DNA Mikroarrayler: SNP analizleri

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "DNA Mikroarrayler: SNP analizleri"

Transkript

1 Hafta IX Genombilimde Mikrodizin Uygulamaları ve iyoinformatik Analiz DNA Mikroarrayler: SNP analizleri Doç. Dr. Hilâl Özdağ

2 DNA Mikrodizin Genomik Dizi SNP 5 T / G 3 SNP prob = 25 baz Perfect Match Mismatch Allel A Perfect Match Mismatch Allel

3 DNA Mikrodizin SNP C / A TAGCCATCGGTA N GTA C TCAATGATCAGCT ATCGGTAGCCAT G ATCGGTAGCCAT C CAT G AGTTACTA CAT G AGTTACTA PM Allel MM Allel A A ATCGGTAGCCAT T ATCGGTAGCCAT A CAT G AGTTACTA CAT G AGTTACTA PM Allel MM Allel

4 DNA Mikrodizin PM A MM PM MM A Prob Çift Seti (Kuartet) SNP başına 56 olasılık Oryantasyon başına 28 Dağıtılmış yerleşim Düz zincir 5 3 PM A MM PM MM A 3 5 Ters zincir

5 DNA Mikrodizin PMA PMA PMA PMA PMA PMA PMA MMA MMA MMA MMA MMA MMA MMA PM PM PM PM PM PM PM MM MM MM MM MM MM MM 14 kuartet değerlendirilip en iyi 10 tanesi herbir TNP yi temsil etmek üzere seçilir. Seçilen bu 10 kuartet herbir TNP nin varlığını hem düz hem de ters zincirde inceler. Tek bir TNP yi sorgulamak üzere toplam 40 prob kullanılmaktadır.

6 Tek Primer Amplifikasyonu ile Karmaşıklığın Ortadan Kaldırılması

7 DNA Mikrodizin 250 ng Genomik DNA Xba Xba Xba RE muamelesi Tek primer ile amplifikasyon Adaptörün bağlanması 4 PCR Reaksiyonu Fragmentasyon ve işaretleme Hibridizasyon Ve Tarama

8 DNA Mikrodizin Mikrosatellit 10K # Marker ,000 Çözünürlülük 10 cm (10 M) 1 cm (1 M) * # PCR Reak/örnek 200 (2x multipleks) 4 # PCR Primer/örnek Süre (400 örnek) > 8 hafta 4-6 hafta elirteç başına DNA Deney başına DNA 40 ng 16,000 ng.025 ng 250 ng

9 DNA Mikrodizin Farklılıklar 100k 10K Dizin sayısı 2 1 Enzim sayısı 2: Xba1 ve HindIII 1: Xba aşlangıç DNA miktarı 250 ng X2 enzim = 500 ng 250 ng PCR Amplifikasyon oyutu bp bp Fragmente edilecek miktar 40ug 20ug Tarama Yüksek çözünülürlüklü tarama Rutin tarama Fragmentasyon reaktifinin konsantrasyonu 0.06U/uL 0.048U/uL Algoritma ve yazılım DM Algoritma ve GTT MPAM ve GDAS 2.0 Ana uygulama alanı Asosiyasyon çalışmaları ağlantı TNP ler Perlegen ve Kamu Kamu

10 DNA Mikrodizin

11 DNA Mikrodizin

12 DNA Mikrodizin

13 DNA Mikrodizin <> <>

14 Resequencing Tiling Strategy A ATCGGTAGCCATACATGAGTTACTA T ATCGGTAGCCATTCATGAGTTACTA 12 bases C ATCGGTAGCCATCCATGAGTTACTA ATCGGTAGCCATGCATGAGTTACTA G ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT TAGCCATCGGTAGGTACTCAATGAT A TAGCCATCGGTACGTACTCAATGAT T TAGCCATCGGTATGTACTCAATGAT C TAGCCATCGGTAAGTACTCAATGAT G CAGCT GTCGA

15 Resequencing Tiling Strategy TCGGTAGCCATGAATGAGTTACTAC TCGGTAGCCATGCATGAGTTACTAC TCGGTAGCCATGGATGAGTTACTAC TCGGTAGCCATGTATGAGTTACTAC ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT AGCCATCGGTAGATACTCAATGATG AGCCATCGGTAGCTACTCAATGATG AGCCATCGGTAGGTACTCAATGATG AGCCATCGGTAGTTACTCAATGATG CAGCT GTCGA

16 Resequencing Tiling Strategy CGGTAGCCATGCATGAGTTACTACA CGGTAGCCATGCCTGAGTTACTACA CGGTAGCCATGCGTGAGTTACTACA CGGTAGCCATGCTTGAGTTACTACA ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT GCCATCGGTACGAACTCAATGATGT GCCATCGGTACGCACTCAATGATGT GCCATCGGTACGGACTCAATGATGT GCCATCGGTACGTACTCAATGATGT CAGCT GTCGA

17 Resequencing Tiling Strategy GGTAGCCATGCAAGAGTTACTACAG GGTAGCCATGCACGAGTTACTACAG GGTAGCCATGCAGGAGTTACTACAG GGTAGCCATGCATGAGTTACTACAG ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT CAGCT GTCGA CCATCGGTACGTACTCAATGATGTC CCATCGGTACGTCCTCAATGATGTC CCATCGGTACGTGCTCAATGATGTC CCATCGGTACGTTCTCAATGATGTC

18 Resequencing Tiling Strategy GTAGCCATGCATAAGTTACTACAGC GTAGCCATGCATCAGTTACTACAGC GTAGCCATGCATGAGTTACTACAGC GTAGCCATGCATTAGTTACTACAGC ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT CAGCT GTCGA CATCGGTACGTAATCAATGATGTCG CATCGGTACGTACTCAATGATGTCG CATCGGTACGTAGTCAATGATGTCG CATCGGTACGTATTCAATGATGTCG

19 Resequencing Tiling Strategy TAGCCATGCATGAGTTACTACAGCT TAGCCATGCATGCGTTACTACAGCT TAGCCATGCATGGGTTACTACAGCT TAGCCATGCATGTGTTACTACAGCT ATCGGTAGCCATGCATGAGTTACTA TAGCCATCGGTACGTACTCAATGAT CAGCT GTCGA ATCGGTACGTACACAATGATGTCGA ATCGGTACGTACCCAATGATGTCGA ATCGGTACGTACGCAATGATGTCGA ATCGGTACGTATTCAATGATGTCGA

20 A Düz zincir C G T T C G C A

21 CustomSeq Resequencing Dizinleri AGCGT ACCGT A C G T A C G T Çip başına 30 kb çift zincirli DNA dizilimi okunabiliyor. Toplam 60 kb.

22 CustomSeq Deney Protokolü Kontrol Kalıp/Primerler Genomik DNA Kısa Ölçekli PCR Uzun Ölçekli PCR Miktar tayini-örneklerin Karıştırılması Fragmentasyon reaktifi Fragment Đşaret Hibridizasyon için oligo kontrolleri Hibridizasyon Veri analizi

23 Deney Akışı Đlgilenilen genlerin belirlenmesi Karıştırma ve Fragmentasyonasyon DNA fragmentleri Genomik DNA PCR Ürünleri Đşaretleme Geceboyu hibridizasyon Tarama Yıkama Đstasyonu: Yıkama/oyama Sondan işaretli fragmentler

24 Affymetrix CustomSeq Arrays iological Sample Probe Array 2.5 Days Wash & Stain >chr21: gtggcatgatcttggctcactgcagttcaagcaattctcctgccttagc cccctgagtagctgggattacaggtgcctgctaccaccctcagctaat tttttgtatttttaatagagacggggtttcaccatgttggccaggctggtc tcgaactcctgacctcgtgattcgtctgcctcggccttccaaagtgctg ggagtacaggcatgagccaccgcacccggcctgtatatcttttttaaa aggaaaagaacatatcccagaagtttccaactgagtttccctctgggt caataccagaattgggtgggggtcttcagctcacccctaaactcatca ttgataagcagaatgaatgaccatggctggtttagaca. Scan ~30 Kb

25 DNA Analiz Yazılımı Cihaz Kontrolü.DAT dosyasının oluşturulması GCOS.CEL dosyasının oluşturulması.chp dosyasının oluşturulması.chp veri karşılaştırılması GeneChip DNA Analysis Software 2.0 (GDAS)

GENETĐK OMĐK TEKNOLOJĐLERĐ. Doç. Dr. Hilâl Özdağ D N A

GENETĐK OMĐK TEKNOLOJĐLERĐ. Doç. Dr. Hilâl Özdağ D N A GENETĐK 111-503 OMĐK TEKNOLOJĐLERĐ Doç. Dr. Hilâl Özdağ D N A 1 Mammals Other chordates Other eukaryotes Homo sapiens [NCI 35] browse what's new Vega Gallus gallus [WASHUC1] browse what's new Drosophila

Detaylı

Genetikten Genombilime Geçişte Transkriptom Analizleri

Genetikten Genombilime Geçişte Transkriptom Analizleri Genetikten Genombilime Geçişte Transkriptom Analizleri Doç.Dr. Hilâl Özdağ AÜ iyoteknoloji Enstitüsü Mammals Other chordates Other eukaryotes Homo sapiens [NCI 35] Vega Gallus gallus [WASHUC1] Drosophila

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

1. HP PCR Template Preparation DNA isolation Kit özellikler

1. HP PCR Template Preparation DNA isolation Kit özellikler Genel Şartlar: 1. Teklif edilen kitler, orjinal ambalajında olmalıdır. Kitlerin ve kutuların içindeki reaktiflerin/sarf malzemelerin üzerinde üretici firma adı, testin adı, test sayısı, son kullanma tarihi

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

İ Ö Ö Ü Ü İ İ İ Ç İ «Ö Ç İ İ Ö İ Ç Ç Ç İ Ö İ İ Ü Ü Ç Ğ Ö Ç Ü Ğ Ö İ Ç Ü Ü Ü Ü Ü Ç İ İ İ Ö Ö Ç Ç İ Ç Ü İ İ Ç Ç Ç Ç Ö Ö Ç Ü Ö Ç Ç Ö Ö Ö Ö Ö Ö ÜĞ Ü Ö Ç Ç İ Ç Ç İ İ Ü Ö Ç Ç İ

Detaylı

ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı

ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ı ü Ğ Ğ ş üş ü ş ğ ş ü ğ ş ü ç Ö Ö Ü ü ü ş Ş ğ ş Ü üç ü ü ü ü ş ç ş ğ üş ğ ü ü ü ş ş ü ş ğ ç ş ğ ğ ş ş ş ü ü ü ğ ü ü ü üç ğ ü ç ş ü ğ Ç ğ ç ş ü ü ü ğ ü ğ ü Ü ü ü Ö ç ü ü ü üğ ş ş ç ğ ç ü ü ü üğ ş ş ç ğ ü

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı MIKROARRAY TEKNOLOJİSİ Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı 2602040083 vshancer@yahoo.com EŞ ANLAMLILAR Biochip DNA chip DNA microarray Gene array 2 Neden bu teknolojiye ihtiyaç

Detaylı

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

KAYAŞEHİR 18. BÖLGE 1. ETAP KURALI SATIŞTAKİ BAĞIMSIZ BÖLÜMLER

KAYAŞEHİR 18. BÖLGE 1. ETAP KURALI SATIŞTAKİ BAĞIMSIZ BÖLÜMLER GRUBU KAT 1 342362 1 Standart Konut 2 MMA Endeks 1 201534236200880T4006 880 3 B1 ZEMİN 1 1+1 66,82 55,7 GD 154.447 15 23.167 96 1.368 20 30.889 108 1.144 25 38.612 120 965 40 61.779 120 772 2 342362 1

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

HIZLI YÖNTEMLER (III)

HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla

Detaylı

Microarray Teknolojisi

Microarray Teknolojisi Microarray Teknolojisi Evrimsel ve Ekolojik Çalışmalarda Kullanımı K. İpekdal Proteomik ve Genomik 2006 A. Microarray Teknolojisi Son 10 yılda pek çok model sistem hazırlanırken organizmadan büyük miktarlarda

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı

Polimeraz Zincir Reaksiyonu. Mikrobiyoloji Anabilim Dalı 4. Ha&a Polimeraz Zincir Reaksiyonu Mikrobiyoloji Anabilim Dalı Sunu içeriği PCR ın tanımı PCR ın kısa tarihçesi Hücre içi DNA replikasyonu PCR bileşenleri PCR temel prensipler PCR ın kullanım alanları

Detaylı

İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler. O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi

İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler. O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi İlaç Direncinin Saptanmasında Güncel Moleküler Yöntemler O. Kaya Köksalan Deneysel Tıp Araştırma Enstitüsü (DETAE) İstanbul Üniversitesi TB solunum yoluyla bulaşan önlenebilir bir hastalıktır Bulaşları

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

BİO 775 PROTEOMİK ve GENOMİK

BİO 775 PROTEOMİK ve GENOMİK 1 BİO 775 PROTEOMİK ve GENOMİK SEQUENCE TAGGED SITES (STSs) EXPRESSED SEQUENCE TAG (ESTs) S. Esin SELÇUK 2006 2 SEQUENCE TAGGED SITES (STSs) STS; genomda 200-300 baz uzunluğundaki kısa bir bölgedir ve

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

Comparative Genomic Hybridization (CGH)

Comparative Genomic Hybridization (CGH) CGH, ARRAY-CGH Comparative Genomic Hybridization (CGH) CGH sitogenetik tekniğini ilk defa, Kallioniemi ve ark. 1992 de Science da yayınlattıkları çalışmaları ile ortaya koydular. Kallioniemi A, Kollioniemi

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

FISH ve in situ melezleme

FISH ve in situ melezleme FISH ve in situ melezleme In situ melezleme belirli bir mrna nın doku içinde nerede bulunduğunu görmemize yarar. Bu metod inceleyenin ilgilendiği mrna nın normal yerini görmesine olanak sağlar. In situ

Detaylı

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER I DNA POLİMORFİZMİNİN MOLEKÜLER MARKER LARLA ANALİZİ DNA Polimorfizminin tanımlanması Bireyler arasındaki genetik farklılıkların belirlenmesini sağlar. Polimorfizm

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

HAFTA II Mendel Genetiği

HAFTA II Mendel Genetiği GENETĐK 111-503 HAFTA II Mendel Genetiği Doç. Dr. Hilâl Özdağ 1865 Gregor Mendel kalıtım kurallarının temellerini attı. http://www.dnaftb.org/dnaftb/1/concept/ 1 Seçilen Özellikler Hartl DL, Jones EW,

Detaylı

QIAsymphony DSP Dolaşan DNA Kiti

QIAsymphony DSP Dolaşan DNA Kiti QIAsymphony DSP Dolaşan DNA Kiti Şubat 2017 Performans Özellikleri 937556 Sample to Insight İçindekiler Performans Özellikleri... 4 Temel performans... 4 Çalışma kesinliği... 5 2 ml ve 4 ml protokollerinin

Detaylı

HAFTA III Bağlantı, Asosiyasyon, Haritalama

HAFTA III Bağlantı, Asosiyasyon, Haritalama Biyoteknoloji ve Genetik I HAFTA III Bağlantı, Asosiyasyon, Haritalama Prof. Dr. Hilâl Özdağ T.H. Morgan ve A.H. Sturtevant 1911 Morgan ın soruları: 1. Gen ayrılmasının kaynağı nedir? Janssens ve ark:

Detaylı

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi SEKANS TEKNİKLERİ DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

NÜKLEİK ASİTLERİN ELEKTROFOREZİ

NÜKLEİK ASİTLERİN ELEKTROFOREZİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ NÜKLEİK ASİTLERİN ELEKTROFOREZİ Yüksek Lisans Semineri Hazırlayan: Venhar ÇELİK Danışman: Yrd.Doç.Dr. Dilek Turgut-BALIK NÜKLEİK ASİTLERİN

Detaylı

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak BİYOFİZİK 2015 1 Amaç Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak 2 Hedefler Bu pratiğin sonunda öğrenciler, polimeraz zincir

Detaylı

KOLOREKTAL KARSİNOMA VE ÖNCÜ LEZYONLARINDA MİKROSATELLİT İNSTABİLİTESİNİN İMMÜNHİSTOKİMYASAL OLARAK DEĞERLENDİRİLMESİ

KOLOREKTAL KARSİNOMA VE ÖNCÜ LEZYONLARINDA MİKROSATELLİT İNSTABİLİTESİNİN İMMÜNHİSTOKİMYASAL OLARAK DEĞERLENDİRİLMESİ KOLOREKTAL KARSİNOMA VE ÖNCÜ LEZYONLARINDA MİKROSATELLİT İNSTABİLİTESİNİN İMMÜNHİSTOKİMYASAL OLARAK DEĞERLENDİRİLMESİ Seher YÜKSEL 1, Berna SAVAŞ 2, Elçin KADAN 3, Arzu ENSARİ 2, Nazmiye KURŞUN 4 1 Gümüşhane

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

MEME KARSİNOMUNDA HER2/NEU DURUMUNU DEĞERLENDİRMEDE ALTERNATİF YÖNTEM: REAL TİME-PCR

MEME KARSİNOMUNDA HER2/NEU DURUMUNU DEĞERLENDİRMEDE ALTERNATİF YÖNTEM: REAL TİME-PCR MEME KARSİNOMUNDA HER2/NEU DURUMUNU DEĞERLENDİRMEDE ALTERNATİF YÖNTEM: REAL TİME-PCR Nuket Eliyatkın Hakan Özgür Pınar Erçetin Safiye Aktaş Ali Küpelioğlu Sunum Planı Meme Kanserinde HER2 nin yeri HER2

Detaylı

C - 01-9cm. Lazer Kesim Dikey / Laser Cut Vertical. Kesim Kodu / Cut Code

C - 01-9cm. Lazer Kesim Dikey / Laser Cut Vertical. Kesim Kodu / Cut Code 107.5 mm 82.5 mm 175 mm 107.5 mm 175 mm Kesim Kodu / Cut Code C - 01-9cm Kesim Kodu / Cut Code C - 01-13cm 127 mm 102 mm 214 mm 127 mm 82.5 mm 214 mm 107.5 mm 82.5 mm 175 mm 107.5 mm 175 mm Kesim Kodu

Detaylı

Yard.Doç.Dr.Evrim ÜNSAL. Array CGH Tabanlı PGS: Güncel Durum ve Gelecek Beklentileri

Yard.Doç.Dr.Evrim ÜNSAL. Array CGH Tabanlı PGS: Güncel Durum ve Gelecek Beklentileri Yard.Doç.Dr.Evrim ÜNSAL Array CGH Tabanlı PGS: Güncel Durum ve Gelecek Beklentileri Array CGH tabanlı PGS; Güncel durum ve gelecek beklen0leri Neden PGS Array pla5ormları NGS teknolojisi ve açılımları

Detaylı

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml

Detaylı

ADLİ DNA ANALİZLERİ A N K A R A

ADLİ DNA ANALİZLERİ A N K A R A ADLİ DNA ANALİZLERİ İ B R A HIM S E M İ Z O Ğ LU E K İ M 2 0 1 3 A N K A R A ADLİ BİLİMLER Locard ın değişim prensibi: «Her temas bir iz bırakır.» Locard a göre, suçlu olan kişi bir obje veya kişi ile

Detaylı

Moleküler Dizileme Teknolojileri

Moleküler Dizileme Teknolojileri Moleküler Dizileme Teknolojileri Dr. Güven Toksoy, PhD İstanbul Üniversitesi İstanbul Tıp Fakültesi Tıbbi Genetik AD 31.10.2014 22:44 1 Klasik dizileme Sanger dizileme Maxim Gilbert dizileme tekniği Yeni

Detaylı

artus BK Virus QS-RGQ Kit

artus BK Virus QS-RGQ Kit artus BK Virus QS-RGQ Kit Performans Özellikleri artus BK Virus QS-RGQ Kit, Versiyon 1, 4514363 Testi gerçekleştirmeden önce www.qiagen.com/products/artusbkvirusrgpcrkit.aspx adresinde yeni elektronik

Detaylı

INFINITI CYP450 2D6I Testi Kullanım Talimatı

INFINITI CYP450 2D6I Testi Kullanım Talimatı INFINITI CYP450 2D6I Testi Kullanım Talimatı In Vitro Diagnostik Kullanım İçin SADECE İHRACAT İÇİN Üretim Yeri: AutoGenomics, Inc., 2980 Scott Street, Vista, CA USA 92081 Yetkili AB Temsilcisi: BÜHLMANN

Detaylı

YAKIN DOĞU ÜNİVERSİTESİ GENOMİK ANALİZLER. Mahmut Çerkez Ergören, PhD. Uygulamalı Hücre Kültürü Kursu 3-4 Haziran 2016.

YAKIN DOĞU ÜNİVERSİTESİ GENOMİK ANALİZLER. Mahmut Çerkez Ergören, PhD. Uygulamalı Hücre Kültürü Kursu 3-4 Haziran 2016. YAKIN DOĞU ÜNİVERSİTESİ GENOMİK ANALİZLER Mahmut Çerkez Ergören, PhD Uygulamalı Hücre Kültürü Kursu 3-4 Haziran 2016 LeFoşa, KKTC Genomik/ Proteomik Analizler -omiks (ing. omics): Biyolojide çalışılan

Detaylı

Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION

Detaylı

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006 SEKANS TEKNİKLERİ GENOMİK-PROTEOMİK Ders Sorumlusu: Doç.Dr. Hatice MERGEN Hazırlayan: Levent ZORBEK Ankara,2006 DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem;

Detaylı

attomol apo B-100 quicktype

attomol apo B-100 quicktype attomol apo B-100 quicktype İnsan apolipoprotein B-100 (apo B-3500 mutasyonu) gen inde 10708G>A geçiş tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1015

Detaylı

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Replikasyon genetik materyelin tamamen kendi benzeri yeni bir molekül oluşturma işlemidir. DNA kendini eşleyebilen yegane biyomoleküldür

Detaylı

Bayiliklerimiz. at your side. ThyriCon SPA. SapiSelco. 0850 304 46 68 info@ankamuh.com www.ankamuh.com

Bayiliklerimiz. at your side. ThyriCon SPA. SapiSelco. 0850 304 46 68 info@ankamuh.com www.ankamuh.com MART 2015 61 Bayiliklerimiz at your side SPA ThyriCon SapiSelco 0850 304 46 68 info@ankamuh.com www.ankamuh.com Hemen Teklif İsteyin 08503044668 ANKA ELK.ELEKT.MÜH.SAN.TİC.LTD.ȘTİ. PERPA TİC.MERK. A BLOK

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.

Detaylı

KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A

KULLANIM KILAVUZU. LCD Array Kit. Süt ID 2.0. Customized LCD-Array Kit. Kod: A KULLANIM KILAVUZU LCD Array Kit Süt ID 2.0 Customized LCD-Array Kit Kod: A-850-12 1) Giriş: Bu dizi süt ve süt ürünlerinde hayvan DNA'sının hızlı, kolay ve güvenilir tanımlaması için geliştirilmiştir.

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8

DERS BİLGİLERİ BTEC 513 1-2 3 + 0 3 8 DERS BİLGİLERİ Ders Kodu Yarıyıl T+U Saat Kredi AKTS BİYOİNFORMATİĞE GİRİŞ BTEC 513 1-2 3 + 0 3 8 Ön Koşul Dersleri YOK Dersin Dili Dersin Seviyesi Dersin Türü Dersin Koordinatörü Dersi Verenler İngilizce

Detaylı

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI

TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI TÜBERKÜLOZ DIŞI MİKOBAKTERİLERİN TANIMLANMASINDA PCR-RFLP VE DNA SEKANS ANALİZİ SONUÇLARININ KARŞILAŞTIRILMASI Uzm. Dr. Özgür APPAK Dokuz Eylül Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D GİRİŞ:

Detaylı

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ

PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ PREİMPLANTASYON GENETİK TANIDA KULLANILAN YÖNTEMLER ve ÖNEMİ Yrd. Doç. Dr. Hakan GÜRKAN Trakya Üniversitesi Tıp Fakültesi Tıbbi Genetik Anabilim Dalı PGT NEDİR? Gebelik öncesi genetik tanı (PGT) adı verilen

Detaylı

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU

GIDA MÜHENDİSLİĞİ BÖLÜMÜ DOKTORA DERS KATALOĞU DOKTORA DERS KATALOĞU ERCİYES ÜNİVERSİTESİ GDM 638 Lipid Kimyası Zorunlu DERS SAATİ: 3 Bahar Yrd. Doç. Dr. Hasan YALÇIN KREDİSİ :3 Tel:(352) 4374901 (32731), E-mail: hyalcin@erciyes.edu.tr, Web sayfası

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite

Detaylı

BAKTERİLERİN GENETİK KARAKTERLERİ

BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür

Detaylı

RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500

Detaylı

Tüberkülozun Mikrobiyolojik Tanısı. Süheyla SÜRÜCÜOĞLU

Tüberkülozun Mikrobiyolojik Tanısı. Süheyla SÜRÜCÜOĞLU Tüberkülozun Mikrobiyolojik Tanısı Süheyla SÜRÜCÜOĞLU Tüberkülozun etkin kontrolü için; Yayma sonuçları Kültür ve identifikasyon Duyarlılık testleri ; 24 saat ; 21 gün ; 30 günde bildirilmeli CDC, 1995

Detaylı

Yedek Uçlar Geniş bir uygulama alanı Mobil sıkma aleti güç konnektörleri, koaksiyel, fiber optik ve modüler konnektörler dahil geniş bir dizi uygulama için sıkma uçlarına sahiptir. Bunlar karıştırma riskini

Detaylı

attomol lactose intolerance C>T quicktype

attomol lactose intolerance C>T quicktype attomol lactose intolerance -13910C>T quicktype İnsan laktase-genine karşı -13910C>T geçiş tespitine yönelik mutasyon testi Sadece in vitro diagnostik kullanım içindir! 20 tespit sipariş numarası: 1045

Detaylı

microarray teknolojisi

microarray teknolojisi microarray teknolojisi ekolojik ve evrimsel çalışmalarda kullanımı Kahraman İpekdal microarray nedir? DNA microarray i (gen çipi, DNA çipi ya da biyoçip olarak da bilinir) ekspresyon profili oluşturmak,

Detaylı

Moleküler Biyolojide Kullanılan Yöntemler-5

Moleküler Biyolojide Kullanılan Yöntemler-5 Moleküler Biyolojide Kullanılan Yöntemler-5 Polimeraz zincir reaksiyonu (PCR) (DNA nın in vitro çoğaltılması) 2 Hücrede doğal olarak (in vivo)gerçekleşen replikasyon, in vitro koşullarda da (hücre dışında)

Detaylı

KAYAŞEHİR 18. BÖLGE 2. ETAP KURALI SATIŞTAKİ BAĞIMSIZ BÖLÜMLER

KAYAŞEHİR 18. BÖLGE 2. ETAP KURALI SATIŞTAKİ BAĞIMSIZ BÖLÜMLER KAYAŞEHİR 18. BÖLGE 2. ETAP KURALI TAKİ BÖLÜMLER ENDEKSİ KDV KAT 1 342365 1 Standart Konut 2 MMA Endeks 1 201534236500880T0003 880 2 A2 ZEMİN 1 2+1 77 64,65 GB 169.935 15 25.490 96 1.505 20 33.987 108

Detaylı

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL

Detaylı

DNA Teknolojisi ve Genomikler

DNA Teknolojisi ve Genomikler DNA eknolojisi ve enomikler PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero enel Bakış: enomların anlaşılması ve manüple edilmesi Modern bilimin en

Detaylı

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi

Detaylı

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi KRAS Mutasyon Tespit Kiti Teknik Şartnamesi 1. KRAS testi ile insan KRAS geninin kodon 12, kodon 13 ve kodon 61 deki mutasyonlarının kantitatif ölçümü 2. Yöntem dizi analizine dayalı pyrosequencing metodu

Detaylı

attomol HLA-B*27 Sadece in vitro diagnostik kullanım içindir! 1.Giriş 2. Genel Açıklamalar

attomol HLA-B*27 Sadece in vitro diagnostik kullanım içindir! 1.Giriş   2. Genel Açıklamalar attomol HLA-B*27 HLA-B*27 in tespitine yönelik kit (Doku tiplemesi için kullanmayın!) Sadece in vitro diagnostik kullanım içindir! 40 tespit sipariş numarası: 1030 1.Giriş İnsan lökosit antijenleri(hla)

Detaylı

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Yrd. Doç. Dr. Umut Fahrioğlu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü

Detaylı

INFINITI CFTR-31 Testi Kullanım Talimatı

INFINITI CFTR-31 Testi Kullanım Talimatı INFINITI CFTR-31 Testi Kullanım Talimatı In Vıtro Diagnostik Kullanım İçin SADECE İHRACAT İÇİN Üreti Yeri: AutoGenomics, Inc., 2980 Scott Street, Vista, CA USA 92081 Yetkili AB Temsilcisi: BÜHLMANN Laboratories

Detaylı

Differential Display. Özgür Çakır

Differential Display. Özgür Çakır Differential Display Özgür Çakır Differential gen anlatımı Gelişmeye bağlı gen anlatımı değişiklikleri Ortam uyaranları ile gen anlatımı değişimleri Doku veya hücreye özel gen anlatımları Farklı anlatım

Detaylı

α1-antitrypsin quicktype

α1-antitrypsin quicktype attomol α1-antitrypsin quicktype İnsan α-1 antitripsin gen inde M-, Z- and S-alellerin tespitine yönelik kit Sadece in vitro diagnostik kullanım içindir! Z-mutasyonun tespiti için 10 sipariş numarası:

Detaylı

FLORESAN İN SİTU HİBRİDİZASYON

FLORESAN İN SİTU HİBRİDİZASYON FLORESAN İN SİTU HİBRİDİZASYON Sağlık Teknikeri Hande ÇOLAKOĞLU Ege Üniversitesi Tıp Fakültesi Hastanesi Patoloji AD SIVI ve DOKULARIN FISH UYGULAMASI ÖNCESİ HAZIRLIK İŞLEMLERİ FISH Çalışmalarında Ön Uygulama

Detaylı

Performans Özellikleri

Performans Özellikleri Performans Özellikleri QIAamp DSP DNA FFPE Tissue Kiti, Sürüm 1 60404 Sürüm yönetimi Bu belge, QIAamp DSP DNA FFPE Tissue Kiti Performans Özellikleri, Sürüm 1, R3 belgesidir. Testi gerçekleştirmeden önce

Detaylı

PROTEİN ÇİPLERİ MUSTAFA UZUN NİSAN 2007

PROTEİN ÇİPLERİ MUSTAFA UZUN NİSAN 2007 PROTEİN ÇİPLERİ MUSTAFA UZUN NİSAN 2007 İnsanlık tarihinin en büyük ve sonuçları açısından en önemli projelerinden olan İnsan Genom Projesi (human genom project) ile elde edilen veriler,insan oğluna yeni

Detaylı

SOLİT ORGAN TRANSPLANTASYONU ve BK VİRUS ENFEKSİYONLARI Doç. Dr. Derya Mutlu Güçlü immunsupresifler Akut, Kronik rejeksiyon Graft yaşam süresi? Eskiden bilinen veya yeni tanımlanan enfeksiyon etkenleri:

Detaylı

Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen

Detaylı

Pınar AKALIN Burcu SAYINLI, Ayten Y. KARATAŞ Merkez: Şube: Tel: Web:

Pınar AKALIN Burcu SAYINLI, Ayten Y. KARATAŞ Merkez: Şube: Tel: Web: Pınar AKALIN, Ltd. Şti. Burcu SAYINLI, İstanbul Teknik Üniversitesi Kimya Bölümü Polimer Bilim ve Teknolojisi Ayten Y. KARATAŞ, İstanbul Teknik Üniversitesi Moleküler Biyoloji ve Genetik Bölüm Merkez:

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II. RNA Çalışmaları Transkriptom

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II. RNA Çalışmaları Transkriptom MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II RNA Çalışmaları Transkriptom RNA Bakteri hücresinin %6 sı Memeli hücresinin %1.1 i Total 10-15µg RNA nın RNA dır %80-85 i rrna %15-20 si trna ve nukleusa ait

Detaylı

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II. ( WESTERN BLOTTING (WESTERN EMDİRİMİ) ve İMMÜNODETEKSİYON

MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II. ( WESTERN BLOTTING (WESTERN EMDİRİMİ) ve İMMÜNODETEKSİYON MOLEKÜLER BİYOLOJİDE KULLANILAN YÖNTEMLER II ( WESTERN BLOTTING (WESTERN EMDİRİMİ) ve İMMÜNODETEKSİYON Western blotting: Akrilamit jeldeki protein bantlarının daha kararlı ve sabit bir ortama (örneğin,

Detaylı

MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı

MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı MERKEZ LABORATUVAR Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı Yüksek Performans Sıvı Kromatografisi (HPLC) Karbonhidratların, organik asitlerin, vitaminlerin, amino asitlerin

Detaylı

GENOMİKS & PROTEOMİKS

GENOMİKS & PROTEOMİKS GENOMİKS & PROTEOMİKS VĠZE SONRASI EK NOTLAR Yrd. Doç. Dr. NaĢit ĠĞCĠ GEN İFADE ANALİZLERİ 1 Gen Ġfade Analizleri mrna seviyesinde gen ifade analizleri: Northern blot (Tek gen analizi) qrt-pcr (Tek gen

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

NRAS Mutasyon Kiti Teknik Şartnamesi

NRAS Mutasyon Kiti Teknik Şartnamesi NRAS Mutasyon Kiti Teknik Şartnamesi 1- Sistem ile PCR ürünlerinden direkt olarak dizi analizi yapılabilmeli, ayrıca cycle sequencing işlemine gerek kalmamalıdır. 2- Sistemde dizinin sentezi ile deteksiyonu

Detaylı