıcak ve soğuk karkas

137 665 YAKAN, AKSU ELMALI, ELMALI ŞAHİN, MOTOR, CAN Tablo 1. Canlı ağırlık, karkas, karkas parçaları ve iç organlara ait ağırlıklar (g), oranları (%) ve median değerleri Table 1. The weights (g), ratio (%) and median values of live weight, carcass, cut of carcass and edible offal Beyaz Alaca Parametre P X±Sx % Median X±Sx % Median Canlı Ağırlık 3840± ±63.4 Sıcak Karkas 781± ± ± ± Soğuk Karkas 71± ± ± ± Karkas Parçaları Boyun 196± ± ± ± But 95± ± ± ± Göğüs 784± ± ± ± * Sırt 80± ± ± ± * Kanat 348± ± ± ± * Abdominal Yağ 115± ± ± ± İç Organlar Kalp 8.40± ± ± ± Karaciğer 78.80± ± ± ± Taşlık 137.0± ± ± ± *: P<0.05 (% değerler için) Tablo. Karkas özellikleri arasındaki fenotipik korelasyon katsayıları Table. Correlation values among some carcass parts Parametre Kesim Ağırlığı Sıcak Karkas Ağırlığı Soğuk Karkas Ağırlığı Boyun Ağırlığı But Ağırlığı Göğüs Ağırlığı Sırt Ağırlığı Sıcak Karkas Ağırlığı *** Soğuk Karkas Ağırlığı *** 0.99 *** Boyun Ağırlığı But Ağırlığı Göğüs Ağırlığı ** Sırt Ağırlığı ** ** ** Kanat Ağırlığı * * 0.84 ** * *: P<0.05; **: P<0.01; ***: P<0.001 ağırlıkları arasındaki korelasyon katsayıları önemli (P<0.001) bulunmuştur. Tablo 3 te Beyaz ve Alaca kazlara ait bazı et kalitesi özellikleri verilmiştir. Beyaz ve Alaca kazlarda sırasıyla ph 0 değeri 5.68 ve 5.93 (P<0.01); 7. saatte su tutma kapasitesi %9.60 ve %9.3; pişirme kaybı 8.64 ve (P<0.05) ve MDA 0.9 ve 0.43 mg MDA/kg et (P<0.05) olarak tespit edilmiştir. Renk bakımından ise derideki a* değeri hariç gerek göğüs etinde gerekse deride tüm değerler (L*, a* ve b*) bakımından önemli farklılıklar (P<0.05; P<0.01) bulunmuştur. Etin ham kül ve ham protein oranları varyeteler arasında benzer olurken, kuru madde ve ham yağ oranları arasında farklılık önemli (P<0.05) olmuştur. Kazlarda göğüs eti, deri ve abdominal yağlarına ait yağ asidi kompozisyonları Tablo 4 te verilmiştir. Yağ asitleri oranları kullanılarak elde edilen toplam değerler ile indeks değerler ise Tablo 5 te sunulmuştur. TARTIŞMA ve SONUÇ Çalışmada Beyaz ve Alaca kazların kesim ağırlıkları (3840 ve 30 g) Isguzar ve Pingel 15, Çelik ve Bozkurt ve Kırmızıbayrak ve ark. nın 3 bildirdiği değerler ile benzer olurken, çok sayıdaki çalışmadan 16,4-9 ise daha düşük olmuştur. Bu farklılığın sebebinin kesim yaşı, genotip, yetiştirme bölgesi ve yetiştiricilik şeklinden kaynaklanabileceği düşünülmektedir. Zira Türkiye de kaz yetiştiriciliğinin en yoğun olarak yapıldığı Kars ve Ardahan bölgesinde 17,7,8 kesim ağırlığı genel olarak diğer bölgelerden 15, yüksek olmaktadır. Karkas randımanı bakımından varyeteler (beyaz ve alaca) arasında fark olmamıştır (P>0.05). Tespit edilen sıcak karkas randımanları (%7.49 ve 71.56) Tilki ve ark. 4, Isguzar ve Pingel 15, Tilki ve İnal 9 ve Kırmızıbayrak ve ark. nın 3 bildirişleri ile benzer, Tilki ve ark. 8,30,31, Çelik ve Bozkurt ve Kırmızıbayrak ın 7 bildirişlerinden daha yüksek olmuş-

138 666 Halk Elinde Yetiştirilen Beyaz... Tablo 3. Bazı et kalitesi parametrelerine ait ortalama ve median değerler Table 3. Means and median values of some meat quality characteristics Beyaz Alaca Parametre P X±Sx Median X±Sx Median 0. dakika 5.68± ± ** ph 45. dakika 5.58± ± saat 5.74± ± Su tutma kapasitesi (%) 4. saat 1.04± ± saat 9.60± ± Pişirme kaybı (%) 4. saat 8.10± ± saat 8.64± ± * Malondialdehit 4. saat 0.16± ± (mg MDA/ kg et) 7. saat 0.9± ± * L* 40.3± ± * Göğüs eti a*.86± ± * Renk b* 10.81± ± * L* 75.80± ± ** Deri a* 7.9± ± b* 15.1± ± * Etin kimyasal kompozisyonu (%) Kuru madde 30.05± ± * Ham Kül.34± ± Ham Protein 0.84± ± Ham Yağ 4.55± ± * *: P<0.05; **: P<0.01; -: Önemli değil tur. Ekstansif şartlarda yetiştirilen kazların karkas randımanlarının entansif şartlarda yetiştirilenlere göre daha yüksek olduğu bilinmektedir 30,31. Bu sebeple yapılan çalışmadaki karkas randımanı değerleri literatür ile uyum göstermektedir. Karkas parçalarından göğüs, sırt ve kanat oranları varyeteler arasında farklılık (P<0.05) göstermiştir. Göğüs ve kanat gibi tüketici tarafından daha çok tercih edilen parçaların oranı Alaca kazlarda (%31.43 ve 16.41) Beyaz kazlara (%9.04 ve 14.9) göre daha yüksek olurken, sırt gibi daha az tercih edilen parçanın oranı Beyaz kazlarda daha fazla olmuştur. Çalışmada kullanılan her iki varyetedeki göğüs oranları (%9.03 ve 31.43) bazı çalışmalarda 15,9,30 bildirilen değerlerden yüksek olurken, bazıları,3,31 ile benzer olmuştur. Kesim ağırlığı ile karkas ağırlıkları arasında tespit edilen fenotipik korelasyon katsayıları yüksek ve önemli (P<0.001) olmuştur. Bu durum Kırmızıbayrak ın 7 kazlardaki bulguları ile uyumludur. ph et kalitesinin değerlendirilmesinde su tutma kapasitesi, pişirme kaybı, tekstür ve renk üzerine doğrudan etkili olduğu için en önemli parametrelerden birisidir 17,3. Kanatlılarda kesim anındaki ph düzeyine, kas glikojen rezervlerinin bireyler arasındaki farklılıkları 1,13,17, kesim öncesi maruz kalınan stres düzeyi 14,17 ve kesim ağırlığı etki edebilmektedir 33,34. Bu çalışmada ph 0 Alaca kazlarda Beyaz kazlara göre yüksek bulunmuştur (P<0.01). Alaca kazların kesim ağırlıklarının (30 g) Beyaz kazlara (3840 g) göre düşük olması ph 0 değeri farklılığının sebebi olarak düşünülmektedir. Zira kanatlılarda yapılan çalışmalarda 7,33,35 kesim yaşının ve kesim ağırlığın artması ile ph değerinin düştüğü bildirilmektedir. Yapılan çalışmada tespit edilen ph 0, ph 45 ve ph 4 değerlerinin kazlarda yapılan diğer çalışmalar 17,5 ile benzer olduğu tespit edilmiştir. Yine tüketimde en önemli ph değeri olan ph 4 bakımından elde edilen sonuçlar broilerlerde 7,9, kuzu ve oğlaklarda elde edilen sonuçlar ile benzer olmuştur. Tüketiciler tarafından etin satın alınmasındaki en önemli unsurlar, fiyat, duyusal ve besinsel kalite ile ürün güvenliğidir 17. Duyusal kalitede su tutma kapasitesi ve renk belirleyici konumdadır. STK bakımından kesimden sonraki hem 4. saatte hem de 7. saatte farklılık olmamıştır. Tespit edilen değerler (7. saatte %9.60 ve 9.3) Kırmızıbayrak ve ark. nın 17 yaptığı çalışma bulguları (% arasında) ile benzerdir. Diğer bir duyusal kalite kriteri olan renk bakımından varyeteler arasında göğüs etinde L*, a* ve b*; deride ise L* ve b* değerleri bakımından tespit edilen farlılık önemli (P<0.05 ve P<0.01) bulunmuştur. Bu farklılığın kazların dış görünüş renklerine de yansıyan varyete farklılığından olduğu düşünülmektedir. Göğüs eti bakımından Beyaz kazların daha parlak (40.3 e karşı

139 667 YAKAN, AKSU ELMALI, ELMALI ŞAHİN, MOTOR, CAN Tablo 4. Vücudun farklı yağ kaynaklarındaki yağ asidi kompozisyonu (X±Sx) Table 4. The fatty acid composition from different body fat origin (X±Sx) Yağ Asidi (%) Varyete Göğüs Eti Deri Abdominal Yağ P - C1:0 Beyaz 0.59±0.19 T.E. T.E. Alaca 0.±0.10 T.E. T.E. - * * C14:0 Beyaz 0.84±0.1 a 0.43±0.0 b 0.43±0.03 b * Alaca 0.55± ± ± C14:1 Beyaz 0.70±0.09 T.E. T.E. Alaca 0.41±0.15 T.E. T.E C16:0 Beyaz.67± ±0.7.13±0.7 - Alaca 3.3± ± ± * - - C16:1 Beyaz 3.69± ± ±0.0 - Alaca.75± ± ±0.6 - ** - ** C18:0 Beyaz 6.00± ± ±0.1 - Alaca 7.83± ± ± *** * * C18:1 Beyaz 51.18±0.61 a 56.60±.11 ab 57.34±1.40 b ** Alaca 4.17±1.58 a 49.90±1.56 b 50.57±1.63 b ** ** - * C18: n6 Beyaz 9.53± ± ± Alaca 15.8± ± ± * - C18:3 n3 Beyaz 1.70± ± ±0.9 - Alaca.94± ± ± C0:1 Beyaz 0.57± ± ± Alaca 0.46±0.05 a 0.67±0.04 b 0.6±0.05 ab * - - C0: n6 Beyaz 0.37±0.09 a 0.13±0.0 b 0.36±0.03 a ** Alaca 1.11±0.45 a 0.16±0.0 b T.E. * - C0:3 n6 Beyaz 0.18±0.01 T.E. T.E. Alaca 0.6±0.04 T.E. T.E. - * C0:4 n6 Beyaz 1.49±0.09 a 0.08±0.01 b 0.07±0.01 b *** Alaca.5±0.41 a 0.1±0.01 b T.E. *** - C:6 n3 Beyaz 0.34±0.03 T.E. T.E. Alaca 0.41±0.0 T.E. T.E. *: P<0.05, **: P<0.01, -: Önemli değil, T.E.: Tespit edilemedi, a,b : Aynı satırda farklı harfleri taşıyan ortalamalar arası farklılıklar önemlidir 33.99), ancak Alaca kazların ise daha düşük bir kırmızılık koordinatına sahip (19.07 ye karşı.86) olduğu tespit edilmiştir. Göğüs etinde tespit edilen L* değeri kazlarda yapılan diğer çalışmalar ile benzer 17,39 ya da biraz düşük 5 olmuştur. a* değeri Fernandez ve ark. nın 5 kazlar için bildirdiği değerlere benzer olurken, Kırmızıbayrak ve

140 668 Halk Elinde Yetiştirilen Beyaz... Tablo 5. Vücudun farklı yağ kaynaklarındaki yağ asitlerinden oluşturulan toplam ve indeks değerler (X±Sx) Table 5. Sums and ratio based on fatty acids from different body fat origins Yağ Asidi Varyete Göğüs Eti Deri Abdominal Yağ P * - * DYA Beyaz 30.18± ± ± Alaca 31.93± ± ± ** * ** TDYA Beyaz 56.18± ± ±1. - Alaca 45.80±1.97 a 53.43±1.80 b 53.97±1.77 b * ** - - ADYA Beyaz 13.6± ± ± Alaca.6±1.71 a 15.9±1.97 ab 14.19±1.8 b * * - * T+ADYA Beyaz 69.81± ± ± Alaca 68.06± ± ± ** - - ADYA/ DYA Beyaz 0.45± ± ± Alaca 0.69±0.04 a 0.5±0.07 ab 0.44±0.05 b * ** * ** TDYA/ DYA Beyaz 1.86±0.0 a.10±0.11 b.1±0.04 b * Alaca 1.43±0.07 a 1.74±0.07 b 1.68±0.06 ab * * - * T+ADYA/ DYA Beyaz.31± ± ± Alaca.13±0.03.7±0.08.1± n6/ n3 Beyaz 7.0± ± ± Alaca 5.71± ± ± ** ** * BDİ Beyaz.51±0.04 a.84±0.06 b.87±0.05 b *** Alaca.14±0.05 a.49±0.07 b.54±0.09 b ** Aİ Beyaz 0.37± ± ± Alaca 0.37± ± ± Tİ Beyaz 0.45± ± ± Alaca 0.50± ± ± DYA: Doymuş yağ asitlerinin toplamı, TDYA: Tekli doymamış yağ asitlerinin toplamı, ADYA: Aşırı doymamış yağ asitlerinin toplamı, T + ADYA: Doymamış yağ asitlerinin toplamı, n6/ n3: Toplam omega 6 yağ asitlerinin toplam omega 3 yağ asitlerine oranı, Aİ: Aterojenik indeks, Tİ: Trombojenik indeks, BDİ: Besleyici değer indeksi, Aİ= (C1:0 + (4*C14:0) + C18:0)/ T+ADYA, Tİ=(C14:0 + C16:0 + C18:0)/(0.5*C18:1) + (0.5* TDYA) + (0.5* n6) + (3* n3) + ( n3/ n6), BDİ= (C18:0 + C18:1)/C16:0 ark. nın 17 kazlar için, Chartrin ve ark. nın 39 ise ördekler için bildirdiği değerlerden yüksek olmuştur. Yapılan çalışmada kazlar için tespit edilen renk değerlerinin kuzular ve oğlaklar için bildirilen değerler 36-38,40,44 ile benzerlik gösterdiği dikkat çekmektedir. Etin yapısında bulunan proteinler ısıya (70-75 C) maruz kaldıkları zaman denatüre olmakta ve bunun neticesinde de bir miktar su açığa çıkmaktadır 19. Kesimden sonraki 7. saatte pişirme kaybı bakımından varyeteler arasındaki fark önemli bulunmuştur (P<0.05). Bu çalışmada pişirme kaybı bakımından tespit edilen değerler (% arasında) Kırmızıbayrak ve ark. nın 17 kazlar için (% arasında), Yakan ve Ünal ın 36 kuzular için (% arasında) tespit ettiği değerler ile benzer, Fernandez ve ark. nın 5 kazlar için (%19,-0,5 arasında) ve Chartrin ve ark. nın 39 ördekler için (% arasında) tespit ettiği değerlerden yüksek olmuştur. Bu yüksekliğin sebebi pişirme kaybı için kullanılan metodun farklılığı olabilir. Göğüs etinde kesimden 4 saat sonra MDA değeri bakımından varyeteler arasında bir fark olmazken, 7.

141 669 YAKAN, AKSU ELMALI, ELMALI ŞAHİN, MOTOR, CAN saatte tespit edilen değer Beyaz varyetede daha yüksek (P<0.05) olmuştur. MDA değeri lipid oksidasyonuna bağlı olarak arttığı için Beyaz varyetede MDA değerinin yüksek oluşu yağ oranındaki yükseklik ile açıklanabilir. Etin kimyasal kompozisyonu kalitesinin belirlenmesinde diğer önemli bir kriterdir. Yapılan çalışmada kuru madde (%30.05 e karşı 8.08) ve yağ (%4.55 e karşı 4.55) oranları Beyaz kazlarda önemli düzeyde yüksek bulunmuştur (P<0.05). Kuru madde oranındaki yüksekliğin sebebi olarak yağ oranındaki yükseklik düşünülmektedir. Broilerlerde yapılan bazı çalışmalarda 11,41,4 canlı ağırlık artışına bağlı olarak etteki yağ oranında da artış olduğu tespit edilmiştir. Beyaz kazlarda etteki yağ oranının Alaca kazlara göre yüksek olması bu durum ile açıklanabilmektedir. Bu çalışmada tespit edilen protein oranları Isguzar ve Pingel in 15 ve Summers ve ark. nın 43 kazlar için, Beriain ve ark. nın 37 ve Macit ve ark. nın 44 kuzular için tespit ettiği değerler ile benzer olurken, Uğurlu ve ark. nın 41 broilerler için ve Yakan ve Ünal ın 36 kuzular için bildirdiği değerlerden biraz düşük olmuştur. Etteki yağ oranı kazlarda yapılan bazı çalışmalar 39,43,45 ile benzer olurken, bir çalışmadan 15 düşük olmuştur. Etteki yağ oranı bakımından her iki varyetede de tespit edilen değerler broilerlerde bildirilen değerlerden 41,4 yüksek olurken, Alaca kazlarda tespit edilen değer (%3.07) kuzularda tespit edilen değerler 36,44 ile benzer olmuştur. Çalışmada her iki varyetede de vücudun çeşitli yağ kaynaklarından (göğüs eti, deri ve abdominal yağ) elde edilen yağdaki yağ asidi kompozisyonu analiz edilmiştir. Beyaz varyetede C14:0, C18:1, C0: ve C0:4 bakımından, Alaca varyetede ise C18:1, C0:1, C0: ve C0:4 bakımından vücudun yağ kaynakları arasında önemli düzeyde farklılık bulunmuştur (P<0.05, P<0.01, P<0.001). Diğer taraftan Beyaz ve Alaca kazlar arasında göğüs etinde C16:1, C18:0, C18:1 ve C18: bakımından; deride C14:0, C18:1, C18:3 ve C0:4 bakımından; abdominal yağda ise C14:0, C18:0 ve C18:1 bakımından önemli düzeyde farklılık bulunmuştur (P<0.05, P<0.01, P<0.001). Bazı yağ asitleri (C14:0, C16:0, C18:0, C16:1, C18:1 ve C18:) bakımından elde edilen sonuçlar Stevenson un 46 ve Janicki ve ark. nın 0 bildirdiği değerler ile benzer olmuştur. Kalp-damar sağlığı bakımından diyetle ilgili en önemli faktörler olan DYA, TDYA ve ADYA oranlarına bakıldığı zaman Beyaz ve Alaca kazlar arasında önemli farklılık bulunmaktadır (P<0.05, P<0.01). Bu araştırmada tespit edilen DYA, TDYA ve ADYA oranları Stevenson un 46 ve Janicki ve ark. nın 16 bildirdiği değerler ile benzer olmuştur. Göğüs etinde T + ADYA ve BDİ bakımından Beyaz kazların, Alaca kazlara üstün olduğu (P<0.05, P<0.01) görülmektedir. BDİ bazı çalışmalarda 36,47 kuzular için bildirilen değerlerden daha yüksek olmuştur. Aİ ve Tİ bakımından hem varyeteler arasında hem de vücudun farklı bölgelerinden elde edilen yağ kaynakları arasında bir farklılık olmamıştır. Ancak tespit edilen değerlerin 1 in altında olması olumlu olarak kabul edilmektedir. Çalışmada elde edilen DYA oranı (%8.70 ile 3.04 arasında) broilerlerde 7,10 elde edilen değerlerden (%.7 ile 8.85 arasında) biraz yüksek, kuzularda 36,47 ve sığırlarda 48,49 elde edilen değerlerden düşük (kuzularda %46.6 ile arasında, sığırlarda %37.00 ile arasında); TDYA oranı (%45.80 ile arasında) broilerlerde 7,10, kuzularda 36,47 ve sığırlarda 48,49 elde edilen değerlerden (broilerlerde %37.16 ile arasında, kuzularda %37.94 ile arasında, sığırlarda %34.16 ile 4.30 arasında) yüksek; ADYA oranı ise (%10.07 ile.6 arasında) broilerlerde 7,10 elde edilen değerlerden (%5.50 ile 33.3) düşük, kuzularda 36,47 elde edilen değerlerden (%6.61 ile arasında) yüksek, sığırlarda 48,49 elde edilen değerler (%6.93 ile 1.9 arasında) ile benzer olmuştur. Birleşik Krallık Ulusal Arşivi Sağlık Ofisi insanların diyetlerindeki n6/n3 oranının 4 ten fazla olmaması gerektiğini bildirmektedir 50. İlgili değer bu çalışmadaki Beyaz kazlarda arasında olurken, Alaca kazlarda ise arasında olmuştur. Bu değerlerin Ryhanen ve ark. nın 10 broilerler için bildirdiği değerlerden yüksek (4.59 ve 5.07), Yakan ve Ünal 36 ile Caneque ve ark. nın 47 farklı kuzu ırkları için bildirdiği değerler (4.06 ile 1.3 arasında) ile benzer ya da düşük, Raes ve ark. 48 ile Muchenje ve ark. nın 49 çeşitli sığır ırkları için bildirdikleri değerler (1.63 ile 6.70 arasında) ile benzer ya da yüksek bulunmuştur. Çalışmada canlı ağırlık bakımından Beyaz varyete daha yüksek değere sahip olmuştur. Karkastaki göğüs ve kanat gibi arzu edilen parçaların oranları bakımından Alaca varyete daha yüksek, sırt gibi arzu edilmeyen parça bakımından da daha düşük değerlere sahip olmuştur. Et kalitesi özellikleri bakımından Beyaz varyetenin daha parlak, daha kırmızı ve daha yağlı bir ete sahip olduğu tespit edilmiştir. Yağ asidi özellikleri bakımından ADYA oranı dışındaki hemen hemen tüm değerlerin Beyaz varyetede daha iyi değerlere sahip olduğu görülmüştür. Diğer taraftan kaz etinin genel et kalite özellikleri bakımından (ph, su tutma kapasitesi, pişirme kaybı, renk, kuru madde) kuzu etine benzer olduğu, ancak yağ asidi kompozisyonu ve bunlardan elde edilen indeks değerler bakımından kuzu etinden daha iyi değerlere sahip olduğu tespit edilmiştir. Teşekkür Bu çalışmaya verdikleri destekten dolayı Prof. Dr. Ceyhan ÖZBEYAZ ve Prof. Dr. Necmettin ÜNAL a teşekkür ederiz. KAYNAKLAR 1. Yıldız G: Kaz besleme. Yem Magazin Derg, 6, 60-6, Gönül T, Yücelyiğit E, Aksu M, Kapucu A: Kars Kazcılık Üretme İstasyonu İnceleme Raporu. s. 1-15, Ankara, Selçuk E, Akyurt İ, Geliyi C: Kaz yetiştiriciliği. Tarım ve Orman Bakanlığı Ziraat İşleri Genel Müdürlüğü Yayınları. s. 5-7, Ankara, TÜİK: Türkiye İstatistik Kurumu. Erişim tarihi: Doğan K: Kümes hayvanlarının beslenmesi: Kazların bilimsel beslenmesi ve yemleme ilkeleri. Yem Sanayii Derg, 59, 9-35, 1988.

142 670 Halk Elinde Yetiştirilen Beyaz Ulbricht TLV, Southgate DAT: Coronary heart disease: Seven dietary factors. Lancet, 338, , Atasoy F, Yakan A, Uğurlu M, Ünal N, Aksu T, Cengiz S: Kısıtlı protein ile beslenen erkek ve dişi broilerlerde karkas özellikleri, et kalitesi ve bağışıklık düzeyleri. Ankara Üniv Vet Fak Derg, 57 (1): 49-54, Bölükbaşı ŞC: Effect of dietary conjugated linoleic acid (CLA) on broiler performance, serum lipoprotein content, muscle fatty acid composition and meat quality during refrigerated storage. Br Poultry Sci, 47, , Lu L, Ji C, Luo XG, Liu B, YU SX: The effect of supplemental manganese in broiler diets on abdominal fat deposition and meat quality. Anim Feed Sci Technol, 19, 49-59, Ryhanen EL, Perttila S, Tupasela T, Valaja J, Eriksson C, Larkka K: Effect of Camelina sativa expeller cake on performance and meat quality of broilers. J Sci Food Agr, 87, , Suto Z, Horn P, Jensen JF, Sorenson P, Csapo J: Carcass traits, abdominal fat deposition and chemical composition of commercial meat type chicken during twenty week growing period. Arch Geflugelkd, 6 (1): 1-5, Komiyama CM, Mendes AA, Takahashi SE, Moreira J, Garcia RG, Sanfelice C, Borba HS, Leonel FR, Almeida Pa ICL, Balog A: Chicken meat quality as a function of fasting period and water spray. Braz J Poultry Sci, 10 (3): , Berric, Debut M, Sante-Lhoutellier V, Arnould C, Boutten B, Sellier N, Baeaz E, Jehl N, Jego Y, Duclos MJ, Le Bihan-Duval E: Variation in chicken breast meat quality: Implications of struggle and muscle glycogen content at death. Br Poultry Sci, 46 (5): , Debut M, Berri C, Baeza E, Sellier N, Arnould C, Guemene D, Jehl N, Boutten B, Jego Y, Beaumont C, Le Bihan-Duval E: Variation of chicken technological meat quality in relation to genotype and preslaughter stress condition. Poult Sci, 8, , İşgüzar E, Pingel H: Growth, carcass composition and nutrient content of meat of different local geese in Isparta region of Turkey. Arch Tierz Dummerstorf, 46 (1): 71-76, Janicki B, Rosinski A, Elminowska-Wenda G, Bielinski H, Gronek P: Effect of feeding (intensive versus semi-intensive) on yield and fatty acid composition of abdominal fat in White Italian Geese. J Appl Anim Res, 17, 79-84, Kırmızıbayrak T, Önk K, Ekiz B, Yalçıntaş H, Yılmaz A, Yazıcı K, Altınel A: Effects of age and sex on meat quality of Turkish Native Geese raised under a free-range system. Kafkas Univ Vet Fak Derg, 17 (5): , Barton-Gade PA, Demeyer D, Honikel KO, Joseph RL, Puolanne E, Severini M, Smulders F, Tonberg E: Reference methods for water holding capacity in meat and meat products: Procedures recommended by an OECD working group. 39 th International Congress of Meat Science and Technology, Calgary, 1-6 Agu Honikel KO: Reference methods for the assessment of physical characteristics of meat. Meat Sci, 49, , Esterbauer H, Cheeseman CH: Determination of aldehydic lipid peroxidation products: Malonaldehyde and 4-hydroxynonenal. Meth Enzymol, 186, , AOAC: Official Methods of Analysis of Association of Offical Analytical Chemistry International, 17 th ed., Maryland, USA, Çelik B, Bozkurt Z: Slaughter and carcass traits of native geese reared in Muş province. Zootehnie si Biotehnologii, 4 (): 43-48, Kırmızıbayrak T, Önk K, Yazıcı K: Kars ilinde serbest çiftlik koşullarında yetiştirilmiş yerli ırk kazların kesim ve karkas özellikleri üzerine yaş ve cinsiyetin etkisi. Kafkas Univ Vet Fak Derg, 17 (1): 41-45, Tilki M, Yazıcı K, Sarı M, Işık S, Saatçi M: Yerli Türk kazlarında çıkım ayı ve cinsiyetin kesim ve karkas özelliklerine etkisi. Kafkas Univ Vet Fak Derg, 17 (5): , Fernandez X, Lahirigoyen E, Auvergne A, Molette C, Bouillier-Oudot M: The effect of stunning methods on product qualities in force-fed ducks and geese. 1. Carcass downgrading and meat quality. Animal, 4 (1): , Bochno R, Murawska D, Brzostowska U: Age-related changes in the distribution of lean fat with skin and bones in goose carcasses. Poult Sci, 85, , Kırmızıbayrak T: Kars ilinde halk elinde yetiştirilen yerli ırk kazların kesim ve karkas özellikleri. Turk J Vet Anim Sci, 6, , Tilki M, Saatçi M, Kırmızıbayrak T, Aksoy AR: Kars ili Boğazköyde yetiştirilen kazların kesim ve karkas özellikleri. Kafkas Univ Vet Fak Derg, 10 (): , Tilki M, İnal Ş: Türkiye de yetiştirilen değişik orijinli kazların verim özellikleri. III. Kesim ve karkas özellikleri. Turk J Vet Anim Sci, 8, , Tilki M, Saatçi M, Kırmızıbayrak T, Aksoy A: Effect of age on growth and carcass composition of Native Turkish Geese. Arch Geflügelk, 69 (): 77-83, Tilki M, Şahin T, Sarı M, Işık S, Saatçi M: Effect of age and sex on fattening performance and carcass characteristics of native Turkish geese. Kafkas Univ Vet Fak Derg, 15 (): 45-50, Berri C: Breeding and quality of poultry. In, Mead GC (Ed): Poultry Meat Processing and Quality. pp. 1-3, CRC Press, Cambridge, Abdullah AY, Matarneh SK: Broiler performance and the effects of carcass weight, broiler sex and postchill carcass aging duration on breast filet quality characteristics. J Appl Poult Res, 19, 46-58, Bianchi M, Petracci M, Sirri F, Folegatti E, Franchini A, Meluzzi A: The influence of the season and market class of broiler chickens on breast meat quality traits. Poult Sci, 86, , Abdullah YA, Marwan MM, Haitham OM, Sulaiman KM, Majdi AAI: Effects of strain on performance, and age at slaughter and duration of postchilling aging on meat quality traits of broiler. Asian- Aust J Anim Sci, 3 (1): , Yakan A, Ünal N: Meat production traits of a new sheep breed called Bafra in Turkey. Meat quality characteristics of lambs. Trop Anim Health Prod, 4, , Beriain MJ, Horcada A, Purroy A, Lizaso G, Chasco J, Mendizabal JA: Characteristics of Lacha and Rasa Aragonesa lambs slaughtered at three live weights. J Anim Sci, 78, , Ekiz B, Özcan M, Yılmaz A, Tölü C, Savaş T: Carcass measurements and meat quality characteristics of dairy suckling kids compared to an indigenous genotype. Meat Sci, 85, 45-49, Chartrin P, Meteau K, Juin H, Bernadet MD, Guy G, Larzul C, Remington H, Mourot J, Duclos MJ, Baeze E: Effects of intramuscular fat levels on sensory characteristics of duck breast meat. Poult Sci, 85, 914-9, Yılmaz A, Ekiz B, Özcan M, Kaptan C, Hanoğlu H, Yıldırır M: Effect of crossbreeding indigenous hair Goat with Saanen on carcass measurements and meat quality of kids under an intensive production system. Anim Sci J, 80, , Uğurlu M, Atasoy F, Yakan A, Akçay A: Etlik piliçlerde cinsiyet, yaş ve erken dönemde protein kısıtlamasının bazı iç organlar, etin kimyasal kompozisyonu ve ayak lezyonları üzerine etkisi. Lalahan Hay Enst Derg, 51 (1): 1-30, Bogosavljevic-Boskovic S, Pavlovski Z, Petrovic MD, Doskovic V, Rakonjac S: Broiler meat quality: Proteins and lipids of muscle tissue. Afr J Biotech, 9 (54): , Summers JD, Hurnik G, Leeson S: Carcass compositon and protein utilization of embden geese fed varying levels of dietary protein supplemented with lysine and methionine. Can J Anim Sci, 67, , Macit M, Aksakal V, Emsen E, Esenbuga N, Aksu MI: Effects of vitamin E supplementation on fattening performance, non-carcass components and retail cut percentages, and meat quality traits of Awassi lambs. Meat Sci, 64, 1-6, Kociova CV, Horvathova V, Misikova E: The content and composition of lipids in geese of different breeds and crosses. CAB Abst. 93/646, Stevenson MH: Effects of diets of varying energy concentrations on the growth and carcase composition of geese. Br Poultry Sci, 6, , Caneque V, Diaz MT, Alvarez I, Lauzurica S, Perez C, De la Fuente J: The influences of carcass weight and depot on the fatty acid composition of fats of suckling Manchego lambs. Meat Sci, 70, , Raes K, Balcaen A, Dirinck P, De Winne A, Claeys E, Demeyer D, De Smet S: Meat quality, fatty acid composition and flavour analysis in Belgian retail beef. Meat Sci, 65, , Muchenje V, Hugo A, Dzama K, Chimonyo M, Strydom PE, Raats JG: Cholesterol levels and fatty acid profiles of beef from three cattle breeds raised on natural pasture. J Food Comp Anal,, , Department of Health: Nutritional aspects of cardiovascular disease. Report on Health and Social Subjects. No: 46, HMSO, London, 1994.

143 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE The Effects of Ketoprofen and Meloxicam on Bone Healing in Rat Model: A Comparative Dual Energy X-Ray Absorptiometry Study [1] Barış KÜRÜM * Zeynep PEKCAN * Birkan KARSLI * Ali KUMANDAŞ * Ertuğrul ELMA * [1] This research was supported by the Scientific Research Project Coordination Unit of Kırıkkale University * Kırıkkale Üniversitesi Veteriner Fakültesi, Cerrahi Anabilim Dalı, TR Kırıkkale - TÜRKİYE Makale Kodu (Article Code): KVFD Summary Pain control is a common clinical approach in trauma and postoperative care especially complicated orthopedic surgeries to ease the deleterious effects of pain. Various kinds of pain killers have been used, and nowadays nonsteroidal anti-inflammatory drugs (NSAIDs) are among the most commonly used drugs for pain control purposes. Prostaglandin-endoperoxide synthetase, also commonly called cyclooxygenase (COX), is one of the key enzymes in prostaglandin bio-synthesis. The COX enzymes have subgroups of enzymes, each of which suppresses different inflammatory mediators. These enzymes are involved in different functions, some of which are essential for continuity of physiological processes. Thus, NSAIDs are expected not to cause any change of functions of some enzymes while suppressing others. Among the COX enzymes, COX-1 is associated with gastrointestinal system functions and gastrointestinal mucosa while COX- is associated with inflammation and pain. Like most drugs, NSAIDs have known and possible side effects. In various studies related to NSAIDs, inhibitory effects of conventional NSAIDs with non-selective effects and specific COX- inhibitors on bone healing have been reported. In this study, the effects of ketoprofen and meloxicam on bone fracture healing induced in 4 adult male Wistar rats was studied by Dual Energy X-Ray Absorptiometry (DEXA). The results indicates that meloxicam inhibits the fracture healing to some degree. Keywords: Cyclooxygenase inhibitors (COX), Ketoprofen, Meloxicam, Dual energy X-Ray Absorptiometry (DEXA), Bone healing, Rat Ketoprofen ve Meloksikam ın Kemik İyileşmesi Üzerine Etkilerinin Rat Modelinde DEXA Ölçümleri ile Değerlendirilmesi Özet Günümüzde ağrının kontrol edilmesinin gerekliliği net olarak ortaya konulmuştur. Bu amaçla farklı ilaç grupları kullanılmaktadır, şu an için en yaygın kullanılan ilaç gruplarından birisi de steroid olmayan yangı önleyici ilaçlardır (NSAIDs). Prostaglandin-endoperoxide sentetaz ya da daha sık kullanılan adı ile siklooksijenaz enzimleri (COX) prostoglandin sentezinde anahtar rolü olan enzimlerdir. COX enzimleri üç alt grubu olan bir enzim grubudur ve her alt grup farklı yangı mediatörlerini baskılarlar. Bu enzimlerin farklı fonksiyonları vardır ve bazıları fizyolojik fonksiyonların devamı için gereklidir. Dolayısı ile kullanılacak NSAID ilacın kimi enzim gruplarını baskılarken kimi enzim gruplarının fonksiyonlarında değişim oluşturmaması istenir. Bu enzim gruplarından COX-1 olarak isimlendirilenler gastrointestinal sistem fonksiyonları ve mukozası ile, COX- grubu ise yangı ve ağrı ile ilişkilidir. İlaçların çoğu gibi NSAID ilaçların da bilinen yan etkilerine ilaveten olası yan etkileri de vardır. NSAID ilaçlarla ilgili yapılan çeşitli araştırmalarda, hem seçici etkisi olmayan geleneksel NSAID ilaçların hem de spesifik COX- inhibitörü ilaçların kemik iyileşmesi üzerinde inhibe edici etkileri rapor edilmiştir. Bu çalışmada 4 adet, Wistar ırkı, erişkin, erkek rat kullanılarak ketoprofen ve meloksikamın kırık iyileşmesi üzerine olan etkileri klinik gözlemler ve Dual Energy X-Ray Absorptiometry (DEXA) ölçümleri ile ortaya konulmaya çalışılmıştır. Elde edilen veriler meloksikamın kırık iyileşmesini bir ölçüde inhibe edebildiğini göstermektedir. Anahtar sözcükler: Siklooksijenaz inhibitörleri (COX), Ketoprofen, Meloksikam, Dual enerji X ray absorbtiometry (DEXA), Kemik iyileşmesi, Rat İletişim (Correspondence) /33 bkurum74@yahoo.com

144 67 The Effects of Ketoprofen... INTRODUCTION During the last two decades, studies and reports clearly indicated that pain causes physiological abnormalities that have harmful effects on organisms. Once it is understood pain control one of medical priorities in patients, the pain medications as well as their modes of use and related procedures have been under investigation. In past, nonsteroidal anti-inflammatory drugs (NSAIDs), having a moderate analgesic effects, were only used in osteoarthritis. However, the new generation NSAIDs have a wide range of use as the side effects were minimized. As in antiinflammatory agents and pain killers, NSAIDs are commonly used in post operative care of small animals to control inflammation and pain as well as to alleviate pain caused by diseases such as osteoarthritis 1-3. The higher success rate of NSAIDs compared to other narcotic pain killers has been proved through comparative studies conducted in human and animals 4-8. Prostaglandin-endoperoxide synthetase, commonly called cyclooxygenase (COX), is the key in bio synthesis of prostaglandins. Cyclooxygenase represents a group of enzymes. The COX-1 enzymes are associated with gastrointestinal system mucosa and implemented in gastrointestinal functions. On the other hand, the COX- enzymes, defined by Daniel Simmons in 1988, are responsible inflammation and pain After characterization of COX- enzymes, researchers identified another enzyme group in the dog brain and called it COX-3 1. Although the COX- 3 enzymes seemed different than COX-1 and COX-, later they were defined as COX-1 derivatives upon revealing that they are controlled by the same gene 1. The COX-3 enzyme can be inhibited by the drugs with a COX-1 and COX- inhibition effects such as paracetamol 1. Several researchers, who conducted research regarding NSAIDs effects on bone fracture healing using direct or radiological methods, reported that NSAIDs did not cause a quantitative difference in callus formation However, some studies reported some qualitative difference through histological studies. These studies indicated that NSAIDs retards callus maturation 16-18, however, the mechanism of COX- inhibitor effects on bone healing and bone metabolism has not been clearly defined yet. In the mean time, it is known that COX- enzymes have some effects on intramembranous and endochondrial ossification 19 and are required in bone healing 0. In this study, it was aimed to investigate possible inhibitory effects of the NSAID ketoprofen and meloxicam at post-operative doses in bone healing in a rat femur fracture model through bone mineral density (BMD) measurement techniques. MATERIAL and METHODS The animal experiments proceeded upon obtaining an approval from the Kırıkkale University Ethical Council for Animal Experiments (009/13). A total of 4 male Wistar rats (GATA, Turkey) with a mean weight of 96.8 g were randomly allocated into three groups; ketoprofen group (n=8), meloxicam group (n=8), and control/placebo (n=8). The animals were kept in pairs in wire-topped plastic cages in a 1-h light and 1-h dark cycle and fed ad libitum allowing free access to tap water and standard laboratory rodent diet (Ankara Yem/Kırıkkale). For surgery the animals were anesthetized with intraperitoneal administration of a combination of xylazine HCl (Alfazyne 0 mg/ml Egevet, Izmir, Turkey) and ketamine HCl Fig 1. Some steps of the operation procedure Şekil 1. Operasyondan bazı aşamalar

145 673 KÜRÜM, PEKCAN, KARSLI KUMANDAŞ, ELMA (Alfamine 100 mg/ml Egevet, Izmir, Turkey). After shaving the skin and aseptic wash, a 0G1½ (Microlance TM 0.9X40 Nr.1 TW PM) cannula was inserted into the medullary canal through the intercondylar area just medial to the patellar tendon in front of the cruciate ligaments. Then the cannula was removed, a Kirschner wire (0.8 mm) was placed into medullary canal, and then the wire was cut just near the femoral condyle. The femur was subjected to a standardized closed midshaft fracture using a specially designed fracture forceps. Upon collecting the postoperative radiogram of each fracture, the precision of the fracture models was examined. All animals in the ketoprofen (Tobrofin, Provet Veterinary Products Ltd, İstanbul Turkey) group were given 0.5 mg/100 g body weight intraperitoneally twice daily for 1 days, and the first injection was made just prior to surgery. The animals in the meloxicam (Maxicam, Sanovel, İstanbul, Turkey) group were given 0.1 mg/100 g body weight and the animals in the placebo group were given a corresponding volume of saline intraperitoneally. The doses for meloxicam and ketoprofen were calculated using the recommended doses for dogs use. Such doses were proved to be adequate in earlier study 1. To prevent inflammation and ulceration in the gastrointestinal system, 0.1 mg/100 g omeprazol (Losec ampul Astra/ Sweeden) was administered intraperitoneally,3. All animals were euthanized by a thiopental sodyum (Pental 1 g, İ.E Ulagay, İstanbul) overdose 4. Three weeks after surgery, the bone density at the fracture site was measured in separated femurs (after removing the implant in the femur) using a dual energy x-ray absorptiometry (DEXA) machine, (Siemens PIXIMUS, Germany). Small animal (research mod) software was used to determine the bone mineral content (BMC) and bone Fig. Postoperative anterioposterior and mediolateral radiological view of the fracture Şekil. Oluşturulan kırığın AP ve ML radyolojik görünümü Fig 3. DEXA scan results of the one of the case Şekil 3. Olgulardan birinin DEXA tarama sonuçları

146 674 The Effects of Ketoprofen... mineral density (BMD). The stability of the machine was controlled by means of the calibration phantom, which was regularly scanned during the study period. All DEXA scans were performed by the same operator. Each femur was scanned in a craniocaudal direction. The region of interest (ROI) was considered as the entire femur. There were invasive methods in the past to evaluate bone density; however, the current technology provides non-invasive methods based on ultrasonography and gama or X-ray technologies. It is currently feasible to determine BMD and BMC values using non-invasive methods including radiogrametry, single photon absorptiometry, dual photon Fig 4. The graphic of the bone mineral density (BMD) of the groups) Şekil 4. Çalışma gruplarına ait kemik mineral yoğunluk (BMD) ölçümlerine ait grafik RESULTS All animals tolerated the surgery well. Grossly, there was no evidence of infection, and new bone formation was evident in all 4 animals at the time of euthanasia. Data are presented as mean values ± standard deviation (SD). The data were first analyzed for normality and homogeneity of variance. The normality test revealed that the data was normally distributed and the Levene test showed that the variances are homogeneous. The groups were compared using one way analysis of variance (ANOVA) and LSD post hoc test (P<0.05). All analyzes were done by SPSS (SPSS Inc., Chicago, IL) for Windows, version 15. The DEXA measurements performed post-operatively at the 3 rd week indicated that the rats in the meloxicam group, BMD is significantly lower compared to those of the other groups (P=0.03). However, there were no difference between ketoprofen and control groups (P>0.05). DISCUSSION The effects of various generations of NSAIDs on bone metabolism and bone healing have been investigated by researchers for the past half century. As the results of several studies revealed that the conventional nonselective COX inhibitors and selective COX- inhibitors retards bone fracture healing by impeding remodeling and mineralization at healing sites Thus, their use especially in patients with elderly and metabolic disorders related to bone metabolism absorptiometry, dual energy absorptiometry and quantitative computed tomography As study by Paniagua et al. 49 claimed that DEXA scanning is adequate to determine BMD in rats and the data generated were reliable and reproducible while radiogrametry, SPA, DPA and QCT were more precise techniques. In the present study, we investigated the effects of two different generations of NSAIDs on bone mineral density, and thus, bone healing rate in a rat model of femur fracture. The results indicated that meloxicam, a more COX- selective inhibitor, have an inhibitory effects on BMD; however, such data should be further confirmed by biomechanical tests. Although a relationship between BMD and callus strength has been suggested, the value of biomechanical test for callus strength is indispensable 50. The reason for use of ketoprofen and meloxicam in our study is that these drugs are commonly used in veterinary practice as well as the fact that ketoprofen is an inhibitor of COX-1 and COX- while meloxicam is a more COX- selective inhibitor. In a study conducted in dogs revealed that there was no difference between for ketoprofen and meloxicam for alleviation of pain and blood coagulation rate 51. Thus, these two drugs can be considered as alternatives to each other. Upon testing various COX- inhibitors, Simon et al. 5 and Leonelli et al. 53 reported that COX- inhibitors retard bone fracture healing. The most frequently studied NSAIDs with claimed effects include the selective COX- inhibitor celecoxib and rafecoxib as well as the non-selective NSAID ibuprofen, ketorolac, and indomethasin.

147 675 KÜRÜM, PEKCAN, KARSLI KUMANDAŞ, ELMA In a study by Dimmen et al. 18, rats receiving parecoxib at doses equivalent to perioperative doses in human for a week had lower BMD at the fracture line 18. In the same study, the difference in BMD between placebo and parecoxib receiving rats were reduced at the end of the 6 th week; however, the bone resistance measured biomechanically was still weaker in parecoxib receiving rats compared to placebo receiving rats. Beck et al. 54 evaluated the bone fracture healing in rats based on BMD parameter, diklofenac and tramadol, which are conventional NSAIDs, and concluded that the degree of bone healing inhibition was higher in diclofenac receiving rats compared to control and tramadol receiving rats. In the same study, the BMD value was calculated from CT measurements following removal of the intramedullar pin in euthanized animals, not based on DEXA scanning. In conclusion, ketoprofen does not inhibit bone fracture healing and bone mineralization based on the DEXA scanning data indicating no difference between the ketoprofen receiving and control rats. On the other hand, meloxicam considerably inhibit bone fracture healing and bone mineralization based on the data indicating a significant difference between the meloxicam receiving rats and the others. These results support the notion suggesting there is direct relationship between COX- enzymes and bone fracture healing and mineralization. However, as indicated earlier biomechanical tests should also be conducted to reveal clinical inhibition. REFERENCES 1. Mathews KA: Nonsteroidal anti-inflammatory analgesics in pain management in dogs and cats. Can Vet J, 37 (9): , Brock N: Treating moderate and severe pain in small animals. Can Vet J, 36 (10): , Lees P, May SA, McKellar QA: Pharmacology and therapeutics of non-steroidal antiinflammatory drugs in the dog and cat. First general pharmacology. J Small Anim Pract, 3, , Dahl V, Dybvik T, Steen T, Aune AK, Rosenlund EK, Raeder JC: Ibuprofen vs. acetaminophen vs. ibuprofen and acetaminophen after arthroscopically assisted anterior cruciate ligament reconstruction. Eur J Anaesthesiol 1, , Dahl V, Raeder JC, Drosdal S, Wathne O, Brynildsrud J: Prophylactic oral ibuprofen or ibuprofen-codeine versus placebo for postoperative pain after primary hip arthroplasty. Acta Anaesthesiol Scand, 39, 33-36, Fogarty DJ, O Hanlon JJ, Milligan KR: Intramuscular ketorolac following total hip replacement with spinal anaesthesia and intrathecal morphine. Acta Anaesthesiol Scand 39, McLoughlin C, McKinney MS, Fee JP, Boules Z: Diclofenac for daycare arthroscopy surgery: comparison with a standard opioid therapy. Br J Anaesth 65, 60-63, O Hara DA, Fragen RJ, Kinzer M, Pemberton D: Ketorolac tromethamine as compared with morphine sulfate for treatment of postoperative pain. Clin Pharmacol Ther, 41, , Xie WL, Chipman JG, Robertson DL, Erikson RL, Simmons DL: Expression of a mitogen-responsive gene encoding prostaglandin synthase is regulated by mrna splicing. Proc Natl Acad Sci USA, 88 (7): Dubois RN, Abramson SB, Crofford L, Gupta RA, Simon LS, Van De Putte LB, Lipsky PE: Cyclooxygenase in biology and disease. Faseb J, 1, , Seibert K, Zhang Y, Leahy K, Hauser S, Masferrer J, Perkins W, Lee L, Isakson P: Pharmacological and biochemical demonstration of the role of cyclooxygenase in inflammation and pain. Proc Natl Acad Sci USA, 91, , Chandrasekharan NV, Dai H, Roos KL, Evanson NK, Tomsik J, Elton TS, Simmons DL: COX-3, a cyclooxygenase-1 variant inhibited by acetaminophen and other analgesic/antipyretic drugs. Proc Natl Acad Sci USA 99, , Hall FM, Davis MA, Baran DT: Bone mineral screening for osteoporosis. N Engl J Med, 316 (4): 1-14, Griffin MG, Kimble R, Hopper W, Pacifici R: Dual energy X-ray absorbsiometry of the rat: Accuracy precision and measurement of bone loss. J Bone Miner Res, 7, , Sievanen H, Kannus P, Jarvinen M: Precision of measurement by dual energy x-ray absorbsiometer of bone mineral density and content in rat hindlimb in vitro. J Bone Miner Res 4, , Aspenberg P: Avoid COX inhibitors after skeletal surgery. Acta Orthop Scand. 73, , Bergenstock M, Min W, Simon AM, Sabatino C, O Connor JP: A comparison between the effects of acetaminophen and celecoxib on bone fracture healing in rats. J Orthop Trauma 19, , Dimmen S, Nordsletten L, Engebretsen L, Steen H, Madsen JE: Negative effect of parecoxib on bone mineral during fracture healing in rats. Acta Orthop, 79, , Zhang X, Schwarz EM, Young DA, Puzas JE, Rosier RN, O Keefe RJ: Cyclooxygenase- regulates mesenchymal cell differentiation into the osteoblast lineage and is critically involved in bone repair. J Clin Invest 109, , Simon AM, Manigrasso MB, O Connor JP: Cyclo-oxygenase function is essential for bone fracture healing. J Bone Miner Res, 17, , Altman RD, Latta LL, Keer R, Renfree K, Hornicek FJ, Banovac K: Effect of nonsteroidal antiinflammatory drugs on fracture healing: A laboratory study in rats. J Orthop Trauma, 9, , Flecknell PA: Analgesia of small mammals. Vet Clin North Am: Exot Anim Pract, 4 (1): 47-56, Karasu Z: Stres ülseri ve tedavisi. Ege Tıp Dergisi, 40 (): Pekcan Z: Deney hayvanlarında anestezi, analjezi ve ötenazi yöntemleri. In, Bilgiç H, Karadağ M (Eds): Gögüs Hastalıklarında in-vivo ve in-vitro Araştırma Yöntemleri. pp , AVES Yayıncılık. Fındıkzade İstanbul, Allen HL, Wase A, Bear W: Indomethacin and aspirin: effect of nonsteroidal anti-inflammatory agents on the rate of fracture repair in the rat. Acta Orthop Scand, 51, , Altman RD, Latta LL, Keer R, Renfree K, Hornicek FJ, Banovac K: Effect of nonsteroidal antiinflammatory drugs on fracture healing: A laboratory study in rats. J Orthop Trauma, 9, , Engesaeter LB, Sudmann B, Sudmann E: Fracture healing in rats inhibited by locally administered indomethacin. Acta Orthop Scand, 63, , Hogevold HE, Grogaard B, Reikeras O: Effects of short-term treatment with corticosteroids and indomethacin on bone healing. A mechanical study of osteotomies in rats. Acta Orthop Scand, 63, , Keller J, Bunger C, Andreassen TT, Bak B, Lucht U: Bone repair inhibited by indomethacin. Effects on bone metabolism and strength of rabbit osteotomies. Acta Orthop Scand, 58, , Reikeraas O, Engebretsen L: Effects of ketoralac tromethamine and indomethacin on primary and secondary bone healing. An experimental study in rats. Arch Orthop Trauma Surg, 118, 50-5, 1998.

148 676 The Effects of Ketoprofen RØ J, Sudmann E, Marton PF: Effect of indomethacin on fracture healing in rats. Acta Orthop Scand, 47, , Sudmann E, Dregelid E, Bessesen A, Morland J: Inhibition of fracture healing by indomethacin in rats. Eur J Clin Invest, 9, , Leonelli SM. Goldberg BA. Safanda J. Bagwe MR, Sethuratnam S. King SJ: Effects of a cyclooxygenase- inhibitor (rofecoxib) on bone healing. Am J Orthop, 35, 79-84, Obeid G, Zhang X,Wang X: Effect of ibuprofen on the healing and remodeling of bone and articular cartilage in the rabbit temporomandibular joint. J Oral Maxillofac Surg, 50, , Lindholm TS, Tornkvist H: Inhibitory effect on bone formation and calcification exerted by the anti-inflammatory drug ibuprofen. Scand J Rheumatol, 10, Keller J, Bünger C, AndreassenTT, Bak B, Lucht U: Bone repair inhibited by indomethacin: effects on bone metabolism and strength of rabbit osteotomies. Acta Orthop Scand, 58, , Reuben SS: Considerations in the use of COX- inhibitors in spinal fusion surgery. Anesth Analg, 93, , Reuben SS: Effect of nonsteroidal anti-inflammatory drugs on osteogenesis and spinal fusion. Reg Anesth Pain Med, 6, , Adolphson P, Abbaszadegan H, Jonsson H, Dalén N, Sjöberg HE, Kalén S: No effects of piroxicam on osteopenia and recovery after Colles fracture. Arch Orthop Trauma Surg, 11, , Markel MD, Chao EY: Noninvasive monitoring techniques for quantitative description of callus mineral content and mechanical properties. Clin Orthop, 93, 37-45, Markel MD, Wikenhiser MA, Morin RL, Lewallen DG, Chao EYS: The determination of bone fracture properties by dual-energy x-ray absorptiometry and single-photon absorptiometry: a comparative study. Calcif Tissue Int, 48, , Aro HT, Wipperman BW, Hodgson SF, Wahner HW, Lewallen DG, Chao EYS: Prediction of properties of fracture callus by measurement of mineral density using micro-bone densitometry. J Bone Joint Surg, 71A, 100, Cohen B, Rushton N: A comparative study of periprosthetic bone mineral density measurement using two different dual-energy x-ray absorptiometry systems. Br J Radiol, 67, , Eyres KS, Bell MJ, Kanis JA: New bone formation during leg lengthening evaluated by dual energy X-ray absorptiometry. J Bone Joint Surg [Br], 75B, , Eyres KS, Kanis JA: Bone loss after tibial fracture evaluated by dual energy X-ray absorptiometry. J Bone Joint Surg [Br], 77B, Hagiwara S, Lane N, Engelke K, Sebastian A, Kimmel DB, Genant HK: Precision and accuracy for rat whole body and femur bone mineral determination with dual X-ray absorptiometry. Bone and Mineral,, Janes GC, Collopy DM, Price R, Sikorski JM: Bone density after rigid plate fixation of tibial fractures. A dual-energy x-ray absorptiometry study. J Bone Joint Surg [Br] 75B, , Lu PW, Briody JN, Howman-Giles R, Trube A, Cowell C: DXA for bone density measurement in small rats weighing g. Bone 15, 199-0, Gala Paniagua J, Díaz-Curiel M, de la Piedra GC, Castilla Reparaz C, Torralbo García M: Bone mass assessment in rats by dual energy X-ray absorptiometry. Br J Radiol, 71-(847): , Powell ES, Lawford PV, Duckworth T, Black MM: Is callus calcium content an indicator of the mechanical strength of healing fractures: An experimental study in rat metatarsals. J Biomed Eng, 11, 77-81, Deneuche AJ, Dufayet C, Goby L, Fayolle P, Desbois C: Analgesic Comparison of Meloxicam or Ketoprofen for Orthopedic Surgery in Dogs. Vet Surgery, 33, , Simon AM, Sabatino C, O Connor JP: Effects of cyclooxygenase- inhibitors on fracture healing. Presented in; Orthopaedic Research Society, 47 th Annual Meeting, Session 35, Fracture Repair I, San Francisco, California, February Leonelli S, Goldberg B, Safanda J, Bagwe M, Sethuratnam, S King, S: The effect of cyclooxygenase (COX-) inhibitors on bone healing. Paper presented at the 48th annual meeting of the Orthopaedic Research Society, Dallas, TX, February, Beck A, Salem K, Krischak G, Kinzl L, Bischoff M, Schmelz A: Nonsteroidal anti-inflammatory drugs (NSAIDDs) in the perioperative phase in traumatology and orthopedics effects on bone healing. Oper Orthop Traumatol, 17, , 005.

149 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE Yetiştirici Elinde Bulunan Norduz Koyunlarının Laktasyon Süt Verimi ve Laktasyon Eğrisine Etki Eden Faktörler Seyrani KONCAGÜL * İrfan DAŞKIRAN ** Mehmet BİNGÖL *** * Harran Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR-6300 Şanlıurfa - TÜRKİYE ** Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü, TR Yenimahalle, Ankara - TÜRKİYE *** Yüzüncü Yıl Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR Van - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Bu çalışmada, Norduz ırkı koyunlara ait laktasyon eğrilerinin tanımlanmasında kullanılan modeller karşılaştırılmış ve laktasyon eğrisini en iyi tanımlayan model kullanılarak laktasyon eğrisi parametreleri tahmin edilmiştir. Daha sonra, bu pametrelere ve laktasyon süt verimine etki eden faktörler araştırılmıştır. Analizlerde, 189 tamamlanmış laktasyona ait toplam.366 denetim günü verim kaydı kullanılmıştır. Laktasyon eğrisinin doğumdan itibaren önce bir azalma bunu takiben laktasyon ortasına doğru bir artış ve daha sonra tekrar azalma gösteren sinüzoidal bir şekil gösterdiği gözlenmiştir. Dördüncü dereceden Legendre polinomiyal (LEG4) model, halk elinde yetiştiriciliği yapılan Norduz koyunlarının laktasyon eğrisini tanımlamakta en yaygın olarak kullanılan matematiksel modellerden daha iyi bir performans göstermiştir. 180-gün laktasyon süresine göre standardize edilmiş toplam süt verimi 130.9±3.4 kg olarak tespit edilmiştir. Laktasyon sırası, kuzulama yaşı ve kuzulama ayı laktasyon süt verimi üzerinde önemli etkiye sahip olup, kuzulama ayı ve laktasyon sırasının laktasyon eğrisinin şekli üzerinde de önemli etkiye sahip olduğu tespit edilmiştir. Anahtar sözcükler: Laktasyon, Norduz koyunu, Legendre polinomyaller Factors Affecting Lactation Milk Yield and Lactation Curve of Norduz Sheep in Farmer Condition Summary In this research, mathematical models describing lactation curve of Norduz sheep breed were compared, and lactation parameters were estimated by selected model describing the lactation curve better than others. Then, factors affecting the lactation parameters and lactation milk yield were investigated. In the analysis, a total of.366 test-day records belonging to 189 completed lactations were used. It was observed that the lactation curve showed a decrease after lambing followed by an increase towards to the middle of the lactation, and then a decrease afterwards, like a sinusoidal shape. The forth degree Legendre polynomial model (LEG4), comparing to other models used, showed the best performance in describing the lactation curve of Norduz sheep raised in farmer condition. Total lactation milk yield, corrected to 180-day lactation lenght, was 130.9±3.4 kg. It was found that parity, lambing age and lambing month have a significant effect on lactation milk yield (LSV), and lambing month and parity also have a significant effect on lactation trajectory. Keywords: Lactation, Norduz sheep, Legendre polynomials GİRİŞ Laktasyon eğrilerinin bilinmesi hem uygun bir ıslah programı 1, hazırlamak için hem de uygun bir sürü yönetim ve üretim planlaması yapabilmek için de önemli bilgiler sağlar 3,4. Laktasyon eğrilerini tanımlamakta kullanılan matematiksel modeller bir taraftan tamamlanmamış laktasyonlarda toplam süt verimini tahmin etmek için kullanılırken, diğer taraftan çevre ve sürü yönetim faktörleri bakımından da modelleme çalışmalarında kullanılırlar 5. Wood-model 6 bu hususta en iyi bilinen model olmasına rağmen, daha sonraki araştırmalarda özellikle süt sığırlarının laktasyon seyrini tanımlamakta kullanılan birçok değişik model önerilmiş ve araştırmalarda kullanılmıştır 5,7-19. İletişim (Correspondence) m_seyrani_n@yahoo.com

150 678 Yetiştirici Elinde Bulunan... Bu modellerin çoğu keçi,0,1 ve koyunların 13,-6 laktasyon eğrilerini tanımlamak için de kullanılmıştır. Ancak, koyunların laktasyon eğrilerinin tanımlanmasında sıklıkla Woodmodel inden yararlanılmıştır 3,7,8. Süt verimi ve laktasyon eğrisine etki eden çevre faktörleri ve etkilerinin belirlenmesi amacıyla koyunlar üzerinde bir dizi çalışmalar yapılmıştır. Bu çalışmalarda özellikle ırk, kuzulama yılı ve sezonu, laktasyon sırası, ilk laktasyona başlama yaşı, verim seviyesi, kuzulamadan önceki ve sonraki dönemde besleme ve doğum tipi gibi faktörlerin laktasyon eğrisine ve toplam süt verimine etki ettikleri bildirilmiştir 1,9-35. Norduz koyunlarının laktasyon süt verimine etki eden faktörlerin belirlenmesine yönelik çalışmalar sınırlıdır 36,37. Araştırıcılar, Norduz koyunları üzerinde yaptıkları çalışmalarda, laktasyon süresi ve laktasyon süt verimi üzerine yaş, doğum tipi ve vücut ağırlığının önemli etki ettiğini, günlük süt verimi üzerine ise yas ve doğum tipinin etki ettiğini bildirmiş olup, laktasyon süresi ve laktasyon süt verimi bakımından Türkiye de yetiştirilen diğer yerli ırklardan daha iyi performans gösterdiğini ve etkili bir seleksiyon programıyla bu ırkın ıslah edilebileceğini bildirmiştir. Bu çalışma, Norduz koyunlarında laktasyon eğrisini tanımlayan ve laktasyon eğrisi parametrelerine etki eden faktörleri inceleyen ilk çalışma olması bakımından önem arz etmektedir. Bu çalışmanın amaçları: 1) Norduz koyunlarında laktasyon eğrisini tanımlayan en iyi modelin belirlenmesi ve ) Belirlenen model kullanılarak laktasyonun tanımlanması ve laktasyon eğrisi parametrelerine ve laktasyon süt verimine etki eden faktörlerin incelenmesidir. MATERYAL ve METOT Veri Norduz koyunları Doğu Anadolu Bölgesi nin yerli koyun ırkıdır ve yöredeki 3 köyde meraya dayalı yetiştiriciliği yapılmaktadır. Veriler, Van ili Gürpınar ilçesine bağlı Norduz yöresinde yetiştirici elinde bulunan Norduz ırkı koyunlardan toplanmıştır. 189 koyunun tamamlanmış laktasyonuna ait toplam.366 denetim günü verisi analiz edilmiştir: her koyundan her 14 günde bir olmak üzere laktasyon süresince toplam 14 süt denetimi verisi toplanmıştır. Analize dahil edilen tüm laktasyonlar en az 5 denetim günü verisine ve ilk denetim günü kuzulamadan sonraki iki hafta içerisinde toplanmış olma özelliğine sahip olup bu özellikleri taşımayanlar analiz dışı bırakılmışlardır. Verim kontrolleri ilk test günü sağımı yapıldıktan sonra her iki haftada bir tekrarlanmıştır. Böylece laktasyon eğrisini daha iyi tanımlama olanağına sahip olunmuştur. Denetim günü süt verimleri bir gün akşam diğer dün sabah sağımı esasına göre alınmış ve sabah-akşam sağılan süt miktarları toplanarak denetim günü verimi (kg) olarak kaydedilmiştir. Veri Analizi Laktasyon eğrilerini tamınlamakta kullanılan modeller bakımından literatür taraması yapılmış ve en yaygın olarak kullanılan modeller seçilmiştir. Bunun yanında, son zamanlarda süt sığırlarının laktasyon eğrilerinin tanımlanmasında kullanılmaya başlanılan Legendre polinomiyaller de koyunların laktasyon eğrilerini tanımlamakta kullanılabilme olanaklarını araştırmak için analiz modellerine dahil edilmiştir. Verilerin analizinde kullanılan modeller: MG Modeli 5 : LMG Modeli 5 : Nel Modeli 14 : Wood Modeli 6 : LWood Modeli 6 : CLD Modeli 9 : Burada, y t kuzulamadan sonraki t. gündeki denetim günü süt verimini, a, b, c, d model parametrelerini, t kuzulamadan sonraki t. günü, t 1 ise t 1 olarak ifade etmektedir. = (t laktasyon uzun / ) /100 Legendre polinomiyal (LEG): Süt sığırlarının laktasyon eğrilerini tanımlamak için kulanılmıştır 38. Bu model şöyle tanımlanmaktadır: n i 1 yt = = αiφ(t) y t e log( y y y t t (abt ct d 1 1 t ) burada, t: -1 ve +1 arasında bir değer alır (Eşitlik 1), tg min ve tg max sırasıyla ilk ve son denetim günlerini 38,39, ф(t) ifadesi ise normalize edilmiş polinomiyali belirtir (Eşitlik ). P n (t) ise polinomialin n. derecesini göstermektedir (Eşitlik ), tg tg min n 1 t 1 [1] [] tg max tg ( t) Pn (t) min çalışmada kullanılan ikinci (LEG), üçüncü (LEG3) ve dördüncü (LEG4) derece legendre polinomiyaller aşağıda verildiği gibidir 39, Araştırmada süt verilerinin analizinde SAS 40 paket programındaki PROC NLIN süreci kullanılmıştır. Modellerin karşılaştırılmasında ölçüt olarak, kalıntı ortalamaları (KO), belirleme katsayısı (R ), ve gözlenen ve tahmin edilen laktasyon eğrisi arasındaki korrelasyon katsayısı (r) kullanılmıştır. t ) a bt t a b at bt ct e cn 1 ct 1 d t log( y t ) log(a) b log(t) ct y t a bt ae ct P (t) (3t 1) P3 (t) (5t 3t) 1 4 P4 (t) (35t 30t 3) 8

151 679 KONCAGÜL DAŞKIRAN, BİNGÖL Laktasyon eğrisini tanımlayan en iyi model belirlendikten sonra, model parametreleri kullanılarak tahmini laktasyon süt verimleri (TLSV) hesaplanmıştır. Tahminleri elde etmek için, günlük ve toplam laktasyon süt verimleri koyun başına hesaplanmıştır. Belirlenen modelin parametreleri kullanılarak elde edilen tahmini laktasyon süt verimi (TLSV), Fleischmann 41 metodu adı verilen yöntemle hesaplanan laktasyon süt verimi (LSV) ile karşılaştırılmıştır. Fleischmann metodunun genel ifadesi şöyledir: n Si Si1 LSV S1 x A1 xai Sn1 x15 i burada, LSV, toplam laktasyon süt verimi; A 1, kuzulama ile ilk süt denetim sağımı arasındaki gün sayısı; A i, i inci denetim sağımı ile i+1 inci denetim sağımı arasındaki gün sayısı; S i, i inci denetim sağımındaki süt miktarı; ve 15 ise, son denetim süt sağımından laktasyonun sonuna kadar geçtiği varsayılan gün sayısı. LSV ve TLSV elde edildikten sonra, bu değerler 180 gün laktasyon süresi esas alınarak standardizasyon yapılmıştır. Belirlenen modele ait parametreler ve 180 güne göre standardize edilmiş LSV ve TLSV arasındaki korelasyon katsayıları da SAS PROC CORR süreci kullanılarak hesaplanmıştır. Belirlenen modelden elde edilen parametrelere ve laktasyon süt verimine (LSV) etki eden faktörlerin (çevresel ve sürü yönetimi bakımından) belirlenmesi amacıyla, aşağıdaki doğrusal model kullanılarak SAS PROC GLM yöntemiyle analiz edilmiştir: Y ijklm KA LS DT i j ijklm burada, Y ijklm = TLSV, LSV ve model parametrelerini; m, analiz edilen özellik bakımından genel ortalamayı; KA i, i inci kuzulama ayının; LS j, j inci laktasyon sırasının; DT k, ise k ıncı doğum tipinin etkisini; YAS l, l inci yaşın etkisini; e ijklm ise hatayı temsil etmektedirler. Modeldeki çevre faktörlerinin seviyeleri arasındaki karşılaştırmalar ise SAS PROC GLM sürecindeki MEANS/LSD seçeneği kullanılarak gerçekleştirilmiştir. k YAS e l BULGULAR Model Seçimi Modellerin, laktasyon eğrilerine uyum istatistikleri Tablo 1 de verilmektedir. Kalıntı Ortalamaları (KO) bakımından en kötü performansı Nelder ve Wood modelleri göstermiş, buna karşılık diğer bütün modellerden elde edilen KO lar 0 dan farksız bulunmuştur. Belirleme katsayısı (R ) bakımından, en iyi performansı Legendre polinomialler (LEG) göstermiştir, bunlar arasında 0.96 ile LEG4 en yüksek R değerini alırken, bunu sırasıyla 0.94 ve 0.9 ile LEG3 ve LEG izlemişlerdir. Diğer modellerden elde edilen R değerleri 0.90 ın altında kalmışlardır. Aynı durum, gözlenen ve tahmin edilen laktasyon eğrisi arasındaki korelasyon (r) katsayısı bakımından da gözlemlenmiştir. En yüksek r değerini 0.74 ile LEG4 alırken, bunu sırasıyla 0.66 ve 0.60 ile LEG3 ve LEG izlemişlerdir. Diğer modellerden elde edilen değerler çok daha düşük olarak bulunmuştur. KO, R ve r parametreleri birlikte değerlendirildiğinde, bu araştırmada kullanılan Norduz koyunlarının laktasyon eğrilerini en iyi tanımlayan modelin LEG4 modeli olduğu belirlenmiştir. Bundan dolayı, bu makalenin geri kalan kısmında LEG4 modelinin parametreleri kullanılarak laktasyon eğrisinin özellikleri tanımlanacak, laktasyon eğrisi ve laktasyon süt verimine etki eden faktörlerin belirlenmesine yer verilecektir. Model Parametrelerinin Anlamı Model parametreleri ve standart hataları ile model parametreleri arasındaki korelasyonlar Tablo de verilmektedir. A parametresi, standardize edilmiş zamanının 0 olduğu zamanki süt verimini ifade etmektedir. Standardize edilmiş zamanın 1 ile +1 arasında değişmesinden dolayı, zamanın 0 olduğu an laktasyonun tam ortasıdır. Dolayısıyla, A parametresi, laktasyonun tam ortasındaki tahmini süt verimini (kg) göstermektedir. b ve c parametreleri, laktasyonun ortasına kadar süt verim eğrisinde meydana gelen iniş ve çıkışı, d ve q parametreleri ise laktasyonun ortasından Tablo 1. Norduz koyunlarının laktasyon eğrilerini tanımlamakta kullanılan modelleri karşılaştırma istatistikleri Table 1. Comparison criteria of models used for describing lactation curves of Norduz sheep Model KO R r MG 0.00± ± ±0.011 DMG 0.00± ± ±0.011 Nelder ± ± ±0.09 Wood ± ± ±0.005 LWood 0.00± ± ±0.01 CLD 0.00± ± ±0.01 LEG 0.00± ± ±0.004 LEG3 0.00± ± ±0.004 LEG4 0.00± ± ±0.007 KO: kalıntı ortalaması, R : belirleme katsayısı, r: gözlenen ve tahmin edilen laktasyon eğrisi arasındaki korelasyon katsayısı, MG: Morant and Gnanasakthy model, LGM: doğrusallaştırılmış Morant and Gnanasakthy model, Nelder: Nelder modeli, Wood: Wood modeli, LWood: doğrusallaştırılmış Wood modeli, LEG: ikinci dereceden legendre polynomial model, LEG3: üçüncü dereceden legendre polynomial model, LEG4: dördüncü dereceden legendre polynomial model

152 680 Yetiştirici Elinde Bulunan... Tablo. Dördüncü dereceden legendre polynomial fonksiyona ait model parametreleri(±sh), LSV ortalamaları (±SH) (kg), model parametreleri, gerçek ve tahmini laktasyon süt verimleri arasındaki korelasyon katsayıları Table. Model parameters of the fourth degree Legendre polynomial function (±SE), mean LSV (±SE), correlation coefficient among model parameters, real and estimated lactation milk yields Laktasyon N A b c d q LSV ±0.058 a 0.01± ± ± ± ±3.7 a ±0.041 a -0.1± ± ± ± ±.6 ab ±0.076 b -0.0± ± ± ± ±.6 bc 3< ±0.085 b -0.1± ± ± ± ±4.31 c Kuzulama Ayı Şubat ±0.07 a -0.05± ± ±0.015 a 0.14±0.008 a 17.4±1.57 a Mart ±0.111 b -0.06± ± ±0.056 b 0.08±0.017 b 139.6±3.00 b Nisan 7 1.±0.183 ab -0.8± ± ±0.04 ab -0.06±0.053 c 145.8±9.95 ab Kuzulama Yaşı ±0.063 a 0.01± ± ± ± ±3.41 a ±0.040 ab -0.11± ± ± ± ±.9 b ±0.075 b -0.03± ± ± ± ±.4 c 4< 0 1.8±0.079 b -0.1± ± ± ± ±4.03 c Doğum Tipi Tekiz ± ± ± ± ± ±1.45 İkiz ± ± ± ± ± ±5.04 Genel ± ± ± ± ± ±3.4 Korelasyonlar A B C D Q TLSV A, B, C, D, Q: dördüncü dereceden legendre polinomiyal model parametreleri, LSV: 180-gün e gore standardize edilmiş laktasyon süt verimi, TLSV: model parametreleri kullanılarak tahmin edilen laktasyon süt verimi sonraki süt verim eğrisinde meydana gelen iniş ve çıkışı ifade etmektedirler (Şekil 1). Parametreler Arasındaki İlişkiler Model parametreleri arasındaki korelasyonlar Tablo de verilmiştir. Parametreler arasındaki korelasyonlar oldukça yüksek bulunmuş, en yüksek korelasyon b ve c parametresi arasında (r=0.89) olup bunu sırasıyla c-d ve b-d arasındaki korelasyonlar izlemiştir. LSV ve TLSV arasındaki ilişki (r=0.99) Tablo de verilmektedir. Fleischmann metodu kullanılarak LSV hesabı doğrusal interpolasyonu esas aldığından, test günleri arasındaki uzaklık arttıkça iki test günü arasında hesaplanan toplam süt miktarı ile gerçek süt miktarı arasındaki farklılık artacak, sonuç olarak hatalı tahminde bulunma ihtimali de yükselecektir. Ancak, bu araştırmada iki test günü arası uzaklık 14 gün gibi kısa aralıklar olduğundan, LSV gerçeğe çok yakın olarak hesaplanabilmiştir. Şekil 1. Norduz koyunlarının laktasyon eğrisi Fig 1. Lactation curve of Norduz sheep

153 681 KONCAGÜL DAŞKIRAN, BİNGÖL Çevre Faktörlerinin Etkileri Laktasyon süt verimi (LSV) üzerine etki eden faktörler bakımından ortalamalar ve standart hatalar Tablo de verilmektedir. Bu çalışmada göz önünde bulundurulan faktörlerden hemen hepsi çeşitli derecelerde model parametreleri ve LSV üzerinde önemli etkide bulunmuşlardır. Çevre faktörlerinin etkilerinin hesap edilmesi için kullanılan model LSV de gözlenen varyasyonun %51. sini açıklamıştır. LSV bakımından, ardışık laktasyonlar (1-, -3 ve 3-4) bir- birinden farklı bulunmazken, bir diğer (1-3 ve -4) laktasyonlar arası farklılık önemli bulunmuştur (P<0.05). Bu çalışmada kuzulama ile ilk süt kontrol zamanı arasında geçen süre modele dahil edilmemiştir çünkü doğumların başlamasından sonra iki hafta içerisinde süt denetimlerine başlanmış ve her iki haftada (14 gün) bir denetimler tekrar edilmiştir. Kuzulama ayı bakımından, LSV Nisan ayında kuzulayan koyunlar için en yüksek değeri alırken Şekil. Norduz koyunlarının kuzulama ayına göre laktasyon eğrisi Fig. Lactation curve of Norduz sheep by month of lambing Şekil 3. Norduz koyunlarının laktasyon sırasına göre laktasyon eğrisi Fig 3. Lactation curve of Norduz sheep by parity

154 68 Yetiştirici Elinde Bulunan... bunu sırasıyla Mart ve Şubat ayında kuzulayanlar takip etmiştir. Mart ayında kuzulayanlar Şubat ayında kuzulayanlardan daha yüksek (P<0.05) LSV verimine sahip olurken, Nisan ayında kuzulayanlarla benzer LSV verimine sahip olmuşlardır. Şubat ve Nisan aylarında kuzulayanlar arasında LSV bakımından önemli bir farklılık tespit edilememiştir. Nisan ayında kuzulayan koyunların LSV bakımından diğer aylarda kuzulayanlardan istatistiksel olarak farklı olmamasının sebebi, Nisan ayında kuzulayanların LSV ortalamasının çok yüksek standart hataya (LSV=145.8±9.95) sahip olmasına bağlanmaktadır. LSV bakımından kuzulama yaşı seviyeleri arasında önemli farklılık bulunmuştur (P<0.05) (Tablo ). En yüksek LSV, 5 ve daha yaşlı koyunlarda gözlenirken bunu sırasıyla 4, 3 ve yaşlı koyunlar almıştır. Kuzulama yaşının artışına (, 3 ve 4 yaş) bağlı olarak LSV deki artışlar önemli (P<0.05) bulunurken, LSV de 4 yaşından sonraki artış önemli bulunmamıştır. Doğum tipinin LSV ye herhangi bir etkisi tespit edilmemiştir. Model parametreleri ile çevre faktörleri arasındaki ilişki Tablo de verilmektedir. A parametresi bakımından, laktasyon 1- arasındaki ve laktasyon 3-4 arasındaki farklılıklar, önemli bulunmamış, fakat laktasyonlar 3 ve 4 laktasyonlar 1 ve den yüksek bulunmuştur (P<0.05). Bu ise, 3. ve 4. laktasyondaki koyunların daha yüksek pik verimine sahip olduklarını göstermektedir. Kuzulama ayı bakımından, A parametresi Mart ayında kuzulayan koyunlar için en yüksek değeri alırken bunu sırasıyla Nisan ve Şubat ayında kuzulayanlar takip etmiştir. Mart ayında kuzulayanlar Şubat ayında kuzulayanlardan daha yüksek (P<0.05) pik verimine sahip olurken, Nisan ayında kuzulayanlarla benzer pik verimine sahip olmuşlardır. A parametresi bakımından, doğum tipi seviyeleri arasındaki farklılıklar istatistiksel olarak önemli bulunmamıştır. Diğer taraftan, kuzulama yaşı seviyeleri arasında önemli farklılık tespit edilmiştir: ve 3 yaşlar ve 3, 4 ve 5 yaşlar arasındaki farklılık önemli bulunmazken, ve 4-5 yaşlar arasındaki farklılık önemli bulunmuştur (P<0.05). Bu ise, yaşından sonra laktasyon pik veriminin giderek artmasına rağmen, bu artış miktarlarının önemli olmadığını göstermektedir. Laktasyon eğrisine etki eden faktörlerden laktasyon sırası, kuzulama yaşı ve doğum tipinin b, c, d, ve q parametrelerine herhangi bir etkisi tespit edilememiştir. Diğer taraftan, kuzulama ayının laktasyon seyrindeki pik veriminden önceki dalgalanmalara (b ve c parametreleri) herhangi bir etkisi bulunmazken, pik veriminden sonraki dalgalanmalara (d ve q parametreleri) olan etkisi önemli bulunmuştur (P<0.05). d parametresi Mart ayında kuzulayan koyunlar için en yüksek değeri alırken bunu sırasıyla Nisan ve Şubat ayında kuzulayanlar takip etmiştir. Mart ayında kuzulayanlar Şubat ayında kuzulayanlardan daha yüksek (P<0.05) d değerine sahip olurken, Nisan ayında kuzulayanlarla benzer değer almıştır. Şubat ve Nisan aylarında kuzulayanlar arasında d parametresi bakımından önemli bir farklılık tespit edilememiştir. Şekil 1 den de anlaşılacağı gibi, d parametresi pik verimden sonra laktasyon eğrisindeki aşağı doğru olan salınımın en düşük seviyesine kadar olan kısmını tanımlamaktadır ki, yüksek d değeri azalış oranının hızlı, küçük d değeri ise azalış oranının yavaş olduğu anlamına gelmektedir. Kuzulama ayı na göre laktasyon eğrileri Şekil de verilmektedir. Tablo ve Şekil birlikte değerlendirildiğinde pik verimden sonra, Mart ayında kuzulayan koyunların süt verimlerinde Şubat ve Nisan ayında kuzulayanlara göre daha hızlı bir düşüş yaşanmaktadır. q parametresi bakımından kuzulama ayları birbirinden farklı bulunmuştur (P<0.05). En yüksek q değerini Şubat ta kuzulayanlar alırken bunu sırasıyla Mart ve Nisan aylarında kuzulayanlar almıştır. Şekil den de anlaşılacağı gibi, q parametresi pik verimden sonra laktasyon eğrisindeki aşağı doğru olan salınımın en düşük seviyesinden sonraki kısmını tanımlamaktadır ki, pozitif q değeri süt veriminde tekrar bir artış olduğunu, Şubat ve Mart aylarında sırasıyla q = 0.14 ve 0.08, göstermektedir. Nisan ayında kuzulayanlarda ise pik veriminden sonra süt verimindeki azalmayı takiben tekrar bir artma meydana gelmemiştir ki, bunun sebebi bu ayda kuzulayanların q değerinin (q = 0.06±0.053) 0 dan farksız olmasına bağlanabilir. TARTIŞMA ve SONUÇ Norduz ırkı koyunların laktasyon eğrisi biçimi, bilinen klasik laktasyon eğrisine göre farklılık sergilemektedir. Klasik laktasyon eğrisinde, doğumdan sonra günlük süt veriminde hızlı bir artış, daha sonra laktasyonun sonuna kadar bir azalma gözlenmektedir. Şekil 1 de de görüleceği gibi, Norduz koyunlarına ait laktasyon eğrisi, doğumdan sonra günlük süt veriminde azalma-artma ve bunu tekrar azalmaartma izlemekte olup, sinüzoidal şekilde bir salınım şeklini almaktadır. Bu koyunların tipik koyun laktasyon seyrinden farklı bir laktasyon seyrine sahip olmasının sebebini bölgenin iklim ve topoğrafik yapısına bağlı şekillenen bitki örtüsü, dolayısıyla mera kompozisyonu ve otlak alanlarının otlatılma alışkanlığına bağlamak mümkündür. Dolayısıyla, beş parametreli legendre polinimial fonksiyon (LEG4) bu şekilde bir seyir izleyen laktasyon eğrisini en iyi tanımlayan model olmuştur. Laktasyon eğrisini tanımlayan bir matematiksel modelin parametreleri arasındaki yüksek korelasyon olması halinde, kullanılan modelin laktasyonu tam olarak tanımlamayacağı bildirilmiş 4 olmasına rağmen, bu çalışmada dördüncü dereceden Legendre polinomiyal model karşılaştırma ölçütleri bakımından en iyi performansı göstermiştir (Tablo 1). Bu araştırmada gözlenen toplam LSV, Norduz koyunlarında daha önceden yapılan iki araştırmadan birinde 36 bildirilen LSV miktarı ile benzerlik gösterirken, diğer 37 araştırmada bildirilenden daha yüksek bulunmuştur. LSV ve TLSV arasındaki yüksek korelasyon (r=0.99) toplam laktasyon süt veriminin hesaplanmasında LEG4 modelinin kullanılmasının uygun olduğunu göstermektedir. Koyunların laktasyon süt denetimleri yapıldıktan sonra, Fleischmann metodu kullanılarak LSV miktarı laktasyon tamamlandıktan

155 683 KONCAGÜL DAŞKIRAN, BİNGÖL sonra hesaplanmakta ve LSV yi çok iyi bir şekilde tahmin edilebilmektedir 1,41. Ancak, tamamlanmamış laktasyonlar için bu metodun kullanılamayacağını bildiren araştırma da mevcuttur 4. LSV üzerine doğum tipinin etkisi önemli bulunmazken, laktasyon sırası (LS), kuzulama ayı (KA) ve kuzulama yaşının (KY) etkileri önemli bulunmuştur (P<0.05), ve bu sonuçlar daha önceden yapılan diğer çalışmalarla,43,44 genel olarak paralellik göstermektedir. Bu sonuçlarla kısmen benzerlik gösteren bir araştırmada 37 LSV üzerine yaş ve doğum tipinin etkili olduğu bildirilmiştir. Aynı zamanda ikiz kuzulayan koyunların daha fazla LSV değerine sahip olduklarını bildiren diğer bazı araştırmalar da mevcuttur 8,9,17,4,45. Doğal olarak daha erken zamanda kuzulayan koyunların daha uzun laktasyon süresine, dolayısıyla daha yüksek LSV ye sahip olacağı beklenmektedir 4,46. Aynı zamanda, LSV ile otlakların koyunlar tarafından kullanılmaya başlama zamanı arasında da ilişki olduğu daha önceki araştırmalarda bildirilmiştir,43,47. Araştırıcılar, bahar mevsiminin mera üzerindeki dolayısıyla koyunlar üzerindeki olumlu etkisinden dolayı, kış aylarında kuzulayan koyunlar ile bahar aylarında kuzulayan koyunların laktasyon sürelerinin farklı olmasına rağmen benzer LSV ye sahip olduklarını bildirmişlerdir. Bizim çalışmamıza konu olan Norduz koyunları için de benzer şartlar geçerli olmaktadır ki, Mart ve Nisan aylarında kuzulayan koyunların Şubat ayında kuzulayan koyunlardan daha fazla LSV ye sahip olduğu gözlenmiştir. Norduz koyunlarının içinde bulundukları coğrafik şartlar nedeniyle, meradaki karların erimesi ve meranın otlatılabilmesi ancak bahar mevsiminin ortasına denk düşmektedir. Bunun yanında bölgenin dağlık olması nedeniyle, merada vejetasyonun başlama zamanı rakıma bağlı olarak daha geç olmaktadır. Önce düşük rakımlı merada bir süre otlatılan koyunlar meranın kurumaya başlaması ile birlikte daha yüksek rakımlı meralara götürülerek otlatılmaktadırlar 36. Aynı zamanda koyunlara otlatmaya ek olarak herhangi bir yem takviyesi yapılmamaktadır. Böylece, otlatmanın başlamasına yakın zamanda kuzulayan koyunların, kış aylarında kuzulayan koyunlara göre daha fazla LSV ye sahip olması beklenen bir durum olmaktadır. Bu bölgedeki coğrafik durum ve otlatma sistemi LSV yi etkilediği gibi laktasyon seyrini de önemli ölçüde etkilemektedir. Şekil 1, Şekil ve Şekil 3 ten de anlaşılacağı gibi, Norduz koyunlarının laktasyon eğrisi tipik laktasyon eğrisinden farklı bir seyir izlemektedir. Bu ırk koyunlarda pik verim laktasyonun ortasında (kuzulamadan sonraki günler arası) meydana gelmektedir. Buna göre, Norduz koyunlarının laktasyon eğrisinde iki farklı persistensi den bahsedilebilir: birisi pik veriminden önceki, diğeri ise pik veriminden sonraki. Pik veriminden önceki persistensi ölçütü b ve c parametrelerinin değerleri, pik veriminden sonraki persistensi ölçütü ise d ve q parametrelerinin değerleri olarak alınabilir. Sürünün besleme ve otlatma uygulaması ve aynı zamanda kuzulamaların gerçekleştiği aya da bağlı olarak laktasyon eğrisinin seyri de tipik laktas- yon eğrisinden daha farklıdır. Bu çalışmada gözlenen şekilde bir laktasyon eğrisi daha önceki bir çalışmada 48 da bildirilmiştir: Akkaraman ve HamdanixAkkaraman melezi koyunların laktasyon seyrininin incelendiği çalışmada, günlük süt veriminin kuzulamadan sonraki ilk 30 günde azaldığını daha sonraki 60 günde artış gösterdiğini ve bunu takiben tekrar azalma eğilimine girdiğini bildirilmiştir. Laktasyon süt verimi ve eğrisi hayvanın türüne, tür içinde ırka da bağlı olarak farklı çevre koşullarından farklı yönde etkilenmektedirler. Buna bağlı olarak, farklı çevre şartlarında yetiştirilen çeşitli tür ve ırklarda laktasyon erğisini tanımlayan en uygun model de farklı olabilmektedir 5. Akkaraman, Kıvırcık-Akkaraman ve Sakız-Akkaraman melezi koyunlarda yapılan bu çalışmada en iyi modelin Wilmink modeli olduğunu ve bunu Wood ve Dhanoa modellerinin izlediğini bildirilmişlerdir. Morkaramanda, Dave modeli 49 en uygun model olarak bildirilirken, İvesilerde yapılan farklı iki çalışmadan birinde 6 Wood modeli, diğerinde 3 ise Wood, Cobby & Le Du, Dhanoa ve Wilmink eşit derecede uygun olduğu bildirilmiştir. Kimi sütçü koyun ırklarında yapılan bir çalışmada 13 Wood modelinin başarılı olduğu bildirilirken, diğer bir araştırmada 50 ise Morant, Grossman ve Pollott modellerinin Wood modelinden daha iyi uyum sağladığı bildirilmiştir. Latxa koyun ırkında yapılan bir çalışmada 4 ise Morant ve Gnanasakthy tarafından önerilen modelin uygun olduğu bildirilmiştir. Bu modellerin çoğu süt sığırlarının laktasyon eğrilerini tanımlamak içinde kullanılmakla birlikte son zamanlarda kullanılmaya başlanan Kübik Splayn 1, Doğrusal Splayn 1,51 ve Legendre polinomial 39,5 gibi modeller de önerilmektedir. Bu çalışmada, dördüncü dereceden Legendre polinomial (LEG4) model, halk elinde yetiştiriciliği yapılan Norduz koyunlarının laktasyon eğrisini tanımlamakta en yaygın olarak kullanılan matematiksel modellerden daha iyi bir performans göstermiştir. LEG4 model tarafından tahmin edilen laktasyon süt verimi (TLSV), Fleischmann metodu kullanılarak hesaplanan laktasyon süt verimi (LSV) ile çok sıkı bir benzerlik (r=0.99) göstermektedir. Laktasyon sırası, kuzulama yaşı ve kuzulama ayı laktasyon süt verimi üzerinde önemli etkiye sahiptir. Aynı zamanda, kuzulama ayı ve laktasyon sırası laktasyon eğrisinin şekli üzerinde de önemli etkiye sahiptir. Van ilinin Norduz bölgesine özgü bu koyun ırkında, coğrafik şartlar da göz önünde bulundurulduğunda, koç katım zamanının kuzulamaların Mart ayında olacak şekilde planlanması laktasyon süt verimi bakımından büyük önem taşımaktadır. KAYNAKLAR 1. Barillet F, Boichard D: Use of first lactation test-day data for genetic evaluation of the Lacaune dairy sheep. 5th World Cong on Genet Appl Livest Prod, Guelph, ON, Canada, 18, , Montaldo H, Almanza A, Juiirez A: Genetic group, age and season effects on lactation curve shape in goats. Small Rum Res, 4, 195-0, Sakul H, Boylan WJ: Lactation curves for several US sheep breeds. Anim Prod, 54, 9-33, 199.

156 684 Yetiştirici Elinde Bulunan Şahin EH, Korkmaz A: Koyunlarda süt verim özellikleri ve kontrolü. Vet Bil Derg, 0 (1): 5-11, Morant SV, Gnanasakthy A: A new approach to the mathematical formulation of lactation curves. Anim Prod, 49, , Wood PDP: Algebraic model of the lactation curve in cattle. Nature (Lond.), 16, , Beever DE, Rook AJ, France J, Dhanoa MS, Gill M: A review of empirical and mechanistic model of lactational performance by the dairy cow. Livest Prod Sci, 9, , Camacho J, Baaijen M, Perez E: Comparison of different models for the lactation curve in a tropical country. 45th Annu Mtg Eur Assoc Anim Prod, JAM van Arendonk ed,wageningen Pers,Wageningen, Netherlands, p. 50, Cobby JM, Le Du YLP: On fitting curves to lactation data. Anim Prod, 6, , Keskin İ, Tozluca A: Süt sığırlarında laktasyon eğrilerinin farklı matematik modellerle belirlenmesi ve kontrol aralığının tespiti. Süleyman Demirel Üniv Zir Fak Derg, 18 (34): 11-19, Koncagul S, Yazgan K: Modelling first lactation of Holstein cows on herds in the southeast region of Turkey. J Anim Vet Adv, 7 (7): , Koncagül S, Yazgan K: Siyah Alaca süt sığırlarının laktasyon eğrilerinin tanımlanmasında Legendre ve Splayn modellerin klasik laktasyon eğrisi modelleri ile karşılaştırılması. Hay Üret Derg, 5 (1): 17-3, McGill K, Fullard P, Celi PC, Thomson E, Hall A, Iqbal PC, Raadsma HW: Lactation curve characteristics and persistency of lactation in dairy ewes milked once a day: Preliminary Observations. Australian Society of Animal Production, 6th Biennial Conference, Short Communication, 5-7 July, Wagga Wagga, Australia, n. 71, Nelder JA: Inverse polynomials, a useful group of multifactor response functions. Biometrics,, , Papajsik IA, Bodero J: Modelling lactation curves of Friesian cows in a subtropical climate. Anim Prod, 47, 01-07, Shanks RD, Berger PJ, Freeman AE, Dickinson FN: Genetic aspects of lactation curves. J Dairy Sci, 64, , Stanton TL, Jones LR, Everett RV, Kachman SD: Estimating milk, fat and protein lactation curves with a test day model. J Dairy Sci, 75, , Wilmink JBM: Adjustment of test-day milk, fat and protein yield for age, season and stage of lactation. Livest Prod Sci, 16, , Yazgan K, Koncagül S: Laktasyon eğrilerinin tanımlanmasında doğrusal ve Kübik Spline ile Legendre Polinomial fonksiyonlarının kullanımı. VI Zootekni Bilim Kongresi, 4-6 Haziran, Erzurum, s , Fernandez C, Sanchez A, Garces C: Modeling the lactation curve for test-day milk yield in Murciano-Granadina goats. Small Rum Res, 46, 9-41, Gipson TA, Grossman M: Lactation curves in dairy goats: A review. Small Rum Res, 3, , Carta A, Sanna SR, Casu S: Estimating lactation curves and seasonal effects for milk, fat and protein in Sarda dairy sheep with a test day model. Livest Prod Sci, 44, 37-44, Esenbuğa N, Bilgin ÖC: İvesi koyunlarının laktasyon eğrisinin tahmini ve tanımlanması için farklı matematiksel modellerin mukayesesi. IV Ulusal Zootekni Bilim Kongresi, 1-3 Eylül, Isparta, s , Grossman M, Koops WJ: Multiphasic analysis of lactation curves in dairy cattle. J Dairy Sci, 71, , Ünal N, Orman MN, Çolak C, Atasoy F, Mundan D, Aytaç M: Saf ve melez Akkaraman (KıvırcıkxAkkaraman F1 ve SakızxAkkaraman F1) koyunlarda farklı laktasyon eğrisi modellerinin karşılaştırılması. Lalahan Hay Araş Derg, 47 (): 7-13, Yıldız A: Ceylanpınar Tarım İşletmesinde yetiştirilen İvesi koyunlarının laktasyon eğrisi ve laktasyon eğrisi parametrelerine etkili faktörlerin belirlenmesi. Doktora Tezi, Fırat Üniv. Sağlık Bil. Enst., Elazığ, Portolano F, Spatafora F, Bono G, Margiota S, Todaro M, Ortoleva V, Leto G: Application of the wood model to lactation curves of Comisana sheep. Small Rum Res, 4, 7-13, Torres-Hernandez G, Hohenboken WD: Biometric properties of lactations in ewes raising single or twin lambs. Anim Prod, 30, , Aboul-Naga AM, El-Shobokshy AS, Marie IF, Moustafa MA: Milk production from subtropical non-dairy sheep. I. Ewe performance. J Agric Sci, 97 (): , Carriedo JA, Diez R, San Primitivo F: Genetic study of some factors influencing the milk production of dairy ewes II. Environmental factors. In, Proceeding of the Second World Congress, General Application on Livestock Production VIII, Ministo de Agricultura, Madrid, Spain, pp , Gootwine E, Alef B, Gadeesh S: Under conformational its heritability in the Asf (Awassi X East Friesian) cross of dairy sheep in Israel. Ann Gene Sel Anim, 1, 9-13, Lawlor MJ, Louca A, Mavrogenis A: The effect of three suckling regimes on the lactation performance of Cyprus fattailed Chios and Awassi sheep and the growth rate the lambs. Anim Prod, 18, 93-99, Peralta-Lailsona M, Trejo-Gonzalezb AA, Pedraza-Villagomeza P, Berruecos-Villalobosc JM, Vasquezc CG: Factors affecting milk yield and lactation curve fitting in the creole sheep of Chiapas-Mexico. Small Rum Res, 58, 65-73, Treacher TT: Balance entre necesidades y provision de alimentos para la oveja lactante. In Memorias II Jornadas sobre produccion animal, Zaragoza, Madrid, Espana, pp , Wilson LL, Varela-Alvarez H, Hess CE, Rugh MC: Influence of energy level, creep feeding and lactation stage on ewe milk and lamb growth characters. J Anim Sci, 33 (3): , Bingöl M: Norduz koyunlarının döl ve süt verimleri ile büyüme-gelişme ve dışyapı özellikleri. Doktora Tezi, Yüzüncü Yıl Üniv Fen Bil Enst, Van, Yılmaz O, Denk H, Nursoy H: Milk yield characteristics of Norduz sheep. Yüzüncü Yıl Üniv Vet Fak Derg, 15 (1-): 7-31, Schaeffer LR: Application of random regression models in animal breeding. Livest Prod Sci, 86, 35-45, Silvestre AM, Petim-Batista F, Colaço J: The accuracy of seven mathematical functions in modeling dairy cattle lactation curves based on test-day records from varying sample schemes. J Dairy Sci, 89, , SAS: SAS/STAT. SAS Inst Inc, Cary, NC, USA, Barillet F, Astruc JM, de Brauwer P, Casu PS, Fabbri G, Feddersen E, Frangos K, Gabina D, Gama LT, Ruiz TJL, Sanna SR: Int. Committee for animal recording guidelines: International Regulations for Milk Recording in Sheep. pp. 15, Ins, de Elevage, Paris, France, Ruiz R, Oregui LM, Herrero M: Comparison of models for describing the lactation curve of Latxa sheep and an analysis of factors affecting milk yield. J Dairy Sci, 83 (11): , Gabina D, Arrese F, Arranz J, de Heredia IB: Average milk yields and environmental effects on Latxa sheep. J Dairy Sci, 76, , Maria G, Gabina D: Non-genetic effects on milk production of Latxa ewes. Small Rum Res, 1, 61-67, Aguilar JA, Aparicio JJ, Fernandez-Rivera S, Tovar I: Lactation curves and milk yield of Corriedale, Rambouillet and Suffolk ewes. J Dairy Sci, 7 (Suppl 1): (Abstr.), Maria G, Gabina D: Simplification of milk recording scheme in Latxa milking sheep. Livest Prod Sci, 31, , Barillet F: Amelioration genetique de la composition du lait de brebis: Exemple de la race Lacaune. PhD Diss., Inst Natl Rech Agron, Paris-Grignon, France, Tufan A: Koyunlarda süt veriminin laktasyon boyunca değişimi ve farklı yöntemlere göre tahmin edilmesi. Yüzüncü Yıl Üniv Tarım Bil Derg, 11 (): 1-7, Demirsoy S: Morkaraman Koyunların Laktasyon Egrisinin Belirlenmesi İçin Uygun Modelin Tahmini. Doktora Tezi, Ankara Üniv. Sağlık Bil. Enst., Ankara, Pollott GE, Gootwine E: Appropriate mathematical models for describing the complete lactation of dairy sheep. Anim Sci, 71, , Silvestre AM, Petim-Batista F, Colaço J: Genetic parameter estimates of Portuguese dairy cows for milk, fat, and protein using a spline test-day model. J Dairy Sci, 88, , Takma Ç, Akbaş Y: Variance components and genetic parameter estimates using random Regression models on test day milk yields of Holstein Friesians. Kafkas Univ Vet Fak Derg, 15 (4): , 009.

157 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE The mrna Expression Pattern of Skeletal Muscle Regulatory Factors in Divergent Phenotype Swine Breeds [1] Mehmet Ulaş ÇINAR * Huitao FAN * [1] This project was supported by the German Research Foundation (DFG), Functional Genetic Principles of Water Binding Capacity in Pork DRIP FOR753 Germany * Institute of Animal Sciences, Animal Breeding and Husbandry Unit, University of Bonn, Bonn, GERMANY Makale Kodu (Article Code): KVFD Summary Muscle regulatory factors (MRFs) play a major role in muscle growth and development. Thus, they are considered as candidate genes for meat production traits in pigs. These basic helix-loop-helix (bhlh) and paired box transcription factors together with Bone morphogenetic proteins, regulate myogenesis: they initiate the formation of muscle fibers and regulate the transcription of muscle specific genes. The objective of this study was to investigate the mrna abundance of transcription factor (TF) genes (MYOD, MYF5, MYOG, PAX3, PAX7, BMP and BMP4) in the adult skeletal muscle (longissimus dorsi) of divergent Duroc (high meat fat ratio) and Pietrain (low meat fat ratio) pig breeds. For this purpose, purebred Duroc and Pietrain animals (for each breed n = 5) were used for mrna expression study. Highest gene expression was observed for MYOG, followed by BMP. The lowest gene expression was observed for PAX3. Moreover, we statistically investigated differences in the expression profiles of these genes between the Duroc and Pietrain breeds. Among seven genes MYF5 and PAX3 showed different expression (P<0.01) between Duroc and Pietrain breeds. Duroc showed higher MYF5 and PAX3 mrna abundance compared to the Pietrain breed. Although PAX3 gene was the lowest expressed, results suggest that Duroc breed may have more skeletal muscle regeneration potential compared to Pietrain breed. Keywords: Duroc pigs, Pietrain pigs, Myogenic regulatory factors, mrna expression Özet İskelet Kası Düzenleyici Faktörlerin mrna İfadesinin Farklı Özellikteki Domuzlarda Gösterimi Kas düzenleyici faktörler (KDF), kas büyümesi ve gelişmesinde önemli bir rol oynar. Bu nedenle domuzlarda et üretim özellikleri için aday genler olarak kabul edilirler. Bu temel helix-loop-heliks (thlh) ve eşleştirilmiş kutu transkripsiyon faktörleri ile kemik morfogenetik proteinleri miyogenesisi düzenlerler: kas liflerinin oluşumu başlatmak ve kas spesifik genlerin transkripsiyonunu düzenlerler. Bu çalışmanın amacı, Duroc (yüksek et yağ oranı) ve Pietrain (düşük et yağ oranı) domuz ırklarında yetişkin iskelet kası (longissimus dorsi) transkripsiyon faktörü (TF) genlerinin (MYOD, MYF5, MYOG, PAX3, PAX7, BMP ve BMP4) mrna ifadesini araştırmaktır. Bu amaçla, safkan Duroc ve Pietrain hayvanlar (her ırkan cins n = 5) mrna ifade çalışması için kullanılmıştır. En yüksek gen ifadesi MYOG için, ve onu takiben BMP için gözlendi. En düşük gen ifadesi PAX3 için gözlendi. Ayrıca bu genlerin ifadeleri Duroc ve Pietrain ırklarında istatistiksel olarakta araştırılmıştır. Yedi gen içinde MYF5 ve PAX3 genleri Duroc ve Pietrain ırkları arasında (P<0.01) farklı ifade gösterdi. Duroc ırkı hayvanlar Pietrain ırkına kıyasla daha yüksek MYF5 ve PAX3 mrna ifadesi gösterdi. PAX3 gen ifadesi düşük olmasına rağmen sonuçlar Duroc ırkının Pietrain ırkına kıyasla daha yüksek kas yenileme potensiyeline sahip olabileceğini göstermiştir. Anahtar sözcükler: Duroc domuzlar, Pietrain domuzlar, Miyogenik düzenleyici faktörler, mrna ifadesi INTRODUCTION Skeletal muscle development in vertebrates (also termed myogenesis) is a highly integrated process 1. Adult muscle tissue is characterized by its capacity to grow and to regenerate after injury, managed by the processes which require stem cells - so called satellite cells. Myogenesis is regulated by a group of muscle-specific trans- İletişim (Correspondence) ucin@itw.uni-bonn.de

158 686 The mrna Expression... cription factors, know also as the myogenic regulatory factors (MRFs): Myogenic factor 5 (MYF5), muscle-specific regulatory factor 4 (MRF4; also known as MYF6), myoblast determination protein (MYOD) and myogenin (MYOG) 3. MRFs are transcription factors that activate many downstream genes to initiate muscle cell differentiation. MRFs are basic helix-loop-helix (bhlh) proteins that heterodimerize with a ubiquitous class of bhlh transcription factors known as E proteins 4. These complexes bind to a canonical DNA sequence, CANNTG, called the E-box within the regulatory elements of genes to affect their expression 4. Beside during prenatal stages of muscle development, MRFs regulating muscle specific expression patterns during postnatal muscle tissue functioning 5. Bone morphogenetic proteins (BMPs) are multi-functional growth factors that belong to the transforming growth factor ß (TGFß) superfamily 6. Stem cells in the skeletal muscle have the capacity to differentiate into osteogenic cells upon stimulation with BMP. Thus, these cells can act as carriers of BMP as well as participate in new-bone formation by differentiating into osteogenic cells 7. Although to date, around twenty BMP family members have been identified and characterized 6, in our study, we focused on BMP and BMP4. Bone morphogenetic proteins (BMP) directs the development of neural crest cells into neuronal phenotypes 8, while BMP4 and BMP7 specifically induce a sympathetic adrenergic phenotype 6. The implantation of bone morphogenetic protein into muscular tissues induces ectopic bone formation at the site of implantation 9 and recent evidence suggests that perturbation of this cleavage can have profound effects on skeletal muscle growth 10. The understanding of the growth and development of skeletal muscle is one of the most important goals in animal science 11. The development of skeletal muscle depends on the number and size of muscle fibers. In pigs, fiber formation ceases around days of gestation when the total number of fibers is established 1. Postnatal muscle growth for pigs is achieved by an increase in number (hyperplasia) and size (hypertrophy) of myofibres. Postnatal muscle growth is accompanied by the proliferative activity of satellite cells which are the source of new nuclei incorporated into the muscle fibres 11. Muscle fiber hypertrophy is associated with an increased DNA content, yet myonuclei do not retain the ability to synthesize DNA 13. Satellite cells are the postnatal source of DNA which contributes to muscle fibers growth. DNA accretion occurs through proliferation of satellite cells followed by differentiation and fusion with existing muscle fibers 14. Similar to prenatal stage 1, postnatal muscle growth also orchestrated by MRFs 15. Investigating gene expression and gene regulation in phenotypically diverse populations is a useful approach to reveal the effects of genetic variability and to understand the development and regulation of quantitative traits in livestock. Genetic background of skeletal muscle growth in extreme divergent breeds has been shown in several studies Among modern western pigs, Duroc (high meat fat ratio) and Pietrain (low meat fat ratio) breeds extensively utilized in commercial pork production differ extremely for their muscle phenotypes 16. Although given the critical roles that MRFs play in myogenesis and the expression of MRFs is associated with skeletal muscle growth, a few study was devoted to understand breed dependent molecular mechanism of MRFs and BMPs. Therefore, the aim of the present study was to identify mrna expression of skeletal muscle related transcription factor (TF) genes (MYOD, MYF5, MYOG, PAX3, PAX7, BMP and BMP4) in the longissimus dorsi muscle of divergent swine breeds Duroc and Pietrain. MATERIALS and METHODS Animals Pietrain (n=5) and Duroc (n=5) female pigs at the age of 6-months were used in this study. Details regarding the animals used in this study were given in previous paper 16. All the pigs were slaughtered at a commercial abattoir according to German performance test directions 0. The loin eye muscle of each pig was dissected and immediately frozen in liquid nitrogen within 5 min after slaughter. Then the samples were stored at -80 C until RNA isolation. RNA Isolation and cdna Synthesis Total RNA was extracted using TRI-Reagent (Sigma- Aldrich). RNA was purified using RNeasyMini Kit (Qiagen) according to the manufacturer s instructions. Total RNA was then treated using on-column RNase-Free DNase set (Promega) and the concentration was quantified by spectrophotometer (NanoDrop, ND-8000, Thermo-Scientific). RNA quality was checked by % agarose gel electrophoresis. First-strand cdna was synthesized using Superscript II enzyme (Invitrogen). The cdna concentration was measured by spectrophotometer (NanoDrop, ND-8000, Thermo- Scientific). Quantitative Real-time PCR (qrt-pcr) Primers were designed using the online Primer3 program 1 and are listed in Table 1. Experiments were performed in StepOne Plus Real-Time PCR system (Applied Biosystems). The qrt-pcr was set up using μl first-strand cdna template (at the concentration of 100 ng/μl), 7.4 μl deionized H O, 0.3 μm of forward and reverse gene specific primers and 10 μl 1 Power SYBR Green I (Bio-Rad) master mix with ROX as reference dye. The thermal cycling conditions were 3 min at 95 C followed by 40 cycles of 15 seconds at 95 C and 1 min at 60 C. All samples were analyzed twice (technical replication) and the geometric mean of the Ct values were further used for statistical analysis using SAS v9. (SAS Institute Inc., Cary, NC). Melting curve analysis was performed to investigate the specificity of the PCR reaction. The no-template control

159 687 ÇINAR, FAN Table 1. Primer sequences used for qrt-pcr analysis Tablo 1. qrt-pcr çalışmasında kullanılan primer dizileri Gene Name Primers Sequence (5-3 ) Tm ( C) Product Size (bp) GenBank ID MYOD F: TGCAAACGCAAGACCACTAA R: GCTGATTCGGGTTGCTAGAC MYOG F: GGTGAGGGAGTGCAGATTGT R: CAGTGAATGCAGTTCCCACA MYF5 F: CCGACACAGCTTGTGGAATA R: GCCAATCAACTGATGGCTTT PAX3 F: ATCGGCTAATCCTGACATGC R: ACGGTGGGAAACTTTTGATG PAX7 F: GGCAGAGGATCTTGGAGACA R: TGGGTGGGGTTTTCATCAAT BMP F: CTTGACGCTTTTCCCTTTTG R: AAGAGGCATGTGCGGATTAG BMP4 F: ACGGTGGGAAACTTTTGATG R: ATCGGCTAATCCTGACATGC GAPDH F: ACCCAGAAGACTGTGGATGG R: ACGCCTGCTTCACCACCTTC HPRT1 F: AACCTTGCTTTCCTTGGTCA R: TCAAGGGCATAGCCTACCAC F: Forward, R: Reverse NM_ NM_ XM_ AY AY NM_ NM_ AF NM_ (NTC) was included in each run for each gene to check for contamination. The geometric mean of twohousekeeping genes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hypoxanthine phosphoribosyltransferase 1 (HPRT1) were used for normalization of the target genes. The delta Ct (ΔCt) values were calculated as the difference between target gene and geometric mean of the reference genes: ΔCt = Ct target gene Ct housekeeping gene. Ct values were Logarithm (Log) transformed and used for further analysis. The higher Ct values indicated lower expression and vice versa. Statistical Analysis Results from qrt-pcr analysis were expressed as mean ± SEM. The difference between values was analyzed by t-test in SAS software v. 9. and P<0.05 was set statistically significant. The principal component analysis was performed using PAST (Palaeontological Statistics). RESULTS Myogenin found to be most abundant mrna in longissimus dorsi muscle (Fig. 1), followed by BMP and BMP4 (Fig. 1). Paired box transcription factor genes PAX3 and PAX7 were the lowest expressed genes in pig skeletal muscle (Fig. 1). On the other hand, other myogenic regulatory factor genes MYOD and MYF5 showed moderate mrna expression in pig skeletal muscle (Fig. 1). Fig 1. Box-and-whisker plots, representing the expression of genes in the studied groups (Duroc and Pietrain) The results are calculated as delta Ct values. Whiskers represent median and minimum and maximum values for particular groups. Boxes represent lower quartile and upper quartile. Lower Ct values indicate higher mrna expression. Şekil 1. Kutu ve bıyık (box and whisker) diyagramları, incelenen gruplarda (Duroc ve Pietrain) genlerin ifadesini temsil ediyor Sonuçlar delta Ct değerleri olarak hesaplanmıştır. Bıyıklar belirli gruplar için ortanca, minimum ve maksimum değerleri temsil eder. Kutular, alt dörttebirlik ve üst dörttebirlik değerleri temsil eder. Düşük Ct değerleri yüksek mrna ifadesini göstermektedir.

160 688 The mrna Expression... Principal component analysis (PCA) of mrna expression data showed that two breeds (Duroc and Pietrain) well discriminated in case of seven genes mrna expressions (Fig. ). Moreover, it was shown that PAX3 and PAX7 genes clustered distinctly among seven skeletal muscle development genes (Fig. ). Results showed that expression of PAX7 gene has weight on Duroc animals where as PAX3 has more weight on Pietrain animals (Fig. ). The variance analysis results showed that mrna expression of MYF5 and PAX3 showed differential regulation (P<0.01) between Duroc and Pietrain breeds (Fig. 3). Duroc had higher MYF5 and PAX3 expression compared to Pietrain breed (Fig. 3). On the other hand, although, Duroc had a slightly higher mrna expression, no significant difference was detected between Duroc and Pietrain breeds for the mrna expression of MYOD, MYOG, PAX7, BMP and BMP4 genes (Fig. 3). DISCUSSION Pig breeds differ in muscle traits such as muscularity, muscle fiber type, color, etc. 3. Here, we reported the mrna expression of three MRFs, two paired box and two bone morphogenetic protein gene. Among MRFs, mrna and protein expression of MYF6 was shown previously by Fan et al. 16 in Duroc and Pietrain pigs. Their results suggested that Pietrain pigs have higher MYF6 mrna and protein expression compared to Duroc pigs. In this study, myogenin was the most abundantly expressed gene in young pig skeletal muscle, followed by BMP and BMP4 (Fig. 1). Paired box transcription factor genes PAX3 and PAX7 were the lowest expressed genes in pig skeletal muscle (Fig. 1). On the other hand, other myogenic regulatory factor genes MYOD and MYF5 showed moderate mrna expression in pig skeletal muscle tissue (Fig. 1). Application of principal component analysis (PCA) to gene expression dataset was shown in a clear manner 4. PCA is a mathematical algorithm that reduces the dimensionality of the data while retaining most of the variation in the data set 4. When we applied PCA to mrna expressions of seven genes among Duroc and Pietrain breeds, analysis revealed that two breeds can be separated in case of seven genes mrna expressions (Fig. ). Moreover, it was shown that PAX3 and PAX7 genes clustered distinctly among seven skeletal muscle development genes (Fig. ). Results Fig. Visual representation of Principal Component Analysis results for the gene expressions The dots (scores) represent gene expression categories or subgroups, and the arrows (loadings) are the breeds Şekil. Gen ifadeleri icin Temel Öğeler Analizi sonuçlarının grafiksel gösterimi Noktalar gen ifadesi kategorilerini veya alt grupları, oklar ırkları göstermektedir Fig 3. Differential gene expressions among two breeds The results are calculated as delta Ct values. Lower Ct values indicate higher mrna expression Şekil 3. Gen ifadesinin iki ırk arasındaki farklılığı Sonuçlar delta Ct değerleri olarak hesaplanmıştır. Düşük Ct değerleri yüksek mrna ifadesini göstermektedir

161 689 ÇINAR, FAN showed that expression of PAX7 gene has weight on Duroc animals where as PAX3 has more weight on Pietrain animals (Fig. ). mrna expression of MYF5 had weight on Pietrain breed compared to Duroc breed. Notably, other myogenic regulatory factors MYOD and MYOG and Bone morphogenetic proteins BMP and BMP4 clustered together and their weights were equally distributed on Duroc and Pietrain breeds (Fig. ). Different researches have shown that satellite cells play a major role in muscle hypertrophy. These cells represent the oldest known adult stem cells which are involved in normal growth of muscle and regeneration process 5,6. The variance analysis results showed that mrna expression of MYF5 and PAX3 showed differential regulation (P<0.01) between Duroc and Pietrain breeds (Fig. 3). Duroc had higher MYF5 and PAX3 expression compared to Pietrain breed (Fig. 3). On the other hand, although, Duroc had a slightly higher mrna expression, no significant difference was detected between Duroc and Pietrain breeds for the mrna expression of MYOD, MYOG, PAX7, BMP and BMP4 genes (Fig. 3). In mature muscle tissue, satellite cells occur as a small, dispersed population of mitotically and physiologically quiescent cells, marked by their expression of the transcription factor PAX7 7. The PAX3 gene plays an essential role in regulating the developmental program of embryonic myoblasts 7,8. Edwards et al. 9,30 evaluated the Duroc and Pietrain sired pigs and recorded their carcass and meat quality traits. They concluded that Duroc sired progeny were heavier and had a greater average daily gain compared to Pietrain sired ones. Their results were in good agreement with our results, showing that Duroc animals had higher PAX3 mrna expression than Pietrain pigs which may cause more skeletal muscle regeneration potential in Duroc pigs. Recently, importance of PAX7 compared to PAX3 was shown in one review paper 31. In our experiment although mrna expression of PAX7 was found to be higher compared to PAX3 mrna, no significant difference was identified between two pig breeds in terms PAX7 expression. Analysis of mice depleted of PAX3 and MYF5 showed almost complete loss of trunk muscles and a loss of MYOD expression; this indicates that MYOD expression depends on either PAX3 or MYF5 3. The role of myogenic factor MYF5 in mammalian myogenesis during development is well defined 3. Ustanina et al. 33 observed a significant delay in the regeneration of MYF5 deficient skeletal muscles after injury. They concluded MYF5 supports efficient skeletal muscle regeneration by enabling transient myoblast amplification. A few studies were devoted to understand breed specific postnatal transcription profile of muscle regulatory family, but most of them dealt with age specific alteration of transcript abundance. For instance Pierzchała et al. 34 used Polish Large White, Polish Landrace, Pietrain, Duroc and Pulawska gilts to investigate the expression MYF5 at different ages, however, they did not observe any significant differences postnatal expression of MYF5 in porcine skeletal muscle. In Large Whites MYOD and MYF5 were reported to be expressed regularly up to the third week of age followed by a decreasing trend (detected up to 50 days of age) while the differentiation factors myogenin and MRF4 seemed to diminish already after the first week from birth 35. Gayraud-Morel et al. 3 showed that MYF5 is a regulator of regenerative myogenesis and homeostasis, with functions distinct from those of MYOD and MRF4. In our research, we observed transcript abundance difference between Duroc and Pietrain pigs for MYF5 gene but not for MYOD. Inconsistency at mode of regulation (up-down) for the transcript abundance of MYF5 and MYOD could be explained by distinction of functionality. Due to the close vicinity of MYF6 and MYF5 genes on SSC5, these two genes have a common regulatory region and the expression of both genes is in part activated together 36 and differentially mrna regulation of MYF6 between Duroc and Pietrain pigs was shown previously 16. To the best of our knowledge, no literature is available about the transcriptional regulation of MYF5, however, trans-regulation for MYF6 gene was shown in literature 37. Since MYF5 and MYF6 had a common regulatory region, it could be speculated that transcription of MYF5 is controlled by the same eqtl which MYF6 is controlled. However, mode of transcription regulation of MYF5 gene could be investigated with further eqtl studies in larger pig populations. Te Pas et al. 38 genotyped 1.76 animals in five loci of MYF5 gene for association analysis. However, statistical analysis revealed no association with birth weight, growth rate, weight at slaughter age, carcass meat weight, and backfat thickness. Their experiment showed that MYF5 did not explain genetic variation in meat (muscle) development in pigs. On the other hand, Zhang et al. 39 found significant association between MYF5 SNPs and Chinese cattle breeds and suggested MYF5 as strong candidate genes that influence growth traits in cattle. In summary, investigation of gene expression in different pig breeds or developmental stages could reveal candidate genes associated with growth and meat quality traits. Up to now, a few studies about transcript abundance of the myogenic regulatory factors in different pig breed were performed. Our research on expression patterns of main myogenic regulatory factors could be helpful to understand the genetic basis of postnatal myogenesis process and its effects on high and low meat fat ratio pig breed. Especially, up regulation of MYF5 and PAX3 genes suggest that faster growing Duroc pigs connected with the presence of a larger number of active satellite stem cells compared to Pietrain. However, research on polymorphisms and their association of this polymorphism with growth and meat quality traits is further needed for a better understanding of myogenic regulatory factors in different pig breeds. Acknowledgements This project was supported by the German Research Foundation (DFG), Functional Genetic Principles of Water

162 690 The mrna Expression... Binding Capacity in Pork DRIP FOR753 Germany. Authors are indebted to Ms. Nadine Leyer for technical assistance during the experiments. REFERENCES 1. Rehfeldt C, Pas MFWT, Wimmers K, Brameld JM, Nissen PM, Berri C, Valente LMP, Power DM, Picard B, Stickland NC: Advances in research on the prenatal development of skeletal muscle in animals in relation to the quality of muscle-based food. I. Regulation of myogenesis and environmental impact. Animal, 5 (5): , Friedrichs M, Wirsdoerfer F, Flohe SB, Schneider S, Wuelling M, Vortkamp A: Bmp signaling balances proliferation and differentiation of muscle satellite cell descendants. BMC Cell Biol, 1, 6, Braun T, Gautel M: Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat Rev Mol Cell Biol, 1 (6): , Martin PT: Role of transcription factors in skeletal muscle and the potential for pharmacological manipulation. Curr Opin Pharmacol, 3 (3): , Rehfeldt C, Pas MFWT, Wimmers K, Brameld JM, Nissen PM, Berri C, Valente LMP, Power DM, Picard B, Stickland NC: Advances in research on the prenatal development of skeletal muscle in animals in relation to the quality of muscle-based food. II - Genetic factors related to animal performance and advances in methodology. Animal, 5 (5): , Chen D, Zhao M, Mundy GR: Bone morphogenetic proteins. Growth Factors, (4): 33-41, Lee JY, Musgrave D, Pelinkovic D, Fukushima K, Cummins J, Usas A, Robbins P, Fu FH, Huard J: Effect of bone morphogenetic protein- expressing muscle derived cells on healing of critical sized bone defects in mice. J Bone Joint Surg Am, 83A (7): , Christiansen JH, Goles EG, Wilkinson DG: Molecular control of neural crest formation, migration and differentiation. Curr Opin Cell Biol, 1 (6): , Katagiri T, Komaki M, Namiki M, Inada M, Yamaguchi A, Wozney JM, Rosen V, Suda T: Inactivation of the Myo-d family is required for the Bmp- induced osteoblast differentiation of muscle cells. J Bone Miner Res, 10, S148-S148, Allen DL, Greybeck BJ, Hanson AM, Cleary AS, Lindsay SF: Skeletal muscle expression of bone morphogenetic protein-1 and tolloidlike-1 extracellular proteases in different fiber types and in response to unloading, food deprivation and differentiation. J Physiol Sci, 60 (6): , Rehfeldt C, Fiedler I, Dietl G, Ender K: Myogenesis and postnatal skeletal muscle cell growth as influenced by selection. Livest Prod Sci, 66 (): , Murani E, Muraniova M, Ponsuksili S, Schellander K, Wimmers K: Identification of genes differentially expressed during prenatal development of skeletal muscle in two pig breeds differing in muscularity. BMC Dev Biol, 7, 109, Bi P, Kuang S: Stem cell niche and postnatal muscle growth. J Anim Sci, 90 (3): , Moss FP, Leblond CP: Satellite cells as the source of nuclei in muscles of growing rats. Anat Rec, 170 (4): , Psilander N, Damsgaard R, Pilegaard H: Resistance exercise alters Mrf and Igf-I mrna content in human skeletal muscle. J Appl Physiol, 95 (3): , Fan H, Cinar MU, Phatsara C, Tesfaye D, Tholen E, Looft C, Schellander K: Molecular mechanism underlying the differential Myf6 expression in postnatal skeletal muscle of Duroc and Pietrain breeds. Gene, 486 (1-): 8-14, Gil M, Delday MI, Gispert M, MF IF, Maltin CM, Plastow GS, Klont R, Sosnicki AA, Carrion D: Relationships between biochemical characteristics and meat quality of Longissimus thoracis and Semimembranosus muscles in five porcine lines. Meat Sci, 80 (3): , Lefaucheur L, Milan D, Ecolan P, Le Callennec C: Myosin heavy chain composition of different skeletal muscles in Large White and Meishan pigs. J Anim Sci, 8 (7): , Rehfeldt C, Henning M, Fiedler I: Consequences of pig domestication for skeletal muscle growth and cellularity. Livest Sci, 116 (1-3): 30-41, ZDS: Richtlinie fuer die Stationspruefung auf Mastleistung, Schlachtkoerperwert und Fleischbeschaffenheit beim Schwein. Zentralverband der Deutschen Schweineproduktion ev, Ausschussfuer Leistungspruefung und Zuchtwertschaetzung, Bonn, Rozen S, Skaletsky H: Primer3 on the www for general users and for biologist programmers. Methods Mol Biol, 13, , Hammer Ø, Harper DAT: Paleontological data analysis. 1 st ed., 368p, Blackwell Publishing Ltd, Oxford, Cagnazzo M, te Pas MF, Priem J, de Wit AA, Pool MH, Davoli R, Russo V: Comparison of prenatal muscle tissue expression profiles of two pig breeds differing in muscle characteristics. J Anim Sci, 84 (1): 1-10, Ringner M: What is principal component analysis? Nat Biotechnol, 6 (3): , Hawke TJ, Garry DJ: Myogenic satellite cells: physiology to molecular biology. J Appl Physiol, 91 (): , Siegel AL, Kuhlmann PK, Cornelison DD: Muscle satellite cell proliferation and association: New insights from myofiber time-lapse imaging. Skelet Muscle, 1 (1): 7, Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA: Pax7 is required for the specification of myogenic satellite cells. Cell, 10 (6): , Maroto M, Reshef R, Munsterberg AE, Koester S, Goulding M, Lassar AB: Ectopic Pax-3 activates MyoD and Myf-5 expression in embryonic mesoderm and neural tissue. Cell, 89 (1): , Edwards DB, Tempelman RJ, Bates RO: Evaluation of Duroc- vs. Pietrain-sired pigs for growth and composition. J Anim Sci, 84 (): 66-75, Edwards DB, Bates RO, Osburn WN: Evaluation of Duroc- vs. Pietrain-sired pigs for carcass and meat quality measures. J Anim Sci, 81 (8): , Wang YX, Rudnicki MA: Satellite cells, the engines of muscle repair. Nat Rev Mol Cell Bio, 13, , Gayraud-Morel B, Chretien F, Flamant P, Gomes D, Zammit PS, Tajbakhsh S: A role for the myogenic determination gene Myf5 in adult regenerative myogenesis. Dev Biol, 31 (1): 13-8, Ustanina S, Carvajal J, Rigby P, Braun T: The myogenic factor Myf5 supports efficient skeletal muscle regeneration by enabling transient myoblast amplification. Stem Cells, 5 (8): , Pierzchała M, Pareek CS, Lisowski P, Urbanski P, Goluch D, Czarnik U, Kamyczek M, Rozycki M, Cooper RG, Kuryl J: Expression profile of Myf5 and Myf6 genes in skeletal muscles of young growing gilts of five breeds at different ages, based on the most stable reference genes. Anim Sci Pap Rep, 9 (3): 31-46, Caliaro F, Maccatrozzo L, Toniolo L, Reggiani C, Mascarello F, Patruno M: Myogenic regulatory factors expressed during postnatal hyperplastic growth in porcine muscles. Basic Appl Myol, 15 (): 55-60, Carvajal JJ, Cox D, Summerbell D, Rigby PWJ: Control of the expression of the Mrf4 and Myf5 genes: A BAC transgenic approach. Int J Dev Biol, 45, S139-S140, Cinar MU, Fan H, Neuhoff C, Große-Brinkhaus C: Eqtl analysis and association of Myf6 mrna expression with meat quality traits in pigs. Kafkas Univ Vet Fak Derg, 18 (): 35-4, te Pas MFW, Harders FL, Soumillion A, Born L, Buist W, Meuwissen THE: Genetic variation at the porcine Myf-5 gene locus. Lack of association with meat production traits. Mamm Genom, 10 (): 13-17, Zhang RF, Chen H, Lei CZ, Zhang CL, Lan XY, Zhang YD, Zhang HJ, Bao B, Niu H, Wang XZ: Association between polymorphisms of Mstn and Myf5 genes and growth traits in three Chinese cattle breeds. Asian Austral J Anim, 0 (1): , 007.

163 Kafkas Univ Vet Fak Derg 18 (4): , 01 DOI: /kvfd RESEARCH ARTICLE * ** *** **** Summary In Van cats, changes in serum mineral (Na-Sodium, K-Potassium, Ca-Calcium, P-Phosphorus, Mg-Magnesium, Cl-Chlorine and Fe-Iron) and metabolite concentrations (TG-Triglycerides, COL-Cholesterol, T.Prot.-Total protein and ALP-Alkaline phosphatase) were investigated before, during and after the pregnancy. A total of mature cats (19 queens and 3 fertility-proven tomcats) were used as material. Thereafter, 13 queens showed oestrus while others (n=6) did not. Samples of venous blood were collected from anoestrous and oestrous queens upon hand-mating, on the 54 th day. After parturition (n=7), the number of live kittens was recorded and additional samples were collected on the 5 th, 1 th and 19 th days of lactation. Results were also considered for small (n=3) and large number (n=4) of suckling kittens ( 4 or >4 litters, resp.). For minerals, there was a significant (P<0.01) fluctuation in K levels during the prolonged lactation with large number of suckling kittens. However, significant (P<0.05) decrease was found for P value as the lactation period prolonged. Meanwhile, for metabolites, TG levels in previously-mated queens (becoming pregnant or not) were significantly (P<0.01) higher than those both in anoestrus and in lactation. Also, COL levels in pregnant queens were significantly (P<0.05) higher than those in all other occasions and further that there were significant decreases in COL levels both in the first and the second weeks of lactation. Collectively, present findings suggest that; a) the concentrations of K and P minerals and metabolites studied per se (TG, COL, T.Prot. and ALP) changed markedly during the late pregnancy and prolonged lactation, and b) declines in minerals (P) and metabolites (COL) become even greater when the number of suckling kittens increased in queen Van cats during breeding season. Keywords: Van cat, Pregnancy, Lactation, Litter size, Mineral, Metabolite Üreme Sezonundaki Van Kedilerinde Gebelik, Erken Laktasyon Haftaları ve Emzirilen Yavru Sayısının Serum Mineral ve Metabolit Düzeyleri Üzerine Etkileri Özet The Effects of Pregnancy, Early Lactation Weeks and the Number of Suckling Kittens on the Serum Mineral and Metabolite Profiles of Van Cats in Breeding Season Barış Atalay USLU * Sait ŞENDAĞ ** Ömer UÇAR *** Fetih GÜLYÜZ * İbrahim TAŞAL ** Nebi ÇETİN ** Axel WEHREND **** Division of Reproduction and Artificial Insemination, Faculty of Veterinary Sciences, Yuzuncu Yil University, TR Van - TURKEY Division of Obstetrics and Gynaecology, Faculty of Veterinary Sciences, Yuzuncu Yil University, TR Van - TURKEY Division of Reproduction and Artificial Insemination, Faculty of Veterinary Sciences, Ataturk University, TR-540 Erzurum - TURKEY Clinic for Obstetrics, Gynaecology and Andrology of Large and Small Animals with Veterinary Ambulance, Justus Liebig University, 3539 Giessen - GERMANY Makale Kodu (Article Code): KVFD Van kedilerinde, gebelik öncesi, esnası ve sonrasında serum mineral (Na-Sodyum, K-Potasyum, Ca-Kalsiyum, P-Fosfor, Mg-Magnezyum, Cl-Klor ve Fe- Demir) ve metabolit konsantrasyonlarındaki (TG-Trigliserid, COL-Kolesterol, T.Prot.-Total protein ve ALP-Alkalin fosfataz) değişiklikler araştırıldı. Materyal olarak, toplam adet yetişkin kedi (19 dişi ve 3 fertil erkek) kullanıldı. Dişilerin 13 tanesi sonradan östrüs gösterirken, 6 tanesi hiç bir belirti göstermedi (anöstrus). Hem anöstrüsteki hem de elde-çiftleştirme sonrası, 54. günde, gebe kalmayan (n=6) ve kalan dişilerden (n=7) venöz kan örnekleri alındı. Doğum sonrası canlı yavruların sayısı kaydedildi ve laktasyonun 5., 1. ve 19. günlerinde emziren dişilerden kan örnekleri alındı. Ayrıca, sonuçlar bir batında doğan az (n=3) veya çok (n=4) sayıdaki emzirilen yavrular (sırasıyla 4 veya >4 adet yavru sayısı) yönünden değerlendirildi. Elde edilen bulgulara göre, mineraller yönünden, özellikle uzun laktasyon döneminde çok sayıda yavru emziren kedilerdeki K düzeylerinde önemli (P<0.01) dalgalanma gözlendi. Ancak, emzirme döneminde P değerinde önemli (P<0.05) bir azalma vardı. Öte yandan, metabolitler yönünden çiftleşme sonrası (gebe kalmayan veya kalan) kedilerdeki TG düzeylerinin, hem anöstrustaki hem de laktasyondakilerden anlamlı düzeyde (P<0.01) daha yüksek olduğu bulundu. Ayrıca, gebe kedilerdeki COL düzeylerinin diğer tüm durumlardaki kedilerden önemli oranda (P<0.05) daha yüksek olduğu gözlenmekle birlikte, laktasyonun hem ilk hem de ikinci haftasındaki COL düzeylerinde önemli azalma vardı. Sonuç olarak, üreme sezonundaki dişi Van kedilerinde; a) incelenen minerallerden K ve P nin, metabolitlerin ise tamamının (TG, COL, T.Prot. ve ALP) gebeliğin sonunda ve laktasyonun ilk haftalarında belirgin oranda değiştiği, ve b) mineral (P) ve metabolit (COL) düzeylerindeki azalmanın emzirilen yavru sayısının artmasıyla daha da belirginleştiği kanısına varıldı. Anahtar sözcükler: Van kedisi, Gebelik, Laktasyon, Yavru sayısı, Mineral, Metabolit İletişim (Correspondence) atalayuslu@hotmail.com

164 69 The Effects of Pregnancy... INTRODUCTION Van cat is an endemic breed of Van province (in Eastern Anatolia, Turkey), has colourful eyes (one turquoise blue the other amber yellow, Fig. 1) and long/short white fur (Fig. ) 1. In general, cats are seasonally polyoestrous and the ovulation occurs after coital stimulation. Queens reach puberty, as evidenced by their first oestrus signs, between 7-1 months, depending on their parturition season, diseases and feeding conditions. Body weight has also a major influence such that queens show their first oestrus when they reach to kg. Regarding parturition season (Fig. 3), female kittens (Fig. 4) born during winter reach puberty in the first breeding season of the same year of age, while others born in spring do not show any signs until the next spring. However, when the litter size decrease the body size of kittens born becomes greater. Also, the congenital abnormalities and the incidence of abortus increase as the queens become older,3. In queens, pregnancy lasts about 65 days depending on age, breed Fig 3. Mother queen suckling 3 kittens Şekil 3. Üç yavru emziren anne kedi Fig 4. Weaned (3 months old) female kittens Şekil 4. Sütten kesilmiş (3 aylık) yavru kediler Fig 1. Young ( years old) queen Van cat with eyes in different colours Şekil 1. Farklı göz renklerine sahip genç ( yaşında) dişi Van kedisi Fig. Mature (4 years old) queen Van cat with white fur Şekil. Beyaz tüylü yetişkin (4 yaşında) dişi Van kedisi and feeding. Multiple kitten-bearing pregnancies last from days 58 to 69 post-mating. It was reported that queens give a birth to -8 kittens (Fig. 3) along with lactation period enduring for about -3 months. Elements available within the body can be classified as macro- and microelements. Amongst them, in one hand, the Ca, P, Na, K and Mg are all macroelements, available at milligram (mg) levels. On the other hand, the Cl, Fe Zn, Mn and Cu are at mg levels and are classified as trace elements 4. These elements with their tiny amounts (less than 4 mg in total) available are essential substances required for biological functions. These elements are cofactors of numerous enzymes playing crucial roles in enzymatic reactions 5. Not only the elemental deficiency but also the proportional alterations between trace elements may lead to physiological changes/disorders 6,7. The majority of trace elements take part in the syntheses of enzymes, hormones and vitamins 8. Among them, Fe and other metallic ions all enable the non-enzymatic lipid peroxidations 9. Further, Fe plays an effective role mainly in oxygen transferstorage (through haemoglobin) and in enzyme activation 10. Hepatic Fe store is important for the first 6 months of a newborn, since the amount available in milk is low. Luckily,