Karya Koyunlarda Mikrosatellit İşaretleyicilerle Babalık Testi [1] Paternity Analysis with Microsatellite Markers in Karya Sheep

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Karya Koyunlarda Mikrosatellit İşaretleyicilerle Babalık Testi [1] Paternity Analysis with Microsatellite Markers in Karya Sheep"


1 Kafkas Univ Vet Fak Derg 18 (5): , 2012 DOI: /kvfd Journal Home-Page: Online Submission: RESEARCH ARTICLE Karya Koyunlarda Mikrosatellit İşaretleyicilerle Babalık Testi [1] Onur YILMAZ * Orhan KARACA * [1] Bu makale, Onur YILMAZ ın Adnan Menderes Üniv. Bilimsel Araştırma Projeleri Komisyonu tarafından desteklenen (ZRF- 7016) doktora tezi projesinden üretilmiştir * Adnan Menderes Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR Aydın - TÜRKİYE Makale Kodu (Article Code): KVFD Özet Çalışmada 10 mikrosatellit lokusu (MAF65, OarJMP58, OarFCB193, OarFCB304, OarJMP29, BM8125, OarFCB128, OarCP34, OarVH72, DYMS1) kullanılarak Adnan Menderes Üniversitesi Grup Koyun Yetiştirme Programı (ADÜ-GKYP) çekirdek sürüsünde yer alan 16 koç ve bunların 101 yavrusunda babalık testi yapılmıştır. Çalışmada 105 allel gözlemlenmiştir. Lokuslar bazında gözlenen heterozigotluk oranı (Ho) ile arasında, beklenen heterozigotluk oranı (He) ise ile arasında olmuştur. Çalışmada, lokusların bireysel olarak dışlama olasılıkları (PE) ve artan lokus kombinasyonları için dışlama olasılıkları (CPE) hesap edilmiştir. PE değeri ile 0.514; CPE değeri ise ile arasında değişmiştir. Karşılama olasılığı (MP) değeri ile 0.154, tanımlama gücü (PD) değeri ise 0.85 ile 0.94 arasında değişmiştir. Elde edilen sonuçlar ülkemizdeki diğer populasyonlar için bir referans teşkil edecektir. Anahtar sözcükler: Paternity Analysis with Microsatellite Markers in Karya Sheep Paternity Analysis with Microsatellite Markers in Karya Sheep Summary In the present study, 10 microsatellite loci (MAF65, OarJMP58, OarFCB193, OarFCB304, OarJMP29, BM8125, OarFCB128, OarCP34, OarVH72, DYMS1) were evaluated for their possible use to confirm paternity between 16 rams, their 101 offspring in nucleus flock of Adnan Menderes University Group Sheep Breeding Program (ADU-GKYP). A total of 105 alleles were observed in this study. The estimated observed heterozygosities (Ho) were between and and expected heterozygosities (He) were between and Probability of exclusion (PE) for each locus and probability of exclusion for increasing combinations (CPE) of the 10 loci were calculated. PE for each locus were between and 0.514, CPE of the 10 loci were between and Matching probability (MP) (between and 0.154) and power of discrimination (PD) (between 0.85 and 0.94) were also calculated. These results can also be used as a reference for the other sheep population in Turkey. Keywords: Paternity analysis, Probability of exclusion, Karya sheep, Microsatellite GİRİŞ Yirminci yüzyılda özellikle çiftlik hayvanlarında yapılan ıslah çalışmalarında istatistik metotlar yaygın bir uygulama alanı bulmuştur 1. Son birkaç on yılda ise moleküler biyoloji ve istatistik bilimindeki son gelişmeler, çiftlik hayvanlarında genetik ilerleme için büyük etkili kantitatif karakter lokuslarının (QTL) ve genomik varyasyonun tanımlanmasını ve kullanılmasını olanaklı hale getirmiştir 2. İnsanoğlunun artan isteklerine cevap verebilmek için daha yüksek ve kaliteli üretim yapmak kaçınılmazdır. Bu nedenle özellikle hayvansal üretimde hayvanların bireysel olarak tanımlanması gerekmektedir. Önceleri bireysel tanımlamalarda kullanılan; kan gruplarının tiplendirilmesi ve biyokimyasal polimorfizm tespitine yönelik yöntemlerin yerini DNA temeline dayalı tanımlama yöntemleri almıştır yılında ilk kez mikrosatellit (STR - Short Tandem Repeat) olarak adlandırılan ve DNA da ardışık tekrarlar şeklinde yer alan yüksek düzeyde polimorfik yapılar dikkati çekmiş ve bu yapılar kullanılmaya başlanarak başarılı sonuçlar alınmıştır. Moleküler belirteçler hayvancılıkta; populasyonların tanımlanmasında, pedigri analizlerinde, hayvansal ürünlerin orijinlerinin belirlenmesinde, gen fonksiyonlarının belirlenmesinde, evrim hakkındaki bilgilerin artırılması, genom haritalarının çıkarılmasında, seleksiyonda, koruma programlarında genetik yapının korunup korunmadığının kontrolünde, kimlik tanımada ve İletişim (Correspondence)

2 808 Karya Koyunlarda Mikrosatellit... hayvanların kimi ender genleri taşıyıp taşımadıklarının belirlenmesinde yaygın olarak kullanılmaktadır 3-5. Bireyler arasındaki akrabalık ilişkileri ebeveyn testleri ile belirlenebilmektedir. Bunun için; biyokimyasal yöntemler, RFLP (Restriction Fragment Lenght Polymorphism), AFLP (Amplified Fragment Lenght Polymorphism), SNP (Single Nucletide Polymorphism ve mikrosatellit (STR-Short Tandem Repeat) gibi moleküler genetik yöntemlerden yararlanılmaktadır. Ebeveyn testleri ve genetik çeşitliliğin ortaya konmasında mikrosatellit işaretleyicilerin kullanımının, klasik kan grupları veya serum protein tiplendirme yöntemlerine göre daha güvenilir ve etkili bir yol olduğu bildirilmektedir 6-9. Hayvan ıslahında, özellikle damızlık hayvan seçiminde, düzenli bir soy kütüğünün tutulmasının yanı sıra ebeveynlere ait bilgilerin doğruluğu da önemli bir koşuldur. Özellikle koyun ve keçi gibi çoğuz doğum yapan ve sürüler halinde bir arada yetiştirilen çiftlik hayvanlarında, ebeveynlere ait bilgilerde çeşitli nedenlerden kaynaklanan hatalar yapılabilmekte ve soy kütüğüne yanlış bilgiler kaydedilebilmektedir. Bunun gibi şüpheli durumlarda ebeveyn kontrol yöntemlerine başvurularak doğru bilgiler ortaya çıkarılabilmektedir. Ebeveyn tahmininde yapılan hatalar, tahmin edilen döl farklılığı (EPD) üzerine olduğu kadar populasyon genetiği parametrelerinin tahmininde de hatalara neden olmaktadır. Yapılan bu ebeveyn hatalarının %20 civarında olması, populasyondaki yıllık genetik ilerlemenin şiddetli bir biçimde düşmesine neden olmaktadır Bu bağlamda büyük oranda ekstansif koşullarda gerçekleştirilen ülkemiz koyunculuğu için oluşturulacak ıslah programlarında babalık testlerinin doğru biçimde kullanılması damızlık değeri tahminlerinin isabet derecesini artıracaktır. Buna ek olarak daha önce pedigri bilgileri bilinmeyen bir populasyona ait bilgiler temelden oluşturulabileceği gibi var olan pedigriler kontrol edilerek yanlış kaydedilen bilgiler düzeltilebilecektir. Adnan Menderes Üniversitesi Grup Koyun Yetiştirme Programı (ADÜ-GKYP), Aydın ili koyunculuk alt yapısına yönelik olarak 1994 yılında başlanan çalışmalar sonucunda yetiştirici katılımı sağlanarak hayata geçirilen bir ıslah programıdır. Program çerçevesinde yüksek üreme performansı ve süt verim yeteneğine sahip bir genotip olan Karya koyununa yönelik olarak tabakalı açık çekirdek yetiştirme sistemi öngörüleri gerçekleştirilmeye çalışılmaktadır. Karya koyununun oluşumuna katkıda bulunan ırkların katkı düzeyi tam belli değildir. Yoğunluk Sakız ve Kıvırcık genotipine ait olmakla birlikte yöresel koyunların da katkısı söz konusudur. Yapılan saha araştırmalarında Karya koyununun Aydın dışında başta İzmir ve Denizli olmak üzere diğer komşu illerde de yetiştiriciler tarafından tercih edildiği ve yaygın olarak yetiştirildiği belirlenmiştir Bu çalışmada, ADÜ-GKYP Karya Elit sürüsünde yer alan üstün verimli bireylerin damızlık olarak seçilebilmesi için gerekli olan baba bilgilerinin doğruluğunun test edilmesi ve bu genotipte babalık testlerinde kullanılabilecek uygun mikrosatellit belirteçlerin belirlenmesi amaçlanmıştır. MATERYAL ve METOT Çalışmada babalık testi için Adnan Menderes Üniversitesi Grup Koyun Yetiştirme Programı (ADÜ-GKYP) Karya Elit sürüsünde bulunan Karya hayvanlar kullanılmıştır. Çalışmada toplam 16 koç ve bunlardan olan 101 kuzudan tekniğine uygun olarak kan örneği alınmıştır. Çalışmada flüoresan boya ile (D2, D3, D4) işaretlenmiş ve FAO tarafından tavsiye edilen mikrosatellit listesinden (19) seçilen 10 mikrosatellit lokusu (OarCP34, OarFCB193, OarFCB304, OarJMP29, OarFCB128, BM8125, OarJMP58, OarVH72, MAF65, DYMS1) kullanılmıştır. 10 mikrosatellit lokusunun 8 i ile 3 farklı multipleks grup oluşturulmuş primer bağlanma sıcaklıkları bu multipleks gruplara uymayan diğer 2 mikrosatellit lokusu (MAF65 ve DYMS1) ise ayrı ayrı yükseltgenmiştir. Çalışmada kullanılan mikrosatellit lokuslarına ait bilgiler Tablo 1 de verilmiştir. Kan örneklerinden DNA izolasyonu için DNA ekstraksiyon kiti kullanılmıştır Touchdown polimeraz zincir reaksiyonu (PZR) yöntemi ile, ilgili DNA bölgeleri yükseltgenmiştir (Şekil 1). Termal çeviricide primerlere özgü DNA bölgelerinin çoğaltılmasında kullanılan touchdown PZR programı Tablo 2 de verilmiştir. Her bir mikrosatellit lokusu için tüplerdeki toplam hacim 25 μl olacak şekilde, dntp (0.2 mm), MgCl 2 (2.0 mm), primerler (0.25 mm), ve Taq DNA polimeraz ile 100 ng Genomik DNA ve ddh 2 O içeren PZR master miks oluşturulmuştur. Fragman analizleri Beckman Coulter CEQ 8000 cihazında yapılmıştır. Fragman analizi sonucu oluşan fragman uzunlukları (Şekil 2) Beckman Coulter CEQ 8000 yazılımında değerlendirilmiştir. Mikrosatellit lokuslarına ait allel sayıları (n A ), etkili allel sayısı (n E ), polimorfik bilgi içeriği (PIC), gözlenen (Ho) ve beklenen (He), ortalama heterozigotluk (Ĥ) oranları ve null alleller hesaplanmıştır Çalışmada kullanılan mikrosatellit lokuslarından elde edilen bilgilerin Hardy-Weinberg dengesine uygun olup olmadığını bir başka ifade ile gözlenen ve beklenen frekanslar arasındaki bağlantıyı bulmak için ki-kare (χ 2 ) testi kullanılmıştır. Babalık testi için, babalık indeksi (PI), ayrımlama gücü (PD), dışlama olasılığı (P E ) ve kombine edilmiş dışlama olasılıkları (CP E ) hesaplanmıştır İstatistik analizler için GenAlEx 27, Cervus ,29, PowerStatsV12 30 GENEPOP 31 ve Popgene 32 programları kullanılmıştır. BULGULAR Çalışmada 10 mikrosatellit lokusu (MAF65, OarJMP58, OarFCB193, OarFCB304, OarJMP29, BM8125, OarFCB128, OarCP34, OarVH72, DYMS1) kullanılarak Adnan Menderes Üniversitesi Grup Koyun Yetiştirme Programı (ADÜ-GKYP) Elit sürüsünde yer alan 16 koç ve bunların 101 yavrusunda

3 809 YILMAZ, KARACA Tablo 1. Çalışmada kullanılan mikrosatelitlere ait bilgiler Table 1. Details of considered microsatellites Lokus Adı Primerler Baz Çifti (bp) Multipleks Grup Fluoresan İşaret OarCP34 OarFCB304 OarFCB193 OarJMP29 OarFCB128 BM8125 OarJMP58 OarVH72 DYMS1 MAF65 F: GCTGAACAATGTGATATGTTCAGG R: GGGACAATACTGTCTTAGATGCTGC F: CCCTAGGAGCTTTCAATAAAGAATCGG R: CGCTGCTGTCAACTGGGTCAGGG D4 D3 F: TTCATCTCAGACTGGGATTCAGAAAGGC R: GCTTGGAAATAACCCTCCTGCATCCC D3 F: GTATACACGTGGACACCGCTTTGTAC R: GAAGTGGCAAGATTCAGAGGGGAAG D4 F: ATTAAAGCATCTTCTCTTTATTTCCTCGC R: CAGCTGAGCAACTAAGACATACATGCG D2 F: CTCTATCTGTGGAAAAGGTGGG R: GGGGGTTAGACTTCAACATACG D3 F: GAAGTCATTGAGGGGTCGCTAACC R: CTTCATGTTCACAGGACTTTCTCTG F: GGCCTCTCAAGGGGCAAGAGCAGG R: CTCTAGAGGATCTGGAATGCAAAGCTC F: AACAACATCAAACAGTAAGAG R: CATAGTAACAGATCTTCCTACA F: AAAGGCCAGAGTATGCAATTAGGAG R: CCACTCCTCCTGAGAATATAACATG D D Bireysel D Bireysel D4 Tablo 2.Touchdown PZR koşulları Table 2. Thermal cycling conditions according to Touchdown PCR Lokuslar Denaturasyon (ºC) Süre (sn) Bağlanma (ºC) Süre (sn) Uzama (ºC) Süre (sn) OarCP34 OarFCB193 OarFCB304 OarJMP29 OarFCB128 BM8125 OarJMP58 OarVH MAF DYMS Şekil 1. İncelenen 10 mikrosatellitin %2 lik agaroz jeldeki bant görüntüsü Fig 1. PCR fragments belonging to 10 micorsatellites, separated on a 2% Agarose gel babalık testi yapılmıştır. Çalışmada 10 mikrosatellit lokusundan 105 allel gözlemlenmiştir. 10 farklı mikrosatellit lokusuna ait allel sayısının 6 ile 14 arasında değiştiği en yüksek ve en düşük polimorfizm gösteren lokusların sırasıyla OarJMP58 ve OarCP34 olduğu görülmektedir. Çalışmada kullanılan mikrosatellitlere ait gözlenen boyut aralığı (Allelle size range), örnek sayısı (N), allel sayısı (n A ), gözlenen heterozigotluk (Ho), beklenen heterozigotluk (He), polimorfik bilgi içeriği (PIC) ve ortalama heterozigotluk (Ĥ) değerleri Tablo 3 te, elde edilen null allel frekansları ise Tablo 4 te verilmiştir. En yüksek gözlenen heterozigotluk değeri OarCP34 (0.841) lokusunda, en düşük değer ise OarFCB128 (0.541) lokusunda olmuştur. Özellikle OarFCB304, OarFCB128, OarJMP58 ve OarVH72 lokuslarına ait null allel frekansları dikkat çekici bulunmuştur. Null allel frekansı 0.05 den yüksek olduğunda, null allel varlığına ve dolayısıyla heterozigotluk kaybına yönelik şüphe uyandırmaktadır. Eğer populasyon belli varsayımları yerine getiriyor ise

4 810 Karya Koyunlarda Mikrosatellit... Şekil 2. DYMS1 Mikrosatellit lokusu bakımından heterozigot (a) ve homozigot (b) genotipe sahip birey Fig 2. Individuals with heterozygote (a) and homozygote (b) in terms of DYMS1 locus Tablo 3. Kullanılan mikrosatellitlere ait gözlenen boyut aralığı (GBA, bp), örnek sayısı (N), n A, n E, PIC, Ho, He ve Ĥ değerleri Table 3. Allele size range (bp),n, n A, n E, PIC, Ho, He and Ĥ values in considered microsatellites Lokuslar GBA (bp) N n A n E Ho He Ĥ PIC OarCP34 112/ OarFCB193 96/ OarFCB / OarJMP29 110/ OarFCB / BM / OarJMP58 143/ OarVH72 123/ MAF65 121/ DYMS1 181/ Ortalama St.Dev n A : Allel sayısı, n E : Etkili allel sayısı, PIC: Polimorfik bilgi içeriği, Ho: Gözlenen heterozigotluk oranı, He: Beklenen heterozigotluk oranı, Ĥ: Ortalama heterozigotluk değeri allel frekanslarından genotip frekanslarını hesaplamak için Hardy-Weinberg kanunu olarak bilinen basit matematiksel ilişkilendirme söz konusudur. 10 mikrosatellit lokusundan elde edilen bilgiler Hardy-Weinberg dengesine uygunluk bakımından χ 2 testi kullanılarak test edilmiştir. OarFCB304 (P<0.01), OarFCB128 (P<0.001), OarJMP58 (P<0.001) ve OarVH72 (P<0.001) lokuslarının bu eşitliğe uygunluk göstermediği, diğer lokusların ise Hardy-Weinberg eşitliğine uygun olduğu tespit edilmiştir (Tablo 5). Çalışmada 10 mikrosatellit lokusunun babalık indeksi (PI), ayrımlama gücü (PD), karşılama olasılığı (MP) ve dışlama gücü (P E ) hesaplanmıştır (Table 6). Tablo 6 incelendiğinde OarCP34 ve MAF65 isimli mikrosatellit lokuslarının babalık indeksi (PI) değerlerinin diğerlerine oranla daha yüksek olduğu görülmektedir. Allel sayılarına ilişkin bulgular ışığında yüksek sayıda allel veren lokusların ayrımlama gücünün de (PD) diğerlerine göre Tablo 4. İncelenen 10 mikrosatellit lokusuna ait null allel frekansları Table 4. Null allele frequencies obtained from 10 STR loci Lokuslar Null Allel Frekansı OarCP OarFCB OarFCB (*) OarJMP OarFCB (*) BM OarJMP (*) OarVH (*) MAF DYMS *: yüksek null allel frekansını göstermektedir

5 811 YILMAZ, KARACA Tablo 5. İncelenen 10 mikrosatellit lokusuna ait Ki-kare test değerleri Table 5. Chi-Square test values belong to 10 microsatellites Lokuslar DS χ 2 Prob Önem Düzeyi OarCP NS OarFCB NS OarFCB P<0.01 OarJMP NS OarFCB P<0.001 BM NS OarJMP P<0.001 OarVH P<0.001 MAF NS DYMS NS DS: Genotip sayısı, χ 2 = Elde edilen Ki-kare değeri Tablo 6. Kullanılan mikrosatellitlere ait PI, PD, MP ve P E değerleri Table 6. PI, PD, MP and P E values in considered microsatellites Lokuslar PI PD MP P E OarCP OarFCB OarFCB OarJMP OarFCB BM OarJMP OarVH MAF DYMS PI: Babalık indeksi, PD: Tanımlama gücü, MP: Karşılama Olasılığı, P E : Dışlama Olasılığı Tablo 7. Artan lokus kombinasyonlarına göre kombine edilmiş dışlama olasılıkları (CP E) Table 7. Probabilities of exclusion for increasing combinations (CP E) Kombine Dışlama Olasılığı Lokus Sayıları n CP E nispeten yüksek olduğu söylenebilir. Bütün lokuslar göz önüne alındığında PD değerinin >0.80 olduğu görülmektedir. Aynı DNA profilini bulunduran birey sayısının saptanmasını sağlayan karşılama olasılığı değerleri (MP) arasında bulunmuştur. Kullanılan lokusların bireysel dışlama olasılıkları değerlendirildiğinde en yüksek değeri OarJMP58 isimli lokusun gösterdiği (P E =0.514) bunu OarVH72 isimli lokusun takip ettiği (P E =0.498) görülmektedir. 10 mikrosatellit lokusunun aldığı dışlama olasılığı değerleri ile arasında değişmiştir. Çalışmada bireysel dışlama olasılığının yanı sıra artan lokus kombinasyonlarına göre kombine dışlama olasılığı (CP E ) değerleri de hesaplanmıştır (Tablo 7). CP E değerleri kullanılan lokusların farklı kombinasyonları ile elde edilmiştir. Elde edilen bulgulardan anlaşıldığı gibi lokus sayısı arttıkça dışlama olasılığı daha yüksek bir değer almaktadır. Dışlama olasılığı değerinin artması gerçek biyolojik babanın daha yüksek bir isabetle tespit edildiğini göstermektedir. Kombine edilmiş dışlama olasılıkları değerlendirildiğinde CP E değerlerinin ile değerleri arasında değiştiği görülmektedir. 10 mikrosatellit işaretleyicinin kombinasyonu sonucunda elde edilen CP E değerinin olduğu görülmektedir. Bu değerler incelendiğinde 0.90 değerine 5 lokus kombinasyonu ile ulaşılırken babalık testleri için güven sınırı olarak kabul edilen 0.99 değerine 10 mikrosatellit lokusunun kombinasyonu ile ulaşılmıştır. Bu durum çalışmada kullanılan 10 mikrosatellit lokusunun Karya koyunlarda babalık testlerinde yüksek düzeyde güvenilirlikle kullanılabileceğini göstermektedir. TARTIŞMA ve SONUÇ Bu çalışmada, Adnan Menderes Üniversitesi Grup Koyun Yetiştirme Programı (ADÜ-GKYP) kapsamında yer alan Karya Koyun sürüsünde yer alan üstün verimli bireylerin damızlık olarak seçilebilmesi için gerekli olan pedigri bilgilerinin doğruluğunun test edilmesi ve bu genotipte babalık testlerinde kullanılabilecek uygun işaretleyicilerin belirlenmesi amaçlanmıştır. Çalışmada elde edilen gözlenen heterozigotluk değerleri bazı literatürlerde belirtilen aralıktadır Ancak çalışmada MAF65 ve OarCP34 lokuslarından elde edilen gözlenen heterozigotluk değerleri Yıldıran ve Çakır 39 tarafından Bafra, İvesi, Karayaka, Morkaraman, Sakız ve Türk merinosunda yapılan çalışmadan elde edilen değerlerden yüksek bulunmuştur. Hardy-Weinberg dengesi için elde edilen değerler ilgili literatürde 36,38,40 belirtilen değerlerden farklı bulunmasına rağmen OarFCB128 ve OarVH72 lokusları bakımından elde edilen değerler Pramod ve ark. 35 tarafından bildirilen değerlerle uyum içerisindedir. Adı geçen lokusların Hardy- Weinberg dengesinde bulunmaması çalışılan populasyon ve populasyonda yürütülen seleksiyon çalışmaları göz önünde bulundurulduğunda normal bir durum olarak karşımıza çıkmaktadır. Buna ek olarak OarFCB304, OarFCB128,

6 812 Karya Koyunlarda Mikrosatellit... OarJMP58 ve OarVH72 lokusları bakımından Hardy- Weinberg dengesinde bulunmamasının nedeni olarak bu lokuslardaki null alel frekanslarının yüksek olması gösterilebilir. Çünkü null alleller, heterozigotlarda bir allelin Polimeraz Zincir Reaksiyonu (PZR) ile yükseltgenmeyip sadece tek bir allelin homozigot gibi pik vermesine ve böylece hatalı okunmasına bağlanmaktadır. Çalışmada, OarFCB128 için elde edilen PI değeri (1.09) Cerit ve ark. 40 tarafından Kıvırcık koyunlarda yapılan çalışmada OarFCB128 lokusu için elde edilen değerden (2.333) düşük, çalışmada aynı lokus için elde edilen MP değerinin (0.110) Kıvırcık koyunlarda yapılan çalışmada elde edilen değerden (0.073) yüksek olduğu görülmektedir. Bu durumun gerçekleşmesinde, iki çalışmada farklı ırkların kullanılmasının etkili olduğu düşünülmektedir. Arruga ve ark. 10 tarafından Rasa Aragonesa koyunlarında yapılan babalık testi çalışmasında MAF50, MAF18, OarFCB20 ve MCM527 isimli mikrosatellit lokuslarının bireysel dışlama olasılıklarının (P E ) sırasıyla 0.35, 0.32, 0.68 ve 0.50 olduğu bildirilmiştir. Başka bir çalışmada ise DYMS1, OarFCB304, OarJMP58, OarJMP29, MAF65 ve BM8125 lokusları için P E değerleri sırasıyla 0.82, 0.60, 0.88, 0.69, 0.63 ve 0.82 olarak bildirilmiştir 41. Kullanılan lokusların bireysel dışlama olasılıkları değerlendirildiğinde en düşük dışlama olasılığı değerinin ile MAF65 lokusuna, en yüksek dışlama olasılığı değerinin ise ile OarJMP58 lokusuna ait olduğu görülmektedir. Elde edilen bu değerler konuyla ilgili yapılan bazı çalışmalarda bildirilen değerlerle uyum göstermektedir 42. Çalışılan MAF65 lokusu bakımından elde edilen P E değeri (0.293) Ivankovic ve ark. 43 tarafından yapılan çalışmada elde edilen P E değerinden (0.476) düşük bulunmuştur. Marshall ve ark. 44 tarafından yapılan bir çalışmada, OarFCB193 ve OarFCB304 isimli mikrosatellit lokuslarında elde edilen P E değerleri sırasıyla ve olmuştur. Çalışmada elde edilen P E değerleri incelendiğinde OarFCB193 lokusunun belirtilen çalışmadan daha düşük bir değer aldığı görülmektedir. Ancak OarFCB304 lokusundan elde edilen dışlama olasılığı değeri ise belirtilen çalışmadan yüksek olmuştur. Çalışmada 10 mikrosatellit lokusunun kombine edilmesi ile elde edilen CP E değeri küçükbaşlarda yapılan çalışmalar ile karşılaştırıldığında elde edilen değerlerin bazı literatürde belirtilenlerden düşük çıktığı görülmektedir -50. Bu durum yapılan çalışmalardaki lokus sayıları ile doğrudan ilgilidir. Belirtilen literatürler incelendiğinde bu çalışmalarda 10 mikrosatellit lokusundan daha fazla lokusla çalışıldığı görülmektedir. Bu nedenle babalık testi çalışmalarında fazla sayıda lokus kullanılması, daha isabetli dışlama olasılığı değerlerinin elde edilmesini sağlamaktadır. Ayrıca anne, baba ve yavrudan oluşan üçlü gruplar kullanılması bu tip çalışmaların güvenirliğini artırmaktadır. Sunulan çalışmadan elde edilen bulgular incelendiğinde, kullanılan 10 mikrosatellit lokusu yüksek PD değerleri ( 0.85) almışlardır. Ancak FAO tarafından önerilen mikrosatellit listesinden seçilen dışlama olasılıkları düşük olan MAF65, OarFCB193 ve BM8125 lokusları yerine Uluslararası Hayvan Genetiği Derneği (ISAG) tarafından önerilen ve dışlama olasılık değerleri yüksek olan lokusların kullanılmasının yapılacak babalık testleri için daha uygun olacağı düşünülmektedir. Buna ek olarak null allel frekansları incelendiğinde (Tablo 4) OarJMP58 ve OarVH72 lokuslarının tolere edilebilir frekansa sahip olduğu OarFCB304 ve OarFCB128 lokuslarının ise sahip oldukları null allel frekansı değeriyle dikkat çekicidir. Bu nedenle özellikle bu iki lokus (OarFCB304 ve OarFCB128), yanlış yorumlamaya yol açacağından ebeveyn testlerinde kullanılmamalıdırlar. Çalışılan lokuslar dikkate alındığında özellikle dışlama olasılığı bakımından OarFCB304, OarVH72 ve OarJMP58 isimli mikrosatellit lokuslarının öne çıktığı görülmektedir. Çalışmadan elde edilen sonuçlar Aydın ve yöresinde yetiştirilen yerli genotipleri için yapılacak moleküler genetik çalışmalara ciddi bir katkı sağlayacağı gibi bu genotipler için pedigri oluşturma ve tutulan pedigri kayıtlarının doğruluğunu kontrol etmek için de kullanabilecektir. İleriki yıllarda bu çalışmayı destekleyici çalışmaların hayata geçirilmesi ile moleküler genetik analiz ve tanımlamalar ile biyoteknolojik bazı uygulamaların doğrudan ıslah programı ile birleştirilmesi mümkün olacaktır. Bazı gelişmiş ülkelerde özellikle bazı türlerde babalık testleri için mikrosatellit işaretleyiciler tanımlanmasına rağmen bazı türler için mikrosatellitler ile babalık testi oldukça yeni bir sistemdir. Türkiye yerli koyun ırklarında yapılmış sınırlı sayıda çalışmaya ulaşılabilmiştir. Bu nedenle bu çalışma ileride konuyla ilgili yapılacak çalışmalar için özel bir önem ifade etmektedir. KAYNAKLAR 1. Beuzen ND, Stear MJ, Chang KC: Review molecular markers and their use in animal breeding. Vet J, 16, 42-52, Montaldo HH, Meza-Herrera CA: Use of molecular markers and major genes in the genetic imrovement of livestock. Elect J Biotech, 1, 83-89, Cunningham EP, Meghen CM: Biological identification systems: genetic markers. Rev Sci Tech Off Int Epiz, 20, , Kaul R, Singh A, Vijh RK, Tantia MS, Behl R: Evaluation of the genetic variability of 13 microsatellite markers in native Indian pigs. J Genet, 80, , Simm G: Molecular genetic technologies. In, Simm G (Ed): Genetic Improvement of Cattle and Sheep. pp , Farming Press United Kingdom, Bowling AT, Eggleston-Stott ML, Byrns G, Clark RS, Dileanis S, Wictum E: Validation of microsatellite markers for routine horse parentage testing. Anim Genet, 28, , Buchanan FC, Littlejohn RP, Galloway SM, Crawford AM: Microsatellites and associated repetitive elements in the sheep genome. Mamm Genome, 4, , Kemp SJ, Hishida O, Wambugu J, Rink A, Longeri ML, Ma RZ, Da Y, Lewin HA, Barendse W, Teale AJ: A Panel of Polymorphic bovine, ovine and caprine microsatellite markers. Anim Genet, 26, , Marklund S, Ellegren H, Eriksson S, Sandberg K, Andersson L:

7 813 YILMAZ, KARACA Parentage yesting and linkage analysis in the horse using a set of highly polymorphic microsatellites. Anim Genet, 25, 19-23, Arruga MV, Monteagudo LV, Tejedor MT, Barrao R, Ponz R: Analysis of microsatellites and paternity testing in Rasa Aragonesa sheep. Res Vet Sci, 70, , Baron EE, Martinez ML, Vernequez RS, Coutinho LL: Parentage testing and effect of misidentification on the estimation of breeding value in Gir cattle. Genet Mol Biol, 25, , Geldermann H, Pieper U, Weber WE: Effect of Misidentification on the Estimation of Breeding Value and Heritability in Cattle. J Anim Sci, 63, , Koşum N: Koyunculukta uygulanan babalık testleri ve önemi. Hayv Üret, 36, 25-32, Rosa AJM, Schafhouser E, Hassen A, Rouse GH, Wilson DE, Reecy JM: Use of molecular markers to determine parentage in multiple sire Pastures. Beef Res. Rep. Iowa State University USA, Weller JI, Feldmesser E, Golik M, Tager-Cohen I, Domochovsky R, Alus O, Ezra E, Ron M: Factors affecting incorrect paternity assignment in the Israeli Holstein population. J Dairy Sci, 87, , Karaca O, Cemal İ, Atay O: Adnan Menderes Üniversitesi Grup Koyun Yetiştirme Programı (ADÜ-GKYP). Ege Bölgesi 1. Tarım Kongresi Eylül Adnan Menderes Üniversitesi, Aydın, Karaca O, Cemal İ: Koyun genotiplerimizin ıslahı için örnek bir yapılanma: Adnan Menderes Üniversitesi Grup Koyun Yetiştirme Programı (ADÜ-GKYP). Hasad Hayv, 21, 30-35, Karaca O, Cemal İ, Yılmaz O, Yılmaz M: Karya Koyunu. Türkiye Ulusal Koyunculuk Kongresi, Şubat 2009, Ege Üniversitesi, İzmir, s , FAO: Food and agriculture organisation of the United Nations secondary guidelines for development of national farm animal genetic resources management plans. Measurement of domestic animal diversity (MoDAD): Recommended microsatellite markers, Accessed: Botstein D, White RL, Skolnick M, Davis RW: Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet, 32, , Nei M: Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89, , Nei M: Molecular evolutionary genetics. In, Nei M (Ed): Molecular evolutionary genetics. Columbia University Press, New York, Nei M, Kumar S: Molecular evolution and phylogenetics. In, Nei M, Kumar S (Eds): Molecular evolution and phylogenetics. Oxford University Press, London, Brenner C, Morris J: Paternity index calculations in single locus hypervariable DNA probes: validation and other studies. Proceedings for the first International Symposium on Human Identification. Promega Corporation, Madison, Nov pp , Jamieson A, Taylor SS: Comparisons of three probability formulae for parentage exclusion. Anim Genet, 28, , Kimberly AH: Statistical Analysis of STR Data Accessed: Peakall R, Smouse PE: GenAlEx, Genetic Analysis in Excel, Version 6. School of Botany and Zoology, Australian National University, anu.edu.au/bozo/genalex/genalex_download.php, Accessed: Marshall TC: Cervus, 3.0, Cervus is a computer program for assignment of parents to their offspring using genetic markers. Cervus, a Windows package for parentage analysis using likelihood approach. CERVUS was written by Tristan Marshall (1998/2006) Accessed: Kalinowski ST, Taper ML, Marshall TC: Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol, 16, , Brenner C, Morris CJ: PowerStatsV12.xls Computer Software. Paternity index calculations in single locus hypervariable DNA probes: validation and other studies. Accessed: Raymond M, Rousset F: GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. J Hered, 86, , Yeh FC, Yang RC, Boyle TBJ, Ye ZH, Mao JX: POPGENE the user-friendly shareware for population genetic analysis (1997). University of Alberta, Canada Accessed: Grigaliunaite I, Tapio M, Viinalas H, Grislis Z, Kantanen J, Miceikiene I: Microsatellite variation in the Baltic sheep breeds. Vet Med Zoot, 21, 66-73, Handley LJL, Byrne K, Santucci F, Townsend S, Taylor M, Bruford MW, Hewitt GM: Genetic structure of European sheep breeds. Heredity, 99, , Pramod S, Kumarasamy P, Chandra ARM, Sridevi P, Rahumathulla PS: Molecular characterization of vembur sheep (Ovis aries) of South India based on microsatellites. Indian J Sci Technol, 2, 55-58, Soysal Mİ, Koban E, Özkan E, Altunok V, Bulut Z, Nizamlıoglu M, Togan I: Evolutionary relationship among three native and two crossbreed sheep breeds of Turkey: Preliminary results. Revue Med Vet, 156 (5): , Tapio I, Tapio M, Grislis Z, Holm LE, Jeppsson S, Kantanen J, Miceikiene I, Olsaker I, Viinalass H, Eythorsdottir E: Unfolding of population structure in Baltic sheep breeds using microsatellite analysis. Heredity, 94, 448-6, Tascon DC, LittleJohn RP, Almeida PAR, Crawford AM: Genetic variation within Merino Sheep breed: Analysis of closely related populations using microsatellites. Anim Genet, 31, , Yıldıran FAB, Çakır Ş: Analysis of genetic polymorphism with microsatellite method in Turkey local sheep breeds. Kafkas Univ Vet Fak Derg, 18 (1): 75-79, Cerit H, Altınel A, Avanus K, Elmaz O, Karayel E, Temelli R, Kirişçi E: Polymorphism evaluation of various genomic loci in Kıvırcık Sheep breed of Turkey. The 11th International Symposium of the World Association of Veterinary Laboratory Diagnosticians and OIE Seminar on Biotechnology, 9-13 Kasım Bangkok, Thailand, pp , Quanbari S, Eskandari Nasab MP, Osfoori R, Hagh Nazari A: Power of microsatellite markers for analysis of genetic variation and parentage vertification in sheep. Pak J Biol Sci, 10, , Roberts CS, Thomas G: Use of microsatellite markers to include or exclude individuals as Barbados Blackbelly sheep, agri/images/stories/information, Accessed: Ivankovic A, Dovc P, Kavar T, Caput P, Mioc B, Pavic V, Stuhec V, Leto J: Genetic characterisation of the Pag island sheep breed based on microsatellite and mtdna data. Small Ruminant Res,57, , Marshall TC, Slate J, Kruuk LEB, Pemberton JM: Statistical confidence for likelihood-based paternity inference in natural populations. Mol Ecol, 7, , Araujo AMD, Guimaraes SEF, Pereira CS, Lopes PS, Rodrigues MT, Machado TMM: Paternity in Brazilian goats through the use of DNA microsatellites. R Bras Zootec, 39, , Bolormaa S, Ruvinsky A, Walkden-Brown S, Van der Werf J: DNAbased parentage verification in two Australian goat herds. Small Ruminant Res, 80, , Ganai NA, Yadav BR: Parentage determination in three breeds of Indian goat using heterologous microsatellite markers. In, Makkar HPS and Viljoen GJ (Eds): Applications of gene-based technologies for ımproving animal production and health in developing countries. Springer, Netherlands, pp , Jimenez-Gamero I, Dorado G, Munoz-Serrano A, Analla M, Alonso- Moraga A: DNA microsatellites to ascertain pedigree-recorded information in a selecting nucleus of Murciano-Granadina dairy goats. Small Ruminant Res, 65, , Luikart G, Biju-Duval MP, Ertuğrul O, Zagdsuren Y, Maudet C, Taberlet P: Power of 22 microsatellite markers in fluorescent multiplexes for parentage testing in goats (Capra hircus). Anim Genet, 30, , Zhao ZS, Wang GL, Guo JG, Li DQ: Polymorphism distributions of 9 microsatellite loci in Chinese Merino sheep. Yi Chuan, 28, , 2006.

Journal of Cell and Molecular Biology 12(1&2): 39-45, 2014 Research Article 39 Haliç University, Printed in Turkey. http://jcmb.halic.edu.

Journal of Cell and Molecular Biology 12(1&2): 39-45, 2014 Research Article 39 Haliç University, Printed in Turkey. http://jcmb.halic.edu. Journal of Cell and Molecular Biology 12(1&2): 39-45, 2014 Research Article 39 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr Türkiye de bulunan bazı keçi ırklarında mikrosatellit DNA markörlerinin


DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D.

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. DR. ONUR YILMAZ Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. Koç Katımı Çiftleşme mevsiminde kızgınlık gösteren koyunun koç ile birleştirilmesi olayına koç katımı


Keçi Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı Çoklu-PZR (Multipleks PCR) Sistemleri*

Keçi Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı Çoklu-PZR (Multipleks PCR) Sistemleri* Keçi Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı Çoklu-PZR (Multipleks PCR) Sistemleri* Özgecan KORKMAZ AĞAOĞLU**, Bengi ÇINAR KUL***, Bilal AKYÜZ****, Emel ÖZKAN*****, Okan ERTUĞRUL******,


HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:


Mikrosatellitlerin Önemi ve Kullan m Alanlar

Mikrosatellitlerin Önemi ve Kullan m Alanlar Mikrosatellitlerin Önemi ve Kullan m Alanlar Özgecan KORKMAZ A AO LU*, Okan ERTU RUL** Öz: Ko-dominant belirteçlerden olan mikrosatellit DNA lokusları; 2-6 nükleotit uzunlukta kısa, tekrarlanan ve polimorfik


Ezgi KARA*, Murat ÇİMEN**, Servet KAYA*, Ümit GARİP*, Mehmet ŞAHİNSOY*

Ezgi KARA*, Murat ÇİMEN**, Servet KAYA*, Ümit GARİP*, Mehmet ŞAHİNSOY* ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Hakkari İlinde Yetiştirilen Yerli Kıl Keçilerden Elde Edilen Sütlerde Toplam Yağ ve Protein Seviyelerinin Türk Standartlarına Uygunluklarının


DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi


Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi

Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Elazığ İli Karakoçan İlçesinden Elde Edilen Sütlerde Yağ ve Protein Oranlarının AB ve Türk Standartlarına Uygunluklarının Belirlenmesi Muhammet


Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu

Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu ISSN: 2148-0273 Cilt 1, Sayı 2, 2013 / Vol. 1, Issue 2, 2013 Tunceli ili Pertek ilçesinde Yetiştirilen Koyun ve Keçi Sütlerinin Kaliteli Peynir Yapım Standartlarına Uygunluğu Fırat TOK*, Murat ÇİMEN**,


Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL


Edirne İlinden Kış Aylarında Elde Edilen Sütlerde Toplam Yağ ve Protein Değerlerinin Türk Standartlarına Uygunluğunun Belirlenmesi

Edirne İlinden Kış Aylarında Elde Edilen Sütlerde Toplam Yağ ve Protein Değerlerinin Türk Standartlarına Uygunluğunun Belirlenmesi Edirne İlinden Kış Aylarında Elde Edilen Sütlerde Toplam Yağ ve Protein Değerlerinin Türk Standartlarına Uygunluğunun Belirlenmesi Sümeyye MEMKEZE 1, Murat ÇİMEN 1*, Rahime Kamer ÖNOĞLU 1, Neslihan ÇİÇEK


YÜKSEKÖĞRETİM KURULU YARDIMCI DOÇENT 01.12.2014. : Sinop Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Sinop

YÜKSEKÖĞRETİM KURULU YARDIMCI DOÇENT 01.12.2014. : Sinop Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Sinop HÜLYA SİPAHİ ÖZGEÇMİŞ YÜKSEKÖĞRETİM KURULU YARDIMCI DOÇENT 01.12.2014 Adres : Sinop Üniversitesi Fen Edebiyat Fakültesi Biyoloji Bölümü Sinop Telefon : 3682715516-4206 E-posta Doğum Tarihi : Faks : Kadro


Mandalarda Alyuvar Potasyum Polimorfizmi Üzerine Bir Araştırma

Mandalarda Alyuvar Potasyum Polimorfizmi Üzerine Bir Araştırma Mandalarda Alyuvar Potasyum Polimorfizmi Üzerine Bir Araştırma M. İ. Soysal 1 S.Kök 2 E. K.Gürcan 1 1 Trakya Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bölümü, Tekirdağ 2 Trakya Üniversitesi, Keşan


Türkiye deki bazı kedi ırklarının mikrosatellit markörler ile genetik karakterizasyonu

Türkiye deki bazı kedi ırklarının mikrosatellit markörler ile genetik karakterizasyonu Journal of Cell and Molecular Biology 13(1-2):16-25, 2015 Research Article 16 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr Türkiye deki bazı kedi ırklarının mikrosatellit markörler ile


Tekirdağ Ziraat Fakültesi Dergisi/Journal of Tekirdag AgriculturalFaculty Togan ve ark., 2005 2(1)

Tekirdağ Ziraat Fakültesi Dergisi/Journal of Tekirdag AgriculturalFaculty Togan ve ark., 2005 2(1) 43 Irkların Korunmasında Moleküler İşaretler İ. TOGAN 1 İ. SOYSAL 2 C. C. BERKMAN 1 E. KOBAN 1 1 Orta Doğu Teknik Üniversitesi, Biyoloji Bölümü, ANKARA 2 Trakya Üniversitesi, Tekirdağ Ziraat Fakültesi,


İzmir İli Seferihisar İlçesinde Yetiştirilen Keçilerden Elde Edilen Sütlerde Biyokimyasal Parametrelerin Türk Standartlarına Uygunluğunun Belirlenmesi

İzmir İli Seferihisar İlçesinde Yetiştirilen Keçilerden Elde Edilen Sütlerde Biyokimyasal Parametrelerin Türk Standartlarına Uygunluğunun Belirlenmesi İzmir İli Seferihisar İlçesinde Yetiştirilen Keçilerden Elde Edilen Sütlerde Biyokimyasal Parametrelerin Türk Standartlarına Uygunluğunun Belirlenmesi Neslihan ÇİÇEK 1, Murat ÇİMEN 1*, Deniz EFESOY 1,


Batı Anadolu İçin Bir Süt Keçisi: Bornova Keçisi

Batı Anadolu İçin Bir Süt Keçisi: Bornova Keçisi Hayvansal Üretim 43(2): 79-85 (2002) Batı Anadolu İçin Bir Süt Keçisi: Bornova Keçisi Metin Şengonca 1 Mustafa Kaymakçı 1 Nedim Koşum 1 Turgay Taşkın 1 Jörg Steinbach 2 1 Ege Üniversitesi Ziraat Fakültesi


Sakız Koyunu. Prof.Dr.. Orhan KARACA. Adnan Menderes Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, AYDIN

Sakız Koyunu. Prof.Dr.. Orhan KARACA. Adnan Menderes Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, AYDIN Sakız Koyunu Prof.Dr.. Orhan KARACA Adnan Menderes Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, AYDIN SAKIZ Türkiye ve Yunanistan ın ortak ırkıdır Adını, İzmir in Çeşme ilçesine komşu olan Yunanistan


Genetic Characterization of Indigenous Anatolian Water Buffalo Breed Using Microsatellite DNA Markers

Genetic Characterization of Indigenous Anatolian Water Buffalo Breed Using Microsatellite DNA Markers Genetic Characterization of Indigenous Anatolian Water Buffalo Breed Using Microsatellite DNA Markers M. İ. Soysal 1 E. Özkan 1 S. Kök 2 Y. T.Tuna 1 E. K.Gürcan 1 1 Trakya University, Agricultural Faculty


Şanlıurfa Yöresi Halep Keçilerinde Mitokondriyal 12S rrna Gen Sekansına Göre Filogenetik Analizler

Şanlıurfa Yöresi Halep Keçilerinde Mitokondriyal 12S rrna Gen Sekansına Göre Filogenetik Analizler Araştırma Makalesi / Research Article Geliş tarihi: 06.01.2016 Kabul tarihi: 30.03.2016 Harran Tarım ve Gıda Bilimleri Dergisi (2016) 20(1): 39-45 Şanlıurfa Yöresi Halep Keçilerinde Mitokondriyal 12S rrna


X kromozomu (Devam) X STR Polimorfizmi 08.04.2008. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma bağlı

X kromozomu (Devam) X STR Polimorfizmi 08.04.2008. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma bağlı X kromozomu X KROMOZOMAL STR POLİMORFİZMİ Doç. Dr. Faruk AŞICIOĞLU Adli Tıp Uzmanı & Tıbbi Biyoloji Bilim Dr. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma



GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.


Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim



SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm


Clarias gariepinus (Burchell, 1822) un İki Farklı Populasyonunda Genetik Polimorfizimin Araştırılması

Clarias gariepinus (Burchell, 1822) un İki Farklı Populasyonunda Genetik Polimorfizimin Araştırılması GÜ, Gazi Eğitim Fakültesi Dergisi, Cilt 31, Sayı 1 (2011) 261-271 Clarias gariepinus (Burchell, 1822) un İki Farklı Populasyonunda Genetik Polimorfizimin Araştırılması Two Different Population of Clarias


The Growth Traits of Bafra Sheep (Chios x Karayaka B1) at Kazım Karabekir Agriculture Centre

The Growth Traits of Bafra Sheep (Chios x Karayaka B1) at Kazım Karabekir Agriculture Centre Van Vet J, 2015, 26 (2) 93-99 Van Veterinary Journal http://vfdergi.yyu.edu.tr ISSN: 2149-3359 Original Article e-issn: 2149-8644 The Growth Traits of Bafra Sheep (Chios x Karayaka B1) at Kazım Karabekir



VERİM DENETİMLERİ VE GENOMİK TANIMLAMA VERİM DENETİMLERİ VE GENOMİK TANIMLAMA Prof. Dr. İbrahim CEMAL Adnan Menderes Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, AYDIN 12 Haziran 2014, Uşak Damızlık niteliğindeki yüksek verimli, hastalıklara


Paternal Kromozom Y. Maternal Kromozom X. Yrd Doç Dr Sema DEMİRÇİN

Paternal Kromozom Y. Maternal Kromozom X. Yrd Doç Dr Sema DEMİRÇİN Y-STR Analizleri Yrd Doç Dr Sema DEMİRÇİN Maternal Kromozom X Paternal Kromozom Y Y KROMOZOMU İnsan kromozomları içerisinde; İkinci en küçük kromozomdur Genomun sadece %2 kadarını oluşturur 6O milyon kadar





Dr. AKIN PALA ÇOK SAYIDA GEN. Basit kalıtım. Kalitatif/Kategorik özellikler. Bazı Kantitatif Özellikler. Kantitatif Özellikler, kantitatif genetik

Dr. AKIN PALA ÇOK SAYIDA GEN. Basit kalıtım. Kalitatif/Kategorik özellikler. Bazı Kantitatif Özellikler. Kantitatif Özellikler, kantitatif genetik Basit kalıtım ÇOK SAYIDA GEN Polygenic Inheritance Akin Pala akin@comu.edu.tr http://members.comu.edu.tr/akin/ Verim özelliği sadece birkaç gen tarafından etkilenir ve fenotipleri genelde kategoriler halindedir


Doç.Dr. Yasemin ÖNER. Biyometri ve Genetik Anabilim Dalı ÖĞRENİM DURUMU. GÖREVLER Görev Unvanı Görev Yeri Yıl

Doç.Dr. Yasemin ÖNER. Biyometri ve Genetik Anabilim Dalı ÖĞRENİM DURUMU. GÖREVLER Görev Unvanı Görev Yeri Yıl Doç.Dr. Yasemin ÖNER Biyometri ve Genetik Anabilim Dalı Telefon : 224 2941562 Faks : 224 4428152 E-posta : onery@uludag.edu.tr Adres : U.Ü. Ziraat Fakültesi, Zootekni Bölümü, Görükle Kampusu, 16059 Bursa


G i r i ş. Araştırma Makalesi

G i r i ş. Araştırma Makalesi İstanbul Üniv. Vet. Fak. Derg. J. Fac. Vet. Med. Istanbul Univ. 32 (3), 41-52, 2006 32 (3), 41-52, 2006 Araştırma Makalesi AYDIN İLİ ÖZEL İŞLETME KOŞULLARINDA YETİŞTİRİLEN KIL KEÇİLERİNİN BAZI VERİM ÖZELLİKLERİ



A UNIFIED APPROACH IN GPS ACCURACY DETERMINATION STUDIES A UNIFIED APPROACH IN GPS ACCURACY DETERMINATION STUDIES by Didem Öztürk B.S., Geodesy and Photogrammetry Department Yildiz Technical University, 2005 Submitted to the Kandilli Observatory and Earthquake


Renkli Tiftik Keçilerinde Hemoglobin ve Transferrin Tipleri*

Renkli Tiftik Keçilerinde Hemoglobin ve Transferrin Tipleri* Renkli Tiftik Keçilerinde Hemoglobin ve Transferrin Tipleri* 1 YYÜ Özalp Meslek Yüksekokulu, Van Türkiye 2 YYÜ Veteriner Fakültesi Zootekni ABD Van, Türkiye Bahattin ÇAK 1 Mürsel KÜÇÜK 2 Makale geliş ve


Batman İlinden Elde Edilen Sütlerde Toplam Yağın Türk ve Avrupa Birliği Standartlarına Uygunluğunun Belirlenmesi

Batman İlinden Elde Edilen Sütlerde Toplam Yağın Türk ve Avrupa Birliği Standartlarına Uygunluğunun Belirlenmesi Cilt 1, Sayı 1, 2013 / Vol. 1, Issue 1, 2013 Batman İlinden Elde Edilen Sütlerde Toplam Yağın Türk ve Avrupa Birliği Standartlarına Uygunluğunun Belirlenmesi Eyüp Ablak*, Murat Çimen**, Damla Karakoç*,


Kangal Akkaraman Koçlarında Genetik Çeşitlilik ve Ebeveyn Testinin Uygulanabilirliğinin Mikrosatellit. Belirteçler Kullanılarak Araştırılması

Kangal Akkaraman Koçlarında Genetik Çeşitlilik ve Ebeveyn Testinin Uygulanabilirliğinin Mikrosatellit. Belirteçler Kullanılarak Araştırılması Kafkas Univ Vet Fak Derg 18 (6): 973-977, 2012 DOI:10.9775/kvfd.2012.6879 Journal Home-Page: http://vetdergi.kafkas.edu.tr Online Submission: http://vetdergikafkas.org RESEARCH ARTICLE [1] [2] * ** ***


Hayvan Islahı ve Yetiştirme 2. ders

Hayvan Islahı ve Yetiştirme 2. ders Hayvan Islahı ve Yetiştirme 2. ders Akin Pala akin@comu.edu.tr Seleksiyona cevap Et sığırlarında doğum ağırlığını arttırmak istiyoruz. Ağır doğmuş olan bireyleri ebeveyn olarak seçip çiftleştiriyoruz.


Ö Z G E Ç M İ Ş. 1. Adı Soyadı: Mustafa GÖÇKEN. 2. Doğum Tarihi: 12 Haziran 1976. 3. Unvanı: Yrd. Doç. Dr. 4. Öğrenim Durumu: Ph.D.

Ö Z G E Ç M İ Ş. 1. Adı Soyadı: Mustafa GÖÇKEN. 2. Doğum Tarihi: 12 Haziran 1976. 3. Unvanı: Yrd. Doç. Dr. 4. Öğrenim Durumu: Ph.D. Ö Z G E Ç M İ Ş 1. Adı Soyadı: Mustafa GÖÇKEN 2. Doğum Tarihi: 12 Haziran 1976 3. Unvanı: Yrd. Doç. Dr. 4. Öğrenim Durumu: Ph.D. Derece Alan Üniversite Yıl Lisans Endüstri Mühendisliği Çukurova Üniversitesi


Çiftlik Hayvanı Genetik Kaynaklarının Korunması ve Kullanımı İçin Yapılan Küresel Çabalar 1

Çiftlik Hayvanı Genetik Kaynaklarının Korunması ve Kullanımı İçin Yapılan Küresel Çabalar 1 Hayvansal Üretim 45(1): 1-6 (2004) Derleme Çiftlik Hayvanı Genetik Kaynaklarının Korunması ve Kullanımı İçin Yapılan Küresel Çabalar 1 Fikri Çanta, İsmail Oğuz* Ege Üniversitesi Ziraat Fakültesi Zootekni


Adıyaman İlinden Eylül Ayında Elde Edilen İnek Sütlerinin Doğu Afrika Kaliteli Çiğ İnek Sütü Standartlarına Uygunluklarinin Belirlenmesi

Adıyaman İlinden Eylül Ayında Elde Edilen İnek Sütlerinin Doğu Afrika Kaliteli Çiğ İnek Sütü Standartlarına Uygunluklarinin Belirlenmesi Adıyaman İlinden Eylül Ayında Elde Edilen İnek Sütlerinin Doğu Afrika Kaliteli Çiğ İnek Sütü Standartlarına Uygunluklarinin Belirlenmesi Buket COŞKUN 1, Murat ÇİMEN 1*, Hülya YILDIRIM 1, Asiye İLHAN 1,


Uluslararası Hayvancılık 99 Kongresi, 21-24 Eylül 1999, İzmir

Uluslararası Hayvancılık 99 Kongresi, 21-24 Eylül 1999, İzmir ÇİNE ÇAPARI, ÇİNE TİPİ VE MENEMEN x ÇİNE TİPİ (F 1 ) KUZULARDA KİMİ BESİ VE KESİM ÖZELLİKLERİ Orhan KARACA 1 İbrahim CEMAL Okan ATAY ÖZET Bu araştırma Çine Çaparı (ÇÇ), Çine Tipi (ÇT; sentetik yerel) ve






ÖZGEÇMİŞ VE ESERLER LİSTESİ ÖZGEÇMİŞ VE LER LİSTESİ Adı Soyadı: Savaş Atasever Doğum Tarihi: 8 Ocak 970 Öğrenim Durumu: Derece Bölüm/Program Üniversite Yıl Lisans Zootekni Ondokuz Mayıs Üniversitesi 99 Y. Lisans Zootekni Ondokuz


Damızlık İnek Seçimi. Zir. Müh. Zooteknist. Tarım Danışmanı Fatma EMİR

Damızlık İnek Seçimi. Zir. Müh. Zooteknist. Tarım Danışmanı Fatma EMİR Damızlık İnek Seçimi Zir. Müh. Zooteknist Tarım Danışmanı Fatma EMİR Süt sığırcılığını iyi seviyelere çıkarmak için seleksiyon ve çevre şartları önemlidir. Seleksiyon? Her yılın farklı dönemlerinde çeşitli


Markör Sistemleri ve Genetik Karakterizasyon Çalışmalarında Kullanımları Marker Systems and Applications in Genetic Characterization Studies

Markör Sistemleri ve Genetik Karakterizasyon Çalışmalarında Kullanımları Marker Systems and Applications in Genetic Characterization Studies Journal of Cell and Molecular Biology 10(2):11-19, 2012 Review Article 11 Haliç University, Printed in Turkey. http://jcmb.halic.edu.tr Markör Sistemleri ve Genetik Karakterizasyon Çalışmalarında Kullanımları


İlk Tohumlama Döneminde Hamdani Koyunlarının Döl Verimi ve Kuzularının Süt Emme Dönemindeki Yaşama Gücü İle Büyüme Performanslarının Araştırılması

İlk Tohumlama Döneminde Hamdani Koyunlarının Döl Verimi ve Kuzularının Süt Emme Dönemindeki Yaşama Gücü İle Büyüme Performanslarının Araştırılması 13 Uludag Univ. J. Fac. Vet. Med. 25 (2006), 12: 1317 İlk Tohumlama Döneminde Hamdani Koyunlarının Döl Verimi ve Kuzularının Süt Emme Dönemindeki Yaşama Gücü İle Büyüme Performanslarının Araştırılması


Iğdır İlinin Hayvansal Atık Kaynaklı Biyogaz Potansiyeli. Biogas Potential from Animal Waste of Iğdır Province

Iğdır İlinin Hayvansal Atık Kaynaklı Biyogaz Potansiyeli. Biogas Potential from Animal Waste of Iğdır Province Araştırma Makalesi / Research Article Iğdır Üni. Fen Bilimleri Enst. Der. / Iğdır Univ. J. Inst. Sci. & Tech. 2(1): 61-66, 2012 Iğdır İlinin Hayvansal Atık Kaynaklı Biyogaz Potansiyeli Iğdır Üniversitesi






TÜRKİYE DE KÜÇÜKBAŞ HAYVAN YETİŞTİRİCİLİĞİ TÜRKİYE DE KÜÇÜKBAŞ HAYVAN YETİŞTİRİCİLİĞİ Türkiye`de küçükbaş hayvan yetiştiriciliğinin özel bir yeri vardır. Çünkü koyun ve keçiler verimsiz meralarla nadas, anız ve bitkisel üretime uygun olmayan, başka





Siyah Alaca Sığırlarda Kısmi Süt Verimlerinden Yararlanılarak 305 Günlük Süt Veriminin Tahmini

Siyah Alaca Sığırlarda Kısmi Süt Verimlerinden Yararlanılarak 305 Günlük Süt Veriminin Tahmini Siyah Alaca Sığırlarda Kısmi Süt Verimlerinden Yararlanılarak 305 Günlük Süt Veriminin Tahmini İ. Keskin S. Boztepe Selçuk Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, Konya Bu çalışmada, Konya nın


Amasya İlinde İlkbahar Mevsiminde Elde Edilen İnek Sütlerinde Yağ Depresyonunun Belirlenmesi

Amasya İlinde İlkbahar Mevsiminde Elde Edilen İnek Sütlerinde Yağ Depresyonunun Belirlenmesi ISSN: 2148-0273 Cilt 3, Sayı 1, 2015 Vol. 3, Issue 1, 2015 Amasya İlinde İlkbahar Mevsiminde Elde Edilen İnek Sütlerinde Yağ Depresyonunun Belirlenmesi Hayriye AKYÜZ, Murat ÇİMEN*, Hüsna Rezzan ASLAN Özet


Sebze Islahında Moleküler Markırların Kullanımı

Sebze Islahında Moleküler Markırların Kullanımı Sebze Islahında Moleküler Markırların Kullanımı Esra CEBECİ Ziraat Yüksek Mühendisi 28.12.2012-28.06.2013 Atatürk Bahçe Kültürleri Merkez Araştırma Enstitüsü YALOVA Sunu Planı Çalışmanın tanıtımı, Yapılan


ANADOLU MANDASI. Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl.

ANADOLU MANDASI. Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl. ANADOLU MANDASI Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl.Biyometri Biyometri ve Genetik ABD Dombey,Gedek,Camış,Kömüş gibi


Siyah Alaca Sığırlarda Kuruda Kalma Süresi, Servis Periyodu ve İlkine Buzağılama Yaşı ile Bazı Süt Verim Özellikleri Arasındaki İlişkiler

Siyah Alaca Sığırlarda Kuruda Kalma Süresi, Servis Periyodu ve İlkine Buzağılama Yaşı ile Bazı Süt Verim Özellikleri Arasındaki İlişkiler Ulud. Üniv. Zir. Fak. Derg., (2004) 18(1): 69-79 Siyah Alaca Sığırlarda Kuruda Kalma Süresi, Servis Periyodu ve İlkine Buzağılama Yaşı ile Bazı Süt Verim Özellikleri Arasındaki İlişkiler Serdar DURU *


Siyah Alaca ve Esmer Sığırlarda Fazla Meme Başı Sayısına Ait Gen Frekansı, Kalıtım Derecesi ve Süt Verimi ile İlişkileri [1]

Siyah Alaca ve Esmer Sığırlarda Fazla Meme Başı Sayısına Ait Gen Frekansı, Kalıtım Derecesi ve Süt Verimi ile İlişkileri [1] Kafkas Univ Vet Fak Derg 16 (4): 561566, 2010 DOI:10.9775/kvfd.2009.1140 RESEARCH ARTICLE Siyah Alaca ve Sığırlarda Fazla Meme Başı Sayısına Ait Gen Frekansı, Kalıtım Derecesi ve Süt Verimi ile İlişkileri



DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap


Prof. Dr. Mehmet KOYUNCU

Prof. Dr. Mehmet KOYUNCU Prof. Dr. Mehmet KOYUNCU Zootekni Bölüm Başkanı Hayvan Yetiştirme Anabilim Dalı Telefon : 224 2941556 Faks : 224 4428152 E-posta : koyuncu@uludag.edu.tr Adres : Uludağ Üniversitesi Ziraat Fakültesi, Zootekni


GİRİŞ RESEARCH ARTICLE. Onur YILMAZ 1 Tamer SEZENLER 2 Emre ALARSLAN 2 Nezih ATA 1 Orhan KARACA 1 İbrahim CEMAL 1. Özet. Abstract

GİRİŞ RESEARCH ARTICLE. Onur YILMAZ 1 Tamer SEZENLER 2 Emre ALARSLAN 2 Nezih ATA 1 Orhan KARACA 1 İbrahim CEMAL 1. Özet. Abstract Kafkas Univ Vet Fak Derg 20 (6): 829-834, 2014 DOI: 10.9775/kvfd.2014.10859 Journal Home-Page: http://vetdergi.kafkas.edu.tr Online Submission: http://vetdergikafkas.org RESEARCH ARTICLE 1 2 Karacabey


Akın Pala, akin@comu.edu.tr. http://akin.houseofpala.com

Akın Pala, akin@comu.edu.tr. http://akin.houseofpala.com Akın Pala, akin@comu.edu.tr http://akin.houseofpala.com 1 Küçükbaş Hayvan Yetiştirme 2 3 Kaç tür koyun var, verimlerine göre Etçi ırklar, Sütçü ırklar, Yapağıcı ırklar 4 Kaç tür koyun var, anatomi Yurdumuzda


DERLEME. Moleküler Markerlerin Hayvan Yetiştiriciliği ve Genetiğinde Kullanımı * F.Ü.Sağ.Bil.Vet.Derg. 2014; 28 (2): 99-106 http://www.fusabil.

DERLEME. Moleküler Markerlerin Hayvan Yetiştiriciliği ve Genetiğinde Kullanımı * F.Ü.Sağ.Bil.Vet.Derg. 2014; 28 (2): 99-106 http://www.fusabil. DERLEME F.Ü.Sağ.Bil.Vet.Derg. 2014; 28 (2): 99-106 http://www.fusabil.org Murad GÜRSES 1 Metin BAYRAKTAR 2 1 Fırat Üniversitesi, Veteriner Fakültesi, Genetik Anabilim Dalı, Elazığ, TÜRKİYE 2 Fırat Üniversitesi,


atak@yalovabahce.gov.tr /atakarif@gmail.com Ege Üniversitesi Fen Bilimleri Enstitüsü Bahçe Bitkileri Anabilim Dalı / 2010

atak@yalovabahce.gov.tr /atakarif@gmail.com Ege Üniversitesi Fen Bilimleri Enstitüsü Bahçe Bitkileri Anabilim Dalı / 2010 KİŞİSEL BİLGİLER Adı Soyadı Dr. Arif ATAK Unvan Dr.Mühendis Telefon 0226 814 25 20 (1220) E-mail atak@yalovabahce.gov.tr /atakarif@gmail.com Doğum Tarihi - Yeri 15.11.1972 Aksaray Fotoğraf Doktora Üniversite


Sığırlarda Suni Tohumlama Uygulamaları Yönünden Genomik Seleksiyonun Önemi

Sığırlarda Suni Tohumlama Uygulamaları Yönünden Genomik Seleksiyonun Önemi Atatürk Üniversitesi Vet. Bil. Derg. 2015; 10(2): 139-145 Derleme/Review DOI: 10.17094/avbd.98368 Sığırlarda Suni Tohumlama Uygulamaları Yönünden Genomik Seleksiyonun Önemi Muhammed Enes İNANÇ 1, Ali DAŞKIN





HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden


ÖZGEÇMİŞ. Expression Pattern Comparison of Two Ubiquitin Specific Proteases. Functional Characterization of Two Potential Breast Cancer Related Genes

ÖZGEÇMİŞ. Expression Pattern Comparison of Two Ubiquitin Specific Proteases. Functional Characterization of Two Potential Breast Cancer Related Genes ÖZGEÇMİŞ 1. Adı ve Soyadı: Shiva Akhavantabasi 2. Ünvanı: Yrd. Doç. Dr. 3. Email adresi: shiva.akhavan@yeniyuzyil.com 4. Öğrenim Durumu: Derece Alan Üniversite Yıl Lisans Mikrobiyoloji Jahrom Azad Üniversitesi








Kangal Köpeği Yavrularında Vücut Ağırlığı Değişimlerinin Tanımlanmasında Doğrusal Olmayan Büyüme Modellerinin Kullanılması*

Kangal Köpeği Yavrularında Vücut Ağırlığı Değişimlerinin Tanımlanmasında Doğrusal Olmayan Büyüme Modellerinin Kullanılması* Atatürk Üniversitesi Vet. Bil. Derg. 2011; 6(1): 17-22 Atatürk Üniversitesi Veteriner Bilimleri Dergisi http://e-dergi.atauni.edu.tr/index.php/vbd Araştırma Makalesi Kangal Köpeği Yavrularında Vücut Ağırlığı


Hemşin Kuzularında büyüme ve bazı vücut ölçülerinin belirlenmesi

Hemşin Kuzularında büyüme ve bazı vücut ölçülerinin belirlenmesi Lalahan Hay. Araşt. Enst. Derg. 2014, 54 (1) 15-20 Araştırma Makalesi / Research Article Hemşin Kuzularında büyüme ve bazı vücut ölçülerinin belirlenmesi Mehmet SARI 1, Kadir ÖNK 2, Ali Rıza AKSOY 1, Muammer


Current Status of Cattle, Sheep and Goat Breeding in Turkey

Current Status of Cattle, Sheep and Goat Breeding in Turkey Van Vet J, 2015, 26 (2) 111-117 Van Veterinary Journal http://vfdergi.yyu.edu.tr ISSN: 2149-3359 Review e-issn: 2149-8644 Current Status of Cattle, Sheep and Goat Breeding in Turkey Abdurrahman KÖSEMAN






SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler


Farklı Besi Sistemlerinde Besiye Alınan Karya Kuzularda Besi Performansı, Kesim ve Karkas Özellikleri

Farklı Besi Sistemlerinde Besiye Alınan Karya Kuzularda Besi Performansı, Kesim ve Karkas Özellikleri Hayvansal Üretim 52(2): 1-9 Araştırma Makalesi Farklı Besi Sistemlerinde Besiye Alınan Karya Kuzularda Besi Performansı, Kesim ve Karkas Özellikleri Engin Yaralı 1, Orhan Karaca 2 1 Adnan Menderes Üniversitesi,


Batman ve Bitlis İllerinden Elde Edilen İnek Sütlerinde Yağ ve Protein Oranlarının Ab ve Türk Standartlarına Uygunlukların Belirlenmesi

Batman ve Bitlis İllerinden Elde Edilen İnek Sütlerinde Yağ ve Protein Oranlarının Ab ve Türk Standartlarına Uygunlukların Belirlenmesi Batman ve Bitlis İllerinden Elde Edilen İnek Sütlerinde Yağ ve Protein Oranlarının Ab ve Türk Standartlarına Uygunlukların Belirlenmesi Asiye İLHAN 1, Murat ÇİMEN 1*, Zeynep DEMİR 1, Zinet TURHAN 1, Burçin








İzmir İli Bal Arısı (Apis mellifera L.) Populasyonlarında Enzim Polimorfizmi*

İzmir İli Bal Arısı (Apis mellifera L.) Populasyonlarında Enzim Polimorfizmi* Ege Üniv. Ziraat Fak. Derg., 2006, 43(1):75-84 ISSN 1018-8851 İzmir İli Bal Arısı (Apis mellifera L.) Populasyonlarında Enzim Polimorfizmi* Fatih KILIÇ 1 Güldehen BİLGEN 2 Summary Enzyme Polymorphism in



KONGRE BAŞKANI DÜZENLEME KURULU KONGRE BAŞKANI Prof. Dr. Sebahattin ÖZCAN Ankara Üniversitesi DÜZENLEME KURULU Prof. Dr. Mehmet KARATAŞ Düzenleme Kurulu Başkanı Prof. Dr. Dilek TURGUT BALIK Düzenleme Kurulu Başkan Yardımcısı Doç. Dr.


ARAŞTIRMA. Anahtar Kelimeler: Saanen, Kıl keçisi, Melezleme, Büyüme, Yaşama Gücü

ARAŞTIRMA. Anahtar Kelimeler: Saanen, Kıl keçisi, Melezleme, Büyüme, Yaşama Gücü ARAŞTIRMA 2007: 21 (1): 21-26 http://www.fusabil.org Saanen X Kıl Keçisi F1 ve G1 Melezlerinde Büyüme ve Yaşama Gücü Özelliklerinin Araştırılması Ü. Gülcihan ŞİMŞEK Metin BAYRAKTAR Murad GÜRSES Fırat Üniversitesi


Kahramanmaraş İli Süt Sığırcılık İşletmelerinin Yapısal Özellikleri 4.İşletmecilerin Sosyal ve Kültürel Durumları*

Kahramanmaraş İli Süt Sığırcılık İşletmelerinin Yapısal Özellikleri 4.İşletmecilerin Sosyal ve Kültürel Durumları* Atatürk Üniversitesi Ziraat Fakültesi Dergisi, 41 (1), 39-44, 2010 Journal of Agricultural Faculty of Atatürk University, 41 (1), 39-44, 2010 ISSN : 1300-9036 Araştırma Makalesi/Research Article Kahramanmaraş


Uluslararası Spor Bilimleri Araştırma Dergisi (USBAD)

Uluslararası Spor Bilimleri Araştırma Dergisi (USBAD) Uluslararası Spor Bilimleri Araştırma Dergisi (USBAD) Yazım Kuralları: Çalışmanın metni 12 punto, 1,5 satır aralığında, Times New Roman yazı karakterinde, iki yana yaslı şekilde, MS Word programında yazılmalıdır.








15.05.2009 / 27229. 15 Mayıs 2009 CUMA. Resmî Gazete. Sayı : 27229 TEBLİĞ. Köyişleri Bakanlığından: HAYVANCILIĞIN DESTEKLENMESİ HAKKINDA

15.05.2009 / 27229. 15 Mayıs 2009 CUMA. Resmî Gazete. Sayı : 27229 TEBLİĞ. Köyişleri Bakanlığından: HAYVANCILIĞIN DESTEKLENMESİ HAKKINDA 15.05.2009 / 27229 15 Mayıs 2009 CUMA Resmî Gazete Sayı : 27229 TEBLİĞ Tarım ve Köyişleri Bakanlığından: HAYVANCILIĞIN DESTEKLENMESİ HAKKINDA UYGULAMA ESASLARI TEBLİĞİ (TEBLİĞ NO: 2009/44) BİRİNCİ BÖLÜM


1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8)

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8) KONU-7. MOLEKÜLER BĠYOLOJĠDE TEMEL TEKNĠKLER BĠTKĠDEN GENOMĠK DNA ĠZOLASYONU Kullanılan Tamponlar: 1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol,



KULLANICI TARAFINDAN TESTİN DOĞRULANMASI (VERİFİKASYON) Dr. Murat Öktem Düzen Laboratuvarlar Grubu KULLANICI TARAFINDAN TESTİN DOĞRULANMASI (VERİFİKASYON) Dr. Murat Öktem Düzen Laboratuvarlar Grubu Kaynaklar CLSI EP5-A2: Evaluation of Precision Performance of Quantitative Measurement Methods (2004)


The Study of Relationship Between the Variables Influencing The Success of the Students of Music Educational Department

The Study of Relationship Between the Variables Influencing The Success of the Students of Music Educational Department 71 Mehmet Akif Ersoy Üniversitesi Eğitim Fakültesi Dergisi, Yıl 9, Sayı 17, Haziran 2009, 71-76 Müzik Eğitimi Anabilim Dalı Öğrencilerinin Başarılarına Etki Eden Değişkenler Arasındaki İlişkinin İncelenmesi


Türk Tarım - Gıda Bilim ve Teknoloji Dergisi

Türk Tarım - Gıda Bilim ve Teknoloji Dergisi Türk Tarım Gıda Bilim ve Teknoloji Dergisi, 3(7): 577-582, 2015 Türk Tarım - Gıda Bilim ve Teknoloji Dergisi www.agrifoodscience.com Türk Bilim ve Teknolojisi Kastamonu İli Küçükbaş Hayvan Yetiştiriciliğinin


ÖZGEÇMİŞ ve ESERLER LİSTESİ. Derece Alan Üniversite Yıl Önlisans Tıbbi Laboratuvar İstanbul Üniversitesi 2001-2002

ÖZGEÇMİŞ ve ESERLER LİSTESİ. Derece Alan Üniversite Yıl Önlisans Tıbbi Laboratuvar İstanbul Üniversitesi 2001-2002 ÖZGEÇMİŞ ve ESERLER LİSTESİ ÖZGEÇMİŞ Adı Soyadı: Aysel VEYİSOĞLU Doğum Tarihi: 1981 Öğrenim Durumu: Derece Alan Üniversite Yıl Önlisans Tıbbi Laboratuvar İstanbul Üniversitesi 2001-2002 Lisans Biyoloji


Önsöz. Değerli katılımcılar,

Önsöz. Değerli katılımcılar, Önsöz Değerli katılımcılar, Mart 2007 den beri büyük bir ekip olarak, heyecan ile yürüttüğümüz TÜRKHAYGEN-I projesinin yeni bir aşamasına varmış bulunuyoruz. Artık verilerimiz, özellikle mikrosatelit belirteçlere





ÖZGEÇMİŞ. Derece Alan Üniversite Yıl. OrtaöğretimMatematikEğitimi BoğaziciÜniversitesi 2007

ÖZGEÇMİŞ. Derece Alan Üniversite Yıl. OrtaöğretimMatematikEğitimi BoğaziciÜniversitesi 2007 ÖZGEÇMİŞ 1. AdıSoyadı: Rukiye Didem Taylan 2. DoğumTarihi: 25 Temmuz 1984 3. Unvanı: Yrd. Doç. Dr. 4. ÖgrenimDurumu: Derece Alan Üniversite Yıl Lisans OrtaöğretimMatematikEğitimi BoğaziciÜniversitesi 2007





Yasemin ÖNER * Murat PULLU * Oya AKIN ** Cengiz ELMACI *

Yasemin ÖNER * Murat PULLU * Oya AKIN ** Cengiz ELMACI * Kafkas Univ Vet Fak Derg 17 (3): 371-376, 2011 DOI:10.9775/kvfd.2010.3501 RESEARCH ARTICLE Bursa Bölgesinde Yetiştirilen İsviçre Esmeri ve Siyah Alaca Irkı Sığırlarda Beta Laktoglobulin (β-lg) ve Büyüme





Halk elinde ekstansif koşullarda yetiştirilen Sakız X Akkaraman G 1 koyunlarda süt verimi ve bazı kalite özellikleri *

Halk elinde ekstansif koşullarda yetiştirilen Sakız X Akkaraman G 1 koyunlarda süt verimi ve bazı kalite özellikleri * Lalahan Hay. Araşt. Enst. Derg. 2015, 55 (1) 7-14 Araştırma Makalesi / Research Article Halk elinde ekstansif koşullarda yetiştirilen Sakız X Akkaraman G 1 koyunlarda süt verimi ve bazı kalite özellikleri



BALIK POPÜLASYONLARI İÇİN GEN BANKALARI MAKALE BALIK POPÜLASYONLARI İÇİN GEN BANKALARI Dr. Yılmaz ÇİFTÇİ, SUMAE Giriş Dünya üzerinde türleri temsil eden balık popülasyonlarının bir çoğu her geçen gün küçülme göstermektedir. Aşırı avcılığın yanı


ÖZÞENSOY, KURAR, BULUT, NÝZAMLIOÐLU amaçla Uluslararasý Hayvan Genetiði Derneði (ISAG; International Society of Animal Genetics) tarafýndan standartla

ÖZÞENSOY, KURAR, BULUT, NÝZAMLIOÐLU amaçla Uluslararasý Hayvan Genetiði Derneði (ISAG; International Society of Animal Genetics) tarafýndan standartla Vet. Bil. Derg. (2008), 24, 1; 87-91 OLGU SUNUMU MÝKROSATELLÝT DNA MARKÖRLERÝ KULLANILARAK ATLARDA EBEVEYN TAYÝNÝ: BÝR VAKA TAKDÝMÝ Yusuf Özþensoy 1, Ercan Kurar 1*, Zafer Bulut 2, Mehmet Nizamlýoðlu 2
