Rapamisinin prostat kanseri hücre hatlarındaki etkisi The effect of rapamycin in prostate cancer cell lines

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Rapamisinin prostat kanseri hücre hatlarındaki etkisi The effect of rapamycin in prostate cancer cell lines"


1 Araştırma Makalesi / Research Paper Rapamisinin prostat kanseri hücre hatlarındaki etkisi The effect of rapamycin in prostate cancer cell lines Ege Tıp Dergisi / Ege Journal of Medicine 2013;52(1):7-14 Avcı Ç B 1 Süslüer Yılmaz S 1 Şığva Doğan Ö 1 Söğütlü F 2 Dündar M 2 Gündüz C 1 1 Ege Üniversitesi Tıp Fakültesi, Tıbbi Biyoloji Anabilim Dalı, İzmir, Türkiye 2 Ege Üniversitesi Fen Fakültesi, Biyoloji Bölümü, İzmir, Türkiye Özet Amaç: Rapamisin, Streptomyces hygroscopicus ten izole edilen, FKBP12 mtor a bağlanan bir antibiyotiktir. Rapamisin hem in vitro hem de in vivo kanser hücrelerinin proliferasyonunu inhibe etmektedir. Bu çalışmada, insan prostat kanseri hücre modelinde rapamisinin sitotoksik ve apoptotik etkileri değerlendirilip, telomeraz aktivitesi, EGFR ve VDR gen ekspresyonları üzerine etkisinin araştırılması amaçlanmıştır. Gereç ve Yöntem: LNCaP, PC-3 ve DU 145 prostat kanseri hücre hatları Dulbecco s Modified Eagle s Medium da rapamisin ile muamele edilip inkübe edilmişlerdir. Ayrıca rapamisinin sitotoksisitesi tripan mavisi testi, XTT yöntemi ve apoptoz akridin oranj-etidium bromid boyası ile incelenmiştir. htert, EGFR ve VDR genlerinin ekspresyonlarının kantifikasyonu yapılmıştır. Bulgular: Apoptoz değerlendirildiğinde hücre hatlarında rapamisinin IC 50 dozunda apoptoz artışı izlendi. Rapamisinin LNCaP hücre hattında sitotoksisitesi değerlendirildiğinde belirgin bir sitotoksisite gözlendi. htert mrna ekspresyonunda PC-3 hücre hattında düşüş belirlendi. Hücre hatlarında VDR ve EGFR gen ekspresyonları izlendiğinde; PC-3 ve DU 145 te VDR gen ekspresyonunda belirgin bir düşüş gözlendi. EGFR gen ekspresyon seviyesinde ise tüm hücre hatlarında düşüş saptandı. Bu çalışmada en dikkat çekici bulgu, prostat kanseri hücre hattı LNCaP te VDR ekspresyonunun izlenilmemiş olmasıdır. Sonuç: Prostat kanserinde yeni bir moleküler tedavi yaklaşımı gündeme getirilmiştir. Anahtar Sözcükler: Rapamisin, prostat kanseri, htert, EGFR, VDR. Summary Aim: Rapamycin is an antibiotic isolated from Streptomyces hygoroscopicus and binds with FKBP12 mtor. Rapamycin inhibits proliferation of cancer cells in both in vitro and in vivo. It was purposed that cytotoxic, apoptotic effects be taken into consideration and the impact of telomerase activity, EGFR and VDR gene expressions were evaluated. Materials and Methods: LNCaP, PC-3 and DU 145 prostate cancer cell lines were treated with rapamycin in Dulbecco s Modified Eagle s Medium. Cytotoxicity of the cell lines were analyzed with the Trypan Blue Dye test, XTT method and apoptosis with acridine orange-ethidium bromide staining. Quantification of htert, EGFR and VDR gene expressions was performed. Results: Apoptosis was increased in cell lines with the IC 50 dose of rapamycin. When the cyototoxicity of rapamycin was evaluated in the LNCaP cell line, a prominent cyototoxicty was observed. htert mrna expressions decreased in the PC3 cell line. When the gene expressions of VDR and EGFR were analyzed, a distinctive reduction was observed in the VDR gene expression in the PC-3 and DU 145 cell lines. In terms of the EGFR gene expression; a decrease was determined in all cell lines. The most remarkable result of our scientific research is the lack of the VDR gene expression in the LNCaP cell line. Conclusion: The prospect of a new molecular approach to treatment of prostate cancer was raised. Key Words: Rapamycin, prostate cancer, htert, EGFR, VDR. Yazışma Adresi: Çığır BİRAY AVCI Ege Üniversitesi Tıp Fakültesi, Tıbbi Biyoloji Anabilim Dalı, İzmir, Türkiye Makalenin Geliş Tarihi: Kabul Tarihi:

2 Giriş Fosfoinositid-3-kinaz (PI3K) yolağı kanser gelişimine dahil olan kritik yolaklardan biridir. Bu yolak epidermal büyüme faktörü (EGF) gibi büyüme faktörleri tarafından aktive edilebilir ve çok sayıda önemli aşağı regülasyon sinyal yolağının komponentlerinin aktivasyonuna öncülük etmektedir. Bu komponentlerden biri rapamisinin memelilerdeki hedefi proteinidir (mtor). mtor un aktivasyonu, sonuçta hücre bölünmesine öncülük eden aşağı-akış moleküllerinin ardarda aktivasyonu ile sonuçlanmaktadır. Klinik denemelerdeki güncel mtor inhibitörleri; rapamisin ve temsirolimus (CCI-779) tur (1). Rapamisinin karsinogenezdeki etkileri ile ilgili önemli sayıda çalışma bulunmaktadır. Rapamisin, siklin D1 in degradasyonunu stimüle ederek, G1-S transisyonunu inhibe edebilmektedir. Ayrıca, aktive olmuş PI3K-AktmTOR yolağının indikatörü olan fosfo-p70 S6 kinazı aşağı regüle etmektedir (2). PI3K-Akt-mTOR sinyal yolağının aktivasyonu çok sayıda tümör tipinde tespit edilmiştir. Bu yolağın aktivasyonu da, kanser hücrelerinin kemoterapiye direnci, sağkalım, anjiyogenez, proliferasyon için önem taşımaktadır (3). Sonuç olarak, bu yolak moleküler-hedefli tedavide çekici bir hedef haline gelmektedir. Gerçekten, rapamisin tedavisinin doku kültürü sistemlerinde ümit vaad edici antitümör etkisi olduğu gösterilmiştir. (4). Rapamisin (sirolimus), Streptomyces hygroscopicus tan izole edilen, hücre içi reseptörü olan FK506 bağlayıcı protein (FKBP12) ye bağlanarak oluşturulan kompleks, mtor üzerindeki FKBP12-Rapamisin bağlayıcı domaine (FRB) bağlanan bir antifungal makrolid antibiyotiktir. İki yüz seksen dokuz kda ağırlığında geniş polipeptid, serin/treonin spesifik kinazdır. Yapısının mayadan memeli hücrelerine kadar çok iyi korunduğu bilinmektedir. İnsan, fare ve sıçan TOR proteinleri aminoasit düzeyinde %95 benzerlik sergilerler. mtor aminoterminal uçta 20 kadar birbiri ardına dizilmiş tekrar motifleri içermekte, Huntingtin elongasyon faktörü 3, protein fosfataz 2A nın A (PP2A) alt ünitesini içermektedir. mtor hücre büyümesi ve proliferasyonunun anahtar regülatörü olarak bilinmektedir. Translasyon sürecinde fosforilasyona başlayan iki protein bulunmaktadır. İlk hedef protein, ribozomal p70s6 kinazdır (S6K1). İkincisi ise ökaryotik translasyon başlama faktörü (eif4e) supresörü olan 4E-BP1 dir. Fosforlanmış 4E-BP den eif4e nin salınımı, aktif eif4e kompleksinin formasyonuna neden olur, bu da mrna nın kap-bağımlı translasyonu için gereklidir. Rapamisin ve analogları hücre döngüsü progresyonunda G1 fazında G1 den S fazına kadar olan sinyal iletim yolaklarını düzenleyen immunosupresan ve antiproliferatif özellikleri ile bilinirler. Rapamisinin hem in vitro hem de in vivoda kanser hücrelerinin geniş oranda 8 proliferasyonlarını inhibe ettiği gösterilmiştir. Bu ajanın günümüzde antikanser tedavilerin klinik gelişiminde kullanıldığı bilinmektedir. İnsan kanser hücrelerindeki preklinik çalışmalar, rapamisinin prostat, küçük hücreli akciğer, glioblastom, T hücreli lösemi, renal hücre ve göğüs kanserleri tedavisinde etkili olabileceğini göstermiştir. Rapamisin FKBP 12 adlı immunofilin ailesinden FK 506 bağlayıcı proteinlerden birine bağlanarak serin treonin kinaz yolağının inhibisyonu ile antiproliferatif etkiler sergilemektedir. mtor, Fosfatidilinositol-3 kinaz/akt (PI3K/Akt) sinyal yolağının bir aşağı akış mediatörü olmakla beraber hücresel fonksiyonların düzenlenmesinde kritik rol oynamaktadır. Fosfoinositit3-kinaz (PI3K) ailesi enzimleri fosfoinositoltrifosfat (PIP3) gibi 3-fosfoinosititlipid ikincil mesajcılarının üretilmesinden sorumludurlar. Yolak anjiyogenez, motilite, sağkalım ve proliferasyonu içeren çok sayıda temel hücresel özellikleri yöneten sinyallerin kaskadını kontrol etmektedir. PI3K-Akt yolağının aktivasyonu için çok sayıda mekanizma bir seri kanserde tanımlanmıştır. Kanserde PI3K yolağının bloke edilmesi ile ilgili görüşler mevcuttur. PI3K daki onkojenik kinazların inhibe edilmesi bir strateji olarak bilinmektedir (5). D vitamini reseptörü (VDR) geni, kromozom 12q13-14 bölgesinde lokalizedir. Gelişim, farklılaşma ve çeşitli uyaranlara karşı hızlı bir şekilde cevap vermekle görevlidir. D Vitamini, hücre içi reseptörleriyle etkileşerek gen ekspresyonunu düzenlemektedir. Bu mekanizma iyi bilinmemekle birlikte, kalsitriol sentezi ve metabolizmasına bağlıdır. Kalsitriol (1,25 dihidroksi D Vitamini 3) D Vitamini nin aktif metabolitidir. VDR ekspresyonunun düzenlenmesinin hücre tipine özel olduğu ve hem transkripsiyonel hem de transkripsiyon sonrası mekanizmaları içerdiği farklı hücre serileri ile ilgili çalışmalara ihtiyaç vardır (6). VDR nin prostat kanserindeki önceki tanımlamaları ve takip eden kalsitriol etkilerinin incelenmesi prostat kanseri (PCa) hücre hatları etrafında merkezlenmiş olmasına rağmen kalsitriolün normal prostat dokusunda da önemli bir rol oynadığı görülmektedir. Peehl ve ark. (7) taze olarak elde edilen opere prostat örneklerinde ve prostatın epitelyum ve stromal hücrelerinde VDR nin varlığını rapor etmişlerdir. Benin prostat hiperplazilerin cerrahi örneklerinden elde edilen primer kültürler de ayrıca VDR eksprese etmektedir. VDR hem epitelyum hem de stromal hücre kültürlerinde bulunmaktadır fakat VDR, grandula epitelyum hücrelerine oranla, stromal fibroblastlarda daha düşük seviyede görülmüştür. Prostat dokusundaki bölgesi VDR nin miktarını etkilememiştir, periferal bölge ve merkezi bölge kültürleri aynı VDR içeriğine sahiptirler (7). Krill ve ark. (8) VDR ekspresyonunu farklı yaşlardaki donörlerden elde Ege Tıp Dergisi / Ege Journal of Medicine

3 ettikleri normal prostat bezinde çalışmış ve VDR ekspresyonunun yaşla değiştiğini, 50 li yaşlarda bir pik yaptığını ve sonrasında inişe geçtiğini bulmuşlardır (8). Kalsitriol yenidoğan sıçan prostat epitel hücreleri üzerinde (9) ve insan prostat epitelyum hücrelerinde (8) anti-proliferatif etki göstermektedir. Bu çalışmalar D vitamininin normal prostat fizyolojisinde ve gelişiminde bir rolü olduğunu desteklemektedir. Miller ve ark (1992) LNCap insan PCa hücrelerinde VDR varlığını bulmuşlardır (10). Skowronski ve ark. (11) tarafından üç farklı PCa hücre hattında (LNCaP, PC- 3 ve DU 145) VDR nin ve kalsitriolün anti-proliferatif etkisinin (1 100 nm) gösterilmesi, prostat biyolojisinde D Vitamini nin direkt rolünün araştırılmasını ve hormonun PCa tedavisinde nasıl faydalı olabileceği ile ilgili çalışmaları başlatmıştır. Hücrede erişilen kalsitriol hormonunun yüksek konsantrasyonunun günışığı, beslenme, sirkülasyondaki transport ve metabolizmanın etkileşimi sonucu olduğu açıktır ve hala aktif hormonların taşınımının inhibe veya stimüle olması için reseptör ve post-reseptör sinyal yolaklarına ihtiyaç vardır. Örneğin, bozulmamış VDR eksikliği veya VDR deki mutasyonların fonksiyonlarının kaybı kalsitriolün herhangi bir seviyesine ona yanıtı azaltabilir veya elimine edebilir. Birçok faktör, kalsitriole yanıtın büyüklüğünü değiştirerek hedef hücrelerde VDR nin konsantrasyonunu regüle edebilir (12). Prostat kanseri hastalarında immünohistokimya kullanılarak VDR proteininin ekspresyonunun incelendiği bir çalışma prostat tümörlerindeki yüksek VDR ekspresyonunun azalan letal kanser riski ile ilişkili olduğu sonucuna varmıştır (13). Bu durum da, VDR yolağının PCa progresyonunu inhibe ettiğini ve bunun sadece 25(OH)D kan değerlerine değil, VDR içeriğine bağlı olduğunu önerir. Birçok epidemiyolojik çalışma, D Vitamini eksikliğinin PCa riskini artırdığını ve yüksek miktardaki D vitamininin daha iyi prognoz ve gelişmiş sonuçlarla ilişkili olduğunu belirtmektedir. Hücre ve hayvan çalışmaları PCa da D Vitamini nin anti-proliferatif rolünün VDR nin önemini ve ekstra-renal dokulardaki CYP27B1 ve CYP24 enzimleri tarafından oynanan rolleri vurgulamışlardır. Ayrıca son veriler, VDR nin yüksek konsantrasyonlarının agresif hastalığa karşı koruyucu olduğunu önermektedir. Preklinik veriler inandırıcı ve ikna edici olmasına rağmen PCa lı erkeklerde D, kalsitriol veya çeşitli D Vitamini analogları kullanılarak yapılan klinik denemelerin sonuçları hayal kırıklığına sebep olmuştur. Araştırmacılar D Vitamini eksikliğinden kaçınmanın iskelet homeostazisine olan aşikar yararlarının yanında kanser insidansını azaltmada önemli bir amaç olabileceğine inanmışlardır. Kalsitriol bazı kanser hücrelerinde apoptozu indüklemesine rağmen esas görevi anti-proliferatif, anti-inflamatuar ve pro-farklılaşma etkileridir. Bu nedenle, tek başına uygulanan kalsitriol teröpotik olarak yararlı olamayabilir. D Vitamini veya kalsitriolün klinik kanser gelişiminden önce kemoprevensiyonda veya diğer tedavilere bir ek olarak erken dönem kanser hastalarının hastalıklarının ilerlemesini ertelemede çok etkili olabileceğini düşünmüşlerdir (14). Kalsitriol için güvenli bir dozu belirlemek zorken, en yüksek dozda uygulamanın çok ciddi yan etkiler yaratmadan tolere edilebileceği ve D Vitamini, kalsitriol veya analogları gibi diğer ilaçlarla kombinasyonlarının tedaviyi artırdığı ve PCa tedavisi için yararlı olduğu sonucuna varmışlardır. Yararları erkeklerde kanıtlanmasa da preklinik veriler ileride erkeklerde klinik çalışmalar yapılacağının bir göstergesidir. Epidermal büyüme faktör reseptörü (EGFR) geni kromozom 7p11.1-q11.1 bölgesinde lokalizedir. EGFR, 170 kda bir glikoprotein olup ekstraselüler ligand bağlayan ve intraselüler tirozin kinaz aktivitesi olan bölgeye sahiptir. EGFR ailesi yapısal olarak benzer 4 reseptör tirozin kinaz proteininden oluşmaktadır: ErbB-1 (EGFR), ErbB-2 (HER-2), ErbB-3 (HER-3), ErbB-4 (HER-4). Bu dört molekülün hepsinin hücre içi ve dışı ve transmembran kısımları mevcuttur. Epidermal büyüme faktörü (EGF), transforme edici büyüme faktörü (TGF)- gibi ligandlar bu reseptörlere bağlanarak normal ve malin epitelyal hücrelerin büyümesinde ve diferansiyasyonunda etkilidir. EGFR aktivasyonu ile tümör proliferasyonu, migrasyonu, stromal invazyon, neovaskülarizasyon ve apoptoza direnç ortaya çıkmaktadır. EGFR meme, over, kolon, prostat, böbrek ve akciğer kanserlerinde yüksek oranda ifade edilmektedir. Hormonal tedaviye, sitotoksik ajanlara ve radyoterapiye direncin göstergesidir. Androjene bağlı kanser ve normal prostat epitel ilerlemesi sonunda, hormon bağımsız prostat kanseri çok farklı büyüme düzenleyici sinyaller içeren karmaşık bir süreç içine girer. EGFR gen aktivasyonu prostat kanseri hücre büyümesinde etkili olmaktadır. Prostat kanserinde prostat in situ neoplazi olarak isimlendirilen ve hastalığın erken evrelerinde tespit edilen artmış telomeraz aktivitesi tanımlanmıştır. Prostat biyopsilerinden telomeraz aktivitesinin değerlendirilmesi bu malignite için değerli bir tanı markırı olarak bilinmektedir. Kanser gelişiminde telomeraz aktivitesinin moleküler mekanizması hala bilinmemektedir. Prostat kanseri kanser ölümlerinin ikinci nedeni ve en sık tedavi edilen malignite olarak bilinmektedir. Rapamisin ile mtor un inhibisyonu, fosfataz ve tensin (PTEN) negatif tümörlerde kısmen efektiftir. Daha önceki bulgulardan yola çıkarak rapamisinin prostat kanseri hücre hatlarında PI3K /mtor inhibisyonunun araştırılması hedeflenmiştir (15). Çalışmada, insan prostat kanseri hücre modellerinde (PC-3, DU 145 ve LNCaP) rapamisinin sitotoksik ve Cilt 52 Sayı 1 Mart 2013 / Volume 52 Issue:1 March

4 apoptotik etkileri değerlendirilip telomeraz aktivitesi, EGFR ve VDR gen ekspresyonları üzerine etkisinin araştırılması amaçlanmıştır. Gereç ve Yöntem Hücre hatları LNCaP (insan prostat adenokarsinomu, lenf nodu metastazı-androjen bağımlı), PC-3 (insan prostat adenokarsinomu, 4. evre androjen bağımsız) ve DU145 (insan prostat karsinomu beyin metastazı-hormon bağımsız) prostat kanseri hücre hatları % 10 fötal sığır serumu (FBS), 100IU/ml penisilin ve 100 mg/ml streptomisin içeren DMEM da 1, 10, 25, 50 ve 100nM dozda rapamisin ile muamele edilip 37 0 C de, % 95 nemli ortamda % 5 CO 2 li etüvde 24, 48 ve 72 saatlik sürelerde inkübe edilmişlerdir. Çalışmaya 1x10 5 /ml hücre olacak şekilde başlanmıştır. Sitotoksisite testleri Tripan mavisi testi: Hücre canlılığı tripan mavisi testi ile doz ve zamana bağlı olarak değerlendirilmiştir. Canlı hücreler tripan mavisi boyasına geçirgen olmayıp ölü hücreler bu boyayı hücre içine aldıklarından mavi renkte görülmektedirler. Bu özellikler doğrultusunda hücreler, canlılık ve çoğalma yönünden değerlendirilmiştir. Neubauer lamda 1x10 5 /ml hücre temel alınarak ikilenme zamanı tespit edilmiştir. XTT yöntemi: Rapamisinin sitotoksik etkisi XTT yöntemi kullanılarak değerlendirilmiştir. Hücreler 24, 48, 72. saatlerde aynı rapamisin konsantrasyonlarında 3 kuyucuk olacak şekilde 96 lık mikroplatelerde XTT (2,3,- bis[2-metoksi-4-nitro-5-sülfofenil]-2h-tetrozolium-5- kaboksanilit tuzu) solüsyonu kullanılarak spektrofotometrik ELISA yöntemi ile değerlendirilmiştir. Reaktifler 50/1 (işaretleme ajanı/aktivasyon ajanı) oranında olacak şekilde karıştırılarak hazırlanmıştır. XTT suda çözünen bir tetrazolium tuzu olmakla beraber canlı hücrede mitokondrilerindeki dehidrogenaz enzimi ile parçalandığında çözülebilir formazana dönüşmektedir. Formazandan kaynaklanan turuncu rengin yoğunluğu metabolik olarak aktif hücrelerin sayısı ile orantılıdır. Reaksiyon ELISA cihazında okunup kantite edilmiştir. ELISA cihazında 490 nm dalga boyunda ve 630 nm referans aralığında her bir kuyucuğun absorbans değeri (OD) okunmuştur. Hücre canlılığı yüzdesi her bir kuyucukta ölçülen optik dansite değerinin kontrol optik dansite değerine bölünmesi ve yüz ile çarpılması ile hesaplanmıştır. IC 50 değerleri nonlinear regresyon analizine göre [Y = alt + (üst-alt) / (1 +10(Log IC50 - X) x HillSlope) GraphPad Prism yazılımı] belirlenmiştir. Akridin oranj - etidyum bromür boyası ile apoptoz saptanması Apoptoz değerlendirmesi akridin oranj-etidyum bromür boyası kullanılarak yapılmıştır. Bu boya canlı ve ölü hücreler ile nükleusta ve hücre membranındaki nekroz ve apoptoza bağlı değişiklikler hakkında bilgi vermektedir. Vital bir boya olan akridin oranj, hem canlı hem ölü hücreleri boyarken, etidyum bromür ise sadece membran bütünlüğü bozulmuş hücreleri boyamaktadır. Canlı hücreler morfolojik olarak üniform yeşil renkli boyanırlar. Apoptozun erken dönemindeki hücreler de yeşil renkte boyanmakta ancak nükleuslarında, kromatin kondensasyonu ve nükleer fragmantasyonu gösteren parlak yeşil renkli noktalanmalar içerirler. Geç apoptotik dönemdeki hücreler de nekrotik hücreler gibi etidyum bromür ile turuncu renkte boyanırlar. Çalışmada hücreler etidyum bromür akridin oranj boyaları ile boyandıktan sonra floresan mikroskop kullanılarak morfolojik olarak değerlendirilmiştir. Rapamisinin prostat hücre hatlarındaki apoptotik ve nekrotik etkilerinin gözlenmesi amacıyla her alandan en az 450 tane hücre sayılarak canlı nekrotik ve apoptotik hücre sayıları ayrı ayrı belirlenmiştir. htert, EGFR ve VDR gen ekspresyonu kantifikasyonu htert mrna ekspresyonu kantitatif tespiti, Light Cycler TeloTAGGG htert kantifikasyon kiti (Roche Applied Science) (Mannheim, Almanya) kullanılarak Real Time Online RT-PCR ile çalışılmıştır. Tüm kantifikasyon basamakları kit prosedürüne göre yapılmıştır. Rapamisinin IC 50 dozunda, 72. saatte tüm hücre hatlarından total RNA izolasyonu yapılmış ve komplementer DNA eldesi ardından EGFR ve VDR gen ekspresyonları Real Time Online RT-PCR ile çalışılmıştır. EGFR ve VDR gen ekspresyonları belirlemede kullanılan primer ve problar tarafımızdan tasarlanmıştır. İlgili genlerin primer ve prob dizileri aşağıdadır: Gen İleri Primer Geri Primer Prob EGFR cagccacccatatgtaccatc aactttgggcgactatctgc gctggatg GAPDH gaaggtgaaggtcggagtc gaagatggtgatgggatttc caagcttcccgttctcagcc 10 Ege Tıp Dergisi / Ege Journal of Medicine

5 VDR mrna ekspresyonu ve GAPDH primer/prob sekansı 5-3 VDR prob FAM-CCT GCC GGC TCA AAC GCT GTG- TAMRA VDR ileri primer CTC ATC TGT CAG AAT GAA CTC CTT VDR geri primer TCA CCA AGG ACA ACC GAC G GAPDH prob FAM-caa gct tcc cgt tct cag cc-tamra GAPDH ileri primer gaa ggt gaa ggt cgg agt c GAPDH geri primer gaa gat ggt gat ggg att tc Bulgular Rapamisin ile muamele edilmiş ve edilmemiş prostat kanseri hücre hatlarındaki hücre canlılığı Grafik-1 de gösterilmiştir. Sonuçlar değerlendirildiğinde tripan mavisi testine göre 72. saatte, DU145 ve LNCaP hücre hatlarında, sırasıyla 10, 25 ve 50 nm rapamisin muamelesinde viabilitede %50 azalma gözlenmiştir. PC3 hücre hattında 72. Saatte 10nM rapamisin muamelesi ile viabilitede önemli bir değişiklik gözlenmezken, 25 ve 50 nm konsantrasyonda ise viabilitedeki azalma % 50 den fazladır (Şekil-1). DU145, PC3 ve LNCaP hücre hatlarında rapamisinin 72. saatteki IC50 dozları sırasıyla; 11.08, ve 1.24 nm olarak XTT yöntemi ile tespit edilmiştir (Grafik2, r (DU145)=0,8810 p= 0,0204, r (PC3)=0,8471 p= 0,0333, r (LNCaP)=0,9547 p= 0,003). Rapamisinin LNCaP hücre hattında sitotoksisitesi değerlendirildiğinde belirgin sitotoksisite gözlenmiştir (Şekil-2). Apoptoz değerlendirildiğinde; PC-3, LNCaP ve DU 145 hücre hatlarında 72. saatte doza ve zamana bağlı apoptoz artışı gözlenmiştir (Şekil-3,4). htert mrna ekspresyonu değerlendirildiğinde ise PC-3 hücre hattında 72. saatte 1 nm dan itibaren % 50 ye varan düşüş saptanmıştır (Şekil-5). PC-3, LNCaP ve DU 145 hücre hatlarında 72. saatte VDR ve EGFR gen ekspresyonları değerlendirildiğinde; hormon bağımsız prostat kanseri hücre hatları PC-3 ve DU 145 te rapamisin verilmeyen kontrol grubuna oranla VDR ekspresyonunda belirgin bir düşüş gözlemlenirken, hormon bağımlı prostat kanseri hücre hattı olan LNCaP te VDR gen ekspresyonu gözlenmemiştir. EGFR gen ekspresyon seviyesinde ise tüm hücre hatlarında kontrol grubuna oranla belirgin bir düşüş saptanmıştır (Şekil-6). VDR ve EGFR ekspresyonları için kantitatif PCR da housekeeping gen olarak gliseraldehit 3 fosfat dehidrogenaz (GAPDH) kullanılmıştır. Tüm deneyler 3 kez tekrar edilmiştir. Şekil-1. Rapamisinin Tripan mavisi testi ile belirlenen sitotoksisitesi. Şekil-2. Rapamisinin XTT testi ile belirlenen sitotoksisitesi. Cilt 52 Sayı 1 Mart 2013 / Volume 52 Issue:1 March

6 Şekil-3. Rapamisinin apoptotik etkisi (AO/EtBr). C EA N G A Şekil-4. Akridin Oranj Etidyum Bromid ile canlı (C), nekrotik (N), erken (EA) ve geç (GA) apoptotik hücreler (40x). Şekil-5. htert mrna ekspresyonunun rölatif kantitasyonu. Şekil-6. VDR ve EGFR gen ekspresyonlarının kontrole göre kat değişimleri. 12 Ege Tıp Dergisi / Ege Journal of Medicine

7 Tartışma Çalışmamızda rapamisinin PC-3, LNCaP ve DU 145 hücre hatlarında hücre viabilitesi, sitotoksisitesi, apoptozu ve htert mrna, EGFR ve VDR gen ekspresyonları üzerine etkisi saptanmıştır. İnsan kanserleri çoğunlukla proliferasyona, sağkalıma, invaziv ve metastatik yeteneklerin kazanımına sebep olan genetik ve epigenetik değişikliklerin birikimi sonucu epitelyum hücrelerinden köken alırlar. Epidemiyolojik ve laboratuvar araştırmaları kanser gelişimi ile ilişkili olan değişikliklerin bireyin genetiği ve çevresel risk faktörleri arasındaki kompleks ilişkiler sonucu olduğunu belirtmiştir. Çevresel faktörlerin tüm kanser risklerine önemli ölçüde katkıda bulunduklarını öneren veriler temelinde, kanser engelleme stratejilerinde beslenme faktörleri ve spesifik yaşam tarzını kullanmaya odaklanılmıştır. Beslenme faktörleri arasında D Vitamini, epidemiyolojik, laboratuar, hayvan ve klinik çalışmalar içinde kanseri önlemeyle ilişkisi artmaktadır. Epidemiyolojik deliller, kolon, rektal ve meme kanserinin önlenmesinde D vitaminin, D vitamini duyarlı olabilecek mesane, beyin, endometrial duvar, özafagus, safra kesesi, böbrek, akciğerler, yumurtalıklar, pankreas, prostat ve mide kanserlerine göre daha etkili olduğunu göstermektedir. Mekaniğe ait olarak D Vitamini 3 ün biyolojik olarak aktif formu olan 1α25 dihidroksi D Vitamini 3 (1,25D), her dokuda gen ekspresyonu ve sinyal transdüksüyonunun global bir regülatörüdür. Epitelyum hücrelerinde VDR ve ligand 1,25D farklılaşmış fenotipe katkıda bulunur ve hücreleri endojen ve eksojen streslere karşı savunan yolakları destekler. İnsan tümörlerinde ve kanser hücre hatlarında fonksiyonel VDR nin varlığı, bu reseptörün kanser tedavisi için bir hedef olabileceğini göstermiştir. Artan D Vitamini durumu, kanserli hastalarda tedaviye yanıtı veya sağkalımı geliştirebilir. Birçok çalışma, 1alfa,25 dihidroksivitamin D3 (1,25D) nin gelişme arestini indüklediğini, hücre ölümünü tetiklediğini veya in vitroda kanser hücrelerinin ve in vivoda tümörlerin farklılaşmasını desteklediği doğrulamıştır Bu sebeple dolaşımdaki 25-hidroksivitamin D (25D) nin yüksek kan değerleri kanserli hastalarda daha iyi sağkalımla korelasyon göstermesi şaşırtıcı değildir. Bu veriler tam olarak tutarlı değildir fakat bazı çalışmalar D Vitamini metabolizmasının ve VDR ekspresyonun ileri kanserlerde iptal olduğunu belirtmektedir, öyle ki D Vitamini yolağının endojenik aktivitesi anti-tümör etkileri tetiklemede çok yeterli değildir. Bu ilerlemiş olgularda daha etkili D Vitamini tabanlı ilaçlar terapötik değere sahip olabilir. Düzinelerce sentetik D Vitamini analogları, bireysel olarak veya kemoterapötik ilaçlar veya radyasyon ile kombine olarak hayvan kanser modellerinde etki göstermiştir (16). Bea-Jump ve ark. yaptığı çalışmada rapamisinin over, serviks ve endometriyum kanserlerinde potansiyel olarak hedeflenmiş terapötik bir ajan olduğu bildirilmiştir. Bu kanserlerde, rapamisinin, bağımsız bir mekanizma ile ve htert transkripsiyonunun supresyonu öncülüğünde hücre proliferasyonunda, G1 hücre döngüsü arrestinin inhibisyonunu sağlayarak antitümör etkiler sergilediği görülmüştür. Over ve serviks kanser hücre hatlarında, 20 nm rapamisinin htert mrna düzeyini dikkate değer bir şekilde düşürdüğü bulunmuştur (17). Nanni ve ark. yaptığı çalışmada ise prostat hücre hatlarında östrojen reseptörleri aracılığı ile sinyalin düzenlenmesi ve normal ve malin prostat epitel hücrelerinde telomeraz aktivitesinin kontrolünün prostat kanserinin takibinde kullanılan hormona bağımlı tedavilere biyolojik yanıt araştırılmıştır. Bulunan sonuçlar östrojen reseptörleri ile prostat kanserinin direkt kontrolünü htert gen ekspresyonu ve telomeraz aktivitesinin, prostat kanserinde olası bir terapötik hedefi simgeleyen bir transkripsiyonel regülatör olabileceği bildirilmiştir (18). Bu bilgilerin ışığı altında, rapamisinin telomeraz enzimi üzerine etkisi göz önünde bulundurularak, prostat kanserli olgularda ex-vivo ve klinik faz çalışmalarının yapılması ile tedavi protokolünde yer alabileceğini düşünmekteyiz. Rapamisinin IC 50 dozunun EGFR gen ekspresyonunda azalma sağlaması onkojenik özelliğinden dolayı anlamlı olarak değerlendirilmiştir. Petrylak ın yaptığı bir çalışmaya göre, dosetakselin kemik ve tümör damarlanmasını hedefleyen ajanlarla ve D vitamini reseptörü ile kombinasyonu prostat kanserinde yeni bir paradigma olarak karşımıza çıkmaktadır (19). Bu bağlamda rapamisinin VDR gen ekspresyonunu baskılaması ümit vericidir. Androjen bağımlı prostat kanseri hücre hattı olan LNCaP te, VDR gen ekspresyonu saptanmamıştır. Saptanan bu sonuç; VDR gen ekspresyonunun, progresyonda önemli olduğunu ve bu bulgunun diğer hormon bağımlı prostat kanseri hücre hatlarındaki çalışmalar ile desteklenmesi gerektiğini düşündürmektedir. Tüm literatür bilgileri ışığında, prostat kanserinin multipl sinyal yolakları ile etkileşimde olduğu bilindiğinden, çoklu sinyal yolaklarındaki genlerin ekspresyonlarının ayrıntılı bir şekilde irdelenmesi, hormon bağımlı LNCaP hücre hattında VDR gen ekspresyonunun yokluğunun hangi gen/genlerin ekspresyonlarındaki değişiklikler sonucu gerçekleştiğinin incelenmesi ve ilgili gen değişimlerinin daha sonraki çalışmalarda protein düzeyinde araştırılmasının doğru bir ilerleme olacağına inanmaktayız. Cilt 52 Sayı 1 Mart 2013 / Volume 52 Issue:1 March

8 Kaynaklar 1. Wang Y, Mikhailova M, Bose S, Pan CX, devere White RW, Ghosh PM. Regulation of androgen receptor transcriptional activity by rapamycin in prostate cancer cell proliferation and survival. Oncogene 2008;27(56): Nozawa H, Watanabe T, Nagawa H. Phosphorylation of ribosomal p70 S6 kinase and rapamycin sensitivity in human colorectal cancer. Cancer 2007;251(1): Nicholson KM, Anderson NG. The protein kinase B/Akt signalling pathway in human malignancy. Cell Signal 2002;14(5): Fung AS, Wu L, Tannock IF. Concurrent and sequential administration of chemotherapy and the mammalian target of rapamycin inhibitor temsirolimus in human cancer cells andxenografts. Clin Cancer Res 2009;15(17): Huang S, Houghton PJ. Targeting mtor signaling for cancer therapy. Curr Opin Pharmacol 2003;3(4): Çakır OÖ, Tunalı EN. The role of VDR polymorphisms in CaOX kidney stone formation. J Cell Mol Biol 2010;8(2): Peehl DM, Skowronski RJ, Leung GK, Wong ST, Stamey TA, Feldman D. Antiproliferative effects of 1,25-dihydroxyvitamin D3 on primary cultures of human prostatic cells. Cancer Res 1994;54(3): Krill D, Stoner J, Konety BR, Becich MJ, Getzenberg RH. Differential effects of vitamin D on normal human prostate epithelial and stromal cells in primary culture. J Urol 2000;164(5): Konety BR, Leman E, Vietmeier B, Arlotti J, Dhir R, Getzenberg RH. In vitro and in vivo effects of vitamin D (calcitriol) administration on the normal neonatal and prepubertal prostate. J Urol 2000;164(5): Miller GJ, Stapleton GE, Ferrara JA, et al. The human prostatic carcinoma cell line LNCaP expresses biologically active, specific receptors for 1a,25-dihydroxyvitamin D3. Cancer Res 1992;52(3): Skowronski RJ, Peehl DM, Feldman D. Vitamin D and prostate cancer: 1,25 dihydroxyvitamin D3 receptors and actions in human prostate cancer cell lines. Endocrinology 1993;132(5): Krishnan AV, Feldman D. Regulation of vitamin D receptor abundance. In: Feldman D, Glorieux FH, Pike JW (eds). Vitamin D. San Diego: Academic Press; 1997: Hendrickson WK, Flavin R, Kasperzyk JL, et al. Vitamin D receptor protein expression in tumor tissue and prostate cancer progression. J ClinOncol 2011;29(17): Krishnan AV, Trump DL, Johnson CS, FeldmanD. The role of vitamin D in cancer prevention and treatment. Endocrinol Metab Clin North Am 2010;39(2): Jhawer M, Goel S, Wilson AJ, et al. PIK3CA mutation/pten expression status predicts response of colon cancer cells to the epidermal growth factor receptor inhibitor cetuximab. Cancer Res 2008;68(6): Welsh J. Cellular and molecular effects of vitamin D on carcinogenesis. Arch Biochem Biophys 2012;523(1): Bae-Jump VL, Zhou C, Gehrig PA, Whang YE, Boggess JF. Rapamycin inhibits htert telomerase mrna expression, independent of cell cycle arrest. Gynecol Oncol 2006;100(3): Nanni S, Narducci M, DellaPietra L, et al. Signaling through estrogen receptors modulates telomerase activity in human prostate cancer. J Clin Invest 2002;110(2): Petrylak DP. New paradigms for advanced prostate cancer. Rev Urol 2007;9(Suppl 2):S3-S Ege Tıp Dergisi / Ege Journal of Medicine

PI3K/AKT/mTOR Yolağı

PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı Phospha'dilinositol 3-kinaz/protein kinaz B/mammalian target of rapamycin (PI3K/Akt/mTOR) Normal hücresel fonksiyonların yerine ge'rilebilmesi için gerekli olan





Kanser Tedavisi: Günümüz

Kanser Tedavisi: Günümüz KANSER TEDAVİSİNDE MOLEKÜLER HEDEFLER Doç. Dr. Işık G. YULUĞ Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü yulug@fen.bilkent.edu.tr Kanser Tedavisi: Günümüz Geleneksel sitotoksik ilaçlar ve


Anahtar Kelimeler: Apoptoz, Hücre döngüsü, Kanser kök hücresi, Multiselüler tümör sferoid, Prostat,Trabectedin

Anahtar Kelimeler: Apoptoz, Hücre döngüsü, Kanser kök hücresi, Multiselüler tümör sferoid, Prostat,Trabectedin [PS14] Trabectedin in (Yondelis; ET-743) CD133+/ CD44+ İnsan Prostat Kanser Kök Hücresi Üzerindeki Etkilerinin İki Boyutlu (2D) ve Üç Boyutlu (3D) Sistemde İncelenmesi Eda Açıkgöz 1, Ümmü Güven 2, Fahriye



MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri


KHDAK da Güncel Hedef Tedaviler

KHDAK da Güncel Hedef Tedaviler KHDAK da Güncel Hedef Tedaviler Prof.Dr. Adnan Aydıner İstanbul Üniversitesi Onkoloji Enstitüsü İstanbul William, WN et al. Nature Reviews, 2009 a Güncel Hedef Tedaviler EGFR İnhibitörleri EGFR: transmembran



MESANE TÜMÖRLERİNİN DOĞAL SEYRİ MESANE TÜMÖRLERİNİN DOĞAL SEYRİ ve MOLEKÜLER PROGNOSTİK FAKTÖRLER Prof. Dr. Levent Türkeri Üroloji Anabilim Dalı Marmara Üniversitesi Tıp Fakültesi Mesane Tümörü (Transizyonel Hücreli Karsinom) Yüzeyel









BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ BCC DE GÜNCEL Prof. Dr. Kamer GÜNDÜZ Celal Bayar Üniversitesi Deri ve Zührevi Hastalıklar Anabilim Dalı-MANİSA Bazal Hücreli Kanser (BCC) 1827 - Arthur Jacob En sık rastlanan deri kanseri (%70-80) Açık


SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD

SİNYAL İLETİMİ ve KANSER. Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD SİNYAL İLETİMİ ve KANSER Dr. Lale Doğan Hacettepe Üniversitesi Onkoloji Enstitüsü Temel Onkoloji ABD Reseptör Tirozin Kinaz (RTK)= Protein Tirozin Kinaz RTK lar hücre membranında yerleşim gösterir. İnsan








Malignite ve Transplantasyon. Doç. Dr. Halil Yazıcı İstanbul Tıp Fakültesi Nefroloji Bilim Dalı

Malignite ve Transplantasyon. Doç. Dr. Halil Yazıcı İstanbul Tıp Fakültesi Nefroloji Bilim Dalı Malignite ve Transplantasyon Doç. Dr. Halil Yazıcı İstanbul Tıp Fakültesi Nefroloji Bilim Dalı Sunum Planı -Pretransplant malignitesi olan alıcı -Pretransplant malignitesi olan donör -Posttransplant de


Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması

Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik İmmünohistokimyanın Karşılaştırılması Küçük Hücreli Dışı Akciğer Karsinomlarının EGFR Mutasyon Analizinde Real-Time PCR Yöntemi ile Mutasyona Spesifik nın Karşılaştırılması Dr.M.Çisel Aydın, Doç.Dr.Sevgen Önder, Prof.Dr.Gaye Güler Tezel Hacettepe





Docosahexaenoic Acid Induces Cell Death in Human Non- Small Cell Lung Cancer Cells by Repressing mtor via AMPK Activation and PI3K/Akt Inhibition

Docosahexaenoic Acid Induces Cell Death in Human Non- Small Cell Lung Cancer Cells by Repressing mtor via AMPK Activation and PI3K/Akt Inhibition Docosahexaenoic Acid Induces Cell Death in Human Non- Small Cell Lung Cancer Cells by Repressing mtor via AMPK Activation and PI3K/Akt Inhibition DUYGU PELİSTER - 20130701008 İSTANBUL BİLİM ÜNİVERSİTESİ



KANSEROLOJİDE FARMAKOGENOMİ KANSEROLOJİDE FARMAKOGENOMİ Prof.Dr. Işık TUĞLULAR Ege Üniversitesi İlaç Geliştirme ve Farmakokinetik Araştırma - Uygulama Merkezi ( ARGEFAR ) Müdürü Farmakogenomik Kursu 24 Mart 2010 ANTALYA İLAÇ Klinik





En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı





Prostat Kanseri Tanısında PSA yı Nasıl Kullanalım

Prostat Kanseri Tanısında PSA yı Nasıl Kullanalım Prostat Kanseri Tanısında PSA yı Nasıl Kullanalım Dr. Ö. Levent ÖZDAL Türkiye Yüksek İhtisas Hastanesi Üroloji Kliniği, Ankara Tarihçe 1979 da Wang ve ark. Prostat dokusunda PSA yı pürifiye ettiler Serumda


İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Hücre iletişimi Tüm canlılar bulundukları çevreden sinyal alırlar ve yanıt verirler Bakteriler glukoz ve amino asit gibi besinlerin





Rastgele (Stokas7k) kanser modeli - Tümör içindeki her hücre yeni bir kanseri başla5r

Rastgele (Stokas7k) kanser modeli - Tümör içindeki her hücre yeni bir kanseri başla5r Kanser Kök Hücre Kanser Modelleri Rastgele (Stokas7k) kanser modeli - Tümör içindeki her hücre yeni bir kanseri başla5r Kök hücre (Hiyerarşi) modeli - Tümör içindeki bazı hücreler yeni bir kanseri başla5r





TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS. Reha Aydın. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi

TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS. Reha Aydın. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS Reha Aydın İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS Reha Aydın, İstanbul Üniversitesi, Cerrahpaşa Tıp Fakültesi Türkçe



ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı Dönem I. 2. Ders Kurulu II. HÜCRE BİLİMLERİ-I Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Prof. Dr. Alirıza ERDOĞAN Yrd. Doç. Ders Kurulu


Renin-Angiotensin System Blockers May Prolong Survival of Metastatic Non-Small Cell Lung Cancer Patients Receiving Erlotinib

Renin-Angiotensin System Blockers May Prolong Survival of Metastatic Non-Small Cell Lung Cancer Patients Receiving Erlotinib Medicine (Baltimore). 2015 Jun;94(22):e887. doi: 10.1097/MD.0000000000000887. Renin-Angiotensin System Blockers May Prolong Survival of Metastatic Non-Small Cell Lung Cancer Patients Receiving Erlotinib


1. Giriş - Mesane kanseri - Tanı ve evrelendirme - Mesane kanseri ve iyon kanalları 3. Gereç ve yöntem 4. Bulgular 5. Tartışma

1. Giriş - Mesane kanseri - Tanı ve evrelendirme - Mesane kanseri ve iyon kanalları 3. Gereç ve yöntem 4. Bulgular 5. Tartışma Dr. GÜLAY GÜLEÇ CEYLAN, MD, PhD Yıldırım Beyazıt Üniversitesi Tıp Fakültesi Tıbbi Genetik ABD, Ankara 1. Giriş - Mesane kanseri - Tanı ve evrelendirme - Mesane kanseri ve iyon kanalları 3. Gereç ve yöntem


Metastatik Prostat Kanserinde Gelecekten Beklentiler

Metastatik Prostat Kanserinde Gelecekten Beklentiler Metastatik Prostat Kanserinde Gelecekten Beklentiler Dr Çağatay Arslan İzmir Üniversitesi MedicalPark İzmir Hastanesi Medikal Onkoloji Böl. 14.03.2015 Çeşme Prostat Kanserinde Hormonal Tedavinin Gelişimi





Hava Kirliliği ve Kanser

Hava Kirliliği ve Kanser Hava Kirliliği ve Kanser Dr. Hasan Bayram Gaziantep Üniversitesi Tıp Fakültesi Göğüs Hastalıkları Anabilim Dalı E-posta: bayram@gantep.edu.tr Ulusal Kanser Haftası Sempozyumu, Ankara, 2-4 Nisan 2014 İçerik


Rahim ağzı kanseri hücreleri doku kültürü mikroskopik görüntüsü.

Rahim ağzı kanseri hücreleri doku kültürü mikroskopik görüntüsü. Doç.Dr.Engin DEVECİ HÜCRE KÜLTÜRÜ Hücre Kültürü Araştırma Laboratuvarı, çeşitli hücrelerin invitro kültürlerini yaparak araştırmacılara kanser, kök hücre, hücre mekaniği çalışmaları gibi konularda hücre








Üroonkoloji Derneği. Prostat Spesifik Antijen. Günümüzdeki Gelişmeler. 2 Nisan 2005,Mudanya

Üroonkoloji Derneği. Prostat Spesifik Antijen. Günümüzdeki Gelişmeler. 2 Nisan 2005,Mudanya Prostat Spesifik Antijen ve Günümüzdeki Gelişmeler Prostat Kanseri 2004 yılı öngörüleri Yeni tanı 230.110 Ölüm 29.900 Jemal A, CA Cancer J Clin 2004 Kanserler arasında görülme sıklığı #1 Tümöre bağlı ölüm


Chapter 10. Summary (Turkish)-Özet

Chapter 10. Summary (Turkish)-Özet Chapter 10 Summary (Turkish)-Özet Özet Vücuda alınan enerjinin harcanandan fazla olması durumunda ortaya çıkan obezite, günümüzde tüm dünyada araştırılan sağlık sorunlarından birisidir. Obezitenin görülme


MEME KANSERİNDE TIBBİ TEDAVİ PRENSİPLERİ. Prof.Dr.Evin Büyükünal İç Hastalıkları Medikal Onkoloji Cerrahpaşa Tıp Fakültesi

MEME KANSERİNDE TIBBİ TEDAVİ PRENSİPLERİ. Prof.Dr.Evin Büyükünal İç Hastalıkları Medikal Onkoloji Cerrahpaşa Tıp Fakültesi MEME KANSERİNDE TIBBİ TEDAVİ PRENSİPLERİ Prof.Dr.Evin Büyükünal İç Hastalıkları Medikal Onkoloji Cerrahpaşa Tıp Fakültesi A.B.D İstatistiklerine Göre 180.000 MEME KANSERİ VAKASI MEVCUT İLK TEDAVİDEN SONRA



ECZACILIK FAKÜLTESİ BİYOKİMYA PROGRAM KOORDİNATÖRÜ Prof. Dr. Güldal MEHMETÇİK, gmehmetcik@neu.edu.tr YÜKSEK LİSANS DERSLERİ EBM 600 Uzmanlık Alanı Dersi Z 4 0 4 EBM 601 Biyokimya I S 3 0 3 EBM 602 Biyokimya I Laboratuvar S 0 3 1 EBM



HER2 POZİTİF HASTALIĞA YAKLAŞIM HER2 POZİTİF HASTALIĞA YAKLAŞIM Dr.Merih Güray Durak DEÜTF Patoloji ABD 9.Ekim.2014 İzmir Meme Hastalıkları Derneği Bilimsel Toplantısı Meme Kanserinde HER2 HER2 (human epidermal growth factor receptor


KANSER AŞILARI. Prof. Dr. Tezer Kutluk Hacettepe Üniversitesi

KANSER AŞILARI. Prof. Dr. Tezer Kutluk Hacettepe Üniversitesi KANSER AŞILARI Prof. Dr. Tezer Kutluk Hacettepe Üniversitesi Bir Halk Sağlığı Sorunu Şu an dünyada 24.600.000 kanserli vardır. Her yıl 10.9 milyon kişi kansere yakalanmaktadır. 2020 yılında bu rakam %50


Bazı Biyoaktif Bileşiklerin Kanser Hücrelerinde Farklı Ölüm Mekanizmalarını İndükleyici Etkilerinde Hücre İçi Kalsiyumun Rolü Yrd. Doç. Dr. Seval KORKMAZ FARGEM (Farmasötik( Araştırma Geliştirme Merkezi)


TTOD MEME KANSERİ GÜNCELLEME KURSU 13-14 HAZİRAN 2015 İSTANBUL 08:25-08:30 Açılış 08:00-08:30 Pratiği değiştiren çalışmalar. (salonda kahvaltı ile)

TTOD MEME KANSERİ GÜNCELLEME KURSU 13-14 HAZİRAN 2015 İSTANBUL 08:25-08:30 Açılış 08:00-08:30 Pratiği değiştiren çalışmalar. (salonda kahvaltı ile) TTOD MEME KANSERİ GÜNCELLEME KURSU 13-14 HAZİRAN 2015 İSTANBUL 08:25-08:30 Açılış 08:00-08:30 Pratiği değiştiren çalışmalar. (salonda kahvaltı ile) 1. Gün 1. Oturum: Meme kanserine giriş, Patoloji ve Alt



POLİKİSTİK OVER SENDROMU VE GENİTAL KANSER İLİŞKİSİ POLİKİSTİK OVER SENDROMU VE GENİTAL KANSER İLİŞKİSİ Prof. Dr. Fırat ORTAÇ Ankara Üniversitesi Tıp Fakültesi Kadın Hastalıkları ve Doğum AD. Jinekolojik Onkoloji Departmanı Polikistik Over Sendromu(PKOS)


Hücreler arası Bağlantılar ve Sıkı bağlantı. İlhan Onaran

Hücreler arası Bağlantılar ve Sıkı bağlantı. İlhan Onaran Hücreler arası Bağlantılar ve Sıkı bağlantı İlhan Onaran Doku organisazyonu: Hücrelerin bağlanması 1- Hücre-matriks bağlantıları: ekstraselüler matriks tarafından hücrelerin bir arada tutulması 2- Hücre-hücre





Böbrek Tümörlerinin Prognostik Kategorizasyonu

Böbrek Tümörlerinin Prognostik Kategorizasyonu Böbrek Tümörlerinin Prognostik Kategorizasyonu Dr. Özgür Yaycıoğlu Başkent Üniversitesi Tıp Fakültesi Üroloji A.D Adana Uygulama ve Araştırma Merkezi Ürolojik Cerrahi Derneği Böbrek Tümörü ve BPH Toplantısı,





Kolesterol Metabolizması. Prof. Dr. Fidancı

Kolesterol Metabolizması. Prof. Dr. Fidancı Kolesterol Metabolizması Prof. Dr. Fidancı Kolesterol oldukça önemli bir biyolojik moleküldür. Membran yapısında önemli rol oynar. Steroid hormonların ve safra asitlerinin sentezinde öncül maddedir. Diyet


Onkolojide Sık Kullanılan Terimler. Yrd.Doç.Dr.Ümmügül Üyetürk 2013

Onkolojide Sık Kullanılan Terimler. Yrd.Doç.Dr.Ümmügül Üyetürk 2013 Onkolojide Sık Kullanılan Terimler Yrd.Doç.Dr.Ümmügül Üyetürk 2013 Kanser Hücrelerin aşırı kontrolsüz üretiminin, bu üretime uygun hücre kaybıyla dengelenemediği, giderek artan hücre kütlelerinin birikimi..


Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın

Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın Hücre Nükleusu, Nükleus Membranı, Nükleus Porları Doç. Dr. Ahmet Özaydın Nükleus (çekirdek) ökaryotlar ile prokaryotları ayıran temel özelliktir. Çekirdek hem genetik bilginin deposu hem de kontrol merkezidir.


Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi


Genellikle 50 yaş üstünde görülür ancak seyrekte olsa gençler de de görülme olasılığı vardır.

Genellikle 50 yaş üstünde görülür ancak seyrekte olsa gençler de de görülme olasılığı vardır. Erkek üreme sisteminin önemli bir üyesi olan prostatta görülen malign (kötü huylu)değişikliklerdir.erkeklerde en sık görülen kanser tiplerindendir. Amerika'da her 5 erkekten birinde görüldüğü tespit edilmiştir.yine


HER2 Pozitif Meme Kanseri; Sorunlar ve Direnç Mekanizmaları

HER2 Pozitif Meme Kanseri; Sorunlar ve Direnç Mekanizmaları HER2 Pozitif Meme Kanseri; Sorunlar ve Direnç Mekanizmaları Dr Nilüfer Güler Özel Bayındır Hastanesi Medikal Onkoloji Bölümü;ANKARA 25 Mart 2010;Antalya HER-2 Terminolojisi Gen: HER-2/neu Onkogeni (Rat



SANKO ÜNİVERSİTESİ TIP FAKÜLTESİ 2014-2015 EĞİTİM-ÖĞRETİM YILI DERS KURULU 102: HÜCRE VE DOKU SİSTEMLERİ 04-05 EĞİTİM-ÖĞRETİM YILI DERS KURULU 0: HÜCRE VE DOKU SİSTEMLERİ Ders Kurulu Başkanı: / Başkan Yardımcısı: Yrd. Doç. Dr. Hakan Darıcı / ve Embriyoloji Üyeler: / ve Embriyoloji / Tıbbi / Dersin AKTS Kredisi:


Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları



08.11.2008 VİTAMİN D VE İMMÜN SİSTEM VİTAMİN D VİTAMİN D VE İMMÜN SİSTEM VİTAMİN D Vitamin D ve İmmün Sistem İnsülin Sekresyonuna Etkisi Besinlerde D Vitamini Makaleler Vitamin D, normal bir kemik gelişimi ve kalsiyum-fosfor homeostazisi için elzem


DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel


Kanser tedavisinde mtor sinyal yolağı ve mtor inhibitörleri

Kanser tedavisinde mtor sinyal yolağı ve mtor inhibitörleri 156 Dicle Tıp Dergisi / M. Küçüköner ve ark. Kanser tedavisinde mtor inhibitörleri 2013; 40 (1): 156-160 Dicle Medical Journal doi: 10.5798/diclemedj.0921.2013.01.0248 DERLEME / REVIEW ARTICLE Kanser tedavisinde


Cover Page. The handle holds various files of this Leiden University dissertation

Cover Page. The handle  holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/38405 holds various files of this Leiden University dissertation Author: Balcıoğlu, Hayri Emrah Title: Role of integrin adhesions in cellular mechanotransduction



SANKO ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS KURULU 102: HÜCRE VE DOKU SİSTEMLERİ 05-06 EĞİTİM-ÖĞRETİM YILI DERS KURULU 0: HÜCRE VE DOKU SİSTEMLERİ Ders Kurulu Başkanı: / Başkan Yardımcıları: / Histoloji Embriyoloji Yrd. Doç. Dr. Bahadır Murat Demirel / Üyeler: / Tıbbi / Dersin AKTS



BİLİMSEL DOSYA EXTRACT No.1 BİLİMSEL DOSYA EXTRACT No.1 Çok üst düzey araştırmacılar ve biyologlarla (Marsilya Eczacılık Fakültesi Biogenotoxicology Laboratuvarı INSERM, GREDECO) işbirliği içerisinde yürütülen 14 yıllık çalışma sonrasında


Malnutrisyon ve İnflamasyonun. Hasta Ötiroid Sendromu Gelişimine imine Etkisi

Malnutrisyon ve İnflamasyonun. Hasta Ötiroid Sendromu Gelişimine imine Etkisi Sürekli Ayaktan Periton Diyalizi Hastalarında Malnutrisyon ve İnflamasyonun Hasta Ötiroid Sendromu Gelişimine imine Etkisi Ebru Karcı, Erkan Dervişoğlu lu, Necmi Eren, Betül Kalender Kocaeli Üniversitesi,



ONKOLOJİDE İLAÇ ETKİLEŞİMLERİ ORGAN YETMEZLİKLERİNDE ETKİLEŞİM ONKOLOJİDE İLAÇ ETKİLEŞİMLERİ ORGAN YETMEZLİKLERİNDE ETKİLEŞİM İlaç etkileşiminde rolü olan organlar Böbrek Karaciğer Akciğer GİS Kalp Organ fonksiyonlarının değerlendirilmesi Böbrek (üre, kreatinin, GFR)



MİDE KANSERİNDE P53 EKSPRESYONUNUN PROGNOSTİK ÖNEMİ: META- ANALİZ MİDE KANSERİNDE P53 EKSPRESYONUNUN PROGNOSTİK ÖNEMİ: META- ANALİZ Mustafa Yıldırım 1, Vildan Kaya 2, Özlem Demirpençe 3, Hakan Bozcuk 4 1-T.C. Sağlık Bakanlığı Türkiye Kamu Hastaneleri Kurumu Batman İli





AZ DİFERANSİYE TİROİD KANSERLERİ. Prof. Dr. Müfide Nuran AKÇAY Atatürk Üniversitesi Tıp Fakültesi Genel Cerrahi Anabilim Dalı ERZURUM

AZ DİFERANSİYE TİROİD KANSERLERİ. Prof. Dr. Müfide Nuran AKÇAY Atatürk Üniversitesi Tıp Fakültesi Genel Cerrahi Anabilim Dalı ERZURUM AZ DİFERANSİYE TİROİD KANSERLERİ Prof. Dr. Müfide Nuran AKÇAY Atatürk Üniversitesi Tıp Fakültesi Genel Cerrahi Anabilim Dalı ERZURUM Tanım Az diferansiye tiroid karsinomları, iyi diferansiye ve anaplastik


MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı

MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ. Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı MALİGN MELANOM TEDAVİ SEÇİMİNDE MOLEKÜLER PATOLOJİ Ebru Serinsöz, MD, PhD Mersin Üniversitesi Tıp Fakültesi Patoloji Anabilim Dalı Malign Melanom (MM) Moleküler Çağ öncesi MM Moleküler Çağ da MM Moleküler


5. Türk Tıbbi Onkoloji Kongresi

5. Türk Tıbbi Onkoloji Kongresi Bilimsel Program - 20 Mart 2014, Perşembe UĞUR DERMAN SALONU SEÇİLMİŞ VAKA SUNUMLARI - Peritoneal Kanserlerde HIPEC in Yeri HIPEC Nasıl Yapılır? Kolon Kanseri Mezotelyoma KONFERANS - Onkolojide Nereden



DİFERANSİYE TİROİD KANSERİ DİFERANSİYE TİROİD KANSERİ RİSK GRUPLARINA GÖRE TEDAVİ-TAKİP Dr.Nuri ÇAKIR Gazi Ü Tıp Fak Endokrinoloji ve Metabolizma B.D 35.Türkiye Endokrinoloji ve Metabolizma HastalıklarıKongresi 15-19 Mayıs 2013-Antalya





HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı

HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı HALK SAĞLIĞI ANABĠLĠM DALI Ders adı : Endokrin çevre bozucular ve tarama programı Öğretim Üyesi : Prof. Dr. A. Emel ÖNAL Endokrin sistemin çalışmasını değiştiren, sağlıklı insanda veya çocuklarında sağlık



GEBELİK VE MEME KANSERİ GEBELİK VE MEME KANSERİ Doç. Dr. Ramazan YILDIZ Gazi Üniversitesi Tıp Fakültesi Tıbbi Onkoloji Bilim Dalı, 27 Kasım 2014, Ankara Gebelikte Kanser Gebelikte kanser insidansı % 0.07-0.1 arasında Gebelik


Hücreler Arası Sinyal İletim Mekanizmaları

Hücreler Arası Sinyal İletim Mekanizmaları Hücreler Arası Sinyal İletim Mekanizmaları Prof. Dr. Selma YILMAZER Tibbi Biyoloji Anabilim Dalı Hücrelerarası iletişim(sinyalleşme) Sinyal molekülleri: Protein,küçük peptid,amino asid, nukleotid,steroid,vit


Anahtar Kelimeler: apoptozis, flavopridol, kök hücre, prostat kanseri

Anahtar Kelimeler: apoptozis, flavopridol, kök hücre, prostat kanseri [PS13] Flavopridol ün CD133+/CD44+ Prostat Kanser Kök Hücrelerinde Büyüme, Hücre Döngüsü ve Apoptoz Üzerine Etkileri Burak Cem Soner 1, Hüseyin Aktuğ 2, Eda Açıkgöz 2, Fahriye Düzağaç 3, Ümmü Güven 3,


Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi

Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi Doç Dr Ayşen BAYRAM Gaziantep Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D. GİRİŞ İnsan Papilloma Virus



HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Prof.Dr. T. Ulutin HÜCRE YAŞLANMASI Hücrenin biyosentez mekanizmalarındaki hatalar toplamıdır Hücresel metabolizmanın yavaşlaması sonucu geri dönüşü olmayan olaylar toplamıdır Yaşlılık


Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL


Radyasyon onkologları ne diyor?

Radyasyon onkologları ne diyor? Radyasyon onkologları ne diyor? Bu çalışmalar eski Yeni aletlerimiz var (IMRT, IGRT, Robotik RT) En sevdiğim robotik radyocerrahi Yakında Proton tedavisi ve MİRT gelecek Dozlar çok arttırıldı Bizim hasta


Multiple Myelom Radyoterapi Uygulamaları. Prof.Dr. Serra KAMER

Multiple Myelom Radyoterapi Uygulamaları. Prof.Dr. Serra KAMER Multiple Myelom Radyoterapi Uygulamaları Prof.Dr. Serra KAMER Cevap Aranan Sorular Kemik Lezyonlarında Palyatif Radyoterapi Plazmositom tedavisinde küratif radyoterapi Kim ne zaman- tedavi sıralaması?





TKİ'ye Dirençli GİST Tedavisinin Zorlukları

TKİ'ye Dirençli GİST Tedavisinin Zorlukları Doktor Jean-Yves Blay, PhD: Merhaba ve programa hoşgeldiniz. Adım Jean-Yves Blay. Fransa'da Lyon'da çalışan bir Tıbbi Onkoloji Profesörüyüm. TKİ'ye Dirençli GİST Tedavisinin Zorlukları başlıklı bu programa


Prostat Kanseri Tarama ve PSA Dr. Cemil Uygur 30 Mayıs 2009 Eskişehir

Prostat Kanseri Tarama ve PSA Dr. Cemil Uygur 30 Mayıs 2009 Eskişehir Prostat Kanseri Tarama ve PSA Dr. Cemil Uygur 30 Mayıs 2009 Eskişehir PSA nın tarihsel süreci ve klinik kullanımı 1. Tarama / Erken Tanı 2. Gelecekteki Kanseri öngörme 3. Evreleme T evresi N evresi M evresi



PROF.DR. KADİR BAYKAL GATA HAYDARPAŞA EĞİTİM HASTANESİ ÜROLOJİ KLİNİĞİ PROF.DR. KADİR BAYKAL GATA HAYDARPAŞA EĞİTİM HASTANESİ ÜROLOJİ KLİNİĞİ Lokalize prostat Ca: 1-radikal prostatektomi 2- radyoterapi RP sonrası rezidü PSA olmaması gerekir. PSA nın total olarak ortadan kaldırılmasından


Meme ve Over Kanserlerinde Laboratuvar: Klinisyenin Laboratuvardan Beklentisi

Meme ve Over Kanserlerinde Laboratuvar: Klinisyenin Laboratuvardan Beklentisi Meme ve Over Kanserlerinde Laboratuvar: Klinisyenin Laboratuvardan Beklentisi Dr. Handan Onur XXI. Düzen Klinik Laboratuvar Günleri, Ankara, 23 Ekim 2011 MEME KANSERİ Meme Kanseri Sıklıkla meme başına


Handan Tanyıldızı 1, Nami Yeyin 2, Aslan Aygün 2, Mustafa Demir 2, Levent Kabasakal 2 1. İstanbul Üniversitesi, Fen Fakültesi, Nükleer Fizik ABD 2

Handan Tanyıldızı 1, Nami Yeyin 2, Aslan Aygün 2, Mustafa Demir 2, Levent Kabasakal 2 1. İstanbul Üniversitesi, Fen Fakültesi, Nükleer Fizik ABD 2 Yttrium-90 mikroküre tedavisinde radyasyon kaynaklı karaciğer hastalığı (RILD) analizi ve terapötik aktivite miktarı ile karaciğer fonksiyonu arasındaki ilişkinin incelenmesi Handan Tanyıldızı 1, Nami


Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi

Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi Human Papillomavirüs DNA Pozitif ve E6/E7 mrna Negatif, Anormal Sitolojili Servikal Örneklerin Genotiplendirilmesi Aylin Altay Koçak 1, İpek Tüney 2, Koray Ergünay 2, Alp Usubütün 3, Kunter Yüce 4, Ahmet


ULUSAL KONGRESİ. Türk Veteriner Jinekoloji Derneği. 15-18 Ekim 2015. Liberty Hotels Lykia - Ölüdeniz / Fethiye - Muğla AMAÇ

ULUSAL KONGRESİ. Türk Veteriner Jinekoloji Derneği. 15-18 Ekim 2015. Liberty Hotels Lykia - Ölüdeniz / Fethiye - Muğla AMAÇ KÖPEK MEME TÜMÖRLERİNDE TEDAVİ SEÇENEKLERİ AMAÇ Yaşam kalitesini ve süresini uzatmak Nüks veya yeni tümör oluşumlarını engellemek Yrd.Doç.Dr. Nilgün GÜLTİKEN Metastaz oluşumunu engellemek Tümör dokusunda





Primeri Bilinmeyen Aksiller Metastazda Cerrahi Yaklaşım. Dr. Ali İlker Filiz GATA Haydarpaşa Eğitim Hastanesi Genel Cerrahi Servisi

Primeri Bilinmeyen Aksiller Metastazda Cerrahi Yaklaşım. Dr. Ali İlker Filiz GATA Haydarpaşa Eğitim Hastanesi Genel Cerrahi Servisi Primeri Bilinmeyen Aksiller Metastazda Cerrahi Yaklaşım Dr. Ali İlker Filiz GATA Haydarpaşa Eğitim Hastanesi Genel Cerrahi Servisi okült (gizli, saklı, bilinmeyen, anlaşılmaz) okült + kanser primeri bilinmeyen


Gen İfadesi Belirleme Çalışmaları. Doç. Dr. Feray KÖÇKAR, Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Biyoloji Bölümü fkockar@balikesir.edu.

Gen İfadesi Belirleme Çalışmaları. Doç. Dr. Feray KÖÇKAR, Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Biyoloji Bölümü fkockar@balikesir.edu. Gen İfadesi Belirleme Çalışmaları Doç. Dr. Feray KÖÇKAR, Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Biyoloji Bölümü fkockar@balikesir.edu.tr Özet Gen nedir? Gen Ekspresyonu nedir? Gen ifadesinin düzenlenmesi


HİPERKALSEMİ. Meral BAKAR Ankara Numune Eğitim ve Araştırma Hastanesi Tıbbi Onkoloji Gündüz Tedavi Ünitesi

HİPERKALSEMİ. Meral BAKAR Ankara Numune Eğitim ve Araştırma Hastanesi Tıbbi Onkoloji Gündüz Tedavi Ünitesi HİPERKALSEMİ Meral BAKAR Ankara Numune Eğitim ve Araştırma Hastanesi Tıbbi Onkoloji Gündüz Tedavi Ünitesi Tanım: Hiperkalsemi serum kalsiyum düzeyinin normalden (9-11 mg/dl) yüksek olduğunda meydana gelen


İyi diferansiye tiroid kanserleri Radyonüklid tedavi. Dr. Murat Tuncel Hacettepe Üniversitesi Nükleer Tıp Anabilim Dalı

İyi diferansiye tiroid kanserleri Radyonüklid tedavi. Dr. Murat Tuncel Hacettepe Üniversitesi Nükleer Tıp Anabilim Dalı İyi diferansiye tiroid kanserleri Radyonüklid tedavi Dr. Murat Tuncel Hacettepe Üniversitesi Nükleer Tıp Anabilim Dalı Sunum planı Cerrahi sonrası değerlendirme RAİ ablasyon Yan etkiler RAİ negatif hastalar






2013 NİSAN TUS DAHİLİYE SORULARI 2013 NİSAN TUS DAHİLİYE SORULARI Doğru cevap: B Referans: e-tus İpucu Serisi Dahiliye Ders Notları Cilt 2 Sayfa: 10 Doğru cevap: A Referans: e-tus İpucu Serisi Dahiliye Cilt 1 Ders Notları Sayfa: 233


Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya



I. DÖNEM - 2. DERS KURULU ( ) Açıklamalar: I. DÖNEM - 2. DERS KURULU (2014-2015) Kısaltmalar: DK: Ders kurulu, IHU: İyi hekimlik uygulamaları, Mİng: Akademik/Medikal İngilizce, TDE: Türk Dili ve Edebiyatı, Bilgisayar Okur yazarlığı:


J Popul Ther Clin Pharmacol 8:e257-e260;2011

