Hücre Biyolojisi ve Genetikte Güncel Laboratuvar Protokolleri Kerimi E. GÖKAY, M.D., Ph.D Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Hücre Biyolojisi ve Genetikte Güncel Laboratuvar Protokolleri Kerimi E. GÖKAY, M.D., Ph.D. 2008 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu"

Transkript

1 Hücre Biyolojisi ve Genetikte Güncel Laboratuvar Protokolleri Kerimi E. GÖKAY, M.D., Ph.D Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu Önsöz: Bilimsel bir araştırmanın kalitesi araştırma ile oluşturulan veri setinin güvenilirliği (teknik yeterlilik, sonuçların tekrar edilebilir olması, yapılan testlerin araştırma konusu ile doğrudan bağlantılı olması) ve veri analizinin bilimsel yeterliliği (istatistiksel anlamlılık, güncel literatür ile yeterli ve geçerli ilişkiler kurulmuş olması, analizin yorumunda varılan sonuçların tutarlı ve yenilikçi olması) ile belirlenir. Bu nedenledir ki, veri tabanı bilimsel hipotezleri test etmeye yönelik laboratuvar analizlerine dayalı tüm temel bilimlerde en güncel laboratuvar protokollerinin kullanılması ve güncel literatürün takibi kaçınılmaz bir zorunluluktur. James Watson ve Francis Crick in 25 Nisan 1953 tarihli Nature dergisinde yayınlanan Nükleik Asitlerin Moleküler Yapısı adlı bilimsel makalesi tıp ve bilim tarihinde bir dönüm noktası ve insanlık tatihi için ise yeni bir devrin başlangıcı olmuştur 1,2. Bu orijinal makalede de vurgulandığı üzere DNA (Deoksiribo-Nükleik Asit) molekülleri stabil ve olağan koşullarda antiparalel ve komplementer nitelikte biribirine bağlanmış helezonal çift sarmal bir dizin halinde bulunur. Bu yapı genetik bilginin sonraki nesillere aktarılmak üzere kopyalanması (Duplikasyon = Moleküler Kopyalama) yanısıra, yeri ve zamanaı geldiğinde Ribo-Nükleik Asit (mrna, rrna veya trna) türünden efektör moleküllere nitelik ve nicelik bakımından kontrol altında dönüştürülmesine (Transkripsiyon = Moleküler Yorumlama) imkan tanımaktadır. Ayrıca mrna şeklinde yorumlanmış genetik bilgi ribozomlar yoluyla yapısal veya effektör nitelikte farklı protein moleküllerinin sentezi için taslak oluşturmaktadır (Translasyon = Moleküler Tercüme). Hücre içerisinde genetik kalıtımın yorumunu teşkil eden proteinler hücrenin tüm metabolik, fonksiyonel ve yapısal görevlerini dikte eder. İlginçtirki hücrede sentezlenen proteinlerden bazıları (Örneğin: transkripsiyon faktörleri, DNA/RNA Polimerazlar ve nükleik asitlere şu veya bu şekilde bağlanan diğer effektör proteinler) nükleik asitlerin kopyalanma (Duplikasyon) ve yorumlanma (Transkripsiyon) sürecini kontrol altında tutarak bu döngüyü tamamlamaktadır. Hücre Biyolojisi Ana Bilim Dalında merkezi dogma (Central Dogma) olarak nitelenen bu döngü zaman içerisinde bilimsel araştırma ve analiz yöntemlerininde bu eksende guruplaşması ile sonuçlanmştır. Hücre biyolojisine dayalı analizler (morfoloji, hücre ve doku kültürleri, in vivo analizlerin tümü) biyolojik sistemlere holistik bir yaklaşım tekniği gerektirir. Ancak bu holistik analizlerin tümü moleküler analizlerle desteklenmedikçe gözlenen olgunun altında yatan mekanizmalar aydınlatılamaz. Bu nedenledirki, güncel metodolojide moleküler yaklaşım hücre biyolojisisin vazgeçilmez bir parçası haline gelmiştir. Merkezi dogmadan hareketle dört ayrı i

2 moleküler analiz yönteminden bahsedilebilir; 1) Genomik analiz, 2) Transkriptomik analiz, 3) Proteomik analiz ve 4) Metabolomik analiz. Resim 1: Merkezi Dogma ışığında hücre biyolojisi ve genetikte moleküler analiz metodları dört ana guruba ayrılmıştır; 1- Genom analizi (Genomics), 2- Transkripsiyon ara ürünlerinin analizi (Transcriptomics), 3- Proteinlerin analizi (Proteomics) ve 4- Metabolitlerin analizi (Metabolomics). Genomik analiz, DNA dizini olarak organizmanın kalıtım yoluyla miras aldığı, yaşam süreci boyunca olası mutasyonlarla çeşitlendirdiği ve duplikasyon yoluyla gelecek nesillere aktaracağı genetik bilginin incelenmesidir. Transkriptomik analiz ise genomun hücrede veya belli bir dokuda aktif olarak kullanılan kısmının analizidir. Bu niteliği ile nükleik asit dizinleri kalıtımın en temel sırlarını ve tüm bireysel özelliklerin (birçok hastalığa yatkınlık da dahil olmak üzere) şablonlarını dizinlerinde saklamaktadır. Dahası nükleik asitlerde saklanan genetik bilgi zaman içerisinde mutasyon yoluyla değişerek yeni türlerin ortaya çıkmasına (evrimleşme) yada belli türler içerisinde farklı fiziksel özelliklere sahip varyasyonlara (altcinsleşme) yol açmaktadır. DNA sekanslamada (dizin okuma) Sanger in dideoxy sekanslama yöntemi 3 ile tamamlanması belkide imkansız olan insan genomunun tamamını okuma projesi (Human Genome Project) 1990 larda ii

3 otomasyona geçişle beraber büyük ivme kazanmış ve 2003 yılında proje tamamlanmıştır ( bu bilgiye internetten ulaşımak için buraya tıklayınız). Paralel Pyro*Sekanslama ve DNA/RNA mikro-çip hibridizasyon teknolojileri sayesinde bugün artık transkriptomik analiz hiç bir zaman olmadığı kadar hızlı ve güvenilir teknikler arasına girmiştir. Bugün artık insan dahil birçok organizmanın sağlıklı ve patolojik dokularda farklı transkriptom haritaları ve komple baştan sona tüm genetik yapısı son kodonuna kadar bilinmektedir. İlk DNA sekanslama yönteminin bulmasından tam 30 yıl sonra 2007 yılında DNA/RNA sekanslama teknolojisi yıllık cirosu toplam 794 Milyon Dolara varan büyük bir endüstri haline gelmiştir. Bu yıl (2008 yılı sonu itibarıyla) global ekonomideki durgunluğa rağmen bu rakamın Milyon Dolar a varması, 2013 yılında ise ortalama her yıl % 14.7 civarında tahmini bir büyüme hızı ile endüstrinin toplam 1.7 MİLYAR Dolar ciroya ulaşması beklenmektedir 4. Dahası DNA sekanslama teknolojisi çevre dostu enerji üretiminden, sayısal bilgi depolamaya kadar farklı ve yeni Biyoteknolojik uygulama alanlarına baz oluşturmaktadır ( daha fazla bilgiye internetten ulaşımak için buraya tıklayınız). Merkezi dogma pencersinden bakıldığında HAYAT denilen olgu makro boyutta organizmaların birbirleri ile ve çevreleri ile etkileşimi, mikro düzeyde ise nükleik asitler ve/veya protein yapısında organizma içerisinde mevcut küçük fonksiyonel moleküllerin tek, tek veya devasa makro moleküler kurgular halinde karşılıklı etkileşimleri ve devinimleri olarak özetlenebilir. Proteomik analiz ve metabolomik analiz yöntemleri fonksiyonel hücre ve doku profilinin oluşturulmasına imkan tanımaktadır. Dahası birçok hastalığın daha en erken evrelerinde dahi patolojik değişikliklerin (örneğin; metastatik kapasiteye ulaşmış prostat kanseri hücrelerinde sarkozin metabolitinde artış gibi) tanımlanmasına imkan vermektedir. Artık doğru ve modern laboratuvar analiz yöntemleri ile bir damla idrar, bir damla tükürük eskisinen çok ama çok daha değerli bir tanı numunesi haline gelmiştir. Bu eserde amacımız Hücre Biyolojisi ve Genetik dallarında doktora düzeyini tamamlamış ve bilim dalının özelliklle Biyoteknolojik uygulamaları ve yeni metodolojileri ile ilgilenen meslekdaşlarımıza araştırma ve yeni uygulamalar için bir referans ve başlangıç noktası vermektir. Bu nedenle eserde örneğin Sanger in dideoxy sekanslama yöntemi, agaroz jel DNA elektroforezi veya SDS-Poliakrilamid Protein elektroforezi gibi basit ve temel uygulamalara yer verilmemiştir. Okurların bu gibi temel laboratuvar uygulamaları, temel hücre kültürü tekniğini, temel laboratuvar solüsyonlarının hazırlanması ve RT-PCR, Konfokal mikroskop, kapiller elektroforez veya sekanslama cihazı kullanımı gibi temel teknikleri bildiği ve özümsediği varsayımı ile yola çıkılmıştır. Bu veya benzeri konularda eğitim ve tecrübe eksiği olan meslekdaşlarımıza diğer daha temel kaynaklardan eksiklilklerini giderdikten sonra bu kaynağa başvurmalarını öneriyoruz. (Önerdiğimiz birincil başvuru kaynakları bu bölümün sonunda listelenmiştir.) Hücre biyolojisi ve genetik günümüzde yanlızca tababetin esası değil, aynı zamanda temel bilimlerin hepsinin bir arada yoğurup yep yeni biyoteknoloji uygulamalarına dönüştüren bir mühendislik koludur. O nedenledir ki, amacımız özgün olarak hem tıp hemde biyoteknoloji perspektifine odaklanmış bir bakışla, konuyla ilgilenen tüm bireyleri ve değerli meslekdaşlarımızı güncel laboratuvar uygulamaları hakkında bilgilendirip, onların araştırma ufuklarını geliştirmelerinde yardımcı olmaktır. Bu amaca uygun olarak eser dört ana bölüme ayrılmıştır; İlk bölümde ileri canlı hücre görüntüleme teknikleri, üç boyutu hücre/doku kültürleri, haptotaksis iii

4 analizi, fagokinetik mobilite analizi ve co-culture teknikleri gibi güncel hücre analiz teknikleri holistik morfolojik bir yaklaşımla verilmiştir. İkinci bölümde ise kapiller elektroforetik hibridizasyon analizleri, Real-time PCR, transkriptom sekanslama ve paralel Pyro*Sekanslama gibi özgün olarak genomik ve transkriptomik analiz yöntemleri anlatılmıştır. Üçüncü bölümde ise güncel kromatografik analizler, MALDI-TOF, RETOF kütle spektroskopisi ve GC/MS, LC/MS analizleri gibi proteomik ve metabolomik analizin vazgeçilmez teknikleri anlatılmıştır. Dördüncü ve son bölümde ise moleküler analizler için kan (serum), idrar, tükürük, doku-hücre ekstresi gibi numunelerin hazırlanma yöntemleri ve canlı hücre ayrıştırma yöntemleri (örnek sistem deriden kök hücre izolasyonu) ele alınmıştır. Eserin özellikle meslekte yeni bakış açıları arayan ve bilhassa özel sektörde giderek yaygınlaşmakta olan ileri teknoloji uygulamalara ilgi duyan bilim insanlarına faydalı olacağını umuyorum. Şahsım ve bu eserin hazırlanmasnda katkısı geçen Medikal yayın grubumuz adına bu satırları oluyan tüm saygıdeğer dostlarımıza sağlıklı, mutlu, başarılı ve parlak yarınlar dilerim. Dr. Kerimi Erden GÖKAY, Gökay-BIOTECH Ltd., CEO Kaynakça: 1: Watson JD, Crick FH. Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid. Nature Apr 25;171(4356): : CHAMBERS, D.A., 1995 The Double Helix : Perspective and Prospective at Forty Years Chambers D.A. (Editor) Annals of the New York Academy of Sciences Volume 758 New York, NY 3: Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A Dec;74(12): : BCC Research, DNA Sequencing: Emerging Technologies and Applications (BIO045B), [August 2008], 40 Washington Street, Suite 110, Wellesley, MA USA iv

5 Bu esere başvurmadan ÖNCE bilinmesi gereken birincill kaynakça: 1- ROSKAMS, J., 2002 Lab Ref ; A handbook of Recipes, Reagents and Other Reference Tools for Use at the Bench, Roskams J., Rodgers L. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY U.S.A. 2- MITCHELSON, K. R., 2001 Methods in molecular biology; Capillary electrophoresis of nucleic acids, Mitchelson, K. R. and Cheng, J., Humana Press Inc., Totowa, NJ U.S.A. 3- STARKEY, M. P., 2001 Methods in molecular biology; Genomics Protocols, Starkey M. P. and Elaswarapu R., Humana Press Inc., Totowa, NJ U.S.A. 4- BUDOWLE, B., 2000 DNA Typing Protocols; Molecular Biology and Forensic Analysis, Budowle B. et al., Eaton Publishing, BioTechniques, Natick, MA U.S.A. 5- HUNT, S. P., 2000 Functional Genomics; A Practical Approach, Hunt, S. P. and Livesey, F. J., Oxford University Press, Oxford, NY U.S.A. 6- BISHOP, M. J., 1997 DNA and Protein Sequence Analysis; A practical approach, Bishop M. J. and Rawlings C. J., Oxford University Press, Oxford, NY U.S.A. 7- MANIATIS, T., 1989 Molecular Cloning; A Laboratory Manual (2 nd edition), Sambrook J., Fritsch E. F., Maniatis T., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY U.S.A. 8- TAYLOR, D. L., 1989 Fluorescence Microscopy of Living Cells in Culture; Quantitative Fluorescence Microscopy, Imaging and Spectroscopy, Taylor, D. L. and Wang, Y., Academic Press Inc., San Diego, CA U.S.A. DİKKAT Hücre Biyolojisi ve Genetikte Güncel Laboratuvar Protokolleri başlıklı yayınımızın Önsöz bölümü yukarıda ücretsiz olarak istifadenize sunulmuştur. Bu kitabın devamını okumak veya diğer Gökay-BIOTECH, Ltd. yayınlarından edinmek için Gbt-Kimlik Numaranız ile birlikte lütfen YAZILI OLARAK halkla ilişkiler ofisimize başvurunuz. Tüm yayınlarımız CD-ROM (Windows veya Macintosh uyumlu) Adobe-Acrobat (Pdf) formatında istenebilir. Başvurularda istenen adet ve formatın belirtilmesi rica olunur. NOT: Teknoloji transferinin önlenmesi için başlatılan yeni uygulamamız gereği yanlızca kayıtlı müşteri ve kurumumuz elemanlarına verilen Gbt-Kimlik Numarası beyanı telif hakları firmamıza ait tüm kaynak eserlerin siparişinde zorunlu hale getirilmiştir. Her hakkı saklıdır. v

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU DOKTORA DERS KATALOĞU ERCİYES ÜNİVERSİTESİ GDM 638 Lipid Kimyası Zorunlu DERS SAATİ: 3 Bahar Yrd. Doç. Dr. Hasan YALÇIN KREDİSİ :3 Tel:(352) 4374901 (32731), E-mail: hyalcin@erciyes.edu.tr, Web sayfası

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Erken Tanı ve Check-up Rehberi Kerimi E. GÖKAY, M.D., Ph.D. 2007 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu

Erken Tanı ve Check-up Rehberi Kerimi E. GÖKAY, M.D., Ph.D. 2007 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu Erken Tanı ve Check-up Rehberi Kerimi E. GÖKAY, M.D., Ph.D. 2007 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu Önsöz: Modern klinik tıpta tanıya üç ana bilimsel veri tabanının birlikte değerlendirilmesi

Detaylı

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI 12. SINIF KONU ANLATIMI 7 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların genlerine

Detaylı

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ)

(ZORUNLU) MOLEKÜLER İMMÜNOLOJİ I (TBG 607 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL (ZORUNLU) MOLEKÜLER

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyolojide Kullanılan Teknikler Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır.

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır. TIBBİ GENETİK I-DERS TANIMLARI 1-Tanım: DNA ve RNA yapısının öğretilmesi. b. Amaç: DNA nın genetik materyal olmasında moleküler yapısının önemi ve RNA yapısının proteine geçiş ve gen ekspresyonu kontrolündeki

Detaylı

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD Genomiks Temeli DNA nın dizilenmesi ve elde edilen dizilerin biyoinformatiksel metotlar kullanılarak

Detaylı

RİBOZOM YAPI, FONKSİYON BİYOSENTEZİ

RİBOZOM YAPI, FONKSİYON BİYOSENTEZİ RİBOZOM YAPI, FONKSİYON VE BİYOSENTEZİ Ribozom Palade adlı araştırıcı tarafından elektron mikroskop ile tanımlanmıştır. Viruslar hariç tüm canlılarda bulunan bir membranla çevrili olmayan organellerdir.

Detaylı

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI Moleküler biyolojiye giriş Doç.Dr.Pınar AKSOY SAĞIRLI Molecular biology terimi ilk kez Warren Weaver tarafından 1938 de kullanıldı. Hayatın fiziksel ve kimyasal olarak açıklanması olarak tanımlandı. 1977

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Ders Bilgisi. Öğretim Görevlisi ORTA DOĞU TEKNİK ÜNİVERSİTESİ 9080506-1 DERS İZLENCESİ. Ders Kodu 9080506. Ders Bölümü.

Ders Bilgisi. Öğretim Görevlisi ORTA DOĞU TEKNİK ÜNİVERSİTESİ 9080506-1 DERS İZLENCESİ. Ders Kodu 9080506. Ders Bölümü. Ders Bilgisi Ders Kodu 9080506 Ders Bölümü 1 Ders Başlığı PROTEİN VE DNA DİZİ ANALİZİ Ders Kredisi 3 ECTS 8.0 Ders Katalog Tanımı Bu derste, homoloji analizi, motif ve alt-birimlerin(domain) belirlenmesi,

Detaylı

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ Nükleik asitler Sıcaklıkla öldürülmüş S suşları Canlı R suşlarını canlı S suşuna dönüştürür a) Farelere virulan S suşu enjekte edildiğinde ölür b) R suşu enjekte edildiğinde yaşar c) Isıyla öldürülmüş

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

Metabolomik; belirli hücreselbiyokimyasal

Metabolomik; belirli hücreselbiyokimyasal METABOLOMİK Metabolomik; belirli hücreselbiyokimyasal proseslerin arkalarında bıraktıkları o proseslere özgü, kimyasal parmakizlerini, özellikle de, bu proseslerin ürünü olan bütün küçük moleküllerin [metabolitlerin]

Detaylı

DNA ve DNA GÜNÜ Lütfi TUTAR 27 Nisan 2015

DNA ve DNA GÜNÜ Lütfi TUTAR 27 Nisan 2015 DNA ve DNA GÜNÜ Lütfi TUTAR 27 Nisan 2015 www.dna-gunu.com Organizma = İnsan = Homo sapiens İnsan Kromozomları (Karyotip) Deoksiribo Nükleik Asit GEN İFADESİ DNA KEŞFİNDE ÖNEMLİ OLAYLAR 1863 te

Detaylı

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI

ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI ADIM ADIM YGS- LYS 92. ADIM KALITIM 18 GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÇALIŞMA ALANLARI GENETİK MÜHENDİSLİĞİ Belirli bir amaca yönelik olarak genetik madde üzerinde yapılan çalışmaları içerir. Canlıların

Detaylı

SİSTEM BİYOLOJİSİ NEDİR?

SİSTEM BİYOLOJİSİ NEDİR? SİSTEM BİYOLOJİSİ SİSTEM BİYOLOJİSİ NEDİR? Sistem biyolojisi, canlıların genler, proteinler ve biyokimyasal tepkimelerin etkileşen ve bütünleşmiş bir ağ yapısı olarak algılanarak incelenmesini amaçlayan

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili RNA Dünyası Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

BAKTERİLERİN GENETİK KARAKTERLERİ

BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Kök Hücre Biyolojisi Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8 DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS BİYOİNFORMATİĞE GİRİŞ BTEC 513 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce

Detaylı

Moleküler Tıp ve Gen Tedavisine Giriş Kerimi E. GÖKAY, M.D., Ph.D. 2005 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu

Moleküler Tıp ve Gen Tedavisine Giriş Kerimi E. GÖKAY, M.D., Ph.D. 2005 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu Moleküler Tıp ve Gen Tedavisine Giriş Kerimi E. GÖKAY, M.D., Ph.D. 2005 Gökay Biyotek Ltd. Şti. / Medikal Yayın Grubu Önsöz: Moleküler biyoloji, genetik ve hücre biyolojisi ana dallarını kendine baz alan

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

TRANSLASYON ve PROTEİNLER

TRANSLASYON ve PROTEİNLER TRANSLASYON ve PROTEİNLER Prof. Dr. Sacide PEHLİVAN 13 Aralık 2016 mrna daki baz sırasının kullanılarak amino asitlerin doğru sıra ile proteini oluşturmasını kapsayan olayların tümüne Translasyon veya

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ. DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA nın Keşfinin 50. yılının ardından GENOM PROJELERİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN: Dilek SADAK DANIŞMAN : Yrd. Doç. Dr. Dilek TURGUT-BALIK

Detaylı

Biyokimya (CEAC 212) Ders Detayları

Biyokimya (CEAC 212) Ders Detayları Biyokimya (CEAC 212) Ders Detayları Ders Adı Ders Kodu Dönemi Ders Saati Uygulama Saati Laboratuar Saati Kredi AKTS Biyokimya CEAC 212 Güz 3 0 0 3 5 Ön Koşul Ders(ler)i CEAC 202 Dersin Dili Dersin Türü

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

DERS BİLGİLERİ. Ders Kodu Dönem T+U Saat Kredi AKTS. Hareket Sistemi TIP 107 1 107 7 10. Kurul Dersleri Teorik Pratik Toplam.

DERS BİLGİLERİ. Ders Kodu Dönem T+U Saat Kredi AKTS. Hareket Sistemi TIP 107 1 107 7 10. Kurul Dersleri Teorik Pratik Toplam. DERS BİLGİLERİ Ders Kodu Dönem T+U Saat Kredi AKTS Hareket Sistemi TIP 107 1 107 7 10 Kurul Dersleri Teorik Pratik Toplam Anatomi 22 18 40 Tıbbi Biyokimya 21 4 25 Tıbbi Biyoloji 16 2 18 Histoloji ve Embriyoloji

Detaylı

EĞİTİM - ÖĞRETİM YILI DÖNEM I. III. KURULDERS PROGRAMI GENETİK BİLGİNİN AKIŞI- DOKUYA GİRİŞ (16 Ocak Mart 2017 )

EĞİTİM - ÖĞRETİM YILI DÖNEM I. III. KURULDERS PROGRAMI GENETİK BİLGİNİN AKIŞI- DOKUYA GİRİŞ (16 Ocak Mart 2017 ) 2015 2016 EĞİTİM - ÖĞRETİM YILI DÖNEM I III. KURULDERS PROGRAMI GENETİK BİLGİNİN AKIŞI- DOKUYA GİRİŞ (16 Ocak 2017-10 Mart 2017 ) Dekan Baş Koordinatör Dönem I Koordinatörü Dönem I Koordinatör Yardımcısı

Detaylı

Doç. Dr. Fatih ÇALIŞKAN Sakarya Üniversitesi, Teknoloji Fak. Metalurji ve Malzeme Mühendisliği EABD

Doç. Dr. Fatih ÇALIŞKAN Sakarya Üniversitesi, Teknoloji Fak. Metalurji ve Malzeme Mühendisliği EABD BİYOUYUMLULUK (BIO-COMPATIBILITY) 10993-1 Bir materyalin biyo-uyumluluğunun test edilmesi için gerekli testlerin tümünü içerir. (Toksisite, Hemoliz, sitotoksisite, sistemik toksisite,...vs.) Hammaddelerin

Detaylı

Transkripsiyon ve Transkripsiyonun Düzenlenmesi

Transkripsiyon ve Transkripsiyonun Düzenlenmesi MBG 505 BAKTERİ GENETİĞİ Transkripsiyon ve Transkripsiyonun Düzenlenmesi Emrah ÖZÇELİK Ribonükleik asit (RNA) 3 tip RNA Mesajcı RNA (mrna) (genetik seviyede) Transfer RNA (trna) Ribozomal RNA (rrna) (fonksiyonel

Detaylı

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını

Detaylı

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni.

BYM613 Genetik MühendisliM. Hacettepe Üniversitesi. 2011) Chemical and Biomolecular Eng., Cornell Uni. BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr Özgeçmişimim Postdoctoral

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

Biyobankalar. Prof.Dr.Meral Özgüç

Biyobankalar. Prof.Dr.Meral Özgüç Biyobankalar Prof.Dr.Meral Özgüç Hacettepe Üniversitesi, Tıp Fakültesi, Tıbbi Biyoloji Anabilim Dalı 14.05.2014 Genetik Genombilim Yüksek ölçekli teknolojiler Örnek kalite sayı Biyobankalar & Çerçeve Kuralları

Detaylı

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ Yrd. Doç. Dr. Hakan GÜRKAN Trakya Üniversitesi Tıp Fakültesi Tıbbi Genetik Anabilim Dalı PGT NEDİR? Gebelik öncesi genetik tanı (PGT) adı verilen

Detaylı

Doç. Dr. Tijen Talas-Oğraş. TÜBĐTAK - Marmara Araştırma Merkezi Gen Mühendisliği ve Biyoteknoloji Enstitüsü

Doç. Dr. Tijen Talas-Oğraş. TÜBĐTAK - Marmara Araştırma Merkezi Gen Mühendisliği ve Biyoteknoloji Enstitüsü Bitki Biyoteknolojisi ve Açılımları YIBO-2009 Doç. Dr. Tijen Talas-Oğraş TÜBĐTAK - Marmara Araştırma Merkezi Gen Mühendisliği ve Biyoteknoloji Enstitüsü BĐYOTEKNOLOJĐ Biyoteknoloji; ürün oluşumu için biyolojik

Detaylı

Mitokondrial DNA Analiz Paneli

Mitokondrial DNA Analiz Paneli FAST-mtDNA Sequencing Kit Mitokondrial DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

Gen haritasının ne kadarı tamamlandı DNA'nın şimdiye kadar yüzde 99'u deşifre edildi.

Gen haritasının ne kadarı tamamlandı DNA'nın şimdiye kadar yüzde 99'u deşifre edildi. Bilim dünyası, yaşamı alt üst edecek yeni bir gelişmeye daha imza atarak insan DNA'sının şifresini çözmeyi başardı. Çıkarılan 'gen haritası' sayesinde kalp ve kanser hastalığı tarihe karışacak ve insan

Detaylı

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 12 Prokaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON

Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON Biyoteknoloji ve Genetik II Hafta 8 TRANSLASYON Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com TRANSLASYON Translasyon a. mrna ribozoma

Detaylı

Yrd.Doç.Dr.Yosun MATER. Gebze Yüksek Teknoloji Enstitüsü Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü

Yrd.Doç.Dr.Yosun MATER. Gebze Yüksek Teknoloji Enstitüsü Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü Gebze Yüksek Teknoloji Enstitüsü Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü * Glikobiyoloji son 50 yılda ortaya çıkan ve gelişmekte olan önemli bir biyoloji alt dalıdır. * Bu konuya başlarken

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı Dönem I. 2. Ders Kurulu II. HÜCRE BİLİMLERİ-I Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Prof. Dr. Alirıza ERDOĞAN Yrd. Doç. Ders Kurulu

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji ABD Prof. Dr. Filiz Aydın Mitokondri, ökaryotik organizmanın farklı bir organeli Şekilleri küremsi veya uzun silindirik Çapları 0.5-1 μm uzunlukları 2-6 μm Sayıları

Detaylı

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI Programın Yürütücüsü Programın Kadrolu Öğretim Üyeleri : Prof. Dr. Elif YEŞİLADA : Prof. Dr. Başak KAYHAN Doç. Dr. Yılmaz ÇİĞREMİŞ Doç. Dr.Şengül YÜKSEL Doç. Dr.

Detaylı

GEN EKSPRESYONU: GENDEN PROTEİNE

GEN EKSPRESYONU: GENDEN PROTEİNE GENLER ve İŞLEVLERİ GEN EKSPRESYONU: GENDEN PROTEİNE Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Genlerin Doğası Şimdiye kadar öğrendiklerimiz bize canlıya ait bilgilerin DNA da yer aldığını

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

T. C. İZMİR KÂTİP ÇELEBİ ÜNİVERSİTESİ TIP FAKÜLTESİ 2014 2015 EĞİTİM - ÖĞRETİM YILI DÖNEM I

T. C. İZMİR KÂTİP ÇELEBİ ÜNİVERSİTESİ TIP FAKÜLTESİ 2014 2015 EĞİTİM - ÖĞRETİM YILI DÖNEM I T. C. İZMİR KÂTİP ÇELEBİ ÜNİVERSİTESİ TIP FAKÜLTESİ 2014 2015 EĞİTİM - ÖĞRETİM YILI DÖNEM I III. KURUL DERS PROGRAMI GENETİK BİLGİNİN AKIŞI - DOKUYA GİRİŞ (12 Ocak 2015-6 Mart 2015 ) Dekan Baş Koordinatör

Detaylı

ÖĞLE ARASI ÖĞLE ARASI

ÖĞLE ARASI ÖĞLE ARASI 1. HAFTA 7 Kasım 2016 Pazartesi 8 Kasım 2016 Salı 9 Kasım 2016 Çarşamba 10 Kasım 2016 Perşembe 11 Kasım 2016 Cuma Diş Anatomisi ve Morfolojisi 08.30-09.15 09.30-10.15 Dr. Gökçe Soğancı Mandibular santral,

Detaylı

GENETİK VE BİYOTEKNOLOJİ

GENETİK VE BİYOTEKNOLOJİ Editörler Prof.Dr. Cansu Filik İşçen & Yrd.Doç.Dr.M.Bahadır Aktan GENETİK VE BİYOTEKNOLOJİ Yazarlar Prof.Dr. Osman Gülnaz Doç.Dr. Fatih Matyar Doç.Dr. Güldem Dönel Akgül Doç.Dr. Petek Piner Benli Doç.Dr.

Detaylı

DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

A. DNA NIN KEŞFİ VE ÖNEMİ

A. DNA NIN KEŞFİ VE ÖNEMİ DNA nın Yapısı ve Replikasyonu Biyoloji Ders Notları A. DNA NIN KEŞFİ VE ÖNEMİ İlk olarak Friedrich Miescher (1869) akyuvar hücreleri ve balık sperminde yönetici molekülleri tespit etmiştir. Çekirdekte

Detaylı

TRANSLASYON VE DÜZENLENMESİ

TRANSLASYON VE DÜZENLENMESİ TRANSLASYON VE DÜZENLENMESİ TRANSLASYON Translasyonda nükleik asit kullanılır fakat son ürün bir nükleik asit değil proteindir. Translasyon mekanizması 4 ana bileşenden oluşmaktadır: 1. mrnalar 2. trnalar

Detaylı

I. YARIYIL MOLEKÜLER HÜCRE BİYOLOJİSİ I (TBG 601 TEORİK 3, 3 KREDİ)

I. YARIYIL MOLEKÜLER HÜCRE BİYOLOJİSİ I (TBG 601 TEORİK 3, 3 KREDİ) T. C. İSTANBUL BİLİM ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI YÜKSEK LİSANS PROGRAMI 2014-2015 EĞİTİM-ÖĞRETİM YILI DERS İÇERİKLERİ I. YARIYIL MOLEKÜLER HÜCRE BİYOLOJİSİ

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Haziran 2013

Moleküler Biyoloji ve Genetik Bölümü Haziran 2013 Moleküler Biyoloji ve Genetik Bölümü Haziran 2013 Moleküler Biyoloji ve Genetik Bölümü (MBGB) Güçlü ve çok yönlü bir eğitim programı sunarak, gelişen teknoloji çağında, çok hızlı gelişen alanımızda ileri

Detaylı

Performans Özellikleri

Performans Özellikleri Performans Özellikleri QIAamp DSP DNA FFPE Tissue Kiti, Sürüm 1 60404 Sürüm yönetimi Bu belge, QIAamp DSP DNA FFPE Tissue Kiti Performans Özellikleri, Sürüm 1, R3 belgesidir. Testi gerçekleştirmeden önce

Detaylı

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 SANTRAL DOGMA Hücredeki bilgi aktarım mekanizmasının tamamına SANTRAL DOGMA denir. Santral dogma tek yönlü bilgi aktarımıdır. Geri dönüşümü

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

Sekansın Temelleri ve Sekans Bazlı Çalışma Doç. Dr. Fatih Özaltın Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Nefroloji Ünitesi Nefrogenetik Laboratuvarı TİGED-24 Nisan 2011 Dalaman Çekirdekte DNA kromatin

Detaylı

DERS BİLGİLERİ MİKROBİYAL METABOLİZMA BTEC Prof. Dr. Zeynep Petek ÇAKAR. Prof. Dr. Zeynep Petek ÇAKAR

DERS BİLGİLERİ MİKROBİYAL METABOLİZMA BTEC Prof. Dr. Zeynep Petek ÇAKAR. Prof. Dr. Zeynep Petek ÇAKAR DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS MİKROBİYAL METABOLİZMA BTEC585 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

Springer Protokolleri

Springer Protokolleri springer.com Springer Protokolleri Springer, dünyanın en kapsamlı, hakemli, yaşam bilimleri protokolleri koleksiyonunu sunar 7 20.000 den fazla protokol içerir, her sene 2.000 yeni protokol eklenmektedir

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

AİLESEL AKDENİZ ATEŞİ (AAA-FMF)

AİLESEL AKDENİZ ATEŞİ (AAA-FMF) AİLESEL AKDENİZ ATEŞİ (AAA-FMF) MOLEKÜLER YAKLAŞIMLAR DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD AİLESEL AKDENİZ ATEŞİ Otozomal resesif kalıtım Akdeniz ve Ortadoğu kökenli populasyonlarda

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

Biyobankalamanın. Tasarlanması ve Deneyimler

Biyobankalamanın. Tasarlanması ve Deneyimler Biyobankalamanın Örnek İşlem (Data Processing Processing) Sürecinin Tasarlanması ve Deneyimler Tufan T. Acuner, M.D. İstanbul Üniversitesi Sağlık Bilimleri Enstitüsü Genetik Anabilim Dalı Fatmahan Atalar,

Detaylı

Temel Makromoleküller ve Moleküler Biyolojinin Merkezi Doktrini

Temel Makromoleküller ve Moleküler Biyolojinin Merkezi Doktrini Temel Makromoleküller ve Moleküler Biyolojinin Merkezi Doktrini Yaşamın Yedi Temel Direği Makromoleküller Merkezi Doktrin ve Genetik Sınıflandırma Paul Selvin ve Arif Altıntaş ın ders notlarından derlenmiştir.

Detaylı

Prof. Dr. Bülbin SunarReeder. L.T. Daum and G.W. Fischer Longhorn Vaccines and Diagnostics, San Antonio 78208, TX, USA. Longhorn-VandD@sbc.global.

Prof. Dr. Bülbin SunarReeder. L.T. Daum and G.W. Fischer Longhorn Vaccines and Diagnostics, San Antonio 78208, TX, USA. Longhorn-VandD@sbc.global. Klinik Örneklerdeki RNA in korunması, Patojenlerin inaktivasyonu ve Soğuk zincire ihtiyaç olmadan taşınabilmesi için geliştirilmiş özgün moleküler taşıma ortamı (PrimeStoreMTM) Prof. Dr. Bülbin SunarReeder

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Viroloji Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer (

Detaylı

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A

Detaylı

ODTÜ Biyoteknoloji Enstitü ABD 25. Yıl. Prof Dr. Canan Çilingir 14 Kasım 2014 ODTÜ

ODTÜ Biyoteknoloji Enstitü ABD 25. Yıl. Prof Dr. Canan Çilingir 14 Kasım 2014 ODTÜ ODTÜ Biyoteknoloji Enstitü ABD 25. Yıl Prof Dr. Canan Çilingir 14 Kasım 2014 ODTÜ Kutlu Olsun Üniversitemizde interdisipliner çalışmalara olan katkısı Alanın güncel konularında yürüttüğü başarılı araştırmalar

Detaylı

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü 7 İNSAN GENOM PROJESİ Ifl k YULU * In this article, the author has summarized the Human Genome Project and what it aims to achieve. Following the description of the human genome the history, applications,

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Kanser Biyolojisi ve Genetiği Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan

Detaylı

UÜ-SK TIBBİ GENETİK ANABİLİM DALI HİZMET KAPSAMI. Dok.Kodu : FR-YLY-15-401 İlk Yay.Tarihi : 15 Nisan 2007 Sayfa 1 / 6

UÜ-SK TIBBİ GENETİK ANABİLİM DALI HİZMET KAPSAMI. Dok.Kodu : FR-YLY-15-401 İlk Yay.Tarihi : 15 Nisan 2007 Sayfa 1 / 6 UÜ-SK TIBBİ GENETİK ANABİLİM DALI HİZMET KAPSAMI Dok.Kodu : FR-YLY-15-401 İlk Yay.Tarihi : Rev. No : 03 Rev.Tarihi : 28 Şubat 2012 1 / 6 1. HİZMET KAPSAMI: Tıbbi Genetik AD tüm yaş gruplarındaki hastalara,

Detaylı

SANKO ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS KURULU 102: HÜCRE VE DOKU SİSTEMLERİ

SANKO ÜNİVERSİTESİ TIP FAKÜLTESİ 2015-2016 EĞİTİM-ÖĞRETİM YILI DERS KURULU 102: HÜCRE VE DOKU SİSTEMLERİ 05-06 EĞİTİM-ÖĞRETİM YILI DERS KURULU 0: HÜCRE VE DOKU SİSTEMLERİ Ders Kurulu Başkanı: / Başkan Yardımcıları: / Histoloji Embriyoloji Yrd. Doç. Dr. Bahadır Murat Demirel / Üyeler: / Tıbbi / Dersin AKTS

Detaylı

Yeni Nesil Dizileme Prensipleri

Yeni Nesil Dizileme Prensipleri 1 2 3 7 8 9 4 5 6 Yeni Nesil Dizileme Prensipleri Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD NGS Yeni Nesil Dizi Analizi Next Generation Sequencing Massively Parallel Sequencing

Detaylı

NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller)

NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller) NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller) NÜKLEİK ASİTLERİN KEŞFİ *FRIEDRICH MIESCHER * Balık spermlerinin çekirdeklerini ve akyuvar çekirdeklerini ayrıştırarak yaptığı çalışmalarda, bu hücrelerin

Detaylı

BÖLÜM 3 STRATEJİK ALANLAR, AMAÇLAR, HEDEFLER, STRATEJİLER VE PERFORMANS GÖSTERGELERİ

BÖLÜM 3 STRATEJİK ALANLAR, AMAÇLAR, HEDEFLER, STRATEJİLER VE PERFORMANS GÖSTERGELERİ BÖLÜM 3 STRATEJİK ALANLAR, AMAÇLAR, HEDEFLER, STRATEJİLER VE PERFORMANS GÖSTERGELERİ BÖLÜM 3. Stratejik Alanlar,Amaçlar, ler,stratejiler ve Performans Göstergeleri STRATEJİK ALAN 1. Eğitim- Öğretim Alanı

Detaylı

DNA Dizi Analiz Yöntemleri

DNA Dizi Analiz Yöntemleri DNA Dizi Analiz Yöntemleri DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine

Detaylı

Nükleik Asitler. DNA ve RNA nükleik asitleri oluşturur

Nükleik Asitler. DNA ve RNA nükleik asitleri oluşturur NÜKLEİK ASİTLER Nükleik Asitler DNA ve RNA nükleik asitleri oluşturur Genetik bilginin nesiller boyu aktarılması ve bunun proteinlere tercüme edilmesinde görev alırlar Nükleotid ünitelerinden oluşurlar

Detaylı

12. SINIF KONU ANLATIMI 2 DNA VE RNA

12. SINIF KONU ANLATIMI 2 DNA VE RNA 12. SINIF KONU ANLATIMI 2 DNA VE RNA DNA (DEOKSİRİBONÜKLEİK ASİT) Temel nükleik asittir. Prokaryot hücrelerin sitoplazmasında, ökaryot hücrelerde çekirdek, mitokondri ve kloroplast organelinde bulunur.

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

PROTEİN ANALİZ YÖNTEMLERİ

PROTEİN ANALİZ YÖNTEMLERİ PROTEİN ANALİZ YÖNTEMLERİ Protein analizleri, fen bilimleri araştırmaları ve farmosötik endüstrisinde önemli bir araç olarak karşımıza çıkar. Protein Analizinin Amaçları: Hastalıkların Kesin Tanısının

Detaylı