Yenilikler: Cerrahi Patolojiden Likid Biyopsiye

Transkript

1 Güncel Patoloji Uygulama Alanlarındaki Yenilikler: Cerrahi Patolojiden Likid Biyopsiye Serhan Alkan, MD Professor of Pathology Vice Chair of Clinical Pathology

2 28. Ulusal Patoloji Kongresi Çıkar İlişkisi Beyanı 1- Sunumum / Araştırmamız ile ilgili ticari ya da finansal herhangi bir çıkar ilişkisi bulunmamaktadır. 2- Sunumum, amacını aşan herhangi bir tartışma ya da reklam içermemektedir.

3 Here is my DNA sequence

4 Next Generation Sequencing Large panel/targeted genes Exome, Transcriptome, Genome

5 Yeni Nesil Sekanslama /NGS Yüksek verimli genomik analiz Tümor biolojisi Diagnoz Hedefli terapi Tedavi yanıtının değerlendirilmesi Dolaşımda DNA tetkiki Kalıtsal Hastalık Tespiti

6 Yeni Nesil Sekanslama / NGS Patolog olarak öğrenme deneyimim

7 YNS Teknik bilgiler Massively parallel sequencing Sequencing by synthesis Hybrid capture Library preparation Bioinformatic Pipeline FASTQ file BAM file Variant call format (VCF) file Clinical annotation Depth and breadth of gene coverage Deep sequencing SNV, CNV, INDEL Variant allele frequency Nonsynonymous and synonymous variants Variant of undetermined sequence (VUS)

8 Konfüzyon

9 YND Teknik bilgiler /Principles of NGS Sequencing by synthesis

10 FLOW CELL

11

12

13 C

14 C T

15 C T A

16 C T A C T A

17 Her Konumdaki Sekans Simultane Olarak Okunur Fragment on C3: GTG Fragment on H3:TAG Fragment on N3: ATC Fragment on S3: ACC G T A A T G A A B C D E F G H J K L M N O P R S T G T C C C

18 Cluster Array Lego Model Küme Dizisi Cluster Array Real image

19 Her Sekans Simultane Olarak Okunur All identical strands read simultaneously Millions of clusters sequenced in a massively parallel process Milyonlarca küme masif paralel olarak sıralanır

20 Tüm fragmanlar referans genoma göre dizilir All fragments match to reference genome

21 NÜKLEOTİD HİZALAMA/NUCLEOTIDE ALIGNMENT

22 Veritabanında aranan kelimelerin hizalanması için çeşitli arama motorları kullanılır After sequence reads are generated by an NGS platform, they are typically aligned and assembled on a human reference sequence.

23

24 Varyantları bulmak için çeşitli informatik programları kullanılıyor ACTTGTAGCGGACCATTATTAGCCATTG ACTTGTAGCGGACCATTTTTAGCCATTG ACTTGTAGCGGACCATTATTAGCCATTG ACTTGTAGC TTAGCCATTG SOAPsnp realsfs SAMtools GATK Beagle IMPUTE2 MaCH SNVmix VarScan Somaticsniper JointSNVMix Big Data Genomics: Avocado NGSEP

25 The 1 st position the base is C and 2 nd is G. The last read has C and G could be confusing to decide for what is the true nucleotide at this position. The last read has C and G could be confusing to decide for what is the true nucleotide at this position. Files used BAM, FASTq etc

26 Medical Doctors Informatics

27 Neoplastik dokuda YND (NGS) Analizi Normal ve tumor dokusu arasındaki farkın analizi ve varyantların (mutasyonların) tesbiti (çok komplex ve teknik bilgi) Varyantların (mutasyonların) anlamının değerlendirilmesi

28 Neoplastik dokuda YND (NGS) Analizi Normal ve tumor dokusu arasındaki farkın analizi ve varyantların (mutasyonların) tesbiti Molekuler Diagnostik Laboratuvar Varyantların (mutasyonların) anlamının değerlendirilmesi Molecular Patholojist Patholojist Onkolojist

29 Example of Report BRAF mutation Variant Allele Frequency: 47.7%

30 Variant Allele Frequency : 47.7% Variant Allele Frequency(VAF) frequency of mutation Varyantların (mutasyonların) sıklığı

31 DNA RNA Kim hazırlamalı? Bioinformatik Molecular biolojist/molecular patholojist Patholoji ozel konu uzmanları (Hematopathology, neuropatholojist, GI patholojists vs.)

32 Mutasyon Pathojenic varyant Önemi belirsiz olan varyant Variant of Undetermined significance (VUS) Non-Pathojenic varyant

33 Derinlik Kapsam Coverage: how many genes, what part of the gene analyzed Depth: how many reads

34 Günümüzde, akciğer kanseri olan hastaların yaklaşık %50'si hedefe yönelik ajanlar veya immünoterapi ile tedavi edilebilir.

35 Lung CA Genomic Analysis PI3K 1-3% of NSCLCs EGFR EGFR inhibitors BRAF Dabrafenib & Trametinib Vemurafenib? KRAS/NRAS MAPK/MEK inhibitors HER2 Exon 20 Insertion Afatinib or neratinib PTEN AKT AKT/MTOR inhibitors ERK MAPK/MEK inhibitors ALK Crizotinib, ceritinib, brigatinib, lorlatinib, alectinib MTOR AKT/MTOR inhibitors MEK MAPK/MEK inhibitors MET Cabozantinib, crizotinib, and rilotumumab NTRK1 Crizotinib ROS1 Crizotinib. RET Cabozantinib DDR2 Dasatinib FGFR1 amplification/ FGFR3 fusion Ponatinib (amplification) or JNJ (Fusion)

36 Slide 44

37 EGFR Lung Carcinoma NSCLC Frequency of EGFR mutation ~10% in the USA ~35% in Asia Activation mutation (responsive to EGFR inhibition) First generation TKIs erlotinib (Tarceva), gefitinib (Iressa) New generation Afatinib, Osimertinib also effective against T790M ras raf MEK1/2 MAPK 37

38

39 EX 18 EX 18 EX 20 EX 21 EX 20 EX 19 EX 21

40 Exon 19 ve Exon 21 mutasyonu olan Akciger kanseri hastalarda EGFR inhibitoru tedavisinin OS a etkisi

41 Exon 20 insertion mutations It comprise approximately 4 9.2% of all EGFR-mutated lung tumors Most of E20 mutations are resistant to EGFR inhibition (T790M is the most common mutation ) 41

42 Osimertinib in Untreated EGFR-Mutated Advanced Non Small-Cell Lung Cancer Progression-free Survival and Overall Survival. J Soria et al. N Engl J Med 2018;378:

43 EML4-ALK 5% of various histologic types of NSCLCs; associated with nonsmokers or light smokers mutually exclusive of mutations in EGFR and KRAS Good response to ALK inhibition (Crizotinib)

44

45

46 Acquired Resistance to Lorlatinib and Resensitization to Crizotinib. Shaw AT et al. N Engl J Med 2016;374:54-61.

47 MY CANCER GENOME

48 Lorlatinib potently inhibits ALK resistance mutations, including ALKG1202R. Justin F. Gainor et al. Cancer Discov 2016;6:

49 BRCA testing Maintenance Olaparib in Patients with Newly Diagnosed Advanced Ovarian Cancer Kaplan Meier Estimates of Progression-free Survival K Moore et al. N Engl J Med DOI: /NEJMoa

50 Intratumoral heterojen genetik izlenim Böbrek, renal hücreli karsinom

51 Colorectal Cancer Genomic Analysis

52 EGFR

53 EGFR

54 EGFR If KRAS is mutated, it will continue to send activation signal. Therefore inhibition of EGFR does not work

55 KRAS

56 Melanoma GNAQ GNA11 This codes for G-protein activate the BRAF/ MAPK 90 % of uveal melanomas show mutation BRAF MEK ERK RAS NRAS 55% of congenital melanocytic nevi HRAS most often found in Spitz nevi NF1normally inactivates RAS-GTP to RAS-GDP It is lost in 10-15% of mel. C-KIT 15 % acral mel 15 % mucosal mel % of mel chronically sun- damaged Most mutations exon 11 L576P Other mutations in exons 13 and 17 amplifi cations % of acral & mucosal PI3K AKT MTOR PTEN When PTEN is lost, PI3K stimulation is no longer controlled Causing overactivity 30 % of melanomas TERT telomerase increase activity or expression of the protein promotor mutations identified in primary (33%) and metastatic melanomas (85%) CDKN2A (p16) cell cycle inhibitor Most common mutated gene (40 %) in hereditary melanoma and the dysplastic nevus syndrome ARID2 chromatin remodeling Loss of function mutations; found~ 9% mel. BAP1 (BRCA1 assoc protein-1) Tumor supressor; Loss of function mutations; found~ 47% uveal mel or lesions with nodular pattern or epitheliod cytology.

57 BRAF Vemurafenib etkili TKI Size: 190,107 Coding Exon Count: 18

58 Prenatal Risk Analizi Amniyosentez Koryonik villus örneklemesi

59 Anne dolaşımındaki Fetal DNA analizi Non-invaziv Prenatal Tanı (NIPT)

60 40 y anestezistde NIPT testinde KRAS mutasyonu kolon kanseri diagnozu

61 Circulating free DNA/tumor DNA/ Liquid Biopsy Sirkulasyondaki tumor DNA testi EGFR rezistansı c.2369c>t T790M [TCTCAG[C/T]GAGCCA] Tedavi Osimertinib (olumlu cevap)

62 Clinical Implications of Plasma-Based Genotyping With the Delivery of Personalized Therapy in Metastatic Non-Small Cell Lung Cancer. Aggarwal C, et al JAMA Oncol Oct 11 Editorial Plasma vs Tissue Next-Generation Sequencing in Non-Small Cell Lung Cancer-Either, Both, or Neither? Gyawali B 1, West HJ 2. JAMA Oncol Oct 11 NGS should not be presumed to be the right tool for every job. While broad genomic testing is appropriate when the pretest probability of identifying a clinically relevant target with effective biomarker-driven therapy is sufficiently high, the relative ease of plasma NGS should not lower our threshold to perform NGS as a flailing effort to find some hope in settings in which relevant targets with associated therapies are very uncommon.

63 Tasuku Honjo James P. Allison

64 T-cell normal cell PD1 PD-L1 Normal hücreler PD-L1 engelleyici sinyal nedeniyle T-hücrelerinden korunur

65 T-cell T-cell normal cell PD1 PD-L1 Tumor cell PD1 PD-L1 Tumor hücreleri PD-L1 engelleyici sinyal nedeniyle T-hücrelerinden korunur

66 T-cell Tumor cell PD1 PD-L1 PD-L1 e karşı antikorlar (i.e.pembrolizumab) bu tanınmayı bloke eder Lung non-small cell lung ca PD-L1+ >50%

67 T-cell Tumor cell PD1 PD-L1 FDA MSI-yüksek tm ler için bu tedaviyi onayladı Tümör hücreleri eger yüksek sayıda yeni antijen (neoantigen) yaparsa immün cevap daha iyi olabilir

68 Mutasyon oranları

69 TMB of NSCLC associated with clinical benefit of anti PD-1 therapy TMB >200/per exome (~20000/genome) Naiyer A. Rizvi et al. Science 2015;348:

70 Nivolumab plus Ipilimumab in Lung Cancer with a High TMB Progression-free survival was significantly longer with first-line nivolumab plus ipilimumab than with chemotherapy among patients with NSCLC and a high tumor mutational burden, irrespective of PD-L1 expression level. N Engl J Med 2018; 378:

71 aagtcca Assessment for mutation (Tumor mutational Burden) Genome 3 billion base

72 No Mutation Low tumor mutation burden i.e mut in 3 billion (<2 in 3 million) Düşük tümör mutasyon yükü, ~ 3 milyarda 1000 mut (3 milyonda <2)

73 High TMB (i.e mut in 3 billion: 50 in 3 million ) Yüksek TMB (3 milyonda mut, 3 milyonda 50)

74 Low mutation burden High mutation burden TMB analizi için tüm genom test etmek yerine başka bir alternative var mı? Exom veya hedefli gen panel (Minimum kaç gen gerekli >500?)

75 MSI testi, checkpoint inhibitör tedavisi tayini için yeterli bir testmi? Chalmers ZR 2017 Genome Med 2017

76 Hira Rizvi et al. JCO 2018, 36,

77 Desmoplastik melanomlarda PD-1 blokaj tedavisinde yüksek olumlu yanıt a biopsy : stage 3a desmoplastic melanoma. Spread to the bone

78 Acquired Resistance to Anti PD-1 Therapy Jak2 mutation Q503* nonsense mutation leads to inactivation of CD8 cells CD8 cells Zaretsky JM et al. N Engl J Med 2016;375:

79 NGS ile Mikroorganizma Diagnozu

80

81

82 TURKISH GENOME PROJECT LAUNCHED The newly founded Health Institutes of Turkey (TUSEB) have initiated a Turkish genome project that aims at sequencing 100,000 genomes from healthy individuals as well as rare and complex disease patients to promote better health for future generations.

83

84

85

86

87 Genomik disiplini günlük pratiğe getirme Doktorların bilgileri direk olarak klinikte anında kullanabilmesini sağlamak Bunu önemli ölçüde engelleyen faktörler: Nomenklaturde standartlaştırılma eksikliği Çok fazla kağıt ve çok az pratik bilgi Uzman tarafından sekanslamanın klinik pratiğe yavaş adaptasyonu Klinik çalışmalara aktif katılım eksikliği(özellikle nadir bozukluklar için) Veri siloları Ilk planda yapilmasi gerekenler Moleküler biyoloji ve genomic alanda daha derin bilgi edinilmesi Biyoistatistik bilginin integrasyonu Informatik ile ortak çalışma

88 Eric Topol, MD

89

90

91

92