TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ"

Transkript

1 TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ 1

2 GİRİŞ Adli olayların aydınlatılmasında biyolojik örneklerin kimliklendirilmesi çok önemlidir. Adli bilimlerde kullanılan genetik işaretlerin başında STR sistemleri gelmektedir. Ancak bugün özellikle aşırı degrade olmuş veya az miktarda DNA içeren biyolojik delillerin analizinde yeterli değildir. Bu durumda SNP ler ve INDEL lerden yararlanılabilir. 2

3 İNSERSİYON/DELESYON (INDEL) İnsersiyon/delesyon veya yaygın olarak INDEL adı verilen genetik varyasyonlar, DNA dizisine baz dizisinin eklenmesi ya da çıkması şeklinde oluşur. Baz dizisinin çıkması sonucu oluşan versiyonuna delesyon, baz dizisinin eklenmesi sonucu oluşan versiyonuna ise insersiyon adı verilmektedir. delesyon TCAGCAACAACACAGTCATATTTAGCTCTACCACAGTGTG GCAACAACACAGTCATATCCATTCTCAATTAGCTCTACCACAGTGTG insersiyon 3

4 İNSERSİYON/DELESYON (INDEL) DNA da meydana gelen İnsersiyon/delesyonlar sonucu mutasyonlar ve polimorfizmler oluşur. DNA daki bu değişiklikler fenotipi etkiliyor ise mutasyon olarak, bu değişiklikler fenotipi etkilemiyor sadece genetik çeşitlilik sağlıyor ise polimorfizm olarak adlandırılmaktadır. Polimorfizm sonucu meydana gelen farklılıklar kuşaktan kuşağa Mendel yasalarına göre aktarılırlar. Polimorfik bir sistemin adli bilimlerde kimliklendirme amaçlı kullanılabilmesi için o sistemin populasyonda en az %1 sıklıkta görülmesi gereklidir. 4

5 İnsersiyon/Delesyon (INDEL) Polimorfizmi İnsan DNA sındaki polimorfizmin büyük çoğunluğunu oluşturan tek baz değişimi (SNP ler) veya daha fazla bazın insersiyonu ve delesyonuna dayalı polimorfizmler olarak iki gruba ayırmak mümkündür. Bunlar nokta mutasyonları ve çerçeve kayması mutasyonları şeklinde oluşan kalıtımsal değişimler meydana getirirler. Nokta mutasyonunda sadece bir baz mutasyona uğrar ve Tek Nükleotid Polimorfizmini (SNP, Single Nüleotid Polymorfizm) oluştururlar. Çerçeve kayması mutasyonu, baz dizisinin insersiyonu (eklenmesi) veya delesyonu (çıkması) şeklindedir. 5

6 İNSERSİYON/DELESYON (INDEL) Küçük INDEL Büyük INDEL 1. Küçük INDEL ler: Sadece birkaç bç lik uzunluktaki dizinlerdir. Bu INDEL ler polimorfizm göstermesinin yanında daha çok hastalıklarla ilgili varyasyonları oluşturur. Bunun nedeni, genin kodlama bölgesinde INDEL dizinin okumada bozulmaya neden olması ve protein dizisinin değişmesine yol açmasıdır. 2. Büyük INDEL ler: Birkaç kilobaz (kb) uzunluğu aşan dizinlerdir. Bu tip varyasyonlar genomda sanılanın aksine sıklıkla görülmektedir. Adli kimliklendirmede kullanılan ve SNP polimorfizmi kadar olmasa da genom içinde 1000 den fazla bilinen INDEL ler bu varyasyonlardan oluşmaktadır. 6

7 İnsersiyon/Delesyon (INDEL) Polimorfizmi Tüm insan genomunun yaklaşık 3.2 milyon baz olduğu ve tahminlere göre yaklaşık 2700 bazda bir ortaya çıkan, hem kodlama yapan hem de yapmayan bölgelerinde yaklaşık 1 milyon SNP olduğu düşünülmektedir. Genetik varyasyonları belirlemek için yapılan çalışmalar daha çok SNP ler üzerinde yoğunlaşmış olsa da son yıllarda INDEL polimorfizmi üzerinde de çalışmalar yapılmaktadır. 7

8 İnsersiyon/Delesyon (INDEL) Polimorfizmi Özelliklede 2002 yılında Marshfield Tıp Araştırma Vakfında, James Weber ve arkadaşlarının insan genomu üzerinde 2000 in üzerinde dialelik insersiyon/delesyonu karakterize etmesiyle, dialelik indellerin insan polimorfizminin %8 ini oluşturduğunu bildirmişlerdir. Bu çalışma sonucunda toplamda %71 INDEL in aleller arasında 2, 3, veya 4 nükleotid uzunluk farkı varken sadece %4 ünde 16 nükleotid uzunluk farkı çıkmıştır. 8

9 İnsersiyon/Delesyon (INDEL) Polimorfizmi Bir başka çalışma olan Mills ve arkadaşlarının 2006 yılında yaptıkları çalışmayla insan indel varyasyon haritasını çıkararak 7.2 kb da bir görüldüğünü genomda SNP den sonra en sık rastlanan ikinci polimorfizim şeklinin INDEL ler olduğunu bildirmişlerdir. Bu da bilinen 15 milyon genetik varvasyonun 3 milyonunun INDEL lerin oluşturduğunu gösterir. Bu çalışma sonucunda İndellerin %36 sı DNA da promoter bölgede, intronlarda ve eksonlarda yerleşmiştir. 9

10 İnsersiyon/Delesyon (INDEL) Polimorfizmi Adli amaç için uygulanacak INDEL analizinin avantajlı özellikleri; duyarlı olması, tekrarlanabilirliği, doğruluğu, bozulmuş örneklerde yüksek performans göstermesi, multipleks yapılabilme kapasitesi, zaman, maliyet, 10

11 İnsersiyon/Delesyon (INDEL) Polimorfizmi İNDEL lerin düşük mutasyon ve yüksek heterozigotluk oranının olmasından, dışlama ve ayrım gücünün yüksek olmasından ayrıca bozunmuş ve eser miktardaki örneklerde başarılı tiplendirme yapabilmesinden dolayı yeni nesil genetik varyasyonlar olan INDEL ler üzerine daha birçok çalışma yapılacağı düşünülmektedir. Kısacası SNP haritalarına INDEL lerin eklenmesi genom genetik haritaların çözünürlüğünün artırılmasına ve hastalığa neden olan lokuslardaki yerinin bulunmasına yardımcı olabilir. 11

12 İnsersiyon/Delesyon (INDEL) Polimorfizmi Ayrıca kimlik tespiti dahil olmak üzere özellikle nesep tayininde ve kitlesel felaket kurbanlarının akrabalık ilişkilerinin saptanmasında, gelecekte genetik çalışmalarda INDEL lerin yaygın bir şekilde kullanılacaktır. Bir nevi günümüzde DNA profillemesinde kullanılan SNP ve STR polimorfizmine İnsersiyon/Delesyon (INDEL) polimorfizmi alternatif oluşturacaktır. 12

13 Türkiye Popülasyonu Çalışmada aralarında akrabalık ilişkisi bulunmayan Türkiye nin tüm bölgelerini yansıtacak şekilde çalışmaya rıza gösteren sağlıklı 250 kişiden onam alınan kan örnekleri kullanıldı. DNA örneklerinde 30 INDEL lokusunun multiplex (çoklu) amplifikasyonu yapıldı. 13

14 Türkiye Popülasyonu Otozomal kromozomlar üzerinde bulunan 30 INDEL lokusunun optimizasyonu yapılarak söz konusu lokusların Türkiye deki polimorfizmi belirlendi. 14

15 Otozomal 30 INDEL lokusunun 250 kişi üzerinde Genemapper IDX v.1 (Life Technologies) analiz programı kullanılarak genotipi belirlendi. 15

16 Kadın DNA'sına ait elektroforegram görüntüsü 16

17 Erkek DNA'sına ait elektroforegram görüntüsü 17

18 VERİLERİN ANALİZİ GENETİX v , Arlequin v , Promega PowerStats Excel Dosyası, MedCalc MEGA 5.1, 18

19 İSTATİSTİKSEL BULGULAR Alel Frekansları 250 kişide 30 INDEL lokusunun alel sıklığı Arlequin v yazılım programı kullanılarak yapıldı. 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0 D77-/+ D45-/+ D131-/+ D70-/+ D6-/+ D111-/+ D58-/+ D56-/+ D118-/+ D92-+ D93-/+ D99-/+ D88-/+ D101-/+ D67-/+ D83-/+ D114-/+ D48-/+ D124-/+ D122-/+ D125-/+ D64-/+ D81-/+ D136-/+ D133-/+ D97-/+ D40-+ D128-/+ D39-/+ D84-/+ DIP- DIP+ 19

20 Hardy-Weinberg Dengesi Arlequin v programında 30 INDEL lokusunun p-değerleri hesaplandı ve Hardy-Weinberg dengesine bakıldı. P değerinin anlamlılığının değerlendirilmesinde; P 0.05 ise, sapma önemlidir ve popülasyonda denge yoktur. P 0.05 ise, sapma istatistiksel olarak anlamlı değildir ve popülasyon dengededir. 20

21 Adli İstatistik Parametreleri Otozomal 30 INDEL lokusunun ayrım gücü (PD), eşleşme olasılığı (Pm), polimorfik bilgi içeriği (PIC), dışlama gücü (PE), tipik babalık indeksi (TPI) gibi adli istatistik parametreleri Promega PowerStats excel dosyası kullanılarak hesaplandı. 21

22 İSTATİSTİKSEL BULGULAR Popülasyonlar Arası Lokus Bazındaki Farklılıklar 30 INDEL lokusunun Türkiye popülasyonu ile diğer popülasyonların (Kuzey Doğu İtalya, Polonya, Finlandiya, Güney Kore, Tayvan, Somali) makalelerinden elde edilen alel frekanslarından yararlanılarak Arlequin v yazılım programı kullanılarak Fisher s Exact Test ile popülasyonlar arası p-değeri bakımından lokus bazındaki farklılık belirlendi. Tayvan (126) Finlandiya (151) Somali (175) Polonya (122) İtalya (200) Kore (373) Türkiye (250) 22

23 Fisher s Exact Test Sonucu South Korea D97, D40, D128,D39, D84, D122, D125, D64, D81, D118, D93, D99, D67, D131, D111, D56 Italy - Finland D48, D93, D99, D77 Somali Taiwan Poland D138, D84, D114, D124, D122, D125, D81, D99, D88, D101, D45, D131, D70, D111 D40,D128,D39, D48,D122,D64,D81, D118, D99, D131, D111 D131 23

24 İSTATİSTİKSEL BULGULAR Popülasyonlar Arası Genetik Uzaklık (F ST ) 1000 Genome INDEL verilerinin bulunduğu Ensemble ( veri bankasından söz konusu lokuslardan diğer popülasyonlara ait 15 INDEL lokusuna ait 15 INDEL ( HLD45, HLD131, HLD58, HLD99, HLD88, HLD101, HLD83, HLD114, HLD48, HLD81, HLD136, HLD133, HLD128, HLD39, HLD84) lokusunun genotip bilgilerine ulaşılmıştır. Türkiye popülasyonu ile Avrupa, Amerika, Güney Asya, Doğu Asya, Afrika popülasyonlarına ait genotip veriler kullanılarak 15 INDEL lokusu için Arlequin ver programı yardımıyla ortak Fst değerleri hesaplandı. 24

25 INDEL lokuslarının popülasyonlar arası genetik uzaklık (Fst) değerleri Türkiye Avrupa Amerika Güney Asya Doğu Asya Afrika 15 INDEL n:250 n:503 n:347 n: 489 n:504 n:661 Türkiye Avrupa Amerika Güney Asya Doğu Asya Afrika Fst değeri küçük, orta düzey, büyük, 0.25 den büyük ise çok büyük bir genetik farklılaşma 25

26 Filogenetik Ağaç Çizimi İSTATİSTİKSEL BULGULAR Türkiye popülasyonuna ile Avrupa, Amerika, Güney Asya, Doğu Asya, Afrika popülasyonlarına ait genotip veriler kullanılarak INDEL lokusları için bulunan Fst değerleri ile Mega 5.1 programında komşu birleştirme yöntemi kullanılarak filogenetik ağaç çizildi. 26

27 Filogenetik Ağaç Çizimi Guney Asya Dogu Asya Turkiye Avrupa Amerika Afrika

28 SONUÇ Türk populasyonu için yüksek polimorfizm gösteren 30 INDEL (Amelogenin X, Amelogenin Y ve HLD77, HLD45, HLD131, HLD70, HLD6, HLD111, HLD58, HLD56, HLD118, HLD92, HLD93, HLD99, HLD88, HLD101, HLD67, HLD83, HLD114, HLD48, HLD124, HLD122, HLD125, HLD64, HLD81, HLD136, HLD133, HLD97, HLD40, HLD128, HLD39, HLD84) lokusundan oluşan Investigator DIPplex Kit (Qiagen) in adli bilimlerde kullanılabileceği belirlenmiştir. Bu çalışma bulguları Türk Toplumu nun Avrupa Toplumu na genetik olarak daha yakın olduğunu göstermiştir. Bu lokuslar Türk kriminal laboratuvarlarında babalıkakrabalık testlerinde ve degrade DNA örneklerinin analizinde de kullanılabilecektir. 28

29 SONUÇ INDEL lerin, özellikle olay yerinden az miktarda veya bozunmuş olarak gelen biyolojik materyallerde hatta antropolojik ve arkeolojik araştırmalarda, STR lokusları ile tiplendirme yapılamadığı durumlarda ve SNP ye göre daha kısa zamanda ve az maliyetle başarılı bir çoğalma yapılabilmesi gibi özellikleri açısından adli bilimlerde kullanımı zamanla artacaktır Yinede INDEL lokuslarının STR ya da SNP sistemlerine alternatif oluşturabilmesi için yaygın bir şekilde kullanılması, hem diğer somatik kromozomlar hem de cinsiyet kromozomları üzerindeki daha çok INDEL noktasının araştırılması gerekir. 29

30 BENİ DİNLEDİĞİNİZ İÇİN TEŞEKKÜR EDERİM 30

T.C. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ. Danışman: Yard. Doç. Dr. Gönül Filoğlu

T.C. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ. Danışman: Yard. Doç. Dr. Gönül Filoğlu T.C. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ Danışman: Yard. Doç. Dr. Gönül Filoğlu 30 İNSERSİYON/DELESYON (INDEL) LOKUSUNUN TÜRKİYE DEKİ POLİMORFİZMİ FEN BİLİMLERİ ANABİLİM DALI YÜKSEK LİSANS TEZİ BİYOLOG

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Paternal Kromozom Y. Maternal Kromozom X. Yrd Doç Dr Sema DEMİRÇİN

Paternal Kromozom Y. Maternal Kromozom X. Yrd Doç Dr Sema DEMİRÇİN Y-STR Analizleri Yrd Doç Dr Sema DEMİRÇİN Maternal Kromozom X Paternal Kromozom Y Y KROMOZOMU İnsan kromozomları içerisinde; İkinci en küçük kromozomdur Genomun sadece %2 kadarını oluşturur 6O milyon kadar

Detaylı

HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI)

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Adli Biyolojik Incelemeler ve Molekuler Genetik Kursu DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Yrd. Doç. Dr. GÖNÜL FİLOĞLU İ.Ü. ADLİ TIP ENSTİTÜSÜ KRİMİNAL İDANTİFİKASYONDA DNA TİPLEMESİ Moleküler

Detaylı

X kromozomu (Devam) X STR Polimorfizmi 08.04.2008. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma bağlı

X kromozomu (Devam) X STR Polimorfizmi 08.04.2008. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma bağlı X kromozomu X KROMOZOMAL STR POLİMORFİZMİ Doç. Dr. Faruk AŞICIOĞLU Adli Tıp Uzmanı & Tıbbi Biyoloji Bilim Dr. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma

Detaylı

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı.

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı. Bu dersin içeriği, Populasyonun tanımı, Alel ve genotip frekansı, Gen havuzu, Gen frekansı, Gerçek/Doğal populasyonlar ve ideal populasyonlar, Populasyon genetiğinin çalışma alanları, HW kanunu -giriş,

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

GENETĐK Popülasyon Genetiği. Doç. Dr. Hilâl Özdağ. Pierce B., Genetics: A conceptual Approach,

GENETĐK Popülasyon Genetiği. Doç. Dr. Hilâl Özdağ. Pierce B., Genetics: A conceptual Approach, GENETĐK 111-503 Popülasyon Genetiği Doç. Dr. Hilâl Özdağ 1 Popülasyon Genetiği Popülasyon genetiği bireylerin oluşturduğu toplulukların genetik yapısını ve bu yapının zamanla nasıl değiştiğini inceleyen

Detaylı

kime aittir sorusuna cevap aranır.

kime aittir sorusuna cevap aranır. ADLİ BİYOLOJİK İNCELEMELER VE MOLEKÜLER GENETİK KURSU ÖRNEK OLGU SUNUMLARI İLE ADLİ GENETİK RAPORLARIN DEĞERLENDİRİLMESİ Adli bilimlerde genetik işaretler üç amaç için kullanılmaktadır. 1-Kimlik tayini

Detaylı

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Yrd. Doç. Dr. Neşe Direk Dokuz Eylül Üniversitesi Psikiyatri Anabilim Dalı Genetik Epidemiyoloji ve Psikiyatri Genome-Wide vs. Aday Gen Asosiyasyon

Detaylı

Mendel Dışı kalıtım. Giriş

Mendel Dışı kalıtım. Giriş Mendel Dışı kalıtım DR. UMUT FAHRİOĞLU, PHD MSC Giriş Bir organizmanın fenotipinin genotipin bakarak tahmin edilebilmesi için birçok farklı faktörün çok iyi anlaşılabilmesi lazım. Mendel kalıtım modellerindeki

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL

Detaylı

T.H. Morgan ve A.H. Sturtevant 1911

T.H. Morgan ve A.H. Sturtevant 1911 GENETĐK 111-503 HAFTA III Bağlantı, Asosiyasyon, Haritalama Doç. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark: kiyazma 2. Görünüşteki

Detaylı

TEMEL VETERĠNER GENETĠK

TEMEL VETERĠNER GENETĠK DİKKATİNİZE: BURADA SADECE ÖZETİN İLK ÜNİTESİ SİZE ÖRNEK OLARAK GÖSTERİLMİŞTİR. ÖZETİN TAMAMININ KAÇ SAYFA OLDUĞUNU ÜNİTELERİ İÇİNDEKİLER BÖLÜMÜNDEN GÖREBİLİRSİNİZ. TEMEL VETERĠNER GENETĠK KISA ÖZET KOLAYAOF

Detaylı

Hardy Weinberg Kanunu

Hardy Weinberg Kanunu Hardy Weinberg Kanunu Neden populasyonlarla çalışıyoruz? Popülasyonları analiz edebilmenin ilk yolu, genleri sayabilmekten geçer. Bu sayım, çok basit bir matematiksel işleme dayanır: genleri sayıp, tüm

Detaylı

2 Çeşit Populasyon mevcuttur. Gerçek/Doğal Populasyonlar: Örneğin yaşadığınız şehirde ikamet eden insanlar.

2 Çeşit Populasyon mevcuttur. Gerçek/Doğal Populasyonlar: Örneğin yaşadığınız şehirde ikamet eden insanlar. 2 POPULASYON 2 Çeşit Populasyon mevcuttur Gerçek/Doğal Populasyonlar: Örneğin yaşadığınız şehirde ikamet eden insanlar. 2 Çeşit Populasyon mevcuttur İdealize Edilmiş Populasyonlar: Genotip ve alel frekanslarının

Detaylı

ADIM ADIM YGS LYS Adım EVRİM

ADIM ADIM YGS LYS Adım EVRİM ADIM ADIM YGS LYS 191. Adım EVRİM EVRİM İLE İLGİLİ GÖRÜŞLER Evrim, geçmiş ile gelecekteki canlıların ve olayların yorumlanmasını sağlayarak, bugün dünyada yaşayan canlılar arasındaki akrabalık derecesini

Detaylı

GENETİK TANI YÖNTEMLERİ. Prof.Dr.Mehmet Alikaşifoğlu

GENETİK TANI YÖNTEMLERİ. Prof.Dr.Mehmet Alikaşifoğlu GENETİK TANI YÖNTEMLERİ Prof.Dr.Mehmet Alikaşifoğlu S Genetik Tanı Yöntemleri S Sitogenetik Tanı Yöntemleri S Moleküler Sitogenetik Tanı Yöntemleri S Moleküler Genetik Tanı Yöntemleri Sitogenetik Tanı

Detaylı

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz Genom Sayısal ve Yapısal Mutasyonlar Prof. Dr. Fatma Savran Oğuz Organizmanın haploid hücredeki tüm gen ve gen dışı bölgelerinden oluşan kalıtsal maddenin tamamı Genom bir kişinin taşıdığı tüm genetik

Detaylı

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Dr. Muradiye Nacak Gaziantep Üniversitesi Tıp Fakültesi Farmakoloji Anabilim Dalı 4Kasım, 2009 Sunum Planı Farmakogenetik,

Detaylı

ADIM ADIM YGS LYS. 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON

ADIM ADIM YGS LYS. 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON ADIM ADIM YGS LYS 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON GENETİK VARYASYON Aynı türün bireyleri arasındaki farklılığa VARYASYON denir. Varyasyonların hepsi

Detaylı

GENETİK ALGORİTMALAR. Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ

GENETİK ALGORİTMALAR. Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ GENETİK ALGORİTMALAR Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ GENETİK ALGORİTMALAR Genetik algoritmalar, Darwin in doğal seçim ve evrim teorisi ilkelerine dayanan bir arama ve optimizasyon yöntemidir.

Detaylı

YZM 5257 YAPAY ZEKA VE UZMAN SİSTEMLER DERS#6: GENETİK ALGORİTMALAR

YZM 5257 YAPAY ZEKA VE UZMAN SİSTEMLER DERS#6: GENETİK ALGORİTMALAR YZM 5257 YAPAY ZEKA VE UZMAN SİSTEMLER DERS#6: GENETİK ALGORİTMALAR Sınıflandırma Yöntemleri: Karar Ağaçları (Decision Trees) Örnek Tabanlı Yöntemler (Instance Based Methods): k en yakın komşu (k nearest

Detaylı

AİLESEL AKDENİZ ATEŞİ (AAA-FMF)

AİLESEL AKDENİZ ATEŞİ (AAA-FMF) AİLESEL AKDENİZ ATEŞİ (AAA-FMF) MOLEKÜLER YAKLAŞIMLAR DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD AİLESEL AKDENİZ ATEŞİ Otozomal resesif kalıtım Akdeniz ve Ortadoğu kökenli populasyonlarda

Detaylı

Milletlerin akrabalığı

Milletlerin akrabalığı Milletlerin akrabalığı Türklük, bir ırka aidiyet ve bir kan meselesi değil; bir Millet'e mensubiyet ve bir kültür meselesidir. Prof. Dr. D. Ali ERCAN daliercan@gmail.com 16.6.2014, Ankara Değerli arkadaşlar,

Detaylı

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır.

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır. Allel: Bir genin seçenekli biçimi Wild Tip: Normal allel. Bireylerin çoğunda bulunan Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda

Detaylı

Antropoloji, çesitlilik ve SNPler. genetik

Antropoloji, çesitlilik ve SNPler. genetik Antropoloji, çesitlilik ve SNPler genetik Antropoloji: insanı en iyi anlayan ve anlatan bilim dalı (anthropos = insan; logos = bilim) İnsan, biyo-kültürel bir varlık alanı olarak karşımıza çıkmaktadır.

Detaylı

Nicel Genetik ve Çok Etmenli Karakterler

Nicel Genetik ve Çok Etmenli Karakterler Nicel Genetik ve Çok Etmenli Karakterler Giriş Şimdiye kadar tartışılan fenotip özellikleri hep ayrı ayrı gözlenebilen sınırları olan özelliklerdi nitel Ör: uzun/kısa bitki, A,B,O kan grubu vb gibi Daha

Detaylı

Nadir hastalıkların tanısında yeni nesil dizi analizi uygulamalarına klinik yaklaşım: Sonuçların değerlendirilmesi

Nadir hastalıkların tanısında yeni nesil dizi analizi uygulamalarına klinik yaklaşım: Sonuçların değerlendirilmesi Nadir hastalıkların tanısında yeni nesil dizi analizi uygulamalarına klinik yaklaşım: Sonuçların değerlendirilmesi Uzm.Dr.Kadri Karaer Gaziantep Dr.Ersin Arslan Eği6m Araş8rma Hastanesi Gene6k Hastalıklar

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

HAFTA II Mendel Genetiği

HAFTA II Mendel Genetiği GENETĐK 111-503 HAFTA II Mendel Genetiği Doç. Dr. Hilâl Özdağ 1865 Gregor Mendel kalıtım kurallarının temellerini attı. http://www.dnaftb.org/dnaftb/1/concept/ 1 Seçilen Özellikler Hartl DL, Jones EW,

Detaylı

Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N

Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Hacettepe Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı Çocuk Nefrolojisi Bilim Dalı Ankara Giriş Sistinozis (OMIM 219800),

Detaylı

KONU 5 Evrim Mekanizmaları I: Seçilim ve Mutasyon. Aslı Sade Memişoğlu

KONU 5 Evrim Mekanizmaları I: Seçilim ve Mutasyon. Aslı Sade Memişoğlu KONU 5 Evrim Mekanizmaları I: Seçilim ve Mutasyon Aslı Sade Memişoğlu Başlıklar 5.1 Popülasyonlarda Mendel Genetiği: Hardy- Weinberg denge prensibi 5.2 Seçilim 5.3 Seçilim Modelleri: Popülasyon genetiği

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

KANSER EPİDEMİYOLOJİSİ VE KARSİNOGENEZ

KANSER EPİDEMİYOLOJİSİ VE KARSİNOGENEZ KANSER EPİDEMİYOLOJİSİ VE KARSİNOGENEZ Gökhan Erdem GATA Tıbbi Onkoloji BD 19 Mart 2014 5. Türk Tıbbi Onkoloji Kongresi, 19-23 Mart 2014, Antalya EPİDEMİYOLOJİ Epidemiyoloji, sağlık olaylarının görünme

Detaylı

Mutasyon ve Genetik Sürüklenme

Mutasyon ve Genetik Sürüklenme Mutasyon ve Genetik Sürüklenme Bir popülasyondaki alel frekanslarını değiştiren doğal sebepler Doğal seçilim Mutasyon Genetik sürüklenme Kurucu etki (Founder effect) Popülasyon darboğazı, MUTASYON Genel

Detaylı

GENETİK I BİY 301 DERS 5

GENETİK I BİY 301 DERS 5 GENETİK I BİY 301 DERS 5 İçerik Kısım 1: Genler, Kromozomlar ve Kalıtım Kısım 2: DNA-Yapısı, Replikasyonu ve Varyasyonu Kısım 3: Genetik bilginin ifadesi ve düzenlenmesi Kısım 4: Genomik Analiz Kısım 5:

Detaylı

ERKEN ÇOCUKLUKTA GELİŞİM

ERKEN ÇOCUKLUKTA GELİŞİM ERKEN ÇOCUKLUKTA GELİŞİM Gelişimin Biyolojik Temelleri Öğr. Gör. Can ÜNVERDİ Konular kod kalıtım örüntüleri Down sendromu Fragile x sendromu Turner sendromu Klinefelter sendromu Prader willi sendromu danışma

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

AF Konusunda Klinik Pratikte Kullanılan Genetik Çalışmalar Türkiye de Durum Ne?

AF Konusunda Klinik Pratikte Kullanılan Genetik Çalışmalar Türkiye de Durum Ne? AF Konusunda Klinik Pratikte Kullanılan Genetik Çalışmalar Türkiye de Durum Ne? Prof. Dr. Nihal AKAR BAYRAM Ankara Atatürk Eğitim ve Araştırma Hastanesi Patofizyoloji Atriyal fibrilasyonun etyolojisi oldukça

Detaylı

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ SELÇUK KILIÇ, BEKİR ÇELEBİ, MEHMET GENÇ, CANAN KETRE, MUSTAFA KOLUKIRIK 1, Ankara 2 Bioeksen Ar-Ge Teknolojileri

Detaylı

HapMap The International HapMap Consortium. ELİF KARLIK Moleküler Biyoloji ve Genetik Anabilim Dalı

HapMap The International HapMap Consortium. ELİF KARLIK Moleküler Biyoloji ve Genetik Anabilim Dalı HapMap The International HapMap Consortium ELİF KARLIK 2602120047 Moleküler Biyoloji ve Genetik Anabilim Dalı HapMap projesinin hedefi: Sağlık ve hastalıkta insan genomundaki genetik varyasyonları belirleyerek

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ DNA Polimorfizminin tanımlanması Bireyler arasındaki genetik farklılıkların belirlenmesini sağlar. Polimorfizm

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi 2 Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde yatan prensipleri anlamalıdır»

Detaylı

DÖNEM I DERS KURULU I

DÖNEM I DERS KURULU I DÖNEM I DERS KURULU I KONU: Hücre, Hücre Organelleri, Nükleus AMAÇ: Öğrenciler bu dersin sonunda, hücreyi, hücre organellerinin yapı ve işlevlerini tanımlayabilecek, hücre tiplerinin özelliklerini ve arasındaki

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

Sebze Islahında Moleküler Markırların Kullanımı

Sebze Islahında Moleküler Markırların Kullanımı Sebze Islahında Moleküler Markırların Kullanımı Esra CEBECİ Ziraat Yüksek Mühendisi 28.12.2012-28.06.2013 Atatürk Bahçe Kültürleri Merkez Araştırma Enstitüsü YALOVA Sunu Planı Çalışmanın tanıtımı, Yapılan

Detaylı

Fizik Antropoloji Anabilim Dalına ait dersler, Antropoloji Lisans Programı dahilinde verilmektedir.

Fizik Antropoloji Anabilim Dalına ait dersler, Antropoloji Lisans Programı dahilinde verilmektedir. Fizik Antropoloji Anabilim Dalına ait dersler, Antropoloji Lisans Programı dahilinde verilmektedir. İstatistiğe Giriş İstatistik nedir? Tanımlayıcı istatistikler Merkezi dağılım ölçütleri Merkezi yayılım

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın Dominant / resesif tanımları Otozomal ve gonozomal kalıtım nedir? İnkomplet dominant/ kodominant ne ifade eder? Pedigri nedir, Neden yapılır?

Detaylı

YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024

YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024 YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024 YAŞLANMA Hücre yapısını ve organelleri oluşturan moleküler yapılarından başlayıp hücre organelleri,hücre,doku,organ ve organ sistemlerine

Detaylı

GEN MUTASYONLARI. Yrd. Doç. Dr. DERYA DEVECİ

GEN MUTASYONLARI. Yrd. Doç. Dr. DERYA DEVECİ GEN MUTASYONLARI Yrd. Doç. Dr. DERYA DEVECİ Gen mutasyonları 2 temel mekanizma ile gerçekleşir. A. İnsersiyon; Bir veya daha fazla nükleotidin araya girmesiyle B. Delesyon; Bir veya daha fazla nükleotidin

Detaylı

MEME KANSERİ HASTALARINDA JAM-A VE LFA-1 GEN VARYASYONLARININ ETKİSİNİN İNCELENMESİ

MEME KANSERİ HASTALARINDA JAM-A VE LFA-1 GEN VARYASYONLARININ ETKİSİNİN İNCELENMESİ MEME KANSERİ HASTALARINDA JAM-A VE LFA-1 GEN VARYASYONLARININ ETKİSİNİN İNCELENMESİ Bengü TOKAT, 1,2 Deniz KANCA, Tülin ÖZTÜRK, M.Fatih SEYHAN, Zerrin CALAY, Şennur İLVAN, Özlem KURNAZ-GÖMLEKSİZ, Hülya

Detaylı

KROMOZOMLAR ve KALITIM

KROMOZOMLAR ve KALITIM KROMOZOMLAR ve KALITIM 2 https://en.wikipedia.org/wiki/chimpanzee_genome_project GENETİK KOD RNA da üçlü gruplar halinde bulunan ve protein sentezleme sırasında üretilen aminoasit dizilerinin düzenini

Detaylı

GÖĞÜS HASTALIKLARINDA GENETİK ARAŞTIRMA. Prof. Dr. Nejat Akar Ankara Üniversitesi

GÖĞÜS HASTALIKLARINDA GENETİK ARAŞTIRMA. Prof. Dr. Nejat Akar Ankara Üniversitesi GÖĞÜS HASTALIKLARINDA GENETİK ARAŞTIRMA Prof. Dr. Nejat Akar Ankara Üniversitesi DNA RNA Genomik Transkriptomik Gen Dizileri, SNPs RNA Protein Hücre Doku Organ Proteomik Diferansiyel Proteomik Fonksiyonel

Detaylı

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL PRENATAL VE POSTNATAL MOLEKÜLER TANI TESTLERİ Dr.Belgin Eroğlu Kesim *1800 lerde Mendel ile başlayan serüven, *1900 lerde kalıtım biriminin gen

Detaylı

Haplotip ve Bağlantı Analizi. Linkage= Bağlantı Association= İlişkilendirme

Haplotip ve Bağlantı Analizi. Linkage= Bağlantı Association= İlişkilendirme Haplotip ve Bağlantı nalizi Nurten karsu, MD, PhD Hacettepe University Medical Faculty nakarsu@hacettepe.edu.tr Linkage= Bağlantı ssociation= İlişkilendirme Linkage Linkage disequilibrium Polimorfizim

Detaylı

İÇİNDEKİLER. BÖLÜM 1 Değişkenler ve Grafikler 1. BÖLÜM 2 Frekans Dağılımları 37

İÇİNDEKİLER. BÖLÜM 1 Değişkenler ve Grafikler 1. BÖLÜM 2 Frekans Dağılımları 37 İÇİNDEKİLER BÖLÜM 1 Değişkenler ve Grafikler 1 İstatistik 1 Yığın ve Örnek; Tümevarımcı ve Betimleyici İstatistik 1 Değişkenler: Kesikli ve Sürekli 1 Verilerin Yuvarlanması Bilimsel Gösterim Anlamlı Rakamlar

Detaylı

Fonksiyon Optimizasyonunda Genetik Algoritmalar

Fonksiyon Optimizasyonunda Genetik Algoritmalar 01-12-06 Ümit Akıncı Fonksiyon Optimizasyonunda Genetik Algoritmalar 1 Fonksiyon Optimizasyonu Fonksiyon optimizasyonu fizikte karşımıza sık çıkan bir problemdir. Örneğin incelenen sistemin kararlı durumu

Detaylı

ORMAN AĞACI ISLAHI. Yrd. Doç. Dr. DENİZ GÜNEY ( GÜZ DÖNEMİ)

ORMAN AĞACI ISLAHI. Yrd. Doç. Dr. DENİZ GÜNEY ( GÜZ DÖNEMİ) ORMAN AĞACI ISLAHI Yrd. Doç. Dr. DENİZ GÜNEY (2015-2016 GÜZ DÖNEMİ) Hızlı nüfus artışı, sanayi ve teknolojideki gelişmeler, küresel ısınmanın etkileriyle birleşerek ekosistem dengesi üzerinde yoğun baskı

Detaylı

ADIM ADIM YGS LYS Adım EKOLOJİ 15 POPÜLASYON GENETİĞİ

ADIM ADIM YGS LYS Adım EKOLOJİ 15 POPÜLASYON GENETİĞİ ADIM ADIM YGS LYS 108. Adım EKOLOJİ 15 POPÜLASYON GENETİĞİ Belirli bir bölgede yaşayan aynı türlerin oluşturduğu topluluğa popülasyon denir. Popülasyon genetiği, popülasyonu temel alan genetik koludur.

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI Programın Yürütücüsü Programın Kadrolu Öğretim Üyeleri : Prof. Dr. Elif YEŞİLADA : Prof. Dr. Başak KAYHAN Doç. Dr. Yılmaz ÇİĞREMİŞ Doç. Dr.Şengül YÜKSEL Doç. Dr.

Detaylı

Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki

Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki Tarımı yapılan bitkilerin ve evcilleştirilmiş hayvanların tarih öncesi bulguları, atalarımızın faydalı türlerin genetik bileşenlerini değiştirmedeki başarılı girişimlerini belgeler. İstenen ve istenmeyen

Detaylı

BÖLÜM 9 EVRİMİ ANLAMAK

BÖLÜM 9 EVRİMİ ANLAMAK BÖLÜM 9 EVRİMİ ANLAMAK Evrim Bu laboratuar kapsamında doğal seçilim yoluyla evrim teorisi anlatılacak ve evrimin doğadaki işleyişine matematiksel bir yaklaşım sunulacaktır. Evrimin anlaşılması, biyoloji

Detaylı

MİLLİ DNA VERİ BANKASI ÇALIŞMALARI ve ADLİ DNA ANALİZLERİNDE YENİ NESİL

MİLLİ DNA VERİ BANKASI ÇALIŞMALARI ve ADLİ DNA ANALİZLERİNDE YENİ NESİL MİLLİ DNA VERİ BANKASI ÇALIŞMALARI ve ADLİ DNA ANALİZLERİNDE YENİ NESİL İbrahim SEMİZOĞLU TÜRKİYE İLAÇ VE TIBBİ CİHAZ KURUMU EKİM- 2013 MALATYA ÜLKEMİZDE ADLİ DNA ANALİZLERİ BAŞBAKANLIK Üniversiteler Adalet

Detaylı

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11 İÇİNDEKİLER 1. BÖLÜM: EVRİME GİRİŞ...1 1.1. EVRİM VE BAŞLICA EVRİM TEORİLERİ...1 1.1.1. Darwin in Evrim Teorisi...2 1.1.2. Darwin Sonrasının Evrim Teorileri...4 1.1.3. Evrimsel Sentez Teorisi...5 1.2.

Detaylı

I. Projenin Türkçe ve İngilizce Adı ve Özetleri İvesi Koyunlarında mikrosatellite lokuslarında polimorfizmin tespiti Güneydoğu Anadolu Tarımsal Araştı

I. Projenin Türkçe ve İngilizce Adı ve Özetleri İvesi Koyunlarında mikrosatellite lokuslarında polimorfizmin tespiti Güneydoğu Anadolu Tarımsal Araştı T.C. ANKARA ÜNİVERSİTESİ BİLİMSEL ARAŞTIRMA PROJESİ KESİN RAPORU İvesi Koyunlarında Mikrosatellite Lokuslarında Polimorfizmin Tespiti Proje Yürütücüsü: Profesör Doktor Ayhan ELİÇİN Proje Numarası: 20050711087

Detaylı

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine

Detaylı

Süreklilik gösteren özellikler çoğunlukla iki ya da daha fazla gen tarafından kontrol edilirler.

Süreklilik gösteren özellikler çoğunlukla iki ya da daha fazla gen tarafından kontrol edilirler. KANTİTATİF GENETİK Giriş Bu bölümde genetik etkileşim gösteren bazı örnekler tartışılacaktır. Süreklilik gösteren özellikler çoğunlukla iki ya da daha fazla gen tarafından kontrol edilirler. Bu genler,

Detaylı

Hepatit C genotiplendirme sonuçları yönünden Türkiye ve Gürcistan hastalarının karşılaştırılması

Hepatit C genotiplendirme sonuçları yönünden Türkiye ve Gürcistan hastalarının karşılaştırılması Hepatit C genotiplendirme sonuçları yönünden Türkiye ve Gürcistan hastalarının karşılaştırılması Dr.Şafak Göktaş İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Gelişim Tıp Laboratuvarları İstanbul Amaç

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN Bünyamin ATMIŞ DANIŞMAN Yrd. Doç. Dr. Dilek TURGUT BALIK 1. PARMAKİZİ 2. DNA PARMAKİZİ 3.

Detaylı

MİLLETLERİN AKRABALIĞI

MİLLETLERİN AKRABALIĞI MİLLETLERİN AKRABALIĞI National Geographic ve IBM işbirliği ile 2005 yılında uzun soluklu bir genetik antropoloji çalışması başlatılmıştı. Kısaca NG Genom Projesi olarak adlandırılan bu Mega-projenin amacı

Detaylı

Bağlantı ve Kromozom Haritaları

Bağlantı ve Kromozom Haritaları Bağlantı ve Kromozom Haritaları Prof. Dr. Sacide PEHLİVAN 3. Mart. 2017 Bir kişide DNA nın şifrelediği özelliklerin tümü kalıtsal özelliklerdir. DNA üzerinde nükleotitlerden yapılı en küçük ifade edilebilir

Detaylı

Kantitatif özellikler

Kantitatif özellikler Kantitatif genetik Kantitatif özellikler Mendel özellikleri tek genli kalıtım da iki ayrı fenotip bulunur. Birçok özellik tek genle çalışmaz çok sayıda gen ve çevre koşulları devreye girer. Bu nedenle

Detaylı

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN MİTOKONDRİ Doç.. Dr. Mehmet GÜVENG Hemen hemen bütün b ökaryotik hücrelerde ve ökaryotik mikroorganizmalarda bulunur. Eritrositlerde, bakterilerde ve yeşil alglerde mitokondri yoktur. Şekilleri (küremsi

Detaylı

Kromozom yapı değişimleri

Kromozom yapı değişimleri Kromozom yapı değişimleri Kromozom yapı değişimleri Nedeni kırıklardır. Kırık kısımlar birbiri ile birleşme eğilimi gösterirler. Kırıklar kimyasal, fiziksel ve biyolojik etmenlerle oluşabilirler. Yapı

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

Farmakogenetik Dr. Pınar Saip İ.Ü.Onkoloji Enstitüsü

Farmakogenetik Dr. Pınar Saip İ.Ü.Onkoloji Enstitüsü Farmakogenetik Dr. Pınar Saip İ.Ü.Onkoloji Enstitüsü TIBBİ ONKOLOJİ DERNEĞİ İLAÇ ETKİLEŞİMLERİ KURSU PAMUKKALE- Kasım 2004 İlacın yanıtı ve yanetkisi ile ilişkili faktörler tanı Diğer ilaçlar doz Hasta

Detaylı

BİYOCOĞRAFYA DERS 2 1

BİYOCOĞRAFYA DERS 2 1 BİYOCOĞRAFYA DERS 2 1 KAYNAKÇA 2 Türleşme, Farklılaşma ve Yok Olma Bu bölümde; Yeni tür nasıl oluşur? Tür nasıl farklılaşır? Tür niçin yok olur? incelenecektir 3 Türleşme, Farklılaşma ve Yok Olma from

Detaylı

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D.

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. DR. ONUR YILMAZ Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. Koç Katımı Çiftleşme mevsiminde kızgınlık gösteren koyunun koç ile birleştirilmesi olayına koç katımı

Detaylı

Rekombinasyon ve Bağlantı Analizi (Recombination and Linkage Analysis)

Rekombinasyon ve Bağlantı Analizi (Recombination and Linkage Analysis) Rekombinasyon ve Bağlantı Analizi (Recombination and Linkage Analysis) Mayoz bölünme sırasında aynı kromozom (bir kromatid) üzerindeki genler gametlere beraberce, başka bir ifade ile bağlı (zincirlenmiş)

Detaylı

GLOBİN GEN REGÜLASYONU

GLOBİN GEN REGÜLASYONU GLOBİN GEN REGÜLASYONU GLOBİN GENLERİN REGÜLASYONU Her bir globin genin dokuya ve gelişime spesifik ekspressiyonu regülatör dizilimdeki transkripsiyon faktörlerinin etkisi ile sağlanmaktadır. Globin

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN: Dilek SADAK DANIŞMAN : Yrd. Doç. Dr. Dilek TURGUT-BALIK

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

artus BK Virus QS-RGQ Kit

artus BK Virus QS-RGQ Kit artus BK Virus QS-RGQ Kit Performans Özellikleri artus BK Virus QS-RGQ Kit, Versiyon 1, 4514363 Testi gerçekleştirmeden önce www.qiagen.com/products/artusbkvirusrgpcrkit.aspx adresinde yeni elektronik

Detaylı

İNSAN GENETİĞİ EK NOT. Çağdaş genetik terminoloji

İNSAN GENETİĞİ EK NOT. Çağdaş genetik terminoloji İNSAN GENETİĞİ EK NOT Çağdaş genetik terminoloji Mendel in kalıtım birimlerini temsil eden birim faktör lerini günümüzde gen olarak isimlendirmekteyiz. Herhangi bir karakter için (ör: bitki uzunluğu) fenotip,

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

Fizik Antropoloji Anabilim Dalına ait dersler, Antropoloji Lisans Programı dahilinde verilmektedir. Fizik Antropolojiye Giriş.

Fizik Antropoloji Anabilim Dalına ait dersler, Antropoloji Lisans Programı dahilinde verilmektedir. Fizik Antropolojiye Giriş. Fizik Antropoloji Anabilim Dalına ait dersler, Antropoloji Lisans Programı dahilinde verilmektedir. Fizik Antropolojiye Giriş Bu ders içerisinde, Fizik Antropolojinin tarihsel gelişimi, çalışma alanları,

Detaylı

Fenotip: Bir canlının gözle görülebilen tüm özelliklerine fenotip adı verilir. Canlının dış görünüşüdür. Genotip ve çevre etkisiyle meydana gelir.

Fenotip: Bir canlının gözle görülebilen tüm özelliklerine fenotip adı verilir. Canlının dış görünüşüdür. Genotip ve çevre etkisiyle meydana gelir. Kalıtım(Genetik) Nedir? İnsanlar çevreleriyle ilgilenmeye başladıktan sonra her dölün daima atasına benzediğini gözlemişlerdir. Bir çocuğun bazı halleri, davranışları, yetenekleri anne ve babasına benzer.

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

ETKİN İLAÇ KULLANIMINDA GENETİK FAKTÖRLER. İlaç Kullanımında Bireyler Arasındaki Genetik Farklılığın Mekanizması

ETKİN İLAÇ KULLANIMINDA GENETİK FAKTÖRLER. İlaç Kullanımında Bireyler Arasındaki Genetik Farklılığın Mekanizması ETKİN İLAÇ KULLANIMINDA GENETİK FAKTÖRLER İlaç Kullanımında Bireyler Arasındaki Genetik Farklılığın Mekanizması Absorbsiyon İlaç hedefleri Dağılım Hastalıkla ilgili Metabolizma yolaklar Atılım Farmakokinetik

Detaylı

KORELASYON VE REGRESYON ANALİZİ. Doç. Dr. Bahar TAŞDELEN

KORELASYON VE REGRESYON ANALİZİ. Doç. Dr. Bahar TAŞDELEN KORELASYON VE REGRESYON ANALİZİ Doç. Dr. Bahar TAŞDELEN Günlük hayattan birkaç örnek Gelişim dönemindeki bir çocuğun boyu ile kilosu arasındaki ilişki Bir ailenin tükettiği günlük ekmek sayısı ile ailenin

Detaylı

GENETİK I BİY 301 DERS 7

GENETİK I BİY 301 DERS 7 GENETİK I BİY 301 DERS 7 İçerik Kısım 1: Genler, Kromozomlar ve Kalıtım Kısım 2: DNA-Yapısı, Replikasyonu ve Varyasyonu Kısım 3: Genetik bilginin ifadesi ve düzenlenmesi Kısım 4: Genomik Analiz Kısım 5:

Detaylı

Isırıkla İlgili Literatür İncelemesi

Isırıkla İlgili Literatür İncelemesi Isırıkla İlgili Literatür İncelemesi Prof. Dr. Tuna DEMİRDAL İzmir Katip Çelebi Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları AD, SB Atatürk Eğitim Araştırma Hastanesi Enfeksiyon Kliniği, İzmir Avcılarda

Detaylı