DNA Mikroarrayler: SNP analizleri

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "DNA Mikroarrayler: SNP analizleri"


1 Hafta IX Genombilimde Mikrodizin Uygulamaları ve iyoinformatik Analiz DNA Mikroarrayler: SNP analizleri Doç. Dr. Hilâl Özdağ

2 DNA Mikrodizin Genomik Dizi SNP 5 T / G 3 SNP prob = 25 baz Perfect Match Mismatch Allel A Perfect Match Mismatch Allel


4 DNA Mikrodizin PM A MM PM MM A Prob Çift Seti (Kuartet) SNP başına 56 olasılık Oryantasyon başına 28 Dağıtılmış yerleşim Düz zincir 5 3 PM A MM PM MM A 3 5 Ters zincir

5 DNA Mikrodizin PMA PMA PMA PMA PMA PMA PMA MMA MMA MMA MMA MMA MMA MMA PM PM PM PM PM PM PM MM MM MM MM MM MM MM 14 kuartet değerlendirilip en iyi 10 tanesi herbir TNP yi temsil etmek üzere seçilir. Seçilen bu 10 kuartet herbir TNP nin varlığını hem düz hem de ters zincirde inceler. Tek bir TNP yi sorgulamak üzere toplam 40 prob kullanılmaktadır.

6 Tek Primer Amplifikasyonu ile Karmaşıklığın Ortadan Kaldırılması

7 DNA Mikrodizin 250 ng Genomik DNA Xba Xba Xba RE muamelesi Tek primer ile amplifikasyon Adaptörün bağlanması 4 PCR Reaksiyonu Fragmentasyon ve işaretleme Hibridizasyon Ve Tarama

8 DNA Mikrodizin Mikrosatellit 10K # Marker ,000 Çözünürlülük 10 cm (10 M) 1 cm (1 M) * # PCR Reak/örnek 200 (2x multipleks) 4 # PCR Primer/örnek Süre (400 örnek) > 8 hafta 4-6 hafta elirteç başına DNA Deney başına DNA 40 ng 16,000 ng.025 ng 250 ng

9 DNA Mikrodizin Farklılıklar 100k 10K Dizin sayısı 2 1 Enzim sayısı 2: Xba1 ve HindIII 1: Xba aşlangıç DNA miktarı 250 ng X2 enzim = 500 ng 250 ng PCR Amplifikasyon oyutu bp bp Fragmente edilecek miktar 40ug 20ug Tarama Yüksek çözünülürlüklü tarama Rutin tarama Fragmentasyon reaktifinin konsantrasyonu 0.06U/uL 0.048U/uL Algoritma ve yazılım DM Algoritma ve GTT MPAM ve GDAS 2.0 Ana uygulama alanı Asosiyasyon çalışmaları ağlantı TNP ler Perlegen ve Kamu Kamu

10 DNA Mikrodizin

11 DNA Mikrodizin

12 DNA Mikrodizin

13 DNA Mikrodizin <> <>







20 A Düz zincir C G T T C G C A

21 CustomSeq Resequencing Dizinleri AGCGT ACCGT A C G T A C G T Çip başına 30 kb çift zincirli DNA dizilimi okunabiliyor. Toplam 60 kb.

22 CustomSeq Deney Protokolü Kontrol Kalıp/Primerler Genomik DNA Kısa Ölçekli PCR Uzun Ölçekli PCR Miktar tayini-örneklerin Karıştırılması Fragmentasyon reaktifi Fragment Đşaret Hibridizasyon için oligo kontrolleri Hibridizasyon Veri analizi

23 Deney Akışı Đlgilenilen genlerin belirlenmesi Karıştırma ve Fragmentasyonasyon DNA fragmentleri Genomik DNA PCR Ürünleri Đşaretleme Geceboyu hibridizasyon Tarama Yıkama Đstasyonu: Yıkama/oyama Sondan işaretli fragmentler

24 Affymetrix CustomSeq Arrays iological Sample Probe Array 2.5 Days Wash & Stain >chr21: gtggcatgatcttggctcactgcagttcaagcaattctcctgccttagc cccctgagtagctgggattacaggtgcctgctaccaccctcagctaat tttttgtatttttaatagagacggggtttcaccatgttggccaggctggtc tcgaactcctgacctcgtgattcgtctgcctcggccttccaaagtgctg ggagtacaggcatgagccaccgcacccggcctgtatatcttttttaaa aggaaaagaacatatcccagaagtttccaactgagtttccctctgggt caataccagaattgggtgggggtcttcagctcacccctaaactcatca ttgataagcagaatgaatgaccatggctggtttagaca. Scan ~30 Kb

25 DNA Analiz Yazılımı Cihaz Kontrolü.DAT dosyasının oluşturulması GCOS.CEL dosyasının oluşturulması.chp dosyasının oluşturulması.chp veri karşılaştırılması GeneChip DNA Analysis Software 2.0 (GDAS)


GENETĐK OMĐK TEKNOLOJĐLERĐ. Doç. Dr. Hilâl Özdağ D N A GENETĐK 111-503 OMĐK TEKNOLOJĐLERĐ Doç. Dr. Hilâl Özdağ D N A 1 Mammals Other chordates Other eukaryotes Homo sapiens [NCI 35] browse what's new Vega Gallus gallus [WASHUC1] browse what's new Drosophila


Genetikten Genombilime Geçişte Transkriptom Analizleri

Genetikten Genombilime Geçişte Transkriptom Analizleri Genetikten Genombilime Geçişte Transkriptom Analizleri Doç.Dr. Hilâl Özdağ AÜ iyoteknoloji Enstitüsü Mammals Other chordates Other eukaryotes Homo sapiens [NCI 35] Vega Gallus gallus [WASHUC1] Drosophila


Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen


Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli


Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde




ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı

ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ü Ğ Ğ ş üş ü ş ğ ş ü ğ ş ü ç Ö Ö Ü ü ü ş Ş ğ ş Ü üç ü ü ü ü ş ç ş ğ üş ğ ü ü ü ş ş ü ş ğ ç ş ğ ğ ş ş ş ü ü ü ğ ü ü ü üç ğ ü ç ş ü ğ Ç ğ ç ş ü ü ü ğ ü ğ ü Ü ü ü Ö ç ü ü ü üğ ş ş ç ğ ç ü ü ü üğ ş ş ç ğ ü



DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap


MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı MIKROARRAY TEKNOLOJİSİ Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı 2602040083 vshancer@yahoo.com EŞ ANLAMLILAR Biochip DNA chip DNA microarray Gene array 2 Neden bu teknolojiye ihtiyaç


SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.



MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son


PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade



MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son


RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod



KAYAŞEHİR 18. BÖLGE 1. ETAP KURALI SATIŞTAKİ BAĞIMSIZ BÖLÜMLER GRUBU KAT 1 342362 1 Standart Konut 2 MMA Endeks 1 201534236200880T4006 880 3 B1 ZEMİN 1 1+1 66,82 55,7 GD 154.447 15 23.167 96 1.368 20 30.889 108 1.144 25 38.612 120 965 40 61.779 120 772 2 342362 1






HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla


Microarray Teknolojisi

Microarray Teknolojisi Microarray Teknolojisi Evrimsel ve Ekolojik Çalışmalarda Kullanımı K. İpekdal Proteomik ve Genomik 2006 A. Microarray Teknolojisi Son 10 yılda pek çok model sistem hazırlanırken organizmadan büyük miktarlarda


SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi


Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı

Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı 4. Ha&a Polimeraz Zincir Reaksiyonu Mikrobiyoloji Anabilim Dalı Sunu içeriği PCR ın tanımı PCR ın kısa tarihçesi Hücre içi DNA replikasyonu PCR bileşenleri PCR temel prensipler PCR ın kullanım alanları


İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler. O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi

İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler. O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi TB solunum yoluyla bulaşan önlenebilir bir hastalıktır Bulaşları


Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya





07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon


Comparative Genomic Hybridization (CGH)

Comparative Genomic Hybridization (CGH) CGH, ARRAY-CGH Comparative Genomic Hybridization (CGH) CGH sitogenetik tekniğini ilk defa, Kallioniemi ve ark. 1992 de Science da yayınlattıkları çalışmaları ile ortaya koydular. Kallioniemi A, Kollioniemi


Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu


Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler


FISH ve in situ melezleme

FISH ve in situ melezleme FISH ve in situ melezleme In situ melezleme belirli bir mrna nın doku içinde nerede bulunduğunu görmemize yarar. Bu metod inceleyenin ilgilendiği mrna nın normal yerini görmesine olanak sağlar. In situ


Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans



KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7


En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı


HAFTA II Mendel Genetiği

HAFTA II Mendel Genetiği GENETĐK 111-503 HAFTA II Mendel Genetiği Doç. Dr. Hilâl Özdağ 1865 Gregor Mendel kalıtım kurallarının temellerini attı. http://www.dnaftb.org/dnaftb/1/concept/ 1 Seçilen Özellikler Hartl DL, Jones EW,


HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:


DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi SEKANS TEKNİKLERİ DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un



HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik





Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak BİYOFİZİK 2015 1 Amaç Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak 2 Hedefler Bu pratiğin sonunda öğrenciler, polimeraz zincir





Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim





DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi


Yard.Doç.Dr.Evrim ÜNSAL. Array CGH Tabanlı PGS: Güncel Durum ve Gelecek Beklentileri

Yard.Doç.Dr.Evrim ÜNSAL. Array CGH Tabanlı PGS: Güncel Durum ve Gelecek Beklentileri Yard.Doç.Dr.Evrim ÜNSAL Array CGH Tabanlı PGS: Güncel Durum ve Gelecek Beklentileri Array CGH tabanlı PGS; Güncel durum ve gelecek beklen0leri Neden PGS Array pla5ormları NGS teknolojisi ve açılımları


C - 01-9cm. Lazer Kesim Dikey / Laser Cut Vertical. Kesim Kodu / Cut Code

C - 01-9cm. Lazer Kesim Dikey / Laser Cut Vertical. Kesim Kodu / Cut Code 107.5 mm 82.5 mm 175 mm 107.5 mm 175 mm Kesim Kodu / Cut Code C - 01-9cm Kesim Kodu / Cut Code C - 01-13cm 127 mm 102 mm 214 mm 127 mm 82.5 mm 214 mm 107.5 mm 82.5 mm 175 mm 107.5 mm 175 mm Kesim Kodu


Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml


Moleküler Dizileme Teknolojileri

Moleküler Dizileme Teknolojileri Moleküler Dizileme Teknolojileri Dr. Güven Toksoy, PhD İstanbul Üniversitesi İstanbul Tıp Fakültesi Tıbbi Genetik AD 31.10.2014 22:44 1 Klasik dizileme Sanger dizileme Maxim Gilbert dizileme tekniği Yeni



ADLİ DNA ANALİZLERİ A N K A R A ADLİ DNA ANALİZLERİ İ B R A HIM S E M İ Z O Ğ LU E K İ M 2 0 1 3 A N K A R A ADLİ BİLİMLER Locard ın değişim prensibi: «Her temas bir iz bırakır.» Locard a göre, suçlu olan kişi bir obje veya kişi ile


INFINITI CYP450 2D6I Testi Kullanım Talimatı

INFINITI CYP450 2D6I Testi Kullanım Talimatı INFINITI CYP450 2D6I Testi Kullanım Talimatı In Vitro Diagnostik Kullanım İçin SADECE İHRACAT İÇİN Üretim Yeri: AutoGenomics, Inc., 2980 Scott Street, Vista, CA USA 92081 Yetkili AB Temsilcisi: BÜHLMANN


YAKIN DOĞU ÜNİVERSİTESİ GENOMİK ANALİZLER. Mahmut Çerkez Ergören, PhD. Uygulamalı Hücre Kültürü Kursu 3-4 Haziran 2016.

YAKIN DOĞU ÜNİVERSİTESİ GENOMİK ANALİZLER. Mahmut Çerkez Ergören, PhD. Uygulamalı Hücre Kültürü Kursu 3-4 Haziran 2016. YAKIN DOĞU ÜNİVERSİTESİ GENOMİK ANALİZLER Mahmut Çerkez Ergören, PhD Uygulamalı Hücre Kültürü Kursu 3-4 Haziran 2016 LeFoşa, KKTC Genomik/ Proteomik Analizler -omiks (ing. omics): Biyolojide çalışılan


Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION


DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Replikasyon genetik materyelin tamamen kendi benzeri yeni bir molekül oluşturma işlemidir. DNA kendini eşleyebilen yegane biyomoleküldür


SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006 SEKANS TEKNİKLERİ GENOMİK-PROTEOMİK Ders Sorumlusu: Doç.Dr. Hatice MERGEN Hazırlayan: Levent ZORBEK Ankara,2006 DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem;


Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2


Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.


Bayiliklerimiz. at your side. ThyriCon SPA. SapiSelco. 0850 304 46 68 info@ankamuh.com www.ankamuh.com

Bayiliklerimiz. at your side. ThyriCon SPA. SapiSelco. 0850 304 46 68 info@ankamuh.com www.ankamuh.com MART 2015 61 Bayiliklerimiz at your side SPA ThyriCon SapiSelco 0850 304 46 68 info@ankamuh.com www.ankamuh.com Hemen Teklif İsteyin 08503044668 ANKA ELK.ELEKT.MÜH.SAN.TİC.LTD.ȘTİ. PERPA TİC.MERK. A BLOK


Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi


DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8 DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS BİYOİNFORMATİĞE GİRİŞ BTEC 513 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce


KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A

KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A KULLANIM KILAVUZU LCD Array Kit Süt ID 2.0 Customized LCD-Array Kit Kod: A-850-12 1) Giriş: Bu dizi süt ve süt ürünlerinde hayvan DNA'sının hızlı, kolay ve güvenilir tanımlaması için geliştirilmiştir.






SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler



GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU DOKTORA DERS KATALOĞU ERCİYES ÜNİVERSİTESİ GDM 638 Lipid Kimyası Zorunlu DERS SAATİ: 3 Bahar Yrd. Doç. Dr. Hasan YALÇIN KREDİSİ :3 Tel:(352) 4374901 (32731), E-mail: hyalcin@erciyes.edu.tr, Web sayfası






MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite





RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500



BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür


Tüberkülozun Mikrobiyolojik Tanısı. Süheyla SÜRÜCÜOĞLU

Tüberkülozun Mikrobiyolojik Tanısı. Süheyla SÜRÜCÜOĞLU Tüberkülozun Mikrobiyolojik Tanısı Süheyla SÜRÜCÜOĞLU Tüberkülozun etkin kontrolü için; Yayma sonuçları Kültür ve identifikasyon Duyarlılık testleri ; 24 saat ; 21 gün ; 30 günde bildirilmeli CDC, 1995


microarray teknolojisi

microarray teknolojisi microarray teknolojisi ekolojik ve evrimsel çalışmalarda kullanımı Kahraman İpekdal microarray nedir? DNA microarray i (gen çipi, DNA çipi ya da biyoçip olarak da bilinir) ekspresyon profili oluşturmak,


Yedek Uçlar Geniş bir uygulama alanı Mobil sıkma aleti güç konnektörleri, koaksiyel, fiber optik ve modüler konnektörler dahil geniş bir dizi uygulama için sıkma uçlarına sahiptir. Bunlar karıştırma riskini


Moleküler Biyolojide Kullanılan Yöntemler-5

Moleküler Biyolojide Kullanılan Yöntemler-5 Moleküler Biyolojide Kullanılan Yöntemler-5 Polimeraz zincir reaksiyonu (PCR) (DNA nın in vitro çoğaltılması) 2 Hücrede doğal olarak (in vivo)gerçekleşen replikasyon, in vitro koşullarda da (hücre dışında)



KAYAŞEHİR 18. BÖLGE 2. ETAP KURALI SATIŞTAKİ BAĞIMSIZ BÖLÜMLER KAYAŞEHİR 18. BÖLGE 2. ETAP KURALI TAKİ BÖLÜMLER ENDEKSİ KDV KAT 1 342365 1 Standart Konut 2 MMA Endeks 1 201534236500880T0003 880 2 A2 ZEMİN 1 2+1 77 64,65 GB 169.935 15 25.490 96 1.505 20 33.987 108


DNA Teknolojisi ve Genomikler

DNA Teknolojisi ve Genomikler DNA eknolojisi ve enomikler PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero enel Bakış: enomların anlaşılması ve manüple edilmesi Modern bilimin en


Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL


KRAS Mutasyon Tespit Kiti Teknik Şartnamesi

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi KRAS Mutasyon Tespit Kiti Teknik Şartnamesi 1. KRAS testi ile insan KRAS geninin kodon 12, kodon 13 ve kodon 61 deki mutasyonlarının kantitatif ölçümü 2. Yöntem dizi analizine dayalı pyrosequencing metodu


REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Yrd. Doç. Dr. Umut Fahrioğlu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü


Differential Display. Özgür Çakır

Differential Display. Özgür Çakır Differential Display Özgür Çakır Differential gen anlatımı Gelişmeye bağlı gen anlatımı değişiklikleri Ortam uyaranları ile gen anlatımı değişimleri Doku veya hücreye özel gen anlatımları Farklı anlatım





α1-antitrypsin quicktype

α1-antitrypsin quicktype attomol α1-antitrypsin quicktype İnsan α-1 antitripsin gen inde M-, Z- and S-alellerin tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! Z-mutasyonun tespiti için 10 sipariş numarası:



PROTEİN ÇİPLERİ MUSTAFA UZUN NİSAN 2007 PROTEİN ÇİPLERİ MUSTAFA UZUN NİSAN 2007 İnsanlık tarihinin en büyük ve sonuçları açısından en önemli projelerinden olan İnsan Genom Projesi (human genom project) ile elde edilen veriler,insan oğluna yeni


SOLİT ORGAN TRANSPLANTASYONU ve BK VİRUS ENFEKSİYONLARI Doç. Dr. Derya Mutlu Güçlü immunsupresifler Akut, Kronik rejeksiyon Graft yaşam süresi? Eskiden bilinen veya yeni tanımlanan enfeksiyon etkenleri:


Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen





NRAS Mutasyon Kiti Teknik Şartnamesi

NRAS Mutasyon Kiti Teknik Şartnamesi NRAS Mutasyon Kiti Teknik Şartnamesi 1- Sistem ile PCR ürünlerinden direkt olarak dizi analizi yapılabilmeli, ayrıca cycle sequencing işlemine gerek kalmamalıdır. 2- Sistemde dizinin sentezi ile deteksiyonu


MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı

MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı MERKEZ LABORATUVAR Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı Yüksek Performans Sıvı Kromatografisi (HPLC) Karbonhidratların, organik asitlerin, vitaminlerin, amino asitlerin


DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon


Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β


GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ GENOM PROJELERĐ Doç. Dr. Hilâl Özdağ Genom Projeleri Dizileme Klon kütüphaneleri Stratejiler Genom Dizilemesi Tekrar eden DNA dizileri Biraraya getirme (Assembly) PHRAP, PHRED,CONSED Bitiş Boşlukların



YENİ BAYİLİKLERİMİZ BAYİLİKLERİMİZ A BAYİİ YETKİLİ ANKA AN YENİ BAYİLİKLERİMİZ BAYİLİKLERİMİZ A BAYİİ (Kwik Stepper) Punch Setleri ve Hidrolik Üniteler Dairesel Punchlar Kare Punchlar 58 50366912 50356119SET 50319981 50600192 50360183 50344102



SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm





BIONEER ExiCycler 96 REAL TIME PCR CİHAZI. Gradient Real Time PCR Cihazı. Kullanım Amacı. Uygulama Alanları. Temel Teknik Özellikler

BIONEER ExiCycler 96 REAL TIME PCR CİHAZI. Gradient Real Time PCR Cihazı. Kullanım Amacı. Uygulama Alanları. Temel Teknik Özellikler REAL TIME PCR CİHAZI BIONEER ExiCycler 96 Gradient Real Time PCR Cihazı Cihaz, gerçek zamanlı PCR (Polimeraz Zincir Reaksiyonu) yöntemi ile DNA ve RNA nın Amplifikasyonu (çoğaltılması) ve analiz edilmesi



KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA ET ÜRÜNLERİNDE TAĞŞİŞ Tağşiş; gıda maddesinin mevzuata veya izin verilen özelliklerine aykırı olarak üretilmesi hali olarak tanımlanmaktadır. Gıda ürünlerinde; tağşiş bir çok şekilde yapılabilmektedir.


HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine


İşlevsel Genomik Nedir?

İşlevsel Genomik Nedir? İşlevsel Genomik Nedir? İşlevsel Genomik, yapısal genomik tarafından sağlanan bileşenlerin ve bilginin kullanımı ile gen işlevinin değerlendirilmesinde, deneysel yaklaşımların (genom veya sistem boyunca)





J Popul Ther Clin Pharmacol 8:e257-e260;2011



C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi


Marmara Üniversitesi Tıp Fakültesi, Hematoloji-İmmünoloji Bölümü

Marmara Üniversitesi Tıp Fakültesi, Hematoloji-İmmünoloji Bölümü AKIM SİTOMETRİK PANEL REAKTİF ANTİKOR TAYİNİ Dr. Emel Ekşioğlu-Demiralp, 2010 Marmara Üniversitesi Tıp Fakültesi, Hematoloji-İmmünoloji Bölümü PRA Saptama Böbrek Nakli Öncesi 1. Herhangi bir antikor var
