TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ"

Transkript

1 TC. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ İNSERSİYON/DELESYON (INDEL) MARKIRLARI VE TÜRKİYE POPULASYONU ARZU DÜVENCİ 1

2 GİRİŞ Adli olayların aydınlatılmasında biyolojik örneklerin kimliklendirilmesi çok önemlidir. Adli bilimlerde kullanılan genetik işaretlerin başında STR sistemleri gelmektedir. Ancak bugün özellikle aşırı degrade olmuş veya az miktarda DNA içeren biyolojik delillerin analizinde yeterli değildir. Bu durumda SNP ler ve INDEL lerden yararlanılabilir. 2

3 İNSERSİYON/DELESYON (INDEL) İnsersiyon/delesyon veya yaygın olarak INDEL adı verilen genetik varyasyonlar, DNA dizisine baz dizisinin eklenmesi ya da çıkması şeklinde oluşur. Baz dizisinin çıkması sonucu oluşan versiyonuna delesyon, baz dizisinin eklenmesi sonucu oluşan versiyonuna ise insersiyon adı verilmektedir. delesyon TCAGCAACAACACAGTCATATTTAGCTCTACCACAGTGTG GCAACAACACAGTCATATCCATTCTCAATTAGCTCTACCACAGTGTG insersiyon 3

4 İNSERSİYON/DELESYON (INDEL) DNA da meydana gelen İnsersiyon/delesyonlar sonucu mutasyonlar ve polimorfizmler oluşur. DNA daki bu değişiklikler fenotipi etkiliyor ise mutasyon olarak, bu değişiklikler fenotipi etkilemiyor sadece genetik çeşitlilik sağlıyor ise polimorfizm olarak adlandırılmaktadır. Polimorfizm sonucu meydana gelen farklılıklar kuşaktan kuşağa Mendel yasalarına göre aktarılırlar. Polimorfik bir sistemin adli bilimlerde kimliklendirme amaçlı kullanılabilmesi için o sistemin populasyonda en az %1 sıklıkta görülmesi gereklidir. 4

5 İnsersiyon/Delesyon (INDEL) Polimorfizmi İnsan DNA sındaki polimorfizmin büyük çoğunluğunu oluşturan tek baz değişimi (SNP ler) veya daha fazla bazın insersiyonu ve delesyonuna dayalı polimorfizmler olarak iki gruba ayırmak mümkündür. Bunlar nokta mutasyonları ve çerçeve kayması mutasyonları şeklinde oluşan kalıtımsal değişimler meydana getirirler. Nokta mutasyonunda sadece bir baz mutasyona uğrar ve Tek Nükleotid Polimorfizmini (SNP, Single Nüleotid Polymorfizm) oluştururlar. Çerçeve kayması mutasyonu, baz dizisinin insersiyonu (eklenmesi) veya delesyonu (çıkması) şeklindedir. 5

6 İNSERSİYON/DELESYON (INDEL) Küçük INDEL Büyük INDEL 1. Küçük INDEL ler: Sadece birkaç bç lik uzunluktaki dizinlerdir. Bu INDEL ler polimorfizm göstermesinin yanında daha çok hastalıklarla ilgili varyasyonları oluşturur. Bunun nedeni, genin kodlama bölgesinde INDEL dizinin okumada bozulmaya neden olması ve protein dizisinin değişmesine yol açmasıdır. 2. Büyük INDEL ler: Birkaç kilobaz (kb) uzunluğu aşan dizinlerdir. Bu tip varyasyonlar genomda sanılanın aksine sıklıkla görülmektedir. Adli kimliklendirmede kullanılan ve SNP polimorfizmi kadar olmasa da genom içinde 1000 den fazla bilinen INDEL ler bu varyasyonlardan oluşmaktadır. 6

7 İnsersiyon/Delesyon (INDEL) Polimorfizmi Tüm insan genomunun yaklaşık 3.2 milyon baz olduğu ve tahminlere göre yaklaşık 2700 bazda bir ortaya çıkan, hem kodlama yapan hem de yapmayan bölgelerinde yaklaşık 1 milyon SNP olduğu düşünülmektedir. Genetik varyasyonları belirlemek için yapılan çalışmalar daha çok SNP ler üzerinde yoğunlaşmış olsa da son yıllarda INDEL polimorfizmi üzerinde de çalışmalar yapılmaktadır. 7

8 İnsersiyon/Delesyon (INDEL) Polimorfizmi Özelliklede 2002 yılında Marshfield Tıp Araştırma Vakfında, James Weber ve arkadaşlarının insan genomu üzerinde 2000 in üzerinde dialelik insersiyon/delesyonu karakterize etmesiyle, dialelik indellerin insan polimorfizminin %8 ini oluşturduğunu bildirmişlerdir. Bu çalışma sonucunda toplamda %71 INDEL in aleller arasında 2, 3, veya 4 nükleotid uzunluk farkı varken sadece %4 ünde 16 nükleotid uzunluk farkı çıkmıştır. 8

9 İnsersiyon/Delesyon (INDEL) Polimorfizmi Bir başka çalışma olan Mills ve arkadaşlarının 2006 yılında yaptıkları çalışmayla insan indel varyasyon haritasını çıkararak 7.2 kb da bir görüldüğünü genomda SNP den sonra en sık rastlanan ikinci polimorfizim şeklinin INDEL ler olduğunu bildirmişlerdir. Bu da bilinen 15 milyon genetik varvasyonun 3 milyonunun INDEL lerin oluşturduğunu gösterir. Bu çalışma sonucunda İndellerin %36 sı DNA da promoter bölgede, intronlarda ve eksonlarda yerleşmiştir. 9

10 İnsersiyon/Delesyon (INDEL) Polimorfizmi Adli amaç için uygulanacak INDEL analizinin avantajlı özellikleri; duyarlı olması, tekrarlanabilirliği, doğruluğu, bozulmuş örneklerde yüksek performans göstermesi, multipleks yapılabilme kapasitesi, zaman, maliyet, 10

11 İnsersiyon/Delesyon (INDEL) Polimorfizmi İNDEL lerin düşük mutasyon ve yüksek heterozigotluk oranının olmasından, dışlama ve ayrım gücünün yüksek olmasından ayrıca bozunmuş ve eser miktardaki örneklerde başarılı tiplendirme yapabilmesinden dolayı yeni nesil genetik varyasyonlar olan INDEL ler üzerine daha birçok çalışma yapılacağı düşünülmektedir. Kısacası SNP haritalarına INDEL lerin eklenmesi genom genetik haritaların çözünürlüğünün artırılmasına ve hastalığa neden olan lokuslardaki yerinin bulunmasına yardımcı olabilir. 11

12 İnsersiyon/Delesyon (INDEL) Polimorfizmi Ayrıca kimlik tespiti dahil olmak üzere özellikle nesep tayininde ve kitlesel felaket kurbanlarının akrabalık ilişkilerinin saptanmasında, gelecekte genetik çalışmalarda INDEL lerin yaygın bir şekilde kullanılacaktır. Bir nevi günümüzde DNA profillemesinde kullanılan SNP ve STR polimorfizmine İnsersiyon/Delesyon (INDEL) polimorfizmi alternatif oluşturacaktır. 12

13 Türkiye Popülasyonu Çalışmada aralarında akrabalık ilişkisi bulunmayan Türkiye nin tüm bölgelerini yansıtacak şekilde çalışmaya rıza gösteren sağlıklı 250 kişiden onam alınan kan örnekleri kullanıldı. DNA örneklerinde 30 INDEL lokusunun multiplex (çoklu) amplifikasyonu yapıldı. 13

14 Türkiye Popülasyonu Otozomal kromozomlar üzerinde bulunan 30 INDEL lokusunun optimizasyonu yapılarak söz konusu lokusların Türkiye deki polimorfizmi belirlendi. 14

15 Otozomal 30 INDEL lokusunun 250 kişi üzerinde Genemapper IDX v.1 (Life Technologies) analiz programı kullanılarak genotipi belirlendi. 15

16 Kadın DNA'sına ait elektroforegram görüntüsü 16

17 Erkek DNA'sına ait elektroforegram görüntüsü 17

18 VERİLERİN ANALİZİ GENETİX v , Arlequin v , Promega PowerStats Excel Dosyası, MedCalc MEGA 5.1, 18

19 İSTATİSTİKSEL BULGULAR Alel Frekansları 250 kişide 30 INDEL lokusunun alel sıklığı Arlequin v yazılım programı kullanılarak yapıldı. 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0,1 0 D77-/+ D45-/+ D131-/+ D70-/+ D6-/+ D111-/+ D58-/+ D56-/+ D118-/+ D92-+ D93-/+ D99-/+ D88-/+ D101-/+ D67-/+ D83-/+ D114-/+ D48-/+ D124-/+ D122-/+ D125-/+ D64-/+ D81-/+ D136-/+ D133-/+ D97-/+ D40-+ D128-/+ D39-/+ D84-/+ DIP- DIP+ 19

20 Hardy-Weinberg Dengesi Arlequin v programında 30 INDEL lokusunun p-değerleri hesaplandı ve Hardy-Weinberg dengesine bakıldı. P değerinin anlamlılığının değerlendirilmesinde; P 0.05 ise, sapma önemlidir ve popülasyonda denge yoktur. P 0.05 ise, sapma istatistiksel olarak anlamlı değildir ve popülasyon dengededir. 20

21 Adli İstatistik Parametreleri Otozomal 30 INDEL lokusunun ayrım gücü (PD), eşleşme olasılığı (Pm), polimorfik bilgi içeriği (PIC), dışlama gücü (PE), tipik babalık indeksi (TPI) gibi adli istatistik parametreleri Promega PowerStats excel dosyası kullanılarak hesaplandı. 21

22 İSTATİSTİKSEL BULGULAR Popülasyonlar Arası Lokus Bazındaki Farklılıklar 30 INDEL lokusunun Türkiye popülasyonu ile diğer popülasyonların (Kuzey Doğu İtalya, Polonya, Finlandiya, Güney Kore, Tayvan, Somali) makalelerinden elde edilen alel frekanslarından yararlanılarak Arlequin v yazılım programı kullanılarak Fisher s Exact Test ile popülasyonlar arası p-değeri bakımından lokus bazındaki farklılık belirlendi. Tayvan (126) Finlandiya (151) Somali (175) Polonya (122) İtalya (200) Kore (373) Türkiye (250) 22

23 Fisher s Exact Test Sonucu South Korea D97, D40, D128,D39, D84, D122, D125, D64, D81, D118, D93, D99, D67, D131, D111, D56 Italy - Finland D48, D93, D99, D77 Somali Taiwan Poland D138, D84, D114, D124, D122, D125, D81, D99, D88, D101, D45, D131, D70, D111 D40,D128,D39, D48,D122,D64,D81, D118, D99, D131, D111 D131 23

24 İSTATİSTİKSEL BULGULAR Popülasyonlar Arası Genetik Uzaklık (F ST ) 1000 Genome INDEL verilerinin bulunduğu Ensemble ( veri bankasından söz konusu lokuslardan diğer popülasyonlara ait 15 INDEL lokusuna ait 15 INDEL ( HLD45, HLD131, HLD58, HLD99, HLD88, HLD101, HLD83, HLD114, HLD48, HLD81, HLD136, HLD133, HLD128, HLD39, HLD84) lokusunun genotip bilgilerine ulaşılmıştır. Türkiye popülasyonu ile Avrupa, Amerika, Güney Asya, Doğu Asya, Afrika popülasyonlarına ait genotip veriler kullanılarak 15 INDEL lokusu için Arlequin ver programı yardımıyla ortak Fst değerleri hesaplandı. 24

25 INDEL lokuslarının popülasyonlar arası genetik uzaklık (Fst) değerleri Türkiye Avrupa Amerika Güney Asya Doğu Asya Afrika 15 INDEL n:250 n:503 n:347 n: 489 n:504 n:661 Türkiye Avrupa Amerika Güney Asya Doğu Asya Afrika Fst değeri küçük, orta düzey, büyük, 0.25 den büyük ise çok büyük bir genetik farklılaşma 25

26 Filogenetik Ağaç Çizimi İSTATİSTİKSEL BULGULAR Türkiye popülasyonuna ile Avrupa, Amerika, Güney Asya, Doğu Asya, Afrika popülasyonlarına ait genotip veriler kullanılarak INDEL lokusları için bulunan Fst değerleri ile Mega 5.1 programında komşu birleştirme yöntemi kullanılarak filogenetik ağaç çizildi. 26

27 Filogenetik Ağaç Çizimi Guney Asya Dogu Asya Turkiye Avrupa Amerika Afrika

28 SONUÇ Türk populasyonu için yüksek polimorfizm gösteren 30 INDEL (Amelogenin X, Amelogenin Y ve HLD77, HLD45, HLD131, HLD70, HLD6, HLD111, HLD58, HLD56, HLD118, HLD92, HLD93, HLD99, HLD88, HLD101, HLD67, HLD83, HLD114, HLD48, HLD124, HLD122, HLD125, HLD64, HLD81, HLD136, HLD133, HLD97, HLD40, HLD128, HLD39, HLD84) lokusundan oluşan Investigator DIPplex Kit (Qiagen) in adli bilimlerde kullanılabileceği belirlenmiştir. Bu çalışma bulguları Türk Toplumu nun Avrupa Toplumu na genetik olarak daha yakın olduğunu göstermiştir. Bu lokuslar Türk kriminal laboratuvarlarında babalıkakrabalık testlerinde ve degrade DNA örneklerinin analizinde de kullanılabilecektir. 28

29 SONUÇ INDEL lerin, özellikle olay yerinden az miktarda veya bozunmuş olarak gelen biyolojik materyallerde hatta antropolojik ve arkeolojik araştırmalarda, STR lokusları ile tiplendirme yapılamadığı durumlarda ve SNP ye göre daha kısa zamanda ve az maliyetle başarılı bir çoğalma yapılabilmesi gibi özellikleri açısından adli bilimlerde kullanımı zamanla artacaktır Yinede INDEL lokuslarının STR ya da SNP sistemlerine alternatif oluşturabilmesi için yaygın bir şekilde kullanılması, hem diğer somatik kromozomlar hem de cinsiyet kromozomları üzerindeki daha çok INDEL noktasının araştırılması gerekir. 29

30 BENİ DİNLEDİĞİNİZ İÇİN TEŞEKKÜR EDERİM 30

T.C. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ. Danışman: Yard. Doç. Dr. Gönül Filoğlu

T.C. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ. Danışman: Yard. Doç. Dr. Gönül Filoğlu T.C. İSTANBUL ÜNİVERSİTESİ ADLİ TIP ENSTİTÜSÜ Danışman: Yard. Doç. Dr. Gönül Filoğlu 30 İNSERSİYON/DELESYON (INDEL) LOKUSUNUN TÜRKİYE DEKİ POLİMORFİZMİ FEN BİLİMLERİ ANABİLİM DALI YÜKSEK LİSANS TEZİ BİYOLOG

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

Paternal Kromozom Y. Maternal Kromozom X. Yrd Doç Dr Sema DEMİRÇİN

Paternal Kromozom Y. Maternal Kromozom X. Yrd Doç Dr Sema DEMİRÇİN Y-STR Analizleri Yrd Doç Dr Sema DEMİRÇİN Maternal Kromozom X Paternal Kromozom Y Y KROMOZOMU İnsan kromozomları içerisinde; İkinci en küçük kromozomdur Genomun sadece %2 kadarını oluşturur 6O milyon kadar

Detaylı

HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI)

DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Adli Biyolojik Incelemeler ve Molekuler Genetik Kursu DNA TİPLEME YÖNTEMLERİ (SOMATİK STRLOKUSLARI) Yrd. Doç. Dr. GÖNÜL FİLOĞLU İ.Ü. ADLİ TIP ENSTİTÜSÜ KRİMİNAL İDANTİFİKASYONDA DNA TİPLEMESİ Moleküler

Detaylı

X kromozomu (Devam) X STR Polimorfizmi 08.04.2008. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma bağlı

X kromozomu (Devam) X STR Polimorfizmi 08.04.2008. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma bağlı X kromozomu X KROMOZOMAL STR POLİMORFİZMİ Doç. Dr. Faruk AŞICIOĞLU Adli Tıp Uzmanı & Tıbbi Biyoloji Bilim Dr. Yaklaşık 6 µm uzunluğunda olup 165 milyon baz çifti içermektedir. Şimdiye kadar X kromozoma

Detaylı

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı.

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı. Bu dersin içeriği, Populasyonun tanımı, Alel ve genotip frekansı, Gen havuzu, Gen frekansı, Gerçek/Doğal populasyonlar ve ideal populasyonlar, Populasyon genetiğinin çalışma alanları, HW kanunu -giriş,

Detaylı

kime aittir sorusuna cevap aranır.

kime aittir sorusuna cevap aranır. ADLİ BİYOLOJİK İNCELEMELER VE MOLEKÜLER GENETİK KURSU ÖRNEK OLGU SUNUMLARI İLE ADLİ GENETİK RAPORLARIN DEĞERLENDİRİLMESİ Adli bilimlerde genetik işaretler üç amaç için kullanılmaktadır. 1-Kimlik tayini

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları

Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Anksiyete Bozukluklarında Genom Boyu Asosiyasyon Çalışmaları Yrd. Doç. Dr. Neşe Direk Dokuz Eylül Üniversitesi Psikiyatri Anabilim Dalı Genetik Epidemiyoloji ve Psikiyatri Genome-Wide vs. Aday Gen Asosiyasyon

Detaylı

Mendel Dışı kalıtım. Giriş

Mendel Dışı kalıtım. Giriş Mendel Dışı kalıtım DR. UMUT FAHRİOĞLU, PHD MSC Giriş Bir organizmanın fenotipinin genotipin bakarak tahmin edilebilmesi için birçok farklı faktörün çok iyi anlaşılabilmesi lazım. Mendel kalıtım modellerindeki

Detaylı

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Hardy Weinberg Kanunu

Hardy Weinberg Kanunu Hardy Weinberg Kanunu Neden populasyonlarla çalışıyoruz? Popülasyonları analiz edebilmenin ilk yolu, genleri sayabilmekten geçer. Bu sayım, çok basit bir matematiksel işleme dayanır: genleri sayıp, tüm

Detaylı

TEMEL VETERĠNER GENETĠK

TEMEL VETERĠNER GENETĠK DİKKATİNİZE: BURADA SADECE ÖZETİN İLK ÜNİTESİ SİZE ÖRNEK OLARAK GÖSTERİLMİŞTİR. ÖZETİN TAMAMININ KAÇ SAYFA OLDUĞUNU ÜNİTELERİ İÇİNDEKİLER BÖLÜMÜNDEN GÖREBİLİRSİNİZ. TEMEL VETERĠNER GENETĠK KISA ÖZET KOLAYAOF

Detaylı

ADIM ADIM YGS LYS Adım EVRİM

ADIM ADIM YGS LYS Adım EVRİM ADIM ADIM YGS LYS 191. Adım EVRİM EVRİM İLE İLGİLİ GÖRÜŞLER Evrim, geçmiş ile gelecekteki canlıların ve olayların yorumlanmasını sağlayarak, bugün dünyada yaşayan canlılar arasındaki akrabalık derecesini

Detaylı

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler

Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Klinik Araştırmalarda Farmakogenetik Bilginin Kullanılmasına Giriş ve Örnekler Dr. Muradiye Nacak Gaziantep Üniversitesi Tıp Fakültesi Farmakoloji Anabilim Dalı 4Kasım, 2009 Sunum Planı Farmakogenetik,

Detaylı

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz

Genom Sayısal ve Yapısal Mutasyonlar. Prof. Dr. Fatma Savran Oğuz Genom Sayısal ve Yapısal Mutasyonlar Prof. Dr. Fatma Savran Oğuz Organizmanın haploid hücredeki tüm gen ve gen dışı bölgelerinden oluşan kalıtsal maddenin tamamı Genom bir kişinin taşıdığı tüm genetik

Detaylı

GENETİK ALGORİTMALAR. Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ

GENETİK ALGORİTMALAR. Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ GENETİK ALGORİTMALAR Araş. Gör. Nesibe YALÇIN BİLECİK ÜNİVERSİTESİ GENETİK ALGORİTMALAR Genetik algoritmalar, Darwin in doğal seçim ve evrim teorisi ilkelerine dayanan bir arama ve optimizasyon yöntemidir.

Detaylı

Milletlerin akrabalığı

Milletlerin akrabalığı Milletlerin akrabalığı Türklük, bir ırka aidiyet ve bir kan meselesi değil; bir Millet'e mensubiyet ve bir kültür meselesidir. Prof. Dr. D. Ali ERCAN daliercan@gmail.com 16.6.2014, Ankara Değerli arkadaşlar,

Detaylı

ADIM ADIM YGS LYS. 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON

ADIM ADIM YGS LYS. 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON ADIM ADIM YGS LYS 91. Adım KALITIM -17 GENETİK VARYASYON MUTASYON MODİFİKASYON ADAPTASYON - REKOMBİNASYON GENETİK VARYASYON Aynı türün bireyleri arasındaki farklılığa VARYASYON denir. Varyasyonların hepsi

Detaylı

AİLESEL AKDENİZ ATEŞİ (AAA-FMF)

AİLESEL AKDENİZ ATEŞİ (AAA-FMF) AİLESEL AKDENİZ ATEŞİ (AAA-FMF) MOLEKÜLER YAKLAŞIMLAR DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD AİLESEL AKDENİZ ATEŞİ Otozomal resesif kalıtım Akdeniz ve Ortadoğu kökenli populasyonlarda

Detaylı

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır.

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır. Allel: Bir genin seçenekli biçimi Wild Tip: Normal allel. Bireylerin çoğunda bulunan Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda

Detaylı

Antropoloji, çesitlilik ve SNPler. genetik

Antropoloji, çesitlilik ve SNPler. genetik Antropoloji, çesitlilik ve SNPler genetik Antropoloji: insanı en iyi anlayan ve anlatan bilim dalı (anthropos = insan; logos = bilim) İnsan, biyo-kültürel bir varlık alanı olarak karşımıza çıkmaktadır.

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

HAFTA II Mendel Genetiği

HAFTA II Mendel Genetiği GENETĐK 111-503 HAFTA II Mendel Genetiği Doç. Dr. Hilâl Özdağ 1865 Gregor Mendel kalıtım kurallarının temellerini attı. http://www.dnaftb.org/dnaftb/1/concept/ 1 Seçilen Özellikler Hartl DL, Jones EW,

Detaylı

Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N

Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Topaloğlu R, ÖzaltınF, Gülhan B, Bodur İ, İnözü M, Beşbaş N Hacettepe Üniversitesi Tıp Fakültesi Çocuk Sağlığı ve Hastalıkları Anabilim Dalı Çocuk Nefrolojisi Bilim Dalı Ankara Giriş Sistinozis (OMIM 219800),

Detaylı

KANSER EPİDEMİYOLOJİSİ VE KARSİNOGENEZ

KANSER EPİDEMİYOLOJİSİ VE KARSİNOGENEZ KANSER EPİDEMİYOLOJİSİ VE KARSİNOGENEZ Gökhan Erdem GATA Tıbbi Onkoloji BD 19 Mart 2014 5. Türk Tıbbi Onkoloji Kongresi, 19-23 Mart 2014, Antalya EPİDEMİYOLOJİ Epidemiyoloji, sağlık olaylarının görünme

Detaylı

ERKEN ÇOCUKLUKTA GELİŞİM

ERKEN ÇOCUKLUKTA GELİŞİM ERKEN ÇOCUKLUKTA GELİŞİM Gelişimin Biyolojik Temelleri Öğr. Gör. Can ÜNVERDİ Konular kod kalıtım örüntüleri Down sendromu Fragile x sendromu Turner sendromu Klinefelter sendromu Prader willi sendromu danışma

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

HapMap The International HapMap Consortium. ELİF KARLIK Moleküler Biyoloji ve Genetik Anabilim Dalı

HapMap The International HapMap Consortium. ELİF KARLIK Moleküler Biyoloji ve Genetik Anabilim Dalı HapMap The International HapMap Consortium ELİF KARLIK 2602120047 Moleküler Biyoloji ve Genetik Anabilim Dalı HapMap projesinin hedefi: Sağlık ve hastalıkta insan genomundaki genetik varyasyonları belirleyerek

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ DNA Polimorfizminin tanımlanması Bireyler arasındaki genetik farklılıkların belirlenmesini sağlar. Polimorfizm

Detaylı

DÖNEM I DERS KURULU I

DÖNEM I DERS KURULU I DÖNEM I DERS KURULU I KONU: Hücre, Hücre Organelleri, Nükleus AMAÇ: Öğrenciler bu dersin sonunda, hücreyi, hücre organellerinin yapı ve işlevlerini tanımlayabilecek, hücre tiplerinin özelliklerini ve arasındaki

Detaylı

Sebze Islahında Moleküler Markırların Kullanımı

Sebze Islahında Moleküler Markırların Kullanımı Sebze Islahında Moleküler Markırların Kullanımı Esra CEBECİ Ziraat Yüksek Mühendisi 28.12.2012-28.06.2013 Atatürk Bahçe Kültürleri Merkez Araştırma Enstitüsü YALOVA Sunu Planı Çalışmanın tanıtımı, Yapılan

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın Dominant / resesif tanımları Otozomal ve gonozomal kalıtım nedir? İnkomplet dominant/ kodominant ne ifade eder? Pedigri nedir, Neden yapılır?

Detaylı

YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024

YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024 YAŞLANMA /YAŞLANMA ÇEŞİTLERİ VE TEORİLERİ BEYZA KESKINKARDEŞLER 0341110024 YAŞLANMA Hücre yapısını ve organelleri oluşturan moleküler yapılarından başlayıp hücre organelleri,hücre,doku,organ ve organ sistemlerine

Detaylı

I. Projenin Türkçe ve İngilizce Adı ve Özetleri İvesi Koyunlarında mikrosatellite lokuslarında polimorfizmin tespiti Güneydoğu Anadolu Tarımsal Araştı

I. Projenin Türkçe ve İngilizce Adı ve Özetleri İvesi Koyunlarında mikrosatellite lokuslarında polimorfizmin tespiti Güneydoğu Anadolu Tarımsal Araştı T.C. ANKARA ÜNİVERSİTESİ BİLİMSEL ARAŞTIRMA PROJESİ KESİN RAPORU İvesi Koyunlarında Mikrosatellite Lokuslarında Polimorfizmin Tespiti Proje Yürütücüsü: Profesör Doktor Ayhan ELİÇİN Proje Numarası: 20050711087

Detaylı

Mutasyon ve Genetik Sürüklenme

Mutasyon ve Genetik Sürüklenme Mutasyon ve Genetik Sürüklenme Bir popülasyondaki alel frekanslarını değiştiren doğal sebepler Doğal seçilim Mutasyon Genetik sürüklenme Kurucu etki (Founder effect) Popülasyon darboğazı, MUTASYON Genel

Detaylı

MİLLETLERİN AKRABALIĞI

MİLLETLERİN AKRABALIĞI MİLLETLERİN AKRABALIĞI National Geographic ve IBM işbirliği ile 2005 yılında uzun soluklu bir genetik antropoloji çalışması başlatılmıştı. Kısaca NG Genom Projesi olarak adlandırılan bu Mega-projenin amacı

Detaylı

MEME KANSERİ HASTALARINDA JAM-A VE LFA-1 GEN VARYASYONLARININ ETKİSİNİN İNCELENMESİ

MEME KANSERİ HASTALARINDA JAM-A VE LFA-1 GEN VARYASYONLARININ ETKİSİNİN İNCELENMESİ MEME KANSERİ HASTALARINDA JAM-A VE LFA-1 GEN VARYASYONLARININ ETKİSİNİN İNCELENMESİ Bengü TOKAT, 1,2 Deniz KANCA, Tülin ÖZTÜRK, M.Fatih SEYHAN, Zerrin CALAY, Şennur İLVAN, Özlem KURNAZ-GÖMLEKSİZ, Hülya

Detaylı

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL

DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL DÜZEN LABORATUVARLAR GRUBU MOLEKÜLER TANI MERKEZİ İSTANBUL PRENATAL VE POSTNATAL MOLEKÜLER TANI TESTLERİ Dr.Belgin Eroğlu Kesim *1800 lerde Mendel ile başlayan serüven, *1900 lerde kalıtım biriminin gen

Detaylı

Haplotip ve Bağlantı Analizi. Linkage= Bağlantı Association= İlişkilendirme

Haplotip ve Bağlantı Analizi. Linkage= Bağlantı Association= İlişkilendirme Haplotip ve Bağlantı nalizi Nurten karsu, MD, PhD Hacettepe University Medical Faculty nakarsu@hacettepe.edu.tr Linkage= Bağlantı ssociation= İlişkilendirme Linkage Linkage disequilibrium Polimorfizim

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

ADIM ADIM YGS LYS Adım EKOLOJİ 15 POPÜLASYON GENETİĞİ

ADIM ADIM YGS LYS Adım EKOLOJİ 15 POPÜLASYON GENETİĞİ ADIM ADIM YGS LYS 108. Adım EKOLOJİ 15 POPÜLASYON GENETİĞİ Belirli bir bölgede yaşayan aynı türlerin oluşturduğu topluluğa popülasyon denir. Popülasyon genetiği, popülasyonu temel alan genetik koludur.

Detaylı

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI Programın Yürütücüsü Programın Kadrolu Öğretim Üyeleri : Prof. Dr. Elif YEŞİLADA : Prof. Dr. Başak KAYHAN Doç. Dr. Yılmaz ÇİĞREMİŞ Doç. Dr.Şengül YÜKSEL Doç. Dr.

Detaylı

BÖLÜM 9 EVRİMİ ANLAMAK

BÖLÜM 9 EVRİMİ ANLAMAK BÖLÜM 9 EVRİMİ ANLAMAK Evrim Bu laboratuar kapsamında doğal seçilim yoluyla evrim teorisi anlatılacak ve evrimin doğadaki işleyişine matematiksel bir yaklaşım sunulacaktır. Evrimin anlaşılması, biyoloji

Detaylı

MİLLİ DNA VERİ BANKASI ÇALIŞMALARI ve ADLİ DNA ANALİZLERİNDE YENİ NESİL

MİLLİ DNA VERİ BANKASI ÇALIŞMALARI ve ADLİ DNA ANALİZLERİNDE YENİ NESİL MİLLİ DNA VERİ BANKASI ÇALIŞMALARI ve ADLİ DNA ANALİZLERİNDE YENİ NESİL İbrahim SEMİZOĞLU TÜRKİYE İLAÇ VE TIBBİ CİHAZ KURUMU EKİM- 2013 MALATYA ÜLKEMİZDE ADLİ DNA ANALİZLERİ BAŞBAKANLIK Üniversiteler Adalet

Detaylı

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ

HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ HIZLI VE YÜKSEK ÇÖZÜNÜRLÜKTE BRUCELLA GENOTİPLENDİRİLMESİ İÇİN MOLEKÜLER BİR YÖNTEM GELİŞTİRİLMESİ SELÇUK KILIÇ, BEKİR ÇELEBİ, MEHMET GENÇ, CANAN KETRE, MUSTAFA KOLUKIRIK 1, Ankara 2 Bioeksen Ar-Ge Teknolojileri

Detaylı

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11 İÇİNDEKİLER 1. BÖLÜM: EVRİME GİRİŞ...1 1.1. EVRİM VE BAŞLICA EVRİM TEORİLERİ...1 1.1.1. Darwin in Evrim Teorisi...2 1.1.2. Darwin Sonrasının Evrim Teorileri...4 1.1.3. Evrimsel Sentez Teorisi...5 1.2.

Detaylı

Süreklilik gösteren özellikler çoğunlukla iki ya da daha fazla gen tarafından kontrol edilirler.

Süreklilik gösteren özellikler çoğunlukla iki ya da daha fazla gen tarafından kontrol edilirler. KANTİTATİF GENETİK Giriş Bu bölümde genetik etkileşim gösteren bazı örnekler tartışılacaktır. Süreklilik gösteren özellikler çoğunlukla iki ya da daha fazla gen tarafından kontrol edilirler. Bu genler,

Detaylı

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN Bünyamin ATMIŞ DANIŞMAN Yrd. Doç. Dr. Dilek TURGUT BALIK 1. PARMAKİZİ 2. DNA PARMAKİZİ 3.

Detaylı

GEN MUTASYONLARI. Yrd. Doç. Dr. DERYA DEVECİ

GEN MUTASYONLARI. Yrd. Doç. Dr. DERYA DEVECİ GEN MUTASYONLARI Yrd. Doç. Dr. DERYA DEVECİ Gen mutasyonları 2 temel mekanizma ile gerçekleşir. A. İnsersiyon; Bir veya daha fazla nükleotidin araya girmesiyle B. Delesyon; Bir veya daha fazla nükleotidin

Detaylı

Bağlantı ve Kromozom Haritaları

Bağlantı ve Kromozom Haritaları Bağlantı ve Kromozom Haritaları Prof. Dr. Sacide PEHLİVAN 3. Mart. 2017 Bir kişide DNA nın şifrelediği özelliklerin tümü kalıtsal özelliklerdir. DNA üzerinde nükleotitlerden yapılı en küçük ifade edilebilir

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

Fonksiyon Optimizasyonunda Genetik Algoritmalar

Fonksiyon Optimizasyonunda Genetik Algoritmalar 01-12-06 Ümit Akıncı Fonksiyon Optimizasyonunda Genetik Algoritmalar 1 Fonksiyon Optimizasyonu Fonksiyon optimizasyonu fizikte karşımıza sık çıkan bir problemdir. Örneğin incelenen sistemin kararlı durumu

Detaylı

İÇİNDEKİLER. BÖLÜM 1 Değişkenler ve Grafikler 1. BÖLÜM 2 Frekans Dağılımları 37

İÇİNDEKİLER. BÖLÜM 1 Değişkenler ve Grafikler 1. BÖLÜM 2 Frekans Dağılımları 37 İÇİNDEKİLER BÖLÜM 1 Değişkenler ve Grafikler 1 İstatistik 1 Yığın ve Örnek; Tümevarımcı ve Betimleyici İstatistik 1 Değişkenler: Kesikli ve Sürekli 1 Verilerin Yuvarlanması Bilimsel Gösterim Anlamlı Rakamlar

Detaylı

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D.

DR. ONUR YILMAZ. Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. DR. ONUR YILMAZ Adnan Menderes Üniversitesi Ziraat Fakültesi Zootekni Bölümü Biyometri & Genetik A.B.D. Koç Katımı Çiftleşme mevsiminde kızgınlık gösteren koyunun koç ile birleştirilmesi olayına koç katımı

Detaylı

Rekombinasyon ve Bağlantı Analizi (Recombination and Linkage Analysis)

Rekombinasyon ve Bağlantı Analizi (Recombination and Linkage Analysis) Rekombinasyon ve Bağlantı Analizi (Recombination and Linkage Analysis) Mayoz bölünme sırasında aynı kromozom (bir kromatid) üzerindeki genler gametlere beraberce, başka bir ifade ile bağlı (zincirlenmiş)

Detaylı

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması

Detaylı

GLOBİN GEN REGÜLASYONU

GLOBİN GEN REGÜLASYONU GLOBİN GEN REGÜLASYONU GLOBİN GENLERİN REGÜLASYONU Her bir globin genin dokuya ve gelişime spesifik ekspressiyonu regülatör dizilimdeki transkripsiyon faktörlerinin etkisi ile sağlanmaktadır. Globin

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN: Dilek SADAK DANIŞMAN : Yrd. Doç. Dr. Dilek TURGUT-BALIK

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

artus BK Virus QS-RGQ Kit

artus BK Virus QS-RGQ Kit artus BK Virus QS-RGQ Kit Performans Özellikleri artus BK Virus QS-RGQ Kit, Versiyon 1, 4514363 Testi gerçekleştirmeden önce www.qiagen.com/products/artusbkvirusrgpcrkit.aspx adresinde yeni elektronik

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN MİTOKONDRİ Doç.. Dr. Mehmet GÜVENG Hemen hemen bütün b ökaryotik hücrelerde ve ökaryotik mikroorganizmalarda bulunur. Eritrositlerde, bakterilerde ve yeşil alglerde mitokondri yoktur. Şekilleri (küremsi

Detaylı

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM Burcu GÜNGÖR, Sami ÖZGÜR Balıkesir Üniversitesi Necatibey Eğitim OFMA Biyoloji Eğitimi A.B.D Özet Ders kitapları, hem öğretmenlerin hem öğrencilerin

Detaylı

KORELASYON VE REGRESYON ANALİZİ. Doç. Dr. Bahar TAŞDELEN

KORELASYON VE REGRESYON ANALİZİ. Doç. Dr. Bahar TAŞDELEN KORELASYON VE REGRESYON ANALİZİ Doç. Dr. Bahar TAŞDELEN Günlük hayattan birkaç örnek Gelişim dönemindeki bir çocuğun boyu ile kilosu arasındaki ilişki Bir ailenin tükettiği günlük ekmek sayısı ile ailenin

Detaylı

*Soy ağacı: Bireylerin atalarını şekil ya da sembollerle gösteren tabloya soy ağacı denir. Dişiler; yuvarlak erkekler ise kare şekli ile gösterilir.

*Soy ağacı: Bireylerin atalarını şekil ya da sembollerle gösteren tabloya soy ağacı denir. Dişiler; yuvarlak erkekler ise kare şekli ile gösterilir. SOY AĞAÇLARI *Soy ağacı: Bireylerin atalarını şekil ya da sembollerle gösteren tabloya soy ağacı denir. Dişiler; yuvarlak erkekler ise kare şekli ile gösterilir. Evlenmeler, iki birey arasında yatay çizgiyle

Detaylı

Genetik Polimorfizmler ve İlişkili Hastalıklar. Yard. Doç. Dr. Özlem KURT ŞİRİN Biokimya Anabilim Dalı

Genetik Polimorfizmler ve İlişkili Hastalıklar. Yard. Doç. Dr. Özlem KURT ŞİRİN Biokimya Anabilim Dalı Genetik Polimorfizmler ve İlişkili Hastalıklar Yard. Doç. Dr. Özlem KURT ŞİRİN Biokimya Anabilim Dalı Sunum Akışı Polimorfizm Tek nükleotit polimorfizmleri (SNP; Single nucleotide polymorphism) Farmakogenetik

Detaylı

Kromozom yapı değişimleri

Kromozom yapı değişimleri Kromozom yapı değişimleri Kromozom yapı değişimleri Nedeni kırıklardır. Kırık kısımlar birbiri ile birleşme eğilimi gösterirler. Kırıklar kimyasal, fiziksel ve biyolojik etmenlerle oluşabilirler. Yapı

Detaylı

Isırıkla İlgili Literatür İncelemesi

Isırıkla İlgili Literatür İncelemesi Isırıkla İlgili Literatür İncelemesi Prof. Dr. Tuna DEMİRDAL İzmir Katip Çelebi Üniversitesi Tıp Fakültesi Enfeksiyon Hastalıkları AD, SB Atatürk Eğitim Araştırma Hastanesi Enfeksiyon Kliniği, İzmir Avcılarda

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın X kromozomu üzerindeki genler için; Erkekler X e bağlı karakterler için hemizigottur Dişiler iki X kromozomuna sahip oldukları için mutant

Detaylı

Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD

Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD Prof. Dr. Seher Başaran İ.Ü., İstanbul Tıp Fakültesi Tıbbi Genetik AD Prenatal tanıda amaç Fetustaki olası, genetik veya nongenetik nedenlerin yol açtığı, tedavisi olanaksız ciddi hastalık ve malformasyonların;

Detaylı

KRONİK VİRAL HEPATİT C Lİ HASTALARDA IL28B NİN İNTERFERON TEDAVİSİNE YANITLA İLİŞKİSİ. Dr. Gülay ÇEKİÇ MOR

KRONİK VİRAL HEPATİT C Lİ HASTALARDA IL28B NİN İNTERFERON TEDAVİSİNE YANITLA İLİŞKİSİ. Dr. Gülay ÇEKİÇ MOR KRONİK VİRAL HEPATİT C Lİ HASTALARDA IL28B NİN İNTERFERON TEDAVİSİNE YANITLA İLİŞKİSİ Dr. Gülay ÇEKİÇ MOR Giriş-Amaç IL28B geni ve yakınındaki single nucleotide polymorphism lerinin(snp, özellikle rs12979860

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

GENETİK. HOMOZİGOT(ARI DÖL):Yavruda karakteri oluşturan iki genin de aynı şekil ve özellikte olmasıdır.(aa,aa,bb,bb...)

GENETİK. HOMOZİGOT(ARI DÖL):Yavruda karakteri oluşturan iki genin de aynı şekil ve özellikte olmasıdır.(aa,aa,bb,bb...) GENETİK Yeryüzünde iki milyonun üzerinde canlı türü yaşamaktadır.bu canlı türlerinin birbirine benzer ve farklı özellikleri bulunur.hatta bir türün tüm bireylerinde de benzer ve farklı özellikler bulunabilmektedir.bu

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

Önsöz. Değerli katılımcılar,

Önsöz. Değerli katılımcılar, Önsöz Değerli katılımcılar, Mart 2007 den beri büyük bir ekip olarak, heyecan ile yürüttüğümüz TÜRKHAYGEN-I projesinin yeni bir aşamasına varmış bulunuyoruz. Artık verilerimiz, özellikle mikrosatelit belirteçlere

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

Otozomal Baskın Kalıtım (Autosomal Dominant Inheritance) nedir?

Otozomal Baskın Kalıtım (Autosomal Dominant Inheritance) nedir? This information (1) on Autosomal Dominant genetic disorders is in Turkish Otozomal Baskın Genetik Hastalıklar (Kadınlar İçin) (İngilizce si Autosomal Dominant Genetic Disorders) Genetik (genetic) hastalığa,

Detaylı

ANADOLU MANDASI. Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl.

ANADOLU MANDASI. Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl. ANADOLU MANDASI Prof. Dr. M. İHSAN SOYSAL Dr.Emel ÖZKAN Dr.Özden ÇOBANOĞLU Namık Kemal Üniversitesi Tekirdağ Ziraat Fakültesi Zootekni Bl.Biyometri Biyometri ve Genetik ABD Dombey,Gedek,Camış,Kömüş gibi

Detaylı

11/18/2015. Mitokondrial DNA. Umut Fahrioglu, PhD MSc. Mitokondri

11/18/2015. Mitokondrial DNA. Umut Fahrioglu, PhD MSc. Mitokondri Mitokondrial DNA Umut Fahrioglu, PhD MSc Mitokondri 1 Mitokondri Şekerlerden, yağlardan ve diğer yakıtlardan oksijen yardımı ile ATP üretme işlemi olan hücresel solunumun merkezidir. İki zarla çevrilmiştir

Detaylı

Gezgin Satıcı Probleminin İkili Kodlanmış Genetik Algoritmalarla Çözümünde Yeni Bir Yaklaşım. Mehmet Ali Aytekin Tahir Emre Kalaycı

Gezgin Satıcı Probleminin İkili Kodlanmış Genetik Algoritmalarla Çözümünde Yeni Bir Yaklaşım. Mehmet Ali Aytekin Tahir Emre Kalaycı Gezgin Satıcı Probleminin İkili Kodlanmış Genetik Algoritmalarla Çözümünde Yeni Bir Yaklaşım Mehmet Ali Aytekin Tahir Emre Kalaycı Gündem Gezgin Satıcı Problemi GSP'yi Çözen Algoritmalar Genetik Algoritmalar

Detaylı

Özel Bir Hastanede Diyabet Polikliniğine Başvuran Hastalarda İnsülin Direncini Etkileyen Faktörlerin Araştırılması

Özel Bir Hastanede Diyabet Polikliniğine Başvuran Hastalarda İnsülin Direncini Etkileyen Faktörlerin Araştırılması Özel Bir Hastanede Diyabet Polikliniğine Başvuran Hastalarda İnsülin Direncini Etkileyen Faktörlerin Araştırılması 20 24 Mayıs 2009 tarihleri arasında Antalya da düzenlenen 45. Ulusal Diyabet Kongresinde

Detaylı

QIAsymphony DSP Dolaşan DNA Kiti

QIAsymphony DSP Dolaşan DNA Kiti QIAsymphony DSP Dolaşan DNA Kiti Şubat 2017 Performans Özellikleri 937556 Sample to Insight İçindekiler Performans Özellikleri... 4 Temel performans... 4 Çalışma kesinliği... 5 2 ml ve 4 ml protokollerinin

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde

Detaylı

ANKARA ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ DOKTORA TEZİ AİLE TEMELLİ İLİŞKİLENDİRME ÇALIŞMALARINDA SINIRLI ÖRNEKLEM BOYUTU İÇİN İSTATİKSEL SİNYAL İŞLEME ALGORİTMALARININ KULLANILMASI Farid RAJABLI ELEKTRONİK

Detaylı

Mendel Genetiği, Kalıtım, Gen Mühendisliği ve Biyoteknoloji

Mendel Genetiği, Kalıtım, Gen Mühendisliği ve Biyoteknoloji Mendel Genetiği, Kalıtım, Gen Mühendisliği ve Biyoteknoloji MENDEL GENETİĞİ Ebeveyn (ana-baba) ile oğul bireyler arasındaki benzerlik ve farklılıkların nasıl veya hangi oranlarda ortaya çıkabileceğini

Detaylı

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını

Detaylı

A. EġEYĠN BELĠRLENMESĠ

A. EġEYĠN BELĠRLENMESĠ Modern Genetik Biyoloji Ders Notları A. EġEYĠN BELĠRLENMESĠ Bazı omurgasız hayvanlarda ve tam çiçek bulunduran bitkilerin büyük çoğunluğunda hem dişi hem de erkek organ birlikte bulunur. Bazı canlılarda

Detaylı

Bitki Moleküler Biyolojisi. Prof. Dr. Nermin Gözükırmızı

Bitki Moleküler Biyolojisi. Prof. Dr. Nermin Gözükırmızı Bitki Moleküler Biyolojisi Prof. Dr. Nermin Gözükırmızı Bitki Moleküler Biyolojisi moleküler tekniklere dayalı bir bilim dalıdır. Dizileme, PCR, cdna, transkriptomik, proteomik, transformasyon, high-resolution

Detaylı

Ayxmaz/biyoloji. genotipine sahip organizma kaç çeşit gamet. yapılabilir? a. 4 b. 8 c. 16 d. 32 e. 64

Ayxmaz/biyoloji. genotipine sahip organizma kaç çeşit gamet. yapılabilir? a. 4 b. 8 c. 16 d. 32 e. 64 Mor çiçekli bir bitki kendini polenleri ile tozlaştırıldığında, sadece mor çiçekli yeni nesil üretilmiştir. Bu çaprazlama.. örnektir 1. hibridleşmeye. 2. eksik baskınlığa 3. Trihibrid kalıtıma. 4. ayrılma

Detaylı

Hücre Karakterizasyonu

Hücre Karakterizasyonu Hücre Karakterizasyonu Karakterizasyon Chacteriza*on: Hücre nitelendirmesi veya hücre tanımlanması diye de Türkçe ye çevrilebilir. Ama Türkçe de kullanımı olarak bakıldığında «Hücre karakterizasyonu» şeklinde

Detaylı