Tu rkiye de Mikrobiyota C alıs malarında Kullanılan Laboratuvar Yo ntemleri

Transkript

1 Tu rkiye de Mikrobiyota C alıs malarında Kullanılan Laboratuvar Yo ntemleri Meltem Yalınay, M.D., PhD Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

2 Mikrobiyota Analiz Yöntemleri Mikroskobi Dizi Analizi Yeni Nesil Dizileme Biyoinformatik Analiz Kültür Kültür Bağımsız Moleküler Yöntemler Kültüre Dayalı Moleküler Yöntemler

3 Mikrobiyota Analiz Yöntemleri-I Gaita DNA İzolasyonu 3. KLİMUD Kongresi, Antalya Kasım 2015

4

5

6

7 Mikrobiyota Analiz Yöntemleri Moleku ler Yo ntemler Kültüre Dayalı Moleküler Yöntemler Fenotipik Parmak İzi Analiz Yöntemleri Genotipik Parmak Analizi Yöntemleri Kültür Bağımsız Moleküler Yöntemler FISH Kantitatif Dot Blot RAPD PZR-DGGE, PZR-TGGE T-RFLP AP Mikroarray 16S rrna reca Gen Analizi qpzr DNA dizileme Yeni nesil dizileme

8 Mikrobiyota Analiz Yöntemleri Yo ntem Avantaj Dezavantaj qpzr DGGE/TGG E T-RFLP 16S rrna Filogenetik tanımlama Kantitatif Hızlı Yüksek duyarlılık Hızlı Yarı kantitatif Örneklerin ileri testler için kullanımına olanak sağlar Hızlı Yarı kantitatif Maliyet etkin Filogenetik tanımlama Kantitatif PZR bias Bilinmeyen türlere uygulanamaz Tek hedef Filogenetik tanımlama yapamaz PZR bias Filogenetik tanımlama yapamaz PZR bias PZR bias Zahmetli Pahalı Klonlama bias

9 Mikrobiyota Analiz Yöntemleri Yo ntem (Üretici firma) Avantaj Dezavantaj Pirodizileme (454 GS FLX+, Roche) Okuma süresi uzundur Yüksek verimlilik Duyarlı Aynı zamanda birden fazla örneği analiz etme imkanı Koloni biası yoktur Yüksek maliyet Homopolimerlerde yüksek hata oranı Kısa sekans okuma Kapsamlı biyoinformatik analize ihtiyaç duyar Geri dönüşümlü terminatör dizileme (HiSeq2000/2500, Illumina) Etkili Okuma sürelerini iyileştiren süreklilik Yüksek verimlilik Manuel iş azlığı Uzun çalışma süresi Kısa okuma uzunlukları Yükseltme geliştirilme Ligasyon (5500xl SOLiD, Life Technologies) Gerçek zamanlı sekans (PacBio RS, Pacific Biosceince) Düşük hata oranı Yüksek verimlilik Örnek hazırlaması kolay Reaktif maliyeti düşük Çok uzun okuma uzunluğu Çok kısa uzunluklar Uzun çalışma süresi Hata oranı yüksek Sistem maliyeti yüksek Sistem kurulumu zordur

10 Mikrobiyota Analiz Yöntemleri

11 Bioresour Technol Sep;192: doi: /j.biortech Epub 2015 Jun 9. Use of PCR-DGGE based molecular methods to assessment of microbial diversity during anaerobic treatment of antibiotic combinations. Aydin S1, Shahi A2, Ozbayram EG2, Ince B3, Ince O2. Author information Abstract As it is currently often not know how anaerobic bioreactors, e.g. for biogas production, react if the substrate is contaminated by toxic compounds like antibiotics. This study evaluated how anaerobic sequencing batch reactors were affected by amendments of different antibiotics and stepwise increasing concentrations. The compositions of microbial community were determined in the seed sludge using 16S rrna gene clone libraries and PCR-DGGE analyses were used for the detection of microbial community changes upon antibiotics additions. According to PCR-DGGE results, the syntrophic interaction of acetogens and methanogens is critical to the performance of the reactors. Failure to maintain the stability of these microorganisms resulted in a decrease in the performance and stability of the anaerobic reactors. Assessment of DGGE data is also useful for suggesting the potential to control ultimate microbial community structure, especially derived from Gram-negative bacteria, through bioaugmentation to successful for antibiotic biodegradation. Copyright 2015 Elsevier Ltd. All rights reserved.

12 Int J Food Microbiol Feb 15;153(3): doi: /j.ijfoodmicro Epub 2011 Dec 13. Combination of culture-dependent and culture-independent molecular methods for the determination of lactic microbiota in sucuk. Kesmen Z1, Yetiman AE, Gulluce A, Kacmaz N, Sagdic O, Cetin B, Adiguzel A, Sahin F, Yetim H Abstract In this study, the culture-dependent and culture-independent molecular methods were used for the identification of lactic acid bacteria (LAB) in sucuk a Turkish fermented dry sausage. On the one hand, the PCR-DGGE method targetting the V1 and V3 regions of 16S DNA was applied to DNA that was directly extracted from sucuk samples. On the other hand, rep-pcr fingerprinting was performed for the primary differentiation and grouping of the isolates, and the results were confirmed by sequencing of the 16S rdna and 16S-23S rdna intergenic spacer region. As a result of the PCR-DGGE analysis of all the samples, total 8 different lactic acid bacteria were identified, and Lactobacillus sakei, Lactobacillus curvatus and Weissella viridescens were the dominant microbiota among these bacteria. The culturedependent approach indicated that the majority of the strains belonged to the Lactobacillus genera including Lb. sakei, Lactobacillus plantarum, Lb. curvatus, Lactobacillus brevis, Lactobacillus farciminis and Lactobacillus alimentarius. However, Leuconostoc and Weisella were also detected as minor genera. Again, Lactococcus piscium, Weissella halotolerans, Staphylococcus succinus and the comigrated Staphylococcus piscifermentans/staphylococcus condimenti/staphylococcus carnosus group were detected only with the culture-independent method while Lb. plantarum, Leuconostoc mesenteroides and Leuconostoc citreum were identified only by using the culture-dependent method. In the results, it was concluded that the combination of culture-dependent and culture-independent methods was necessary for reliable and detailed investigation of LAB communities in fermented food products.

13 Folia Microbiol (Praha) May;58(3): doi: /s Epub 2012 Oct 4. Culturable bacterial microbiota of Plagiodera versicolora (L.) (Coleoptera: Chrysomelidae) and virulence of the isolated strains. Demirci M1, Sevim E, Demir İ, Sevim A. Author information Abstract Plagiodera versicolora (Laicharting, 1781) (Coleoptera: Chrysomelidae) is an important forest pest which damages many trees such as willow, poplar, and hazelnut. In order to find new microbes that can be utilized as a possible microbial control agent against this pest, we investigated the culturable bacterial flora of it and tested the isolated bacteria against P. versicolora larvae and adults. We were able to isolate nine bacteria from larvae and adults. The isolates were characterized using a combination of morphological, biochemical, and physiological methods. Additionally, we sequenced the partial sequence of the 16S rrna gene to verify conventional identification results. Based on characterization studies, the isolates were identified as Staphylococcus sp. Pv1, Rahnella sp. Pv2, Rahnella sp. Pv3, Rahnella sp. Pv4, Rahnella sp. Pv5, Pantoea agglomerans Pv6, Staphylococcus sp. Pv7, Micrococcus luteus Pv8, and Rahnella sp. Pv9. The highest insecticidal activity against larvae and adults was obtained from M. luteus Pv8 with 50 and 40 % mortalities within 10 days after treatment, respectively. Extracellular enzyme activity of the bacterial isolates such as amylase, proteinase, lipase, cellulose, and chitinase was also determined. Consequently, our results show that M. luteus Pv8 might be a good candidate as a possible microbial control agent against P. versicolora and were discussed with respect to biocontrol potential of the bacterial isolates.

14 J Pediatr Gastroenterol Nutr Mar;56(3): doi: /MPG.0b013e31827a964b. Breast milk jaundice: effect of bacteria present in breast milk and infant feces. Tuzun F1, Kumral A, Duman N, Ozkan H. Author information Abstract OBJECTIVE: Breast milk is an important source of bacteria in establishing the infantile intestinal microbiota that appear to influence the enterohepatic circulation of bilirubin. The aim of the present study was to evaluate the effect of breast milk's microbiological content on the development of breast milk jaundice (BMJ). METHODS: A total number of 60 mother-infant pairs enrolled to the study. Two groups were defined: BMJ group (n=30), full-term otherwise healthy newborns who were considered BMJ; control group (n=30), full-term healthy newborns without jaundice. All newborns in the study were exclusively breast-fed. The breast milk samples and the feces of infants were evaluated for content of selected bacterial populations (Bifidobacterium, Lactobacillus, Clostridium, Staphylococcus, and Streptococcus species) with real-time polymerase chain reaction. RESULTS: Bifidobacterium bifidum content in the breast milk and B adolescentis, B bifidum, and B longum content in the fecal samples were higher in the control group than in the BMJ group. The milk and fecal concentrations of B bifidum were significantly correlated. The concentrations of breast milk B bifidum and fecal B bifidum, B adolescentis, and B longum were found to be negatively correlated with bilirubin levels. CONCLUSIONS: Our results suggest that Bifidobacterium species in breast milk may protect against BMJ.

15 Mikrobiyota çalışmalarında moleküler yöntemler 1. PCR (qpcr ile 16S rrna kantitasyonu) 2. DNA Parmak izi analizleri 1. Denaturating gradient jel elektroforezi 2. SSCP 3. T-RFLP 3. Gen kütüphanesi oluşturulması ve 16S rrna sekans 1. Amplifikasyon ürünlerinin plazmid aracılığı ile transformasyonu dizi analizi 2. Yeni Nesil Dizileme

16 ÖZEL TEŞEKKÜR CEREN ERDOĞDU SERAP SÜZÜK

17 Helicobacter pylori Tedavisinin Bağırsak Mikrobiyota Üzerine Etkisi Serap Su zu k 1, Meltem Yalınay 2, Tarkan Karakan 3 1 THSK, Mikrobiyoloji referans Laboratuvarı DB 2 GÜTF, Tıbbi Mikrobiyoloji Anabilim Dalı 3 GÜTF, Gastroenteroloji Bilim Dalı 3. KLİMUD Kongresi, Antalya Kasım 2015

18 Çalışmanın Amacı Helicobacter pylori (HP), tedavisi alan gönüllülerde antibiyotik kullanımının bağırsak mikrobiyotası üzerindeki etkilerini qpzr yöntemi ile göstermek

19 Çalışmanın Dizaynı Etik Kurul Onayı Alınması İstatistiksel Analiz Gönüllülerin Seçilmesi 10 günlük: PPI+TET+MET+BİZ İki grup gaita örneğinden qpzr ile seçilen bakterilerin kantitasyonunun yapılması Antibiyotik kullanım öncesi gaita örneğinin alınması Tedavi bittikten 6 hafta sonra Antibiyotik kullanım sonrası gaita örneğinin alınması

20 Materyal Metod Bu çalışmada kullanılan standart suşlar; Bifidobacterium breve ATCC Bacteroides fragilis ATCC Lactobacillus acidophilus ATCC 4356 Akkermansia muciniphila ATCC BAA-835 Faecalibacterium prausnitzii ATCC 27766

21 Materyal Metod ATCC suşlarından kültür yapıldı A 260 dalga boyunda 3 okuma DNA kopya sayısı hesaplandı Standart Eğriler oluşturuldu (1/10, 1/100, 1/1000, 1/10000, 1/ dilüsyonlar ) Gram Boyama Ekstraksiyon (QIAmp DNA StoolMini Kit, Qiagen, Almanya) -20 C saklandı

22 ºC Materyal Metod 39 Gönüllüden Gaita Örneği Alındı Tedaviden 6 Hafta Sonra Gönüllülerin 18 inden Antibiyotik Kullanım Sonrası Gaita Örneği Alındı 200 mg gaita -80 C saklandı 200 mg gaita -80 C saklandı Ekstraksiyon (QIAmp DNA StoolMini Kit, Qiagen, Almanya) -20 C saklandı Ekstraksiyon (QIAmp DNA StoolMini Kit, Qiagen, Almanya) -20 C saklandı 1,0 Bif 0,8 Fluorescence df/dt 0,6 0,4 0,2 Threshold 0, ºC

23 Materyal Metod Verilerin tümü Microsoft Excele girilerek log bakteriyel miktarı hesaplandı Veriler SPSS 22.0 paket programı ile analiz edildi Antibiyotik kullanım öncesi ve antibiyotik kullanım sonrası karşılaştırmalar Mann- Whitney U Testi ile değerlendirildi

24 Bulgular Antibiyotik Kullanım Antibiyotik Kullanım Bakteriler Öncesi Ortalama±SS* Sonrası Ortalama±SS p (log 10 /g) (log 10 /g) Bifidobacterium spp 7,81±1,12 6,11±2,74 0,000 B. fragilis 8,24±1,19 5,69±2,89 0,000 Lactobacillus spp 7,39±0,61 6,32±1,74 0,000 A. mucinophilia 8,08±0,60 6,10±0,86 0,000 F. prausnitzii 9,21±2,09 6,32±1,59 0,000 *SS: Standart Sapma

25 Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Moleküler Yöntemlerle Karşılaştırılması Ceren Erdoğdu Danışman: Prof.Dr. Meltem Yalınay 9 Eylül, 2016 Ankara

26 İntestinal mikrobiyota ve NAFLD ilişkisi Lİ et al Journal of Parenteral and Enteral Nutrition

27 Hipotez NAFLD ve kontrol mikrobiyotası arasında farklılıklar bulunmaktadır. Mikrobiyotadaki farklılıklar barsaktan dolaşıma geçen endotoksin miktarını arttırabilir. İnflamasyon artabilir.

28 Metod NAFLD (n=52) KONTROL (n=38) Dışkı Kan DNA Serum Rutin Biyokimyasal tetkikler qpcr Lactobacillus, Bifidobacterium spp. plazmid gen kütüphanesi ELISA (TNF-α, IL-6) Hs-CRP A. muciniphila F. prausnitzii Lactobacillus spp. Bifidobacterium spp. B. fragilis group Enterobacteriaceae Dizi analizi Kromojenik LAL Testi (Endotoksin)

30 Metod 52 hasta (46 sı karaciğer biyopsisi ile doğrulanmış) 38 sağlıklı kontrol 18 yaşında olan, artmış serum aminotransferaz seviyeleri gözlenen, alkol tüketimi <20 gr/hafta olan, son 6 ay içerisinde herhangi bir kortikosteroid, antibiyotik, prebiyotik, probiyotik tedavisi almamış olan, eş zamanlı başka bir hastalığı olmayan hastalar dahil edilmiştir

31 Metod US ve artmış karaciğer enzimleri Brunt skorlama sistemi NAFLD tanısında steatoz, inflamasyon ve fibrozis derecesi göz önünde bulundurulmuştur. Hastalarda fibrozis derecesi F0-F1 orta dereceli fibrozis, F 2 şiddetli fibrozis olarak değerlendirilmiştir. Hasta Bilgi Formu cinsiyet, yaş, kilo, sigara kullanımı, ilaç kullanımı vs. Laboratuvar bulguları (Açlık glukoz, trigliserid, HDL, LDL, ALT, AST, ALP) Brunt EM Liver

33 Crossing-point (Cp) value qpcr analizleri için standartların Akkermansia muciniphila ATCC BAA-835, Faecalibacterium prausnitzii ATCC 27766, Bifidobacterium breve ATCC 15700, Lactobacillus acidophilus ATCC 4356, Bacteroides fragilis ATCC 25285, Escherichia coli ATCC hazırlanması Kültür 0,5 Mc Farland Süspansiyon cfu sayım Ekstraksiyon Nanodrop Ölçüm ,E+02 1,E+04 1,E+06 1,E+08 DNA copy number / µl A. muciniphila B. fragilis group Bifidobacterium spp. F. prausnitzii Enterobacteriaceae Lactobacillus spp. 1/10 dilüsyon Standart eğri

34 Akkermansia muciniphila ATCC BAA-835 kültürü

35 Faecalibacterium prausnitzii ATCC kültürü

36 Dışkı örneklerinden qpcr analizleri Dışkı örnekleri 200 mg Ekstraksiyon Nanodrop Ölçüm Roche LightCycler 2.0

38 Baskın Lactobacillus ve Bifidobacterium türlerinin belirlenmesi Hasta (n=49) Kontrol (n=35) Her örnekten 50 ng/µl havuzlandı LacF ve LacF primerleri ile PCR g-bifid-f ve g-bifid-r primerleri ile PCR Agaroz Jelde Görüntüleme Purifikasyon TA Klonlama vektörü (TA Cloning Kit, with pcr 2.1) kullanarak amplifikasyon ürünlerinin ligasyonu E.coli JM 109 kullanarak transformasyon Ampisilin içeren LB besiyerlerine kültür Hasta Kontr ol Hasta Kontr ol Lactobacillus gen kütüphanesi Bifidobacterium gen kütüphanesi Lac-F Lac-R Koloni PCR g-bifid-f g-bifid-r koloni PCR Agaroz jelde görüntüleme Purifikasyon Sekans PubMed Blast %97 seq similarity

40 İnflamasyon Belirteçleri İnflamauvar sitokinler: TNF-α, IL-6 hazır ticari ELISA kiti kullanıldı. hs-crp Karaciğerden sentezlenen akut faz proteini Normal kons. 0.1 mg/dl Lazer nefelometri ile ölçülüyor Karaciğer patolojisinin şiddeti İnflamasyon belirteci Yoneda et al J Gastroenterol

42 NAFLD ve kontrol mikrobiyotasının kantitatif karşılaştırılması 15 p=0.003 * Kontrol NAFLD log10/gr dışkı 10 5 p=0.001 p<0.001 * * 0 A. muciniphilia F. prausnitzii Lactobacillus spp. Bifidobacterium spp. B. fragilis group Enterobacteriaceae Çoklu lineer regresyon analizi - A. muciniphila ve Enterobacteriaceae nin NAFLD ve kontrol grupları arasında anlamlı olarak farklı kaldığı (p=0,0148 ve p=0,0172)

43 Fibrosis derecesine göre mikrobiyotanın 15 karşılaştırılması F0-F1 F2 log10/gr dışkı 10 5 p<0.001 * 0 A. muciniphilia F. prausnitzii Lactobacillus spp. Bifidobacterium spp. B. fragilis group Enterobacteriaceae

44 Enterobacteriaceae ile BKİ arasındaki 15 pozitif korelasyon Enterobacteriaceae log10/gr dışkı BMI BKİ ve Enterobacteriaceae sayısı arasında anlamlı olarak pozitif bir korelasyon gözlendi (Pearson r=0,282; p=0,021).

45 NAFLD ve kontrol grubu hs-crp seviyeleri hs-crp ** Kontrol NAFLD mg/dl Kontrol NAFLD -hs-crp ozellikle karaciğerdeki inflamasyon icin yüksek duyarlı bir belirteç -Hasta grubunda artmış inflamasyona bağlı yüksek serum hs-crp seviyeleri (p<0.001)

46 EU/mL NAFLD ve kontrol grubu serum endotoksin düzeyleri Endotoxin 60 ** Kontrol NAFLD -Hasta grubunda yüksek Enterobacteriaceae düzeyi ile uyumlu olarak yüksek endotoksin seviyesi (p<0.001)

47 80 60 NAFLD ve kontrol grubu sitokin TNF-alpha düzeyleri IL-6 80 Control Patient 60 pg/ml 40 pg/ml Control Patient 0 Control Patient TNF-α ve IL-6 seviyeleri bakımından fark yok. Serum yarı omürleri kisa olduğu için T hücre reseptörleri çalışılabilir.

48 NAFLD ve kontrol grubunda Lactobacillus türleri L.sakei 4% Kontrol NAFLD L. helveticus 7% L. delbrueckii 9% L.delbrueckii 3% L. Johsonii 5% L.reuteri 19% Uncultured Lactobacillus spp. 18% Uncultured Lactobacillus spp. 5% L.ruminis 39% L.salivarius 4% L.gastricus 2% L.acidophilus 4% L.mucosae 2% L.ruminis 50% L.salivarius 3% L.gastricus 6% L. acidophilus 11% L.mucosae 9% L. delbrueckii L.ruminis L.delbrueckii L.ruminis L.mucosae L.acidophilus L.mucosae L. acidophilus L.gastricus L.salivarius L.gastricus L.salivarius Uncultured Lactobacillus spp. L. helveticus Uncultured Lactobacillus spp. L. Johsonii L.sakei L.reuteri

49 B.ruminatium 2% B.catenulatum 4% NAFLD ve kontrol grubunda Kontrol Bifidobacterium türleri Uncultured Bifidobacterium spp. Clone 8% Uncultured Bifidobacterium spp. clone 10% NAFLD B.kashiwanohense 10% B.bifidum 6% B. adolescentis 55% B.kashiwanohense 2% B.bifidum 2% B.infantis 8% B. adolescentis 42% B.longum 15% B.longum 36% B. adolescentis B.longum B.bifidum B.kashiwanohense B.catenulatum B.ruminatium Uncultured Bifidobacterium spp. Clone B. adolescentis B.longum B.bifidum B.kashiwanohense B.infantis Uncultured Bifidobacterium spp. clone

50 Sonuç NAFLD olan hastalar ve sağlıklı kontrollerde barsak mikrobiyotasi kantitatif olarak farklidir. A. muciniphila NAFLD grubunda daha düşük orandadır. Barsaktaki endotoksinin birincil kaynagi olan Enterobacteriaceae hasta grubunda beklenildiği gibi daha yuksektir. B. fragilis kilo durumuna bağımlı bir değişken. Hasta grubunda beklenildigi gibi serum endotoksin seviyeleri daha yuksektir. Inflamasyon belirteçlerinden biri olan hs-crp duzeyleri hasta grubunda daha yuksektir. F. prausnitzii mikrobiyotanın dominant bir üyesi

51 Sonuç L. reuteri hasta grubunda baskın ancak kontrolde saptanmadı. L. sakei ve L. helveticus kontrolde var ancak hasta grubunda saptanmadı. L. reuteri obezite ile ilişkili mikrobiyota üyesi. Million M. et al. Obesity-associate d gut microbiota is enriched in Lactobacillus reuteri and depleted in Bifidobacterium animalis and Methanobrevibacter smithii. Int J Obesity. 2012, 36:

52 Teşekkürler, CEREN ERDOĞDU Meltem Yalınay Tarkan Karakan Martin J. Blaser Barış Otlu Doruk Engin Sinem Solmaz Berrin Öztürk G.Ü Endoskopi Ünitesi G.Ü Biyokimya Laboratuvarı (Özlem Gülbahar) NYU Biyoistatistik Departmanı (Huilin Li) Ankara Üniversitesi Veterinerlik Fakültesi (Mehmet Şahal) Roche Diagnostics teknik ekibi

53 Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması Erdogdu C, Yalinay M, Karakan T, Battaglia T, Blaser MJ Ceren Erdogdu

54 Hipotez Araştırma sorusu NAFLD ve sağlıklı kontroller arasında bağırsak mikrobiyotası içerik ve yapı bakımından farklıdır. Mikrobiyal çeşitlilik iki grupta farklı mı? Mikrobiyota yapısı karaciğer hasarının şiddetine göre değişiyor mu? Hastalık ve sağlığa etkisi olan spesifik gruplar hangileri?

55 Metod NAFLD (n=43) KONTROL (n=23) NAFLD - biyopsi ile doğrulanmış hastalar 18 yaşında olan, artmış serum aminotransferaz seviyeleri gözlenen, alkol tüketimi <20 gr/hafta olan, son 6 ay içerisinde herhangi bir kortikosteroid, antibiyotik, prebiyotik, probiyotik tedavisi almamış olan, eş zamanlı başka bir hastalığı olmayan hastalar dahil edilmiştir Fibrozis skoru F0-F1 orta dereceli fibrozis F2 şiddetli fibrozis 16S gen kütüphanesi-illumina Miseq sekans

56 Alfa ve Beta C es itlilik (Uzaklık) Ölçu leri Mikrobiyom toplulukları içerisinde ve birbirleri arasındaki uzaklığı ölçmek için kullanılan metriklerdir.

57 Gruplararası alfa çeşitlilik (gözlenen OTU- operasyonel taksonomik ünite,dağılım) Kontrol Hasta F0-F1 F2 Alfa C es itlilik (Alpha Diversity) Bir mikrobiyom verisinde hangi tür canlılar vardır ve ne kadarı ölçmek için kullanılır. Yani bir örnek kendi içinde ne kadar farklıdır sorusuna cevap verir.

58 NAFLD ve kontrol grubunda beta çeşitlilik Kontrol (n=23) NAFLD (n=43) Beta çes itlilik (Beta Diversity) Örneklerin birbirinden ne kadar farklı olduğuna cevap verir. Örnekler arasında karşılaştırma yapar. Örnekteki genel değişimi ölçer. P=0.004, method ANOSIM

59 Fibrozis derecelerine göre beta çeşitlilik F0-F1 (mild fibrosis) n=23 F2 (severe fibrosis) n=20 P=0.005, method ANOSIM

60 NAFLD ve kontrol grubunda relatif dağılımlar Kontrol NAFLD

61 NAFLD ve kontrol grubuna anlamlı olarak etki eden bakteri grupları

62 Sonuç Metagenomik yöntemler mikrobiyom çalışmaları için altın standarttır. Karaciğer patolojisi mikrobiyotada dağılım ve zenginlik olarak farklılığa neden olmuyor ancak mikrobiyota kompozisyonu gruplar arasında farklı.

63 Teşekkürler, Blaser Lab NYU Langone Biyoistatistik Böümü NYU Langone Genom Merkezi Funding T-RO1DK090989/NIH

64 FRIDAY-662 Gut Microbiota in Patients with Non-Alcoholic Fatty Liver Disease Hacettepe University Abstract Background: The effect of the gut microbiota on several diseases is becoming increasingly important issue. Since there is a close relationship between gut and liver via portal vein, the liver is consistently exposed to bacterial products such as endotoxin. The composition and quantification of microbiota members may be important for gut dysbiosis and subsequent bacterial translocation which may be the major cause of non-alcoholic fatty liver disease (NAFLD). In order to support this hyphothesis we performed qpcr analysis in stool of patients with NAFLD and healthy controls. Methods: The stool samples from 52 patients with NAFLD and 38 healthy controls have been collected. NAFLD has been proven by biopsy in 46 of the patients. 16S rrna qpcr assay has been performed for quantification of Akkermansia muciniphila, Faecalibacterium prausnitzii, Bifidobacterium spp, Lactobacillus spp, Bacteroides fragilis group and Enterobacteriaceae. Serum IL-6, TNF-α, hs-crp and endotoxin levels were assessed. Results: A. muciniphila and B. fragilis group were found significantly lower in patients with NAFLD (p=0.003 and p=0.001; respectively). As expected, the Enterobacteriaceae family members were found to be significantly higher in patients group (p<0.001). In consistent with the higher Enterobacteriaceae abundance in NAFLD patients, elevated serum endotoxin levels were also determined. TNF-α and IL-6 levels were not significantly different, however patients have 3 fold higher hs-crp which is a well-known marker of inflammation. Multiple regression analysis has performed in order to adjust for BMI and gender. A. still significantly lower and Enterobacteriaceae levels were significantly higher in patients group after adjusting for BMI and gender (p=0.0221, p=0.0186; respectively). Conclusion: NAFLD patients were characterized with higher Enterobacteriaceae levels, lower A. muciniphila and B. fragilis group levels in our study cohort. Elevated endotoxin levels and inflammation are also supporting our hypothesis. Methods Total of 52 NAFLD subjects and 38 healthy controls were included. Within the NAFLD group 46 of the patients were diagnosed with NASH by biopsy according to the Brunt criteria. NASH patients classified into two groups according to the fibrosis degree as follows: F0-F1, mild fibrosis (n=23); F2, significant fibrosis (n=23). Stool and blood samples were collected at the same day. Quantification of the fecal microbiota was performed by Real-Time PCR. Specific primers used to determine Akkermansia muciniphila, Faecalibacterium prausnitzii, Bacteroides fragilis group, Bifidobacterium spp, Lactobacillus spp and Enterobacteriaceae. In addition to the routine biochemical tests, inflammatory cytokines (IL-6 and TNF-alpha), hs-crp levels and endotoxin levels were also determined in serum. Standard statistical methods were used for the calculation of means and standard deviations. Independent t-test was used in order to compare continuous variables. For categorical variables chi-square test was used. Multiple linear regression analysis was performed in order to adjust for the variables that are significant between the groups. A p value of < 0.05 was used to establish significance. Ceren Erdogdu 1, Meltem Yalinay Cirak 2, Tarkan Karakan 3 Hacettepe University, Faculty of Pharmacy, Department of Pharmaceutical Microbiology, Ankara, Turkey Gazi University, Medical Faculty, Department of Clinical Microbiology, Ankara, Turkey Gazi University, Medical Faculty, Department of Internal Medicine, Division of Gastroenterology, Ankara, Turkey In the whole study group decreased levels of Akkermansia muciniphila (9.54±1.92 vs 10.86±2.14 log 10/gr feces, p=0.003) and B. fragilis group (6,71±1.38 vs 7.81±1.50 log 10/gr feces, p=0.001) were observed. Patient group has increased levels of Enterobacteriaceae (8.03±1.14 vs 6.89±1.12 log 10/gr feces, p<0.001). After adjusting for BMI and age B. fragilis group was no longer significant. NASH subgroup were evaluated according to the fibrosis stage. F2 fibrosis stage had significantly higher Enterobacteriaceae levels as compared to F0-F1 fibrosis stage (p<0.001). Supporting the finding of increased abundance of Enterobacteriaceae in patient group, serum endotoxin levels were also significantly elevated as compared to the controls (p<0.001). Patients have 3 fold higher hs-crp levels (0,12±0.02 mg/dl vs 0.37±0.06 mg/dl, p<0.001), which is a promising marker of inflammation in patients with NAFLD. Table 1. Demographic and Laboratory Results of the Participants Characteristic Patients (n=52) Mean±SD Control (n=38) Mean±SD Male (%) Age (years) 48 ± ± 10 <0.001 BMI (kg/m2) 29 ± 4 22 ± 2 <0.001 Waist circumference [46] 94 ± 9 83 ± ALT (U/L) 50 ± ± 11 <0.001 AST (U/L) 36 ± ± 4 <0.001 ALP (U/L) 105 ± ± 18 <0.001 Total cholesterol (mg/dl) 202 ± ± HDL (mg/dl) 45 ± 9 57 ± 10 <0.001 LDL (mg/dl) 127 ± ± log10/gr feces * A. muciniphilia F. prausnitzii Lactobacillus spp. Bifidobacterium spp. B. fragilis group * * Enterobacteriaceae Control Patient Figure 1. Comparison of log10/gram wet feces levels of bacterial groups between patients with NAFLD and healthy controls. p* Results Triglyceride (mg/dl) 184 ± ± 46 <0.001 *p values Glucose were (fasting; determined mg/dl) by t-test except 102 male ± 22 % which was 87 determined ± 12 <0.001 by chi square test BMI:Body mass index; ALT:Alanine transaminase; AST:aspartate aminotransferase; ALP:alkaline phosphatase; HDL:high-density lipoprotein; LDL:low-density lipoprotein *p values were determined by t-test except male % which was determined by chi square test log10/gr feces A. muciniphilia F. prausnitzii Lactobacillus spp. Bifidobacterium spp. B. fragilis group **** Enterobacteriaceae F0-F1 F2 Figure 2. Comparison of log10/gram wet feces levels of bacterial groups between fibrosis stages in patients diagnosed with NASH. A C EU/mL pg/ml Control Control Endotoxin ** TNF-alpha Patient Patient Control Patient Control Patient Figure 3. Serum levels of endotoxin (A), hs-crp (B), TNF-α (C) and IL-6 (D) between patients and controls. B mg/dl D pg/ml Control Control Conclusions hs-crp Patients with NAFLD has significantly decreased fecal A. muciniphila levels and increased Enterobacteriaceae levels. Within the NASH subgroup patients with significant fibrosis (F 2) has significantly higher fecal Enterobacteriaceae levels suggesting that the different fibrosis stages of NASH should be considered in future studies. Elevated serum endotoxin levels were observed in the patient group in accordance with the higher Enterobacteriaceae levels. Serum hs-crp levels found to be higher in patients group while no difference was observed in terms of IL-6 and TNF-alpha. ** IL-6 Patient Patient Control Patient

65 FRIDAY Increased Akkermansia muciniphila and Bacteroides fragilis group Abundance After Islamic Fasting Hacettepe University Ceren Erdogdu1, Meltem Yalinay Cirak2, Tarkan Karakan3 Hacettepe University, Faculty of Pharmacy, Department of Pharmaceutical Microbiology, Ankara, Turkey Gazi University, Medical Faculty, Department of Clinical Microbiology, Ankara, Turkey Gazi University, Medical Faculty, Department of Internal Medicine, Division of Gastroenterology, Ankara, Turkey Abstract Results Table 1. Specific primers used to determine 16S rrna region of the bacteria and standard strains used to construction of PCR standards log10/gr feces B. fragilis F. prausnitzii Enterobacteriaceae A.muciniphila CAGCACGTGAAGGTGGGGAC ATCC BAA-835 CCTTGCGGTTGGCTTCAGAT AM-2 F. pr ausnitzii GATGGCCTCGCGTCCGATTAG Fprau223F ATCC CCGAAGACCTTCTTCCTCC E. coli ATCC CATTGACGTTACCCGCAGAAGAAGC CTCTACGAGACTCAAGCTTGC 199 Fprau420R Eco1457F 195 Eco1652R log10/gr feces 4 Before IF After IF Figure 2. Quantities of fecal A. muciniphila and B. fragilis group members for each participant determined at baseline and after the end of Islamic fasting. Data was statistically analyzed using Wilcoxon Rank Sum test. p values for A. muciniphila and B. fragilis group is and , respectively. Conclusions AM B A.muciniphila 8 2 E gi l is gr ou nt p er ob ac te ri ac ea e p. ii la i tz sp ra 87 m 63 iu 88.f 60 er 90 sp p. 60 s 86 ct 55 Lact-R B 341 ba CACCGCTACACATGGAG do ATCC 4356 i fi 86 llu Lact-F sn g-bfra-r AGCAGTAGGGAATCTTCCA au CCAGTATCAACTGCAATTTTA ci 50 g-bfra-f L. acidophilus After IF 10 0 to ba 90 g-bifid-r 5 Before IF Tm* 56 pr ATAGCCTTTCGAAAGRAAGAT (oc) hi B. fragilis ATCC Annealing ip GGTGTTCTTCCCGATATCTACA Primer 10 0 g-bifid-f F bp 550 La c Lactobacillus spp. CTCCTGGAAACGGGTGG in B. fragilis gr oup Primer Seq (5-3 ) B. breve ATCC uc spp. Standard strain A. muciniphila 15 5.m Bifidobacterium A Bacterium log10/gr feces Background: Metabolic disorders such as obesity is often associated Table 2. Laboratory Data of the participants measured before and with the changes in microbiota composition and quantity. It has been after Islamic fasting Before Fasting After Fasting well known that dietary habits also effects intestinal microbiota. Here we hypothesized that long-term fasting may have a distinct effect on Characteristic (n=9) (n=9) p* intestinal microbiota. Ramadan fasting is an excellent model of how Mean±SD Mean±SD long-term fasting may affect the microbiota composition. Total of 9 subjects were included in this study during Ramadan between the BMI (kg/m2) 22.9 ± ± dates June 18 and July 16, 2015 which was approximately 17 hours of Waist circumference (19) 83.0 ± ± 5, fasting per day during a 29 day period. ALT (U/L) 24.6 ± ± Method: The stool samples from 9 volunteers were collected the day before the beginning of Islamic fasting and the day end of the AST (U/L) 22.8 ± ± Ramadan. 16S rrna qpcr assay has been performed for quantification ALP (U/L) 79.3 ± ± of Akkermansia muciniphila, Faecalibacterium prausnitzii, Total cholesterol (mg/dl) ± ± Bifidobacterium spp, Lactobacillus spp, Bacteroides fragilis group, Enterobacteriaceae. Blood samples were also collected to test for HDL (mg/dl) 52.9 ± ± metabolic and nutritional parameters. The before and after Islamic LDL (mg/dl) ± ± fasting results were statistically analyzed using Wilcoxon Signed-Rank test. Triglyceride (mg/dl) ± ± Results: All of the subjects were normal weight according to the Glucose (fasting; mg/dl) 87.8 ± ± calculated BMI. The overall bacterial count did not significantly change over time in none of the subjects. However significantly increased BMI:Body mass index; ALT:Alanine transaminase; AST:aspartate aminotransferase; abundance of A. muciniphila and B. fragilis group was observed in all ALP:alkaline phosphatase; HDL:high-density lipoprotein; LDL:low-density lipoprotein subjects after Islamic fasting when compared to the baseline levels *p values were determined by t-test. (p= and ; respectively). Serum fasting glucose and total 15 BF cholesterol levels in all subjects is also significantly reduced in all of AF the subjects (p<0.01 and p=0.009; respectively). Conclusion: Islamic fasting which has been approximately 17 hours of 10 fasting for each day lead to Methods a change in microbiota members. Figure 1. Log10/gr wet feces level means measured before Islamic fasting (baseline) and after Islamic fasting. BF: Before fasting, AF: After fasting Ramadan fasting is an excellent model of how long-term fasting may affect the microbiota composition. Significantly lower fasting glucose and total cholesterol levels were determined at the end of the Islamic fasting when compared to the baseline values. Significantly higher fecal A. muciniphila and B. fragilis group members were determined in the study participants who fasted for an average of 17 hours during Ramadan. This early results suggest that long-term fasting may have a distinct effect on microbiota composition. Metagenomic approaches should be performed in order to better understand the effect of fasting on microbiota composition

66

67 Nonalkolik Karaciğer Yağlanması Olan Hastalarda Barsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması Ceren Erdoğdu, Meltem Yalınay, Tarkan Karakan, Thomas Battaglia, Martin J. Blaser