SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006"

Transkript

1 SEKANS TEKNİKLERİ GENOMİK-PROTEOMİK Ders Sorumlusu: Doç.Dr. Hatice MERGEN Hazırlayan: Levent ZORBEK Ankara,2006

2 DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un zincir sonlanma yöntemi. (Sanger et al.,1977). a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi b-) Otomatik (Fluoresan İşaretleme) Dizi Analizi

3

4 Sanger-Coulson Zincir Sonlanma Yöntemi DNA dizi analizinde en sık kullanılan yöntem Fred SANGER ve arkadaşlarının geliştirdiği yöntem olan zincir sonlanma yöntemidir (Sanger et al., 1977). Bu yöntem enzimatik DNA sentezine dayanır ve günümüzün en yaygın kullanılan DNA dizi analizi tekniğidir. Bu yöntemde dizisi saptanacak olan DNA ipliği yeni sentezlenecek iplik için kalıp olarak kullanılır. DNA sentezini sağlamak için Klenov, Taq DNA polimeraz, ters transkriptaz ya da sekuenaz enzimlerinden birisi kullanılabilir.

5 Yöntemin temeli DNA polimerazın dntp lerin (deoksiribonükleozit trifosfat) yanısıra deoksiribozun 3 pozisyonunda OH grubu taşımayan ddntp leri de (dideoksiribonükleozit trifosfat) substrat olarak kullanabilmesine dayanır. Sentezlenen DNA ya bir ddntp nin katılması 3 pozisyonunda OH grubu olmadığı için sentezi durdurur.

6 datp ddatp

7 Dizi analizi yapılırken dört ayrı reaksiyon karışımı hazırlanır. Her bir karışım kalıp DNA zinciri, bir primer, dntp lerin dördü ve az miktarda ddntp lerden birini içerir. Özgül zincir sonlanması için her bir reaksiyonda farklı bir ddntp bulunur. Reaksiyonların her birinde çok az miktarda modifiye nükleotit kullanıldığı için yeni zincir sentezi rastgele sonlanarak bir dizi DNA fragmenti meydana gelir (Klug et al., 2000).

8 Reaksiyonlar sonucu elde edilen DNA parçalarına elektroforez uygulanarak jel üzerinde yan yana yürütülür. Uygulanan elektriksel alanın etkisi ile DNA parçacıkları en kısası en önde olmak üzere jel üzerinde bir merdiven görüntüsü oluşturur. İşaretleme yöntemine göre jel üzerinde, tespit edilen parçacıklar reaksiyon karışımına konulan ddntp nin tipine göre okunur (Klug et al., 2000).

9 Sanger-Coulson Zincir Sonlanma Yönteminde Kullanılan Kimyasallar Primerler Sanger-Coulson zincir sonlanma yönteminde istenilen DNA kalıbının çoğaltılması ve dizi analizinin yapılabilmesi için özgül oligonükleotitlere yani primerlere ihtiyaç vardır. Primer çiftleri kullanılacak kalıp DNA nın genomik DNA dan eldesinde, çoğaltılmasında kullanılır. Ayrıca primerler yöntemin son aşaması olan sonlanma reaksiyonunda polimeraz enzimi için uygun 3 ucu sağlar. Her iki reaksiyondaki primer çifti aynı olabileceği gibi farklı primerler de kullanılabilir.

10 Gen bölgesinin elde edilmesinde kullanılan primer çifti dizi analizi yapılacak bölgenin daha dışından seçilip dizi analizi reaksiyonunda kullanılan primer ise bu primerlerin arasında ve dizinin analizi yapılacak bölgesine daha yakın olmalıdır. Sekanslama reaksiyonunda tek bir primer kullanılır ve böylece reaksiyon yönü tayin edilmiş olur (Sambrook et al., 1989).

11 Kalıp DNA Sanger-Coulson zincir sonlanma yönteminde hem çift, hem de tek zincirli DNA kullanılabilir. Yöntemin birinci aşamasında polimeraz zincir reaksiyonu (Polymerase Chain Reaction, PCR) tekniği ile elde edilen ve çoğaltılan DNA parçası kalıp DNA olarak adlandırılır. PCR ürünü kalıp DNA, önce reaksiyon artıklarından arındırılmalıdır. Bu çok özen gösterilmesi gereken bir aşamadır. Eğer kalıp DNA yeterince temizlenemezse bir sonraki sonlanma reaksiyonuna aktarılacak olan kimyasallar ile primer artıkları reaksiyonun hassasiyetini bozacaktır (Sambrook et al., 1989).

12 Enzimler Sanger-Coulson zincir sonlanma yönteminde bir çok tipde DNA polimeraz enzimi kullanılabilmektedir. Bu enzimlerin ortak özellikleri özgül ve hassas olmalarıdır.

13 E.coli Klenow Fragmenti DNA Polimeraz I İlk geliştirilen yöntemde kullanılan bu enzimin iki büyük dezavantajı vardır. Birincisi enzimin kontrolsüz olarak çoğaltma reaksiyonlarını yarıda kesmesidir. Özellikle uzun okumalarda bu problem iyice belirginleşmektedir. İkincisi enzimin homopolimerik bölgeler ile ikincil yapısı kuvvetli olan bölgelerde istenilen verimde çalışmamasıdır (Sambrook et al., 1989).

14 Reverse Transcriptase Reverse transcriptase enziminin her ne kadar çok yaygın bir kullanım alanı olmasa da özellikle homopolimerik bölgelerde etkin çözüm verir. Enzim özellikle bu tip bölgelerde Klenow fragmentinden daha etkin ve kullanışlıdır (Sambrook et al., 1989).

15 Sequenase Enzimleri Sequenase enzimleri T7 bakteriofajın dan elde edilirler. Enzimin 3-5 ekzonükleaz aktivitesi inhibe edilmiştir. İnhibe edilen bu özelliği sayesinde enzim tek yönlü ve hızlı çalışır. Kalıp DNA nın uzun olduğu deneylerde yüksek özgül aktivitesi ve dayanıklılığı ile tercih edilir (Sambrook et al., 1989).

16 Taq DNA Polimeraz Özellikle tek zincirli DNA dizisinin saptanmasında tercih edilir. Sıcağa dayanıklı olduğu için yaygın kullanılan enzim türüdür. Özellikle 95 0 C da aktif olması nedeni ile homopolimerik bölgelerde bile çok etkindir (Sambrook et al., 1989).

17 Manuel DNA Dizi Analizi Sekans reaksiyonu kullanılarak zincir sonlandırma metodu uygulanır (Sanger et al., 1977). Örnekler %6 lık denatüre edici poliakrilamid jelde ayrıştırılarak, otoradyografi ile görüntülenir. Çalışılan gen amplifiye edildikten sonra enzimatik ön muamele yapılır. Bu amaçla hidrolitik enzimler (alkalin fosfataz ve ekzonükleaz I ) kullanılır. Ekzonükleaz I ortamdaki tek zincirli DNA iplikciklerini, alkalin fosfataz ise dntp leri uzaklaştırarak, dizi reaksiyonu için kullanılacak amplifikasyon ürününün temizlenmesini sağlar. İşlem tamamlandıktan sonra enzimleri inaktive etmek için, örnek karışımı 80 0 C da 15' bekletilir.

18 Primer tutunma reaksiyonu Temizlenmiş amplifikasyon ürünü üzerine primer ilave edilir. Karışım C da inkübe edildikten sonra, önce buzlu su içinde, sonra buzda bekletilir. Örneğin bu şekilde kademeli olarak soğutulması, kalıp katlanmasını ve primerlerin kendi aralarında eşleşmesini önler.

19 İşaretleme reaksiyonu İşaretleme reaksiyonu için dört farklı tüp hazırlanır. Her bir tüp dört çeşit dntp nin yanısıra bir ddntp içerir. Bu aşamada kullanılan DNA polimeraz T7 bakteriofaj DNA polimerazının modifiye formudur. Bu enzim 3 5' ekzonükleaz aktivitesi içermez. Enzimin polimerizasyon hızı çok yüksek olup, DNA zincirine ddntp takabilme özelliğine de sahiptir. Reaksiyon karışımı 5' oda sıcaklığında bekletilir. İşaretleme aşamasında kullanılan işaretleme çözeltisi üç farklı dntp içerir. Dördüncü tip dntp, karışıma ilave edilen radyoaktif işaretli dntp dir.

20 Sonlandırma reaksiyonu Zincir sonlanması 3'OH grubu bulunmayan nükleotit analoglarının (ddntp) zincire takılması ile sağlanır. Dört farklı sonlandırma çözeltisinin her biri 80µl eşit dntp (A; C; G; T) ve 8µl tek bir bazın ddntp siniiçerir. Sonlandırma için hazırlanan tüplerin her birine sonlandırma çözeltisi reaksiyon karışımından ilave edilir. Tüplere formamid içeren durdurma çözeltisi eklenerek reaksiyon durdurulur. Bu örnekler jele yüklemeden önce denatüre edilir.

21 Reaksiyon Ürünlerinin Elektroforezi Örneklerin görüntülenmesi için ürünler denatüre edici poliakrilamid jel elektroforezine tabi tutulurlar. Jel hazırlandıktan ve polimerizasyon işlemi tamamlandıktan sonra ortamda kalan üre temizlenir. Elektroforez tamponu olarak 1X TBE kullanılır. Sisteme 70 watt, 1800 volt ve 50mA elektrik akımı verilerek ön elektroforez uygulanır. Bu uygulama tamlandıktan sonra yapılan DNA Dizi Analizi reaksiyonları jele yüklenerek saat yürütme yapılır.

22 Reaksiyon Ürünlerinin Otoradyografisi Elektroforez bitiminde jel, asetik asit metanol karışımında bekletilir, Whatmann 1MM kromatografi kağıdı üzerine alınarak jel kurutucuda kurutulur. Kuruma sonrası X-ışınına duyarlı filmle kaplanır. 1-2 gün boyu oda sıcaklığında karanlık odada tutularak otoradyografisi alınır.

23 Otomatik DNA Dizi Analizi Otomatik dizi analizi için çoğaltılan PCR ürünleri çeşitli yöntemler kullanılarak temizlenir. En sık kullanılan temizleme yöntemi ticari kitlerin kullanıldığı silika temelli yöntemlerdir.

24 İşaretleme Reaksiyonu Otomatik Dizi Analizi ticari olarak üretilen kitler kullanılır. En sık olarak ABI Prism Big DyeTM Terminatör Reaksiyon Kiti kullanılır. Bu PCR kitinin özelliği tüm PCR kimyasalları ile beraber, floresan boyalı ddntp ler ile Taq DNA Polimeraz enzimini de tek bir karışım halinde bulundurmasıdır. Big Dye Ready Reaction Mix olarak adlandırılan bu karışıma sadece primer ve temizlenmiş kalıp DNA eklenir ve PCR başlatılır.

25 BigDye Terminatör DNA Polymerase, dntp s and DyeDeoxyterminator s A C G T A A C AC C ACC G ACCG T ACCGTA ACCGTA T Bağlanma Uzama Ürünler

26 Fluorescent Dyes Used in 4-Color 4 Detection FAM (Blue) JOE (Green) TAMRA (Yellow) ROX (Red)

27 Amplifikasyon Koşulları 1 amplifikasyon tüpü (20 µl) için reaksiyon karışımı Kalıp DNA 8.0 µl Big Dye Ready Reaction Mix 8.0 µl Primer (3.2pmol / µl) 1.0 µl Distile su 3.0 µl

28 PCR Programı 96 0 C C 5 24 döngü; 60 0 C C 10 1 döngü;

29 Örneklerin Hazırlanması Örnek hazırlama sırasında amplifikasyon ürünü izopropanol çöktürmesi ile PCR artıklarından temizlenir. Bu aşama özellikle reaksiyona girmemiş floresan boyalı ddntp lerin uzaklaştırılması açısından da çok önemlidir. İşlem uygun şekilde yapılamazsa kontaminant boyalar lazer tarafından okunacak ve analizin hassasiyetini bozacaktır.

30 Örneğin Cihaza Yüklenmesi ve Elektroforezin Başlatılması Örnekler izopropanol ile temizlenip alkol tamamen uzaklaştırıldıktan sonra işaretleme reaksiyonu ürünleri formamid veya TSR içinde çözülür. Örnekler denatüre edildikten sonra buz içinde şoklanarak cihaza yüklenir ve elektroforez başlatılır. Yürütme işlemi 15 kv gerilim ve 50 o C sıcaklıkta gerçekleştirilir.

31 Fluorescent Emission Spectra for ABI Dyes 5-FAM JOE NED ROX Normalized Fluorescent Intensity Laser excitation (488, nm) WAVELENGTH (nm) ABI 310 Filter Set F

32 Matrix File Table from an ABI 310 These values are used by the GeneScan Analysis Software to separate the various dye colors from one another. The letters B, G, Y, and R represent the dye colors Blue, Green, Yellow, and Red, respectively

33 Sonuçların Değerlendirilmesi Elektoroforez işlemi tamamlandıktan sonra bilgisayar ana menüsünden Sequence Analysis programı açılır ve yürütülen örnek burada analiz edilir. Analiz sonrası örnek isminin bulunduğu alan fare yardımıyla çift tıklandığında örneğimizin baz dizisi yeni bir ekran üzerinde renkli pikler halinde görünür. Her bir pik bir DNA fragmentine karşılık gelir. Piklerin rengi ise söz konusu DNA fragmentinin son bazı olan ddntp li bazın rengidir. Her bir pik üzerinde o pikin son bazının ilk harfi renkli olarak yazılıdır. Eğer istenirse baz dizisi metin olarak da alınabilir ya da her iki sonuç yazdırıcı vasıtasıyla kağıda aktarılabilir.

34 Otomatik Dizi Analizi Cihazları 1- Jel Sistemli Cihazlar (ABI Prism 370, 373, 377) 2- Kapiler Sistemli Cihazlar (ABI Prism 310, 3100, 3700)

35 ABI Prism 377 ABI Prism 377

36

37

38

39 Labeled DNA fragments (PCR products) Capillary or Gel Lane Sample Detection Size Separation Detection region Ar+ LASER (488 nm) LASER (488 nm) CCD Panel Color Separation Fluorescence ABI Prism spectrograph

40

41

42 ABI 310 PRISM

43 Kapiller Elektroforez High Voltage Detector Capillary (+) anode (-) cathode

44 STANDARD OPERATION CAPILLARY FILL PRE-ELECTROPHORESIS ELECTROPHORESIS WATER WASH OF CAPILLARY SAMPLE INJECTION WATER WASH OF CAPILLARY ELECTROPHORESIS DETECTION

45 Electrokinetic Injection Process Capillary Electrode Q = πr 2 c s (µ ep + µ eo )Etλ b λ s - - DNA - DNA - Sample Tube Q is the amount of sample injected r is the radius of the capillary c s is the sample concentration E is the electric field applied t is the injection time λ s is the sample conductivity λ b is the buffer conductivity µ ep is the mobility of the sample molecules µ eo is the electroosmotic mobility Rose et al (1988) Anal. Chem. 60:

46

47 ABI Prism 310 Genetic Analyzer Stepper Motor Syringe with polymer solution capillary Heat Plate Anode Laser Injection cathode Outlet buffer Pump Block Autosampler tray Inlet buffer

48

49 ABI Prism 310 Genetik Analizör Cihazı na ait elektrot ve kapiler Enjeksiyon Elektrodu Kapiler Örnek Tepsisi

50 ABI Prism 3100

51 Cihazın İç Yapısı

52

53 Long Read BigDye Terminator v 3.0, 80 cm Capillary Array 3100 Genetic Analyzer Model _11.ab1 Version Basecaller-3100POP4_ BC 1.4.b.2 Lane 11 Signal G:304 A:286 T:249 C:197 DT3100POP4{BDv3}v1.mob Points 1570 to Pk 1 Loc: 1570 Page 1 of 2 Tue, Sep 18, :29 AM Tue, Sep 11, :36 AM Spacing: 16.00{16.00} CATTCTTTAG ACGCTTCC TG TGCTACCATTCTCGGAAATA CTG CAAG AAATCATCG ATG TCCCATG ACGG AAAAGAAGAACCTGGTATTG CCAAAAAGAT AAACTCAGTA GATGATATTAT TTATCAAATGTCAATGCTGGG TCCAAAAAAATGATGAAGAACGATTAGCT GAAATTTTAT CCATAAACAC AAGAAAAGCA CCACCAAAATTCTATGTTCA CTATGTTAATTACAACAAGCGT TTTAGATGA GTGG ATTACCACTGACAGAATAAACCTGAAGAAGATCCAG TTCCCCAAGAAAGAGGCCAAGACCCCCACT AAGAACGGACTTCCTGGGTCCCGTCCTGGCTCTCCAGAGA GAGAGG GTGCCGGCCTCGGCG CAGGCCAGCG GG AAGACCTTGCCAATCCCGGTCCAGATCA CACTCCGCTTCAACCTGCCC AAGG AGCGGGAGGCCATTCCCGGTGGCGAG CCTGACCAGC CGCTCTCCTC CAGCT TCCTGC CTGCAGCCCA ACCACCGCTC AACGAAACGGAAGGTGGAGGTGGTTTCACCAGCAACTCCAGTGCCCAGCG AGACAGCCCCGGCCTCGGTTTTTCCCCAGA ATGGAGCCGC CCGTAGGGCA GTGG GCAGCCCAGCCAGGACG GAAGCGAAAATCGAATTGTTTGG GCACTGA TGAGGACTCCCAGG ACAGCT CTGATGGAAT ACCGTCAGCA CCACGCATGA CTGGCAGCCTGG TGTCTGAT CGAAGCCACG A ACGACATCGT CACCCGGATG AAGAACATTGAGTGCATTGAGCTGGGCCGGCACCGCCTCA AGCCGTGGTA CTTCTCCCCG TACCCACAGGAACTCA CCAC ATTGCCTGTC CTCTACC TGT GCGAG GTTCTG CC TCAAGTAC GGCCGTAGTC TCAAGTGTCT TCAGCGTCAT TTGACCAGTGTGACCTACGA CATCCT CCAG GCAATGAGAT TNCCGCAAGGGCCCATCTCT TCTTNGAGAT GATGGAC

54 ABI Prism 3700

55

56

57 İki Yöntemin Y KıyaslanmasK yaslanması Manuel Yöntem Maliyeti düşükd Daha fazla işgücüi gerekir En fazla 350 bç okunabilir İlk radyoaktif datp zincire eklendikten sonra okuma başlar Daha fazla zaman alır Otomatik YöntemY Maliyeti yükseky Daha az işgücüi gerekir 1000 baz çifti okunabilir Primerden hemen sonra okunabilir Daha kısa k süre s alır

58 Otomatik sekansın n teorik kapasitesi 24 kapiller sekans aletinin kapasitesi 2.7 milyon baz/yıl Tüm m insan genomu sekansında nda bir tek cihaz kullanılırsa1000 yıl y l gerekli Bu nedenle 96 ve 384 kapiller sekans aletleri geliştirilmi tirilmiştir. tir. Slab jel kapiller sistem= 24 saat/9 yürütmey 1-66 milyon baz/1 ay/ 1 sekans aleti Amersham Megabase 1000 ile baz / 1 güng Büyük k genomlar için i in birçok lab. birarada çalışmakta ve günde 18 milyon bazın n sekansını yapabilmektedir.

59 İnsan genom projesinde kullanılan sekanslama stratejileri 1- BAC temelli sekanslama 2- tüm genom shutgun stratejisi

60 BAC temelli sekanslama İnsan genomu yaklaşık kb uzunluğunda fragmentlere ayrıldı. Bu fragmentler BAC vektörlere klonlanarak insan genomunun BAC kütüphanesi oluşturuldu. BAC kütüphanesi yaklaşık kadar BAC klonundan oluşmaktaydı. Daha sonra her bir BAC klonu insan genomundaki yerinin belirlenmesi amacıyla haritalandı.

61 Dizi analizi için her bir BAC klonu yaklaşık 2000 bp lik daha kısa fragmentlere parçalandı. Bu subklonların dizi analizi yapılarak bilgisayarlar kullanılarak birleşme noktalarından faydalanılarak her bir BAC klonunun dizisi çıkarıldı. Daha sonra haritalanan BAC klonları birleştirilerek tüm genomun dizisi çıkarıldı.

62 Tüm Genom Shutgun Stratejisi Dr. J. Craig VENTER ve arkadaşları tarafından geliştirilen bu yöntem haritalamaya gereksinim duymadığından zaman ve işgücü açısından tassarruf sağlamaktadır. Bu yöntemde önce genom yaklaşık 2000 ve bp lik küçük fragmentlere ayrılır daha sonra bu fragmentler plazmit vektörlere klonlanarak çoğaltıldıktan sonra dizisi çıkarılır. Bu diziler bir algoritm programı ile birleştirilerek genomun dizisi çıkarılır.

63

64 Bu teknik basit olarak görünse de insan genomu gibi büyük genomlara uygulandığında kısa bir süre içinde milyonlarca fragmentden elde edilen dizilerin kısıtlı bir sürede birleştirilmesi gerekmektedir. Ayrıca yöntem çok sayıda yüksek kapasitede çalışabilecek sekansır ve sekansı çıkarılan dizilerin birleştirilmesi için bilgisayar sistemlerine gereksinim duymaktadır. Venter bu amaçla TIGR yı (The Institute for Genome Research) kurarak milyonlarca fragmenti biraraya getirmek için Algoritm programı geliştirdi.

65 Bu algoritmayı kullanarak Venter ve arkadaşları 1.8 milyon bp den oluşan Haemophilus influenza genomunun dizisini çıkardılar. Venter ve arkadaşları bu yöntemi insan genomuna uygulamaya karar verdiklerinde bir çok araştırıcı bu yöntemin insan gibi milyonlarca repetatif DNA içeren büyük genomlarda başarılı olmayacağını öne sürmekteydi.

66 Ocak 1998 de yüksek kapasiteli 3700 cihazlarının ve shutgun sekans algoritmasının geliştirilmesi ile insan genom projesi hız kazandı. Mayıs 1998 de Venter, 300 adet 3700 ve çok sayıda yüksek kapasiteli bilgisayar alarak Celera Genomics şirketini kurdu ve İnsan genomunun dizisinin 3 yıl içinde tamamlanacağını duyurdu. Venter ve arkadaşları 9 ay içinde insan genomunun taslağını çıkarmayı başararak yöntemlerinin başarılı olduğunu kanıtladılar.

67

68 Haziran 2000 de insan genom projesinin tamamlandığı açıklandı. Ancak açıklanan diziler taslak diziler olup düzeltilmesi gerekiyordu. İki grup bir arada çalışarak nisan 2003 yılında diziye son şeklini verdiler

69 Haziran 2000 Nisan 2003 Genomun %90 ını içeriyor Hata oranı yaklaşı şık k 1000 bazda gap bulunuyor Genomun %28 i i bitiş standardına na uygun Genomun %99 unu içeriyori Hata oranı yaklaşı şık k bazda gap bulunuyor Genomun %99 i i bitiş standardına na uygun

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi SEKANS TEKNİKLERİ DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un

Detaylı

DİZİ ANALİZİ (SEKANS) TEKNİKLERİ

DİZİ ANALİZİ (SEKANS) TEKNİKLERİ DİZİ AALİZİ (SEKAS) TEKİKLERİ DA dizi analizi, gen yapısı ve genetik kontrol mekanizmaları hakkında bir çok bilgi edinmemizi sağlamıştır. erhangi bir organizmadan çok miktarda saf DA elde edilmesini sağlayan

Detaylı

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA

KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7

Detaylı

İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır.

İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine hibridizasyonuna dayanır.

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara 24-25 Şubat 2011, İzmir Sunum Planı Teorik

Detaylı

DNA Dizi Analiz Yöntemleri

DNA Dizi Analiz Yöntemleri DNA Dizi Analiz Yöntemleri DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine

Detaylı

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ Nükleik asitler Sıcaklıkla öldürülmüş S suşları Canlı R suşlarını canlı S suşuna dönüştürür a) Farelere virulan S suşu enjekte edildiğinde ölür b) R suşu enjekte edildiğinde yaşar c) Isıyla öldürülmüş

Detaylı

MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ

MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ DNA dizi analizleri ya da sekanslama; DNA birincil (temel) yapılarının belirlenmesinde kullanılan yöntemlerdir, DNA nın nukleotid dizilerinin saptanması anlamına gelir.

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY

DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY DNA Sekanslama ve Filogenetik Analizler Dr. Eda UĞURTAY DNA baz dizilimlerinin belirlenmesidir. İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. Kullanım

Detaylı

PCR Bir reaksiyonun kurulması ve optimize edilmesi

PCR Bir reaksiyonun kurulması ve optimize edilmesi Hafta V PCR Temelli Genetik Analiz Yaklaşımları PCR Bir reaksiyonun kurulması ve optimize edilmesi Doç. Dr. Hilâl Özdağ F Đ Z Đ K Đ A L T Y A P I Reaksiyonda kullanılanlar: P C R I. Kalıp DNA a) PCR degrade

Detaylı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil

Detaylı

NÜKLEİK ASİTLERİN ELEKTROFOREZİ

NÜKLEİK ASİTLERİN ELEKTROFOREZİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ NÜKLEİK ASİTLERİN ELEKTROFOREZİ Yüksek Lisans Semineri Hazırlayan: Venhar ÇELİK Danışman: Yrd.Doç.Dr. Dilek Turgut-BALIK NÜKLEİK ASİTLERİN

Detaylı

REAKSİYON PRENSİPLERİ

REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda

Detaylı

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.

Detaylı

Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2

Detaylı

DNA Mikroarrayler: SNP analizleri

DNA Mikroarrayler: SNP analizleri Hafta IX Genombilimde Mikrodizin Uygulamaları ve iyoinformatik Analiz DNA Mikroarrayler: SNP analizleri Doç. Dr. Hilâl Özdağ DNA Mikrodizin Genomik Dizi SNP 5 T / G 3 SNP prob = 25 baz Perfect Match Mismatch

Detaylı

RTA JEL / PZR Saflaştırma Kiti

RTA JEL / PZR Saflaştırma Kiti RTA JEL / PZR Saflaştırma Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-12 DNA parçalarının agaroz jelden geri kazanımı ve PZR ürünlerinin saflaştırılması için Yalnızca profesyonel kullanım için REF 09009050

Detaylı

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT gulden.haspolat@gthb.gov.tr

Detaylı

KAPİLER ELEKTROFOREZ. Uzm. Ecz. Emirhan NEMUTLU

KAPİLER ELEKTROFOREZ. Uzm. Ecz. Emirhan NEMUTLU KAPİLER ELEKTROFOREZ Uzm. Ecz. Emirhan NEMUTLU Elektroforez, iletken bir çözelti içindeki yüklü/yüksüz parçacıkların veya moleküllerin bir elektriksel alan varlığında göç etmesidir. Kapiler Elektroforezin

Detaylı

FLORESAN İN SİTU HİBRİDİZASYON

FLORESAN İN SİTU HİBRİDİZASYON FLORESAN İN SİTU HİBRİDİZASYON Sağlık Teknikeri Hande ÇOLAKOĞLU Ege Üniversitesi Tıp Fakültesi Hastanesi Patoloji AD SIVI ve DOKULARIN FISH UYGULAMASI ÖNCESİ HAZIRLIK İŞLEMLERİ FISH Çalışmalarında Ön Uygulama

Detaylı

Farmakogenetikte Kullanılan Temel Yöntemler

Farmakogenetikte Kullanılan Temel Yöntemler Farmakogenetikte Kullanılan Temel Yöntemler Dr. Melih Ö. Babaoğlu Hacettepe Üniversitesi Tıp Fakültesi Farmakoloji A.D. XIII. TFD Eğitim Sempozyumu Van 1 Hastalık derecesi Fizyolojik durum İlaç etkileşmeleri

Detaylı

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8)

1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol, 20 mm EDTA. 100 mm Tris-HCl (ph 8) KONU-7. MOLEKÜLER BĠYOLOJĠDE TEMEL TEKNĠKLER BĠTKĠDEN GENOMĠK DNA ĠZOLASYONU Kullanılan Tamponlar: 1. Ekstraksiyon Tamponu: %2 (w/v) CTAB (Cetyltrimethyl-ammonium bromide) 1.4 M NaCl, % 0.2 (v/v) β-merkaptoetanol,

Detaylı

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri. Bölüm 9. MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Bölüm 9 MON810 Mısır, Bt-176 Mısır ve Roundup Ready Soya nın PCR ile Nitel Saptanması M. Querci, M. Maretti, M. Mazzara WORLD HEALTH ORGANIZATION

Detaylı

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE

Detaylı

ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ

ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ Genetik mühendisliği gelişmeden önce insanlar yapay seçilim yoluyla istenen özelliklerin yavru canlılarda görülmesini sağlamışlardır. Örneğin seçici üretim

Detaylı

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA

KABUKLULAR FINDIK WHEAT BUĞDAY YUMURTA YER PEANUT FISTIĞI SOYA ET ÜRÜNLERİNDE TAĞŞİŞ Tağşiş; gıda maddesinin mevzuata veya izin verilen özelliklerine aykırı olarak üretilmesi hali olarak tanımlanmaktadır. Gıda ürünlerinde; tağşiş bir çok şekilde yapılabilmektedir.

Detaylı

DNA ARAÇLARI ve BİYOTEKNOLOJİ

DNA ARAÇLARI ve BİYOTEKNOLOJİ DNA ARAÇLARI ve BİYOTEKNOLOJİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER DNA Düzenlenmesi İnsan DNA sı ile yapılan ilk çalışmalar için yani çalışma yöntemi geliştirilmesi için yaklaşık 1 milyon dolar

Detaylı

SODYUM DODESİL SÜLFAT POLİAKRİLAMİD JEL ELEKTROFOREZİ İLE PROTEİNLERİN ANALİZİ

SODYUM DODESİL SÜLFAT POLİAKRİLAMİD JEL ELEKTROFOREZİ İLE PROTEİNLERİN ANALİZİ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ SODYUM DODESİL SÜLFAT POLİAKRİLAMİD JEL ELEKTROFOREZİ İLE PROTEİNLERİN ANALİZİ Yüksek Lisans Semineri Hazırlayan: Abdullah ASLAN Danışman:

Detaylı

VİRAL TANI KİTLERİ (GFJ-480)

VİRAL TANI KİTLERİ (GFJ-480) VİRAL TANI KİTLERİ (GFJ-480) CMV PCR Tanı Kiti Cytomegalovirus un Konvensiyonel PCR yöntemiyle tanınması. HHV-5 olarak da bilinen Sitomegalovirüs, herpes virus ailesinin bir üyesidir. Oldukça sık görülen

Detaylı

MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL

MİKROBİYOLOJİDE BİYOTEKNOLOJİ. Doç. Dr. Funda BAĞCIGİL MİKROBİYOLOJİDE BİYOTEKNOLOJİ Doç. Dr. Funda BAĞCIGİL Biyoteknoloji; Genetik materyallerde moleküler düzeyde yapılan manipulasyonlarla yeni ve istenilen fenotipte organizmalar ve faydalı ürünler elde etmektir

Detaylı

ILIMAN İKLİM MEYVE TÜRLERİNDE ÇEŞİT VE TİPLERİN MOLEKÜLER TEKNİKLERLE KARAKTERİZASYONU

ILIMAN İKLİM MEYVE TÜRLERİNDE ÇEŞİT VE TİPLERİN MOLEKÜLER TEKNİKLERLE KARAKTERİZASYONU ILIMAN İKLİM MEYVE TÜRLERİNDE ÇEŞİT VE TİPLERİN MOLEKÜLER TEKNİKLERLE KARAKTERİZASYONU Meryem YILDIZ ÖCAL Gıda Yüksek Mühendisi Manavgat Gıda Tarım ve Hayvancılık İlçe Müdürlüğü EĞİTİM BİLGİLERİ Eğitim

Detaylı

III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

SDS-PAGE Jel Elektroforezi İÇERİK

SDS-PAGE Jel Elektroforezi İÇERİK İÇERİK Tanım...2 SDS-PAGE jel elektroforez metodu...3 SDS-PAGE jel elektroforezi yürütme ortamının hazırlanması...4 Protein örneklerinin yüklenmesi...8 Jelin yürütülmesi...9 Jelin boyanması ve boyanın

Detaylı

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03. Laboratuvar Tekniği Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.2014) 1 5. Haftanın Ders İçeriği DNA ekstraksiyonu DNA ekstraksiyonunun amacı

Detaylı

PROTEİN ANALİZ YÖNTEMLERİ

PROTEİN ANALİZ YÖNTEMLERİ PROTEİN ANALİZ YÖNTEMLERİ Protein analizleri, fen bilimleri araştırmaları ve farmosötik endüstrisinde önemli bir araç olarak karşımıza çıkar. Protein Analizinin Amaçları: Hastalıkların Kesin Tanısının

Detaylı

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD

HLA Tiplendirmesi PCR-SSP. Türker Duman PhD HLA Tiplendirmesi PCR-SSP Türker Duman PhD Büyük Doku Uygunluk Kompleksi (Major Histocompatibility Complex - MHC) İlk olarak farklı fare suşlarında deri naklinin reddiyle tanımlanan genetik bölgedir Alloreaktiviteden

Detaylı

MAIA Pesticide MultiTest

MAIA Pesticide MultiTest MAIA Pesticide MultiTest GIDALARDA PESTİSiT KALINTILARI İÇİN AB MAKSİMUM KALINTI LİMİTLERİ İLE UYUMLU ÇOKLU KALINTI TARAMA TESTİ Microplate Acetylcholinesterase Inhibition Assay (MAIA) katı veya sıvı gıda

Detaylı

Genetik materyal: DNA replikasyonu

Genetik materyal: DNA replikasyonu Genetik materyal: DNA replikasyonu Umut Fahrioglu, PhD MSc DNA Replikasyonu DNA replikasyonu genomların ve içerdikleri genlerin nesilden nesile aktarılmasında çok önemli bir rol oynar. Hücreden hücreye

Detaylı

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ

SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

HIZLI YÖNTEMLER (III)

HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla

Detaylı

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar

Kromozom, DNA ve Gen. Allel Segregasyonu. DNA çift sarmalı. Hastalık yapan mutasyonlar protein fonksiyonunu bozar. Hastalık yapan mutasyonlar Temel Genetik Kavramlar DNA izolasyon yöntemleri Kromozom, DNA ve Gen Hücre Nukleus Kromozomlar Gen Prof.Dr.Uğur ÖZBEK Protein DNA çift sarmalı Allel Segregasyonu Şeker Fosfat omurga Bazlar Baz çifti A

Detaylı

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor!

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor! Uygulamalı Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları Yaz Dönemi Başlıyor! : DNA izolasyonu, Primer tasarımı, PCR Teknikleri, Agaroz Jel Elektroforezi,

Detaylı

Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar

Western Blot (veya immünblot), protein ekspresyonunu doğrulamak için standart laboratuvar İçerik Giriş...2 Western Blot Yöntemi...2 Protein Örneklerinin Hazırlanması...2 Dikey Jel Sistemi Kullanımı...3 Kuru Transfer Sistem Kullanımı...4 Bloklama...6 Protein Tespiti...6 Kemilüminesans Tanımlama

Detaylı

ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ

ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ ATIKSULARDA FENOLLERİN ANALİZ YÖNTEMİ YÖNTEM YÖNTEMİN ESASI VE PRENSİBİ Fenolik maddeler uçucu özellik göstermeyen safsızlıklardan distilasyon işlemiyle ayrılır ve ph 7.9 ± 0.1 de potasyum ferriksiyanür

Detaylı

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Replikasyon genetik materyelin tamamen kendi benzeri yeni bir molekül oluşturma işlemidir. DNA kendini eşleyebilen yegane biyomoleküldür

Detaylı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 16S rrna Analizi Doç. Dr. Zeynep Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum içeriği Genel bilgi Uygulanışı Kullanım alanları Avantajları Dezavantajları Neden

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

4. PowerPlex ESX 17 Sistemini Kullanarak DNA Amplifikasyonu için Protokoller

4. PowerPlex ESX 17 Sistemini Kullanarak DNA Amplifikasyonu için Protokoller 4. PowerPlex ESX 17 Sistemini Kullanarak DNA Amplifikasyonu için Protokoller Kullanıcı Tarafından Sağlanacak Malzemeler GeneAmp PCR Sistemi 9700 veya 2720 thermal cycler (Applied Biosystems) mikrosantrifüj

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection)

SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) SELEKSİYONA YARDIMCI MARKERLAR (Marker Assisted Selection) Geleneksel olarak bireylerin kendisini, atalarını ve varsa döllerinin bilgilerini içeren kriterlere göre seleksiyon yapılmaktadır. Elde edilen

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara

MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ. Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara MANTARLARIN EPİDEMİYOLOJİK TİPLENDİRİLMESİ Dr. Ayşe Kalkancı Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara Taksonomik terimler Alem (Kingdom) Bölüm veya şube (divisio, filum)

Detaylı

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test)

C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi. No TestAdı Miktar (Test) C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Testler ve Cihaz Kullanımı Teknik Şartnamesi No TestAdı Miktar (Test) 1 Ailesel Akdeniz Ateşi Hastalığı (FMF) Analizi 200 Test 2 Alfa-Talasemi

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı

MERKEZ LABORATUVAR. Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı MERKEZ LABORATUVAR Moleküler Biyoloji Deneylerinde Sıklıkla Kullanılan Bazı Aletlerin Tanıtımı Yüksek Performans Sıvı Kromatografisi (HPLC) Karbonhidratların, organik asitlerin, vitaminlerin, amino asitlerin

Detaylı

ı. BCR-ABL Mbcr Kiti(p210) 144 test

ı. BCR-ABL Mbcr Kiti(p210) 144 test C.B.Ü. TIP FAKÜLTESi TıBBi GENETiK ANABiLiM DAlı Moleküler Genetik Hematolojik Malignensi Translokasyon Testleri ve Cihaz Teknik Şartnamesi ı. BCR-ABL Mbcr Kiti(p210) 144 test 2. BCR-ABL mbcr Kiti(p190)

Detaylı

ADLİ DNA ANALİZLERİ A N K A R A

ADLİ DNA ANALİZLERİ A N K A R A ADLİ DNA ANALİZLERİ İ B R A HIM S E M İ Z O Ğ LU E K İ M 2 0 1 3 A N K A R A ADLİ BİLİMLER Locard ın değişim prensibi: «Her temas bir iz bırakır.» Locard a göre, suçlu olan kişi bir obje veya kişi ile

Detaylı

therascreen BRAF RGQ PCR Kit Kullanım Kılavuzu

therascreen BRAF RGQ PCR Kit Kullanım Kılavuzu Ağustos 2012 therascreen BRAF RGQ PCR Kit Kullanım Kılavuzu 24 Versiyon 1 in vitro diyagnostik kullanım için Rotor-Gene Q MDx 5plex HRM ya da Rotor-Gene Q 5plex HRM cihazda kullanım için 870211 QIAGEN

Detaylı

KOROZYON. Teorik Bilgi

KOROZYON. Teorik Bilgi KOROZYON Korozyon, metalik malzemelerin içinde bulundukları ortamla reaksiyona girmeleri sonucu, dışardan enerji vermeye gerek olmadan, doğal olarak meydan gelen olaydır. Metallerin büyük bir kısmı su

Detaylı

KLOR (Cl2) ANALİZ YÖNTEMİ

KLOR (Cl2) ANALİZ YÖNTEMİ S a y f a 1 KLOR (Cl2) ANALİZ YÖNTEMİ YÖNTEMİN ESASI VE PRENSİBİ Klor, ph 8 de veya daha düşük bir ph da potasyum iyodür çözeltisinden iyotu serbest bırakacaktır. Serbest iyot, indikatör olarak nişasta

Detaylı

Security Geçiş Sistemleri. Döner. Kayar Kapılar. Hastane Kapıları. 90 Derece. Kapılar. Kapılar. Otomatik 90 Açılır Kapı

Security Geçiş Sistemleri. Döner. Kayar Kapılar. Hastane Kapıları. 90 Derece. Kapılar. Kapılar. Otomatik 90 Açılır Kapı Döner Kapılar Kayar Kapılar Hastane Kapıları 90 Derece Kapılar Security Geçiş Sistemleri Otomatik 90 Açılır Kapı Tek Kanatlı 90 Dışa Açılır Kapı Tek Kanatlı 90 İçe Açılır Kapı Çift Kanatlı 90 Dışa Açılır

Detaylı

KEMİLÜMİNESANS JEL DOKÜMANTASYON SİSTEMİ TEKNİK ŞARTNAMESİ

KEMİLÜMİNESANS JEL DOKÜMANTASYON SİSTEMİ TEKNİK ŞARTNAMESİ 1 KEMİLÜMİNESANS JEL DOKÜMANTASYON SİSTEMİ TEKNİK ŞARTNAMESİ (1) Sistemin Genel Teknik Özellikleri: 1. Cihaz western blotlama, nükleik asit tayini, 2-D jel elektroforezi, DIGE ve dot-blot uygulamalarında

Detaylı

GÜVENLİ VE ETKİN LABORATUVAR UYGULAMALARI 111-546 ELEKTROFOREZ. Doç. Dr. Hilâl Özdağ. Elektroforez

GÜVENLİ VE ETKİN LABORATUVAR UYGULAMALARI 111-546 ELEKTROFOREZ. Doç. Dr. Hilâl Özdağ. Elektroforez GÜVENLİ VE ETKİN LABORATUVAR UYGULAMALARI 111-546 ELEKTROFOREZ Doç. Dr. Hilâl Özdağ Elektroforez Yüklü moleküllerin bir elektrik alanı içinde yürütülerek ayrıştırılması tekniğine elektroforez denir. DNA,

Detaylı

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar.

DNA Đzolasyonu. Alkaline-SDS Plasmit Minipreleri. Miniprep ler bakteri kültüründen plasmit DNA sı izole etmenizi sağlar. DNA Đzolasyonu Saflaştırılmak istenen DNA ya genomik DNA dır ya da genomik olmayan mtdna, chldna, plasmit DNAsıdır.DNA izolasyon kitleri, genomik ve genomik olmayan DNA izole etmemizi sağlayan standartlaştırılmış

Detaylı

Moleküler Dizileme Teknolojileri

Moleküler Dizileme Teknolojileri Moleküler Dizileme Teknolojileri Dr. Güven Toksoy, PhD İstanbul Üniversitesi İstanbul Tıp Fakültesi Tıbbi Genetik AD 31.10.2014 22:44 1 Klasik dizileme Sanger dizileme Maxim Gilbert dizileme tekniği Yeni

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

RTA Kandan Genomik DNA İzolasyon Kiti

RTA Kandan Genomik DNA İzolasyon Kiti RTA Kandan Genomik DNA İzolasyon Kiti Kullanma Kılavuzu Yayın Tarihi - 2011-05 IVD İnsan kan örneklerinden in vitro tanı amaçlı genomik nükleik asit izolasyon ve saflaştırması için In vitro tanı amaçlı

Detaylı

MOLEKÜLER MİKROBİYOLOJİ LABORATUVARI ÇALIŞMA PROSEDÜRÜ

MOLEKÜLER MİKROBİYOLOJİ LABORATUVARI ÇALIŞMA PROSEDÜRÜ KOD.MİK.PR.02 YAYIN TRH. KASIM 2011 REV. TRH. EYLÜL 2012 REV. NO.1 SAYFA NO.1/14 1. AMAÇ: Moleküler mikrobiyoloji laboratuvarında yürütülen faaliyetleri tanımlamak. 2. KAPSAM: Bu talimat, Moleküler mikrobiyoloji

Detaylı

KİMYASAL MADDE DEPOLAMA TALİMATI

KİMYASAL MADDE DEPOLAMA TALİMATI REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Tesis Yönetimi ve Güvenliği Kurulu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü 1/6 1. AMAÇ

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

BÖLÜM 8 B- SUNU PROGRAMI 1. MICROSOFT POWERPOINT NEDİR? 2. POWERPOINT PROGRAMININ BAŞLATILMASI

BÖLÜM 8 B- SUNU PROGRAMI 1. MICROSOFT POWERPOINT NEDİR? 2. POWERPOINT PROGRAMININ BAŞLATILMASI BÖLÜM 8 B- SUNU PROGRAMI 1. MICROSOFT POWERPOINT NEDİR? Microsoft Office Paketi ile birlikte kullanıcıya sunulan Powerpoint Programı, etkileşimli sunular (Presentation) hazırlamaya yarayan metin tabanlı

Detaylı

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI

MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI MANTAR ENFEKSİYONLARININ MOLEKÜLER YÖNTEMLERLE TANISI Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Mikrobiyoloji Anabilim Dalı 1 İnvazif Mantar Enfeksiyonları (İME) Bağışıklık sistemi Morbidite-mortalite

Detaylı

sensör sensör çıkışı kontrol birimi Kontrol birimi, kontrol ekipmanı ve çıkış sinyali anahtarlama elemanından meydana gelir.

sensör sensör çıkışı kontrol birimi Kontrol birimi, kontrol ekipmanı ve çıkış sinyali anahtarlama elemanından meydana gelir. Polymer Electric Kanıtlanmış Güvenlik Safe Bumperler; sensör, kontrol ekipmanı ve çıkış sinyali anahtarlama elemanını içeren koruyucu ürünlerdir. (Emniyet Tamponu) sensör sensör çıkışı kontrol birimi Kontrol

Detaylı

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK

BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK BMM 101 BİYOMEDİKAL MÜHENDİSLİĞİNE GİRİŞ Doç. Dr. Birsen Can Demirdöğen BİYONANOTEKNOLOJİ MOLEKÜLER BİYOLOJİ VE GENETİK İnsan fizyolojisi biyomedikal mühendisliğini diğer mühendislik formlarından ayıran

Detaylı

İÇİNDEKİLER ÖN SÖZ... III

İÇİNDEKİLER ÖN SÖZ... III İÇİNDEKİLER ÖN SÖZ... III İÇİNDEKİLER... V 1. LABORATUVARDA KULLANILAN MALZEME VE ALETLER... 1 1.1. Tüpler... 1 1.2. Beher... 1 1.3. Erlenmeyer... 2 1.4. Balonlar... 2 1.5. Mezur... 3 1.6. Pipetler...

Detaylı

J Popul Ther Clin Pharmacol 8:e257-e260;2011

J Popul Ther Clin Pharmacol 8:e257-e260;2011 SİTOMEGALOVİRUS (CMV) Prof. Dr. Seyyâl ROTA Gazi Ü.Tıp Fakültesi LOW SYSTEMIC GANCICLOVIR EXPOSURE AND PREEMPTIVE TREATMENT FAILURE OF CYTOMEGALOVIRUS REACTIVATION IN A TRANSPLANTED CHILD J Popul Ther

Detaylı

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması

Detaylı

TRANSLASYON VE TRANKRİPSİYON

TRANSLASYON VE TRANKRİPSİYON TRANSLASYON VE TRANKRİPSİYON GEN İFADESİ (GEN EKSPRESYONU) Gen ifadesinin düzenlenmesi çeşitli aşamalarda olur: 1) Primer transkriptlerin oluşumu 2) Primer mrna dan matür (olgun) mrna oluşumu 3) mrna nın

Detaylı

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler

Hemoglobinopatilerde Tanı Yönetimi Genetik Testler 1 2 3 4 5 6 7 8 Hemoglobinopatilerde Tanı Yönetimi Genetik Testler Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD 16. Kromozom üzerinde α globin gen bölgesi 11. Kromozom üzerinde β

Detaylı

Automatic Entrance & Acccess System GARAJ. Endüstiyel - Seksiyonel Garaj Kapıları. Seksiyonel Kapılar

Automatic Entrance & Acccess System GARAJ. Endüstiyel - Seksiyonel Garaj Kapıları. Seksiyonel Kapılar TM Automatic Entrance & Acccess System Endüstiyel - Seksiyonel Garaj Kapıları GARAJ Seksiyonel Kapılar TM Automatic Entrance & Acccess System TRONCO Endüstriyel Seksiyonel Kapılar TRONCO endüstriyel seksiyonel

Detaylı

İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya.

İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. Bakterilerin tanımlanması Bakterilerin tanımlanması Bakterilerin

Detaylı

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ

T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ. HAZIRLAYAN Bünyamin ATMIŞ T.C. FIRAT ÜNİVERSİTESİ FEN BİLİMLERİ ENSTİTÜSÜ BİYOLOJİ BÖLÜMÜ DNA PARMAKİZİ YÜKSEK LİSANS SEMİNERİ HAZIRLAYAN Bünyamin ATMIŞ DANIŞMAN Yrd. Doç. Dr. Dilek TURGUT BALIK 1. PARMAKİZİ 2. DNA PARMAKİZİ 3.

Detaylı

Programın Tanıtımı 2-4- 1-3- 8-9- 10-11- 12- 13-

Programın Tanıtımı 2-4- 1-3- 8-9- 10-11- 12- 13- ISIS VERİ YÖNETİMİ Programın Tanıtımı 1-3- 2-4- 6-7- 5-8- 9-10- 11-12- 13-1- Bu bölüme aranacak sorgu için 2 tarih arası bilgi gün / ay / yıl / saat / dakika cinsinden girilir. 2- Arama kriterlerinden

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

REKOMBİNANT DNA TELNOLOJİSİNİN TEMEL PRENSİPLERİ

REKOMBİNANT DNA TELNOLOJİSİNİN TEMEL PRENSİPLERİ REKOMBİNANT DNA TELNOLOJİSİNİN TEMEL PRENSİPLERİ Klonlama Birçok moleküler genetik tekniğinin kalbi gendir. Gen, genetik manipülasyonlarda kullanılmadan önce izole edilmeli ve iyi karakterize edilmelidir.

Detaylı