Differential Display. Özgür Çakır

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Differential Display. Özgür Çakır"

Transkript

1 Differential Display Özgür Çakır

2

3 Differential gen anlatımı Gelişmeye bağlı gen anlatımı değişiklikleri Ortam uyaranları ile gen anlatımı değişimleri Doku veya hücreye özel gen anlatımları

4 Farklı anlatım yapan genlerin analizi tanımlama differential filter hybridization cdna subtraction differential display PCR (DD-PCR) serial analysis of gene expression (SAGE) Miktar belirleme Northern blotting reverse Northern blotting RNase protection competitive PCR quantitative PCR (Q-PCR) cdna (micro)array hybridization

5 Başlangıç için bir hedefe ihtiyaç yok Küçük farklılıklar yakalanabilir Substraksiyondan daha bilgi verici Laboratuvar işi uzun Klonlama gerekir Dizi tayini yapılmalı

6 Differential display Differential display, bir RT-PCR reaksiyonundan sonra oluşan farklı boydaki parçalrın karşılaştırılması temeline dayanır. PCR primerlerinden biri olası 16 nukleotid çifti tarafından takib edilen oligo(dt)dir. Diğer primer ise genellikle 6 bazlık oligolar veya onların karışımıdır. Bu karışım çok yüksek çözünürlüklü akrilamid jelde ayrılır, flouresan veya radyoaktif olarak görünür hale getirilir ve iki durum arasındaki fark izlenir. Hızlı bir metoddur. Ucuzdur, birçok gen izlenebilir Ekspresyon analizi yapmak için uygun bir yöntemdir Miktar belirlemek zordur Gen anlatımındaki küçük değişikler yakalanamaz Genler başlangıçta bilinen veya bilinmeyen genlere uygulanabilir Çok sayıdaki örnek uygun Artefkt sayısı çoktur

7 DD Çok ekstrem koşullar taranmamalı Her örnek için tekrarlar yapılmalı Çok sayıda örnek kullanılmalı Bilinmeyen veya bilinen genler için kullanılabilir

8

9 Differential Display-PCR mrna AAAAAAAAAA reverse transcription cdna AAAAAAAAAA TTTTTTTTTT PCR with dt-anchor primers and random decamers 80x GATGCATTAG control separate on polyacrylamide gel stimulated TTTTTTTTTT GTTTTTTTTTT 4x dow n- regulated upregulated

10 DD-PCR: mrna amplification mrna AAAAAAAAAA crna transcription using T7 RNA polymerase cdna reverse transcription AAAAAAA TTTTTTT T7 crna AAAAAAA TTTTTTT T7 T7 TTTTTTTTTT TTTTTTTTTT 2nd strand synthesis reverse transcription ds cdna AAAAAAA TTTTTTT T7 T7 cdna TTTTTTT AAAAAAA DD-PCR

11 Differential Display Analysis Genhunter

12 Differential Display Analysis Genhunter mrna 5 UTR Coding region 3 UTR UCG AAAAAAA n

13 Differential Display Analysis Genhunter mrna 5 UTR Coding region 3 UTR UCG AAAAAAA n Reverse transcribe

14 Differential Display Analysis Genhunter mrna Anchor Primer (3) 5 UTR Coding region 3 UTR UCG AAAAAAA n Reverse transcribe

15 Differential Display Analysis Genhunter mrna Anchor Primer (3) 5 UTR Coding region 3 UTR UCG AAAAAAA n Reverse transcribe

16 Differential Display Analysis Genhunter mrna Anchor Primer (3) 5 UTR Coding region 3 UTR UCG AAAAAAA n Reverse transcribe 5 UTR Coding region 3 UTR UCG AAAAAAA n cdna(s)

17 5 UTR Coding region 3 UTR UCG AAAAAAA n cdna(s) PCR Amplify labeled dntps

18 Anchor Primer (3) 5 UTR Coding region 3 UTR UCG AAAAAAA n cdna(s) PCR Amplify labeled dntps

19 Anchor Primer (3) 5 UTR Coding region 3 UTR Arbitrary Primers (80) UCG AAAAAAA n cdna(s) PCR Amplify labeled dntps

20 Anchor Primer (3) 5 UTR Coding region 3 UTR Arbitrary Primers (80) UCG AAAAAAA n cdna(s) PCR Amplify labeled dntps X Y Z

21 Anchor Primer (3) 5 UTR Coding region 3 UTR Arbitrary Primers (80) UCG AAAAAAA n cdna(s) PCR Amplify labeled dntps X Y Z Run on denaturing Polyacrylamide gel

22 Anchor Primer (3) 5 UTR Coding region 3 UTR Arbitrary Primers (80) UCG AAAAAAA n cdna(s) PCR Amplify labeled dntps X Y Z Run on denaturing Polyacrylamide gel

23

24 Constant Induced Induced

25 Constant Induced Induced

26 Gel extract PCR amplify

27 Gel extract PCR amplify Ligate in vector, transform miniprep and sequence

28 Gel extract PCR amplify Ligate in vector, transform miniprep and sequence Spot sequences on arrays

29 Differential Display Analysis Genhunter Advantages -bu teknoloji çok basittir -ucuzdur

30 Differential Display Analysis Genhunter Dezavantajları -Miktar belirlenemez -Anlatımdaki küçük değişimler yakalanamaz

31 Differential Display Analysis Genhunter Anchor Primer (3) 5 UTR Coding region 3 UTR Arbitrary Primers (80) UCG AAAAAAA n cdna(s)

32 Differential Display Analysis Genhunter Anchor Primer (3) 5 UTR Coding region 3 UTR Arbitrary Primers (80) UCG AAAAAAA n cdna(s)

33 Differential Display Analysis Qbiogene Generate cdna (similar to the Genehunter method) 5 UTR Coding region 3 UTR AAAAAAA n UCG cdna(s)

34 Differential Display Analysis Qbiogene Generate cdna (similar to the Genehunter method) 5 UTR Coding region 3 UTR AAAAAAA n UCG cdna(s) Restriction digest

35 Differential Display Analysis Qbiogene Generate cdna (similar to the Genehunter method) 5 UTR Coding region 3 UTR AAAAAAA n UCG cdna(s) Restriction digest Ligate adapters

36 Differential Display Analysis Qbiogene Generate cdna (similar to the Genehunter method) 5 UTR Coding region 3 UTR AAAAAAA n UCG cdna(s) Restriction digest Ligate adapters

37 Differential Display Analysis Qbiogene Generate cdna (similar to the Genehunter method) 5 UTR Coding region 3 UTR AAAAAAA n UCG cdna(s) Restriction digest Ligate adapters

38 Differential Display Analysis Qbiogene Generate cdna (similar to the Genehunter method) 5 UTR Coding region 3 UTR AAAAAAA n UCG cdna(s) XYZ Restriction digest Ligate adapters PCR Amplify

39 Differential Display Analysis Qbiogene Advantages -anlatım yapan bölgeden diziler elde edilir

40 Differential Display Analysis Qbiogene Dezavantajlar -bu teknoloji çok güvenilir değil.

41

42

43 Farklı yöntemlerin karşılaştırılması genome- sample sensitivity labor quantitaive wide size intensity diff. filter hybridization +/- - +/- + - cdna subtraction +/- - +/- + - DD-PCR SAGE ++ +/ Northern Rnase protection - + +/- + + comp. PCR rev. Northern - + +/- +/- + Q-PCR /- ++ cdna micro array ++ +/

44

45 Differential Display Proteomics Protein expresyon profili = global profilleme proteomics + proteomics differential display

46 Visualized by 2-DE + gel staining A B Excise spot; elute; digest Extract peptides; MS analyze Protein identification

47 Isotopik İşaretleme: differential display proteomics için bir başka yaklaşım

48 Digital differential display Genlerin bilgisayar ortamında karşılaştırılmasını sağlayan bir metod Ayrı cdna kitaplıklarının profilleri Özetle, farklı dokularda farklı anlatım yapan genler tanımlanır ve gösterilir İstatistik bir test yardımıyla

49 Digital Differential Display

50

51

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler

RT-PCR. (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) Dr Gülnur Güler RT-PCR (reverse transckripsiyon-polimeraz zincir reaksiyonu) mrna ekspresyon seviyelerini belirlemek için sensitiv bir metod

Detaylı

microarray teknolojisi

microarray teknolojisi microarray teknolojisi ekolojik ve evrimsel çalışmalarda kullanımı Kahraman İpekdal microarray nedir? DNA microarray i (gen çipi, DNA çipi ya da biyoçip olarak da bilinir) ekspresyon profili oluşturmak,

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD Genomiks Temeli DNA nın dizilenmesi ve elde edilen dizilerin biyoinformatiksel metotlar kullanılarak

Detaylı

Genetikten Genombilime Geçişte Transkriptom Analizleri

Genetikten Genombilime Geçişte Transkriptom Analizleri Genetikten Genombilime Geçişte Transkriptom Analizleri Doç.Dr. Hilâl Özdağ AÜ iyoteknoloji Enstitüsü Mammals Other chordates Other eukaryotes Homo sapiens [NCI 35] Vega Gallus gallus [WASHUC1] Drosophila

Detaylı

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP)

POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) Deney: M 1 POLİMERAZ ZİNCİR REAKSİYONU (PZR-PCR) VE RESTRİKSİYON PARÇA UZUNLUĞU POLİMORFİZMİ (RFLP) a) PCR yöntemi uygulaması b) RPLF sonuçları değerlendirilmesi I. Araç ve Gereç dntp (deoksi Nükleotid

Detaylı

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi

07.04.2008. DNA İnceleme Teknikleri GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ. DNA Jel Elektroforezin Aşamaları. DNA Jel Elektroforezi GEÇMİŞTEN GÜNÜMÜZE DNA İNCELEME TEKNİKLERİ VE PRENSİPLERİ Prof.Dr.Behnan ALPER Çukurova Üniversitesi Tıp Fakültesi Adli Tıp Anabilim Dalı Adana DNA İnceleme Teknikleri DNA Jel Elektroforezi RFLP Restriksiyon

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

Rekombinant DNA Teknolojisi-I

Rekombinant DNA Teknolojisi-I BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-I Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

Comparative Genomic Hybridization (CGH)

Comparative Genomic Hybridization (CGH) CGH, ARRAY-CGH Comparative Genomic Hybridization (CGH) CGH sitogenetik tekniğini ilk defa, Kallioniemi ve ark. 1992 de Science da yayınlattıkları çalışmaları ile ortaya koydular. Kallioniemi A, Kollioniemi

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı

MIKROARRAY TEKNOLOJİSİ. Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı MIKROARRAY TEKNOLOJİSİ Veysel Sabri HANÇER Moleküler Biyoloji ve Genetik Doktora Programı 2602040083 vshancer@yahoo.com EŞ ANLAMLILAR Biochip DNA chip DNA microarray Gene array 2 Neden bu teknolojiye ihtiyaç

Detaylı

Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan

Detaylı

Microarray Teknolojisi

Microarray Teknolojisi Microarray Teknolojisi Evrimsel ve Ekolojik Çalışmalarda Kullanımı K. İpekdal Proteomik ve Genomik 2006 A. Microarray Teknolojisi Son 10 yılda pek çok model sistem hazırlanırken organizmadan büyük miktarlarda

Detaylı

FISH ve in situ melezleme

FISH ve in situ melezleme FISH ve in situ melezleme In situ melezleme belirli bir mrna nın doku içinde nerede bulunduğunu görmemize yarar. Bu metod inceleyenin ilgilendiği mrna nın normal yerini görmesine olanak sağlar. In situ

Detaylı

DNA ARAÇLARI ve BİYOTEKNOLOJİ

DNA ARAÇLARI ve BİYOTEKNOLOJİ DNA ARAÇLARI ve BİYOTEKNOLOJİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER DNA Düzenlenmesi İnsan DNA sı ile yapılan ilk çalışmalar için yani çalışma yöntemi geliştirilmesi için yaklaşık 1 milyon dolar

Detaylı

DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel

Detaylı

YÖNTEMLERİ. Prof. Dr. Hasan Bayram Gaziantep Üniversitesi Tıp Fakültesi Göğüs Hastalıkları AD E-posta: bayram@gantep.edu.tr

YÖNTEMLERİ. Prof. Dr. Hasan Bayram Gaziantep Üniversitesi Tıp Fakültesi Göğüs Hastalıkları AD E-posta: bayram@gantep.edu.tr IN VİTROV ARAŞTIRMA YÖNTEMLERİ Prof. Dr. Hasan Bayram Gaziantep Üniversitesi Tıp Fakültesi Göğüs Hastalıkları AD E-posta: bayram@gantep.edu.tr Toraks 11.Yıllık Kongresi, Antalya Nisan 2008 Amaç Deneysel

Detaylı

cdna Kitaplık Hazırlanışı

cdna Kitaplık Hazırlanışı cdna Kitaplık Hazırlanışı Uzm.Bio.Veysel Sabri HANÇER İstanbul Üniversitesi Moleküler Biyoloji ve Genetik Doktora Programı 2602043040 Genetik Bilginin İki Kaynağı Vardır; Genomik DNA mrna Ökaryotlardaki

Detaylı

Dilara YILDIRAN. Candida İzolatlarının Tür Düzeyinde. ve MALDI-TOF MS Sistemlerinin Karşılaştırılması. Mikr. Uzm.

Dilara YILDIRAN. Candida İzolatlarının Tür Düzeyinde. ve MALDI-TOF MS Sistemlerinin Karşılaştırılması. Mikr. Uzm. Candida İzolatlarının Tür Düzeyinde Tanımlanmasında Altın Standart Yöntem Olan rdna ITS1/2 Dizi Analizi ile VITEK 2 YEAST ID, API ID 32C ve MALDI-TOF MS Sistemlerinin Karşılaştırılması D i l a r a Y ı

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

BİO 775 PROTEOMİK ve GENOMİK

BİO 775 PROTEOMİK ve GENOMİK 1 BİO 775 PROTEOMİK ve GENOMİK SEQUENCE TAGGED SITES (STSs) EXPRESSED SEQUENCE TAG (ESTs) S. Esin SELÇUK 2006 2 SEQUENCE TAGGED SITES (STSs) STS; genomda 200-300 baz uzunluğundaki kısa bir bölgedir ve

Detaylı

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri

Detaylı

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor!

Uygulamalı. Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları. Yaz Dönemi Başlıyor! Uygulamalı Moleküler Biyoloji Teknikleri, Temel Mikrobiyoloji, Temel Biyokimya ve Laboratuvar Yönetimi Kursları Yaz Dönemi Başlıyor! : DNA izolasyonu, Primer tasarımı, PCR Teknikleri, Agaroz Jel Elektroforezi,

Detaylı

BRCA 1/2 DNA Analiz Paneli

BRCA 1/2 DNA Analiz Paneli FAST-BRCA Sequencing Kit BRCA 1/2 DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR... 3 5

Detaylı

Cisplatin AML Hücrelerinde URG4/URGCP Üzerinden DNA Tamir Mekanizmasını Düzenler Mi?

Cisplatin AML Hücrelerinde URG4/URGCP Üzerinden DNA Tamir Mekanizmasını Düzenler Mi? Cisplatin AML Hücrelerinde URG4/URGCP Üzerinden DNA Tamir Mekanizmasını Düzenler Mi? Doç. Dr. Yavuz Dodurga Yavuz Dodurga 1, Mücahit Seçme 1, Levent Elmas 1, Nazlı Şirin 1, Yasemin Işık Balcı 2 1 Pamukkale

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ

ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ Genetik mühendisliği gelişmeden önce insanlar yapay seçilim yoluyla istenen özelliklerin yavru canlılarda görülmesini sağlamışlardır. Örneğin seçici üretim

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

HPV GENOTİPLENDİRMEDE KULLANILAN YÖNTEMLERDEN KAYNAKLANAN SORUNLAR VE TARTIŞMALAR

HPV GENOTİPLENDİRMEDE KULLANILAN YÖNTEMLERDEN KAYNAKLANAN SORUNLAR VE TARTIŞMALAR HPV GENOTİPLENDİRMEDE KULLANILAN YÖNTEMLERDEN KAYNAKLANAN SORUNLAR VE TARTIŞMALAR Paşa GÖKTAŞ, Şafak GÖKTAŞ, Nilay MALKOÇ Gelişim Tıp Laboratuvarları Moleküler Mikrobiyoloji Ünitesi, Kızıltoprak, İSTANBUL

Detaylı

Revers-Transkriptaz Polimeraz Zincir Reaksiyonu (RT-PCR) ve Uygulama Alanları

Revers-Transkriptaz Polimeraz Zincir Reaksiyonu (RT-PCR) ve Uygulama Alanları ARŞİV 2003; 12:138 Revers-Transkriptaz Polimeraz Zincir Reaksiyonu (RT-PCR) ve Uygulama Alanları Araş.Gör.Burcu OKUTUCU* Yrd.Doç.Dr.Sacide PEHLİVAN** DNA replikasyonu yani DNA nın kendini eşlemesi, DNA

Detaylı

Konak ve Patojen İlişkisinde Genom, Metagenom ve Transkriptomik İnceleme

Konak ve Patojen İlişkisinde Genom, Metagenom ve Transkriptomik İnceleme Konak ve Patojen İlişkisinde Genom, Metagenom ve Transkriptomik İnceleme Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Konak-Patojen İlişkisi- Biyolojik Yolaklar - Big Data

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz.

Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz. 1 / 61 Malzeme Kodu : JENL0643 PRIMER DIZILEME 50 NMOL SATINALMA BİLGİSİ (ŞARTNAME) (*) 31158 1. Primer Dizileme Teknik Şartnamesi a. 50 nanomol konsantrasyonda olmalıdır. b. IDT marka veya bu standarttaki

Detaylı

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml

Detaylı

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013)

Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TB101 Çiğdem Yamaner (Yrd. Doç. Dr.) 3. Hafta (01.10.2013) ADÜ Tarımsal Biyoteknoloji Bölümü 1 DNA moleküllerinin analizinde çok çeşitli yöntemler

Detaylı

YURTDIŞI GEÇİCİ GÖREV DÖNÜŞÜ BİLGİLENDİRME TOPLANTISI Sunan: Dr. Suat KAYMAK. Zirai Mücadele Merkez Araştırma Enstitüsü Müdürlüğü.

YURTDIŞI GEÇİCİ GÖREV DÖNÜŞÜ BİLGİLENDİRME TOPLANTISI Sunan: Dr. Suat KAYMAK. Zirai Mücadele Merkez Araştırma Enstitüsü Müdürlüğü. YURTDIŞI GEÇİCİ GÖREV DÖNÜŞÜ BİLGİLENDİRME TOPLANTISI Sunan: Dr. Suat KAYMAK Zirai Mücadele Merkez Araştırma Enstitüsü Müdürlüğü 28 Ağustos 2013 Giriş Sunum Planı Mikrobiyal Adli Bilimler & Gıda ve Tarım

Detaylı

MEME KARSİNOMUNDA HER2/NEU DURUMUNU DEĞERLENDİRMEDE ALTERNATİF YÖNTEM: REAL TİME-PCR

MEME KARSİNOMUNDA HER2/NEU DURUMUNU DEĞERLENDİRMEDE ALTERNATİF YÖNTEM: REAL TİME-PCR MEME KARSİNOMUNDA HER2/NEU DURUMUNU DEĞERLENDİRMEDE ALTERNATİF YÖNTEM: REAL TİME-PCR Nuket Eliyatkın Hakan Özgür Pınar Erçetin Safiye Aktaş Ali Küpelioğlu Sunum Planı Meme Kanserinde HER2 nin yeri HER2

Detaylı

Yeni Nesil Dizileme Prensipleri

Yeni Nesil Dizileme Prensipleri 1 2 3 7 8 9 4 5 6 Yeni Nesil Dizileme Prensipleri Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD NGS Yeni Nesil Dizi Analizi Next Generation Sequencing Massively Parallel Sequencing

Detaylı

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ

Nükleik asitler. Deoksiribonükleik asit Ribonükleik asit 18.11.2008. DNA nın YAPISI ve ÖZELLİKLERİ Nükleik asitler Sıcaklıkla öldürülmüş S suşları Canlı R suşlarını canlı S suşuna dönüştürür a) Farelere virulan S suşu enjekte edildiğinde ölür b) R suşu enjekte edildiğinde yaşar c) Isıyla öldürülmüş

Detaylı

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya

Detaylı

TÜBERKÜLOZ TANISINDA PCR

TÜBERKÜLOZ TANISINDA PCR 21. Yüzyılda Tüberküloz Sempozyumu ve II. Tüberküloz Laboratuvar Tanı Yöntemleri Kursu, Samsun TÜBERKÜLOZ TANISINDA PCR Doç. Dr. Cafer EROĞLU Ondokuz Mayıs Üniversitesi Tıp Fakültesi Klinik Mikrobiyoloji

Detaylı

HIZLI YÖNTEMLER (III)

HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla

Detaylı

XXVII. ULUSAL BİYOKİMYA KONGRESİ

XXVII. ULUSAL BİYOKİMYA KONGRESİ XXVII. ULUSAL BİYOKİMYA KONGRESİ TİP2 DİYABETİK RATLARDA Vitis vinifera L. EKSTRAKTININ PIK3R1 (phosphatidylinositol 3-kinase regulatory subunit 1) GEN İFADESİ ÜZERİNE ETKİSİ 1 Emine Gülsün CAN 1 Emine

Detaylı

100% by Content, %)

100% by Content, %) Dersin Adı Rekombinant DNA Teknolojisi Course Name Recombinant DNA Technology Ders Uygulaması, Saat/Hafta (Course Implementation, Hours/Week) Kodu Yarıyılı Kredisi AKTS Kredisi Ders Uygulama Laboratuar

Detaylı

2008 N b e T ı ödülü Harald Zur Hausen

2008 N b e T ı ödülü Harald Zur Hausen HPV Human Papilloma Virüs Dr. Tutku TANYEL Düzen Laboratuvarlar Grubu Ekim / 2008 2008 Nobel Tıp ödülü Harald Zur Hausen Prof. Dr. Harald zur Hausen 1981 den itibaren 1. HPV nin birçok genotipi olduğunu

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu

DNA REPLİKASYONU. Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Yrd.Doç.Dr. Seda Örenay Boyacıoğlu DNA REPLİKASYONU Replikasyon genetik materyelin tamamen kendi benzeri yeni bir molekül oluşturma işlemidir. DNA kendini eşleyebilen yegane biyomoleküldür

Detaylı

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ

MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ MOLEKÜLER TANI VE TİPLENDİRME YÖNTEMLERİ Doç.Dr. Aynur KARADENİZLİ Kocaeli Üniversitesi Tıp Fakültesi, Mikrobiyoloji ve Klinik Mikrobiyoloji AD, Kocaeli Francisella tularensis Küçük, aerobik, pleomorfik,

Detaylı

RTA DNA qpcr Probe Master Mix

RTA DNA qpcr Probe Master Mix RTA DNA qpcr Probe Master Mix Kullanma Kılavuzu Yayın Tarihi -- 2012-01 DNA'nın gerçek zamanlı tayini ve miktar ölçümü için Yalnızca profesyonel kullanım için REF 09030025 25 test 09030100 100 test 09030500

Detaylı

* İleri Teknoloji Uygulama ve Araştırma Merkezi, Önceden Haber Vermeksizin Ücretleri ve/veya Ücretlendirme Sistemini Değiştirme Hakkına Sahiptir.

* İleri Teknoloji Uygulama ve Araştırma Merkezi, Önceden Haber Vermeksizin Ücretleri ve/veya Ücretlendirme Sistemini Değiştirme Hakkına Sahiptir. Cumhuriyet Üniversitesi İleri Teknoloji Uygulama ve Araştırma Merkezi (CÜTAM) 2017 Yılında Döner Sermaye Kapsamında Gerçekleştirilecek Analizler için Fiyat Listesi Başvuru Yapan Kuruma Bağlı Olarak Analiz

Detaylı

Sekansın Temelleri ve Sekans Bazlı Çalışma Doç. Dr. Fatih Özaltın Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Nefroloji Ünitesi Nefrogenetik Laboratuvarı TİGED-24 Nisan 2011 Dalaman Çekirdekte DNA kromatin

Detaylı

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim

Detaylı

Moleküler Metodlar ve Myeloma. Dr. Güray Saydam Ege Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı guray.saydam@ege.edu.tr

Moleküler Metodlar ve Myeloma. Dr. Güray Saydam Ege Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı guray.saydam@ege.edu.tr Moleküler Metodlar ve Myeloma Dr. Güray Saydam Ege Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı guray.saydam@ege.edu.tr Çalışmalarımın katıksız hayal ürünü olduklarının söylendiğini duydum. Fransa

Detaylı

Proteomiks Yaklaşımlar Uygulama Alanları ve Hizmetlerimiz. Timuçin AVŞAR Proje Geliştirme Koordinatörü

Proteomiks Yaklaşımlar Uygulama Alanları ve Hizmetlerimiz. Timuçin AVŞAR Proje Geliştirme Koordinatörü Proteomiks Yaklaşımlar Uygulama Alanları ve Hizmetlerimiz Timuçin AVŞAR Proje Geliştirme Koordinatörü Sunum Başlıkları Proteomiks Nedir? Neden Proteomiks? Nasıl çalışılır? Uygulama Alanları Proteomiks

Detaylı

TRANSLASYON VE TRANKRİPSİYON

TRANSLASYON VE TRANKRİPSİYON TRANSLASYON VE TRANKRİPSİYON GEN İFADESİ (GEN EKSPRESYONU) Gen ifadesinin düzenlenmesi çeşitli aşamalarda olur: 1) Primer transkriptlerin oluşumu 2) Primer mrna dan matür (olgun) mrna oluşumu 3) mrna nın

Detaylı

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03. Laboratuvar Tekniği Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.2014) 1 5. Haftanın Ders İçeriği DNA ekstraksiyonu DNA ekstraksiyonunun amacı

Detaylı

BAKTERİLERİN GENETİK KARAKTERLERİ

BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür

Detaylı

Amasya Üniversitesi Merkezi Araştırma Uygulama Laboratuvarı Uygulama ve Araştırma Merkezi 2017 Yılı Analiz Fiyat Listesi

Amasya Üniversitesi Merkezi Araştırma Uygulama Laboratuvarı Uygulama ve Araştırma Merkezi 2017 Yılı Analiz Fiyat Listesi Amasya Üniversitesi Merkezi Araştırma Uygulama Laboratuvarı Uygulama ve Araştırma Merkezi 2017 Yılı Analiz Fiyat Listesi GAZ KROMATOGRAFİSİ ANALİZLERİ (GC/FID) GC Kalitatif 50 TL 75 TL 100 TL GC Kantitatif

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

Hücre Biyoloji Laboratuarı Güz dönemi Alıştırma Soruları (Dr.Selcen Çelik)

Hücre Biyoloji Laboratuarı Güz dönemi Alıştırma Soruları (Dr.Selcen Çelik) Hücre Biyoloji Laboratuarı 2014-2015 Güz dönemi Alıştırma Soruları (Dr.Selcen Çelik Konular: ph ve tamponlar, hücre kültür tekniği, mikrometrik ölçüm ph ve Tamponlar 1. ph sı 8.2 olan 500 ml. 20mM Tris/HCl

Detaylı

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü

Moleküler Nematoloji. Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Moleküler Nematoloji 27.08.2014 Eğitim Süresi: 6 ay (29 Aralık 2013 29 Haziran 2014) Eğitim Yeri: Kaliforniya Üniversitesi, Davis Bitki Bilimleri Bölümü Dr. Gülden HASPOLAT gulden.haspolat@gthb.gov.tr

Detaylı

SAGE ve PROTEOMİK. Ayşen Günel-Özcan Kırıkkale Üniversitesi Tıp Fakültesi Tıbbi Biyoloji ve Genetik Anabilim Dalı

SAGE ve PROTEOMİK. Ayşen Günel-Özcan Kırıkkale Üniversitesi Tıp Fakültesi Tıbbi Biyoloji ve Genetik Anabilim Dalı SAGE ve PROTEOMİK Ayşen Günel-Özcan Kırıkkale Üniversitesi Tıp Fakültesi Tıbbi Biyoloji ve Genetik Anabilim Dalı 1 Takifugu rubripes (400 Mb) Homo sapiens (3000 Mb) 2 Replikasyon DNA Transkripsiyon Metilasyon

Detaylı

Türkiye Maternal Fetal Tıp ve Perinatoloji Derneği VIII.Kongresi 11-14 Ekim 2012, İstanbul

Türkiye Maternal Fetal Tıp ve Perinatoloji Derneği VIII.Kongresi 11-14 Ekim 2012, İstanbul İstanbul Üniversitesi Fetal Nükleik Asit Araştırma Grubu Sonuçları Türkiye Maternal Fetal Tıp ve Perinatoloji Derneği VIII.Kongresi 11-14 Ekim 2012, İstanbul sfetal DNA Lo ve ark. 1997 yılında anne plazma

Detaylı

DNA Mikroarrayler: SNP analizleri

DNA Mikroarrayler: SNP analizleri Hafta IX Genombilimde Mikrodizin Uygulamaları ve iyoinformatik Analiz DNA Mikroarrayler: SNP analizleri Doç. Dr. Hilâl Özdağ DNA Mikrodizin Genomik Dizi SNP 5 T / G 3 SNP prob = 25 baz Perfect Match Mismatch

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

XIX. KÖK HÜCRE ve DOKU MÜHENDİSLİĞİ KURSU:

XIX. KÖK HÜCRE ve DOKU MÜHENDİSLİĞİ KURSU: XIX. KÖK HÜCRE ve DOKU MÜHENDİSLİĞİ KURSU: TEMEL TEKNİKLER ve MOLEKÜLER BİYOLOJİ UYGULAMALARI 16-20 KASIM 2015 KOU-KÖGEM KURS BAŞKANI: KURS SEKRETERİ: Doç. Dr. Yusufhan YAZIR Uzm. Bio. Ayşegül BAĞLAR KURS

Detaylı

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara 24-25 Şubat 2011, İzmir Sunum Planı Teorik

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir

Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir DNA REPLİKASYONU Hücre Neden DNA sını Replike Eder? ÇÜNKİ Mitoz Bölünmenin Gerçekleşmesi İçin S Evresinde DNA nın 2 Katına Çıkması Gerekmektedir Hücre yaşam döngüsü G 1, S, G 2, Mitoz,evreleri ile tamamlar.

Detaylı

Gen Klonlanması. & DNA kütüphanelerinin oluşturulması. Mikrobiyoloji Anabilim Dalı

Gen Klonlanması. & DNA kütüphanelerinin oluşturulması. Mikrobiyoloji Anabilim Dalı 8. Ha&a Gen Klonlanması & DNA kütüphanelerinin oluşturulması Mikrobiyoloji Anabilim Dalı Gen Klonlanması Klonlama ne demektir? Gen klonlaması nedir? Bütün bir organizmayı klonlamadan farkı nedir? Gen klonlaması

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

Mikrosatellitler ve Kullanım Alanları

Mikrosatellitler ve Kullanım Alanları Hayvansal Üretim 41: 9-14 (2000) Mikrosatellitler ve Kullanım Alanları Cemal Ün Klaus Wimmers Siriluck Ponsuksili Friedrich Schmoll Karl Schellander Institute of Animal Science, University of Bonn, Germany

Detaylı

XX. KÖK HÜCRE ve DOKU MÜHENDİSLİĞİ KURSU:

XX. KÖK HÜCRE ve DOKU MÜHENDİSLİĞİ KURSU: XX. KÖK HÜCRE ve DOKU MÜHENDİSLİĞİ KURSU: TEMEL TEKNİKLER ve MOLEKÜLER BİYOLOJİ UYGULAMALARI 7-11 ARALIK 2015 KOU-KÖGEM KURS BAŞKANI: KURS SEKRETERİ: Doç. Dr. Yusufhan YAZIR Uzm. Gen. Müh. Sema YUSUFOĞLU

Detaylı

Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz.

Bu Döküman Uludağ Üniversitesi Rektörlüğü'ne aittir. Başkaları tarafından kullanılamaz ve çoğaltılamaz. 1 / 107 Malzeme Kodu : JENL1243 33893 BCR-ABL T(9;22) TRANSLOKASYON 2 SUBTIPIN BELIRLENMESI ICIN KANTITATIF PCR KITI.SUBTIPLER:P190 (MBCR), P210 (MBCR) (TEST/KUTU) SATINALMA BİLGİSİ (ŞARTNAME) (*) Düzenleme

Detaylı

Dokuz Eylül Üniversitesi Onkoloji Enstitüsü. Prof.Dr.Nur Olgun

Dokuz Eylül Üniversitesi Onkoloji Enstitüsü. Prof.Dr.Nur Olgun Dokuz Eylül Üniversitesi Onkoloji Enstitüsü Prof.Dr.Nur Olgun (THE 5th APOCP,April 3-7,2010, Istanbul, TURKEY) (19.UKK poster) Prevantif Onkoloji AD Etkinlikleri I.Basamak Hekimlerine Yönelik Kanser

Detaylı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans

Detaylı

Gen Anlatımının Kantitatif Analizi Real-Time PCR

Gen Anlatımının Kantitatif Analizi Real-Time PCR BĐLĐMSEL MEKTUP / SCIENTIFIC LETTER. Gen Anlatımının Kantitatif Analizi Real-Time PCR QUANTITATIVE ANALYSIS OF GENE EXPRESSION REAL-TIME PCR : SCIENTIFIC LETTER Dr. Tuba GÜNEL a A Moleküler Biyoloji ve

Detaylı

DNA Teknolojisi ve Genomikler

DNA Teknolojisi ve Genomikler DNA eknolojisi ve enomikler PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero enel Bakış: enomların anlaşılması ve manüple edilmesi Modern bilimin en

Detaylı

T. C. MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ TIP FAKÜLTESİ

T. C. MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ TIP FAKÜLTESİ T. C. MUĞLA SITKI KOÇMAN ÜNİVERSİTESİ TIP FAKÜLTESİ 2016 2017 EĞİTİM - ÖĞRETİM YILI DÖNEM I HÜCRE BİLİMLERİ 3 DERS KURULU ( 3. ) DERS KURULU (6 Şubat 2017-31 Mart 2017) DERS PROGRAMI T. C. MUĞLA SITKI

Detaylı

ÇOKLU RNA TRANSKRİPTLERİNİN ÖLÇÜMÜ KARŞILAŞTIRMASI

ÇOKLU RNA TRANSKRİPTLERİNİN ÖLÇÜMÜ KARŞILAŞTIRMASI 1 ÇOKLU RNA TRANSKRİPTLERİNİN ÖLÇÜMÜ KARŞILAŞTIRMASI Sema AKYÜREK* Müslüm AKGÖZ** TÜBİTAK UME, Barıs Mah. Dr. Zeki Acar Cad. Pk54, 41470 Gebze/KOCAELİ Tel: 0262 679 50 00 E-mail* : sema.akyurek@tubitak.gov.tr

Detaylı

Prof. Dr. Nermin Gözükırmızı

Prof. Dr. Nermin Gözükırmızı Biyoloji Araştırmaları, Moleküler Boyutu ve Önceliklerimiz Prof. Dr. Nermin Gözükırmızı İstanbul Üniversitesi Fen Fakültesi, Moleküler Biyoloji ve Genetik Bölümü nermin@istanbul.edu.tr, http://www.istanbul.edu.tr/fen/mbg/personel.php?id=30

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Moleküler Biyoloji Lab. Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

Kistik Fibrozis DNA Analiz Paneli

Kistik Fibrozis DNA Analiz Paneli FAST-CFTR Sequencing Kit Kistik Fibrozis DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...

Detaylı

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması

Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması İ.Ü. CERRAHPAŞA TIP FAKÜLTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ TIBBİ BİYOLOJİ ANABİLİM DALI Parkinson Hastalığı ile α-sinüklein Geni Polimorfizmlerinin İlişkisinin Araştırılması Araş.Gör. Yener KURMAN İSTANBUL

Detaylı

J Popul Ther Clin Pharmacol 8:e257-e260;2011

J Popul Ther Clin Pharmacol 8:e257-e260;2011 SİTOMEGALOVİRUS (CMV) Prof. Dr. Seyyâl ROTA Gazi Ü.Tıp Fakültesi LOW SYSTEMIC GANCICLOVIR EXPOSURE AND PREEMPTIVE TREATMENT FAILURE OF CYTOMEGALOVIRUS REACTIVATION IN A TRANSPLANTED CHILD J Popul Ther

Detaylı

DNA REPLİKASYONU. Dr. Mahmut Cerkez Ergoren

DNA REPLİKASYONU. Dr. Mahmut Cerkez Ergoren DNA REPLİKASYONU Dr. Mahmut Cerkez Ergoren Arthur Kornberg 1959 Nobel Ödülü "the mechanisms in the biological synthesis of DNA DNA Replikasyonu Replikasyon genetik materyalin tamamen kendi benzeri yeni

Detaylı

ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ

ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ PROF.DR.OĞUZ ÖZTÜRK İSTANBUL ÜNİVERSİTESİ DENEYSEL TIP ARAŞTIRMA ENSTİTÜSÜ (DETAE) MOLEKÜLER TIP ANABİLİM DALI Bal ve Diğer Arı Ürünleri ile Sağlıklı Yaşam Platformu

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler)

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) PROKARYOTLARDA GEN EKSPRESYONU ve REGÜLASYONU (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) Nihal EYVAZ (050559015) Şerife OKAY (050559025) Prof. Dr. Figen ERKOÇ Gazi Eğitim Fakültesi Gen

Detaylı