Ebat: px
Şu sayfadan göstermeyi başlat:

Download ""

Transkript

1 KOMPERATİF GENOMİK Principles of Genome Analysis and Genomics S.B. Primrose and R.M. Twyman Bölüm 7 s

2 Amacı; farklı organizmaların genom yapısındaki farklılık ve benzerliklerin ortaya çıkarılmasıdır. İnsanlar ve diğer organizmalar arasındaki farklılıklar bizim genomumuza nasıl yansıtılır? İnsanlar, meyve sinekleri, solucanlar, bitkiler, mayalar ve bakterilerde proteinlerin sayı ve tipleri ne kadar benzerdir? sorularına cevap aranmaktır.

3 Önemli hücresel fonksiyonları kodlayan DNA dizilerinin türler arasında korunmuş oluşabileceği mantığı temel alınarak; *Birincisi kaba düzeyde, yani organizmanın orijinin belirlenmesi *İkincisi lokal düzeyde evrim sürecinin anlaşılması komperatif genomik analizleri ile ortaya çıkarılabilmektedir.

4 Karşılaştırma yapılabilecek ideal türler; *şekli, *fizyolojisi *davranışı mümkün olabildiği kadar benzer olanlar ile *genomları fonksiyonel olmayan dizilerin ayrılması için yeterli zamana sahip olacak kadar yavaş evrimleşmiş olan türlerdir.

5 Farklı organizmalarda genom organizasyonunu karşılaştırmak için ; Ortolog Paralog genlerin ayırdedilmesi gereklidir. Ortologlar; aynı fonksiyonu kodlayan ve vertikal alçalma ile yavaş evrimleşen farklı organizmalardaki homolog genlerdir. Ortologlar mutasyonların yavaş olarak birikmesi ile ortaya çıkar. Paraloglar; benzer fakat özdeş olmayan fonksiyonları kodlayan bir organizmadaki homolog genlerdir. Paraloglar mutasyon birikiminin ardından gen duplikasyonu ile meydana gelir.

6 Tüm canlı organizmalarda veya çoğunda ortak olan birçok biyokimyasal aktivite vardır: örneğin sitrik asit döngüsü, ATP üretimi, nükleotit sentezi, DNA replikasyonu, vs. Her bir durumda anahtar proteinlerin ortolog olacağı düşünülebilir. evrensel protein aileleri nin tüm archae, eubacteria ve ökaryotlar tarafından paylaşıldığı tanımlanmıştır.

7 Protein evrimi Protein dizilerinin ve üç-boyutlu yapılarının analizi, çoğu proteinin farklı domainlerden oluştuğunu göstermiştir. Mozaik proteinler olarak adlandırılan proteinler metazoalarda fazla bulunmaktadır. Mozaik proteinlerin başlıcaları ekstrasellüer veya membrana bağlı proteinlerin ekstrasellüler parçalarını oluştururlar ve bu nedenle çok hücreliliğin evriminde önemli bir rol oynayabilirler. Mozaik proteinin tek tek domainleri evrimsel olarak hareketlidir, bunun anlamı evrim sürecinde yayılırlar ve akraba olmayan proteinlerde ortaya çıkarlar.

8 Mozaik proteinler metazoada en yaygın olmasına rağmen tek hücreli organizmalarda da bulunur. Üç ana alemin temsilcilerini içeren (Archaea, Eubacteria ve Eukarya) çok sayıda mikrobiyal genom sekanslandığı için domainlerin evrimsel hareketliliğini belirlemek olasıdır.

9 Prokoryatlarda karşılaştırmalı genomik Genom büyüklüğü 0.58 Mb (Mycoplasma genitalism) ile 8 Mb (Saccharopolyspora erythraea) arasında değişiklik gösterir. Gen yoğunluğu, tüm türler karşısında belirgin şekilde benzerdir ve yaklaşık DNA nın her kilobazı 1 gendir. Büyük prokaryotik genomlar küçük olanlardan daha fazla gen içerir. Bunun tersi, insan genomu Drosophila nın sadece iki katı gen içerir.

10 Genomlarının tamamı sekanslanmış eubacteria ve archaebacteri lerin genom büyüklükleri

11 Minimal Genom M. genitalium un genomu 0.58 Mb dir ve bugüne kadar tanımlanan en küçük dizidir. Serbest yaşayan hücresel organizmayla uyumlu minimal genom nedir? Minimal genomu belirlemek için minimal protein seti tanımlanmalıdır.

12 Minimal protein seti Ortolog gruplar ve buna ek olarak gen duplikasyonu takiben seçici gen kaybının olduğu paralogları içeren genlerin clusterları tanımlanarak belirlenebilir. Bu yöntem 4 eubacteria, bir archaebacteria ve bir mayaya uygulandığında ortolog gruplarının 816 clusterı (COGs) tanımlandı. Bunların 327 si üç alemin temsilcilerini içermektedir (Mushegian 1999). 327 protein seti temel alınarak tüm anahtar biyosentetik yolları yeniden oluşturmak mümkündür. Bu analiz 3 archeabacteria ve 12 eubacteriadan elde edilen dizi datası ile tekrar edildiğinde minimal protein seti 322 COG ye düşürüldü.

13 Büyük genomların n analizi Genel kural olarak prokaryotik genom büyüklüğü arttıkça paralog sayısının artması da beklenir. ORF sayısı ve büyüklükleri kıyaslanır.

14 Horizontal gen transferi Horizontal, veya lateral, gen transferi, farklı evrimsel soylar arasındaki genetik değişimdir. İki bakteriyel termofilin genom analizi, genlerin %20-25 inin eubacteriadan ziyade archaebacteria genlerine daha benzer olduğunu göstermiştir. Bu arkaeal-benzeri genler genomdaki clusterlarda oluşmuştur ve belirgin farklı nükleotid kompozisyonuna sahiptir ve horizontal gen transfer ile ortaya çıkabilmektedir. Garcia-Vallve et al. (2000) tüm genom genlerinin horizontal gen transferi aracılığıyla kazanılıp kazılmadığını saptamak için istatistik yöntemi geliştirmişlerdir. Bu yöntem, G+C içeriği, kodon kullanımı, amino asit kullanımı ve gen pozisyonu analizini temel alır. Bu yöntem, 24 sekanslanmış genoma uygulandığında genlerin % unun horizontal olarak transfer edildiğini ve bu genlerin çoğunun sadece bir veya iki soyda var olduğunu göstermiştir.

15 Akraba bakterilerde karşılaştırmalı genomik Çok yakın akrabalarda, gen içeriği ve gen sırasının karşılaştırılması ile bugünün bakteri populasyonunun şekillenmesini sağlayan evrimsel işlemlerin anlaşılması daha kolaylaşmıştır. Evrimsel terimlere göre, en yakın akraba organizmalar, aynı türün farklı izolatlarıdır. Alm et al. (1999) Helicobacter pylori nin iki soyunun tüm sekansını karşılaştırmışlardır ve her soy için özgül olan genlerin sadece %6 sının çok benzer olduğunu bulmuşlardır. H. pylori, genomunun %4 ünden fazlası restriksiyon modifikasyon (R-M) sistemlerini kodlar. R-M genlerinin çoğu her iki suşta da ortak olmasına rağmen, fonksiyonel olan genler iki suşta farklıdır. Suşa spesifik genlerin tümü aktifken, paylaşılan genlerin çoğu inaktiftir. Bu sonuçlar, H. pylori nin daima yeni R-M sistemleri kazandığını ve eskilerini inaktive ettiğini göstermektedir.

16 Karşılaştırmanın bir sonraki düzeyi, aynı cinsin farklı türleri arasındaki benzerlikleri ve farklılıkların tayinidir Salmonella (S. typhi ve S. typhimurium) nın iki serovarı tamamiyle sekanslanmıştır ve karşılaştırmalar yaygın synteny bulunan diğer yakın akraba olan E. coli ile yapılmıştır. S. typhi ye özgü 601 gen (%13.1) ve S. typhimurium a özgü 479 gen (%10.9) vardır. S. tyhpi ye özgü ve E. coli ye akraba 1505 gen (%32.7) ve E. coli ye özgü S. typhi ye akraba 1220 gen (%28.4). Fark, S. typhi de 204 ve diğerinde sadece 39 pseudogenin varlığıdır. S. typhi sadece insanları infekte ederken, S typhimurium memelilerin geniş aralığını enfekte edebilmesidir. Bu pseudogen içeriğindeki farklılığa bağlı olabilir, çünkü S. typhi deki pseudogenlerin çoğu housekeeping fonksiyonlarda yer alır ve virulans elemanlarındadır.

17 Karşılaştırmalı organel genomiği Mitokondriyal genomların karşılaştırılması mtdna tüm ökaryotlarda aynı temel role sahiptir: mtdna fonksiyonel mitokondrinin oluşumu için gerekli olan sınırlı sayıda RNA ve proteinleri kodlar. mtdna nın genetik rolü evrensel olarak korunmuş gibi görünmesine rağmen, bu genom hem konformasyon ve büyüklüğünde, hem de gerçek gen içeriği, düzenleme ve ekspresyonunda varyasyon gösterir

18 atasal ve türemiş mtdna Mitokondrilerin bakteriyal endosimbiyontun soyundan geldiğine inanılır: nukleuslu bir hücrede kurulmuştur ve bir atasal mitokondriyal genom bu eubacterial atasının izlerine sahiptir. Atasal prototip mtdna sı heterotropik kamçılı bir protozoon olan Reclinomonas americana dır. Bu organizmanın mtdna sı, diğer tamamı sekanslanmış mtdna larda bulunan, tüm protein kodlayan genleri içeren 97 gene sahiptir. Türemiş mitokondriyal genomlar, atasal paternden radikal olarak ayrılmışlardır.

19 İntrasellüler gen transferi Mitokondrinin temel fonksiyonu oksidatif fosforilasyon üzerinden ATP üretimidir. En az 21 gen oksidatif fosforilasyon için önemli proteinleri kodlar ve tüm bu genlerin mtdna da yer alması beklenmektedir. Elde edilen sekans dataları, çoğu mitokondriyal genomların anahtar genleri olmadığını göstermektedir ve bu eksik genler nükleusta bulunabilir. 25 farklı legumenin analizi ile bazı cinslerinde mitokondriyal cox2 genin mitokondride yer aldığı, bazılarında nükleusta ve bazılarında ise iki genomda da bulunduğu belirlenmiştir. Her iki genin transkribe edildiği tek bir cins bulunmasına rağmen, genin iki kopyasının bulunduğu çoğu durumda sadece bir gen transkripsiyonel olarak aktiftir.

20 Horizontal gen transferi Grup I intronlar, genetik çaprazlamalarda allelleri içeren intronlardan, alleli olmayan intronlara etkili dağılımı katalizleyen nispeten uzun hedef bölgeleri ile bölgeye özgül endonükleazları kodlar. Bu intron, test edilen 281 angiospermden 48 inin mitokondriyal cox1 geninde saptanmıştır. İntron ve konakçı genom için sekans datasına dayanarak bu intron, bağımsız olarak konakçı bitkilere çapraz-türler arası horizontal transfer aracılığıyla birçok farklı şekilde kazanılmış gibi görünmektedir. Verici ve alıcının her bir bireydeki özdeşlikleri belirlenmiş değildir. Grup I introna zıt olarak, angiosperm mtdnadaki diğer 23 intron grup II ye aittir ve vertikal şekilde iletilmektedir.

21 Ökaryotlarda karşılaştırmalı genomik Minimal ökaryotik genomlar Serbest yaşayan tek hücreli ökaryotun minimal genom büyüklüğü nedir ve minimal bakteriyal genom ile nasıl karşılaştırılması yapılır? Ökaryotik ve prokaryotik bir hücre arasındaki temel genetik farklılıklar nelerdir? Çok hücrelilerin koordinasyonu için ihtiyaç duyulan ilave genetik bilgiler nelerdir? Hayvanlarda, omurgalı genomu ve memeli genomu için minimum büyüklükler nedir? Çiçekli bir bitki için minimum genom büyüklüğü nedir? Çoğu ökaryotik genom, büyük miktarda kodlanmayan DNA içerir ve bu sorular hem genom büyüklüğü hem de kodlanan protein sayısı dikkate alınarak cevaplandırılmalıdır.

22 Ökaryotik bir parazit olan Encephalitozoon cuniculi genomu 2.9 Mb ve yakın akrabası olan Encephalitozoon intestinalis in genomu 2.3 Mb Bu genomlar rdna dan çok az repetitif DNA ve 2000 den daha az gen içermektedir. Çok hücreli organizmalardan Arabidopsis, Caenorhabditis ve Drosophila benzer sayıda protein ( ) kodlar. Bu, çok çeşitli çok hücreli ökaryotların gelişimi gerçekleştirmek ve çevresine tepki vermek için gereksinim duyulan minimal karmaşıklık olabilir. Omurgalılar arasında, Japon puffer fish (Fugu rubripes) bugüne kadar tanımlanan en küçük genoma sahiptir, fakat insan gibi diğer omurgalılara benzer gen içeriğine sahiptir. Fugu genomunun analizi, genlerinin yoğun olarak paketlendiğini göstermektedir. Bugüne kadar tanımlanan en küçük memeli genomu bir yarasa türü olan Miniopterus genomudur. Genom büyüklüğü insanlarınkinin %50 si kadardır, fakat bu küçüklük genom yoğunlunun ya da genlerin kaybının bir sonucudur.

23 Evrimsel anlamda oldukça uzak olan organizmaların genomlarının repetitif elementlerinin sayı ve tipleri karşılaştırılır. Çünkü bunlar gen sayılarından ziyade genom büyüklüğündeki başlıca farklılıkları açıklamaktadır.

24 Gen düzeyinde, intron ve ekzon yapısındaki farklılıklar, belirgin olarak ayrı olan Arabidopsis ile farklı ökaryotik genomlarda görülebilmektedir Üç hayvan genomu karşısında tercih edilen ekzon büyüklüğünün korunması, splaysing mekanizmasının ekzona dayalı içeriğinin korunmuş olduğunu göstermektedir.

25 Çoğu ökaryotik proteinler çok sayıda farklı domainlerden oluşur. *Genom sekanslarının analizi insan proteinlerinde tanımlanan domainlerin %90 ından fazlasının Drosophila ve Caenorhabditis proteinlerinde de bulunduğunu ortaya çıkarmıştır. *Bu nedenle, omurgalı evrimi birkaç yeni domainin keşfini gerektirmiştir. Domainlerin yeni kombinasyonları bazı yeni proteinler oluşturmaktadır. Çoğu proteinler domainlerin mozaikleri olmasına rağmen, sekanslanan genomların herhangi biri tarafından kodlanan proteinlerin yüksek yüzdesi diğer sekanslanan genomlarda ortoloğa sahiptir. *Örneğin, tahmin edilen insan proteinlerinin %60 ının maya, sinek, nematod veya bitki proteinlerinde dizi benzerliği vardır ve sinek proteinlerinin %61 i, nematod proteinlerinin %43 ü ve maya proteinlerinin %46 sı insan kopyalarına (karşılık) sahiptir.

26 Hem Drosophila hem de Caenorhabditis te ortoloğa sahip 1523 insan proteini vardır

27 Gen sırasının karşılaştırılması Farklı organizmalarda gen sırasının karşılaştırılması moleküler filogeniyi geliştirmek için kullanılan çoğu araçtan biridir. Ökaryotlarda inversiyonların oranı prokaryotlardakinden daha yüksektir ve transkripsiyonun yönünün gen oryantasyonu üzerine etkisi daha azdır. Synteninin başlıca faydası, çok iyi haritalanmış organizmadaki gen lokasyonu hakkındaki bilginin iyi haritalanmamış akrabalarında aynı genin yerini bulmak için kullanılabilmesidir.

28 Bakterilerden lateral gen transferi Tüm insan DNA dizisinin ayrıntılı incelenmesi, 113 ile 223 arasındaki genin bakterilerden insanlara veya dört omurgalı atasından birine transfer edildiğini göstermiştir. Lateral gen transferinin kanıtı, bakteriyal genlere çok benzer dizilerin insan genomunda bulunurken omurgasızlarda bulunmamasıdır. Bakterilerden lateral gen transferinin olasılığını yeniden saptamak için her bir aday gen için filogenetik ağaçlar oluşturulur. Eğer omurgalı bir gen dizisi, bakteriyal dizilerin clusterında kısa diziler halinde yer alıyorsa gen lateral olarak bakteriden transfer edilmiştir. Benzer lateral gen transferinin bir olası örneği putativite N-acetylneuraminate lyase genidir.

29

30 Filogenetik footprinting Protein sekansları DNA dizilerinden daha yavaş hızda evrim geçirdiği ve bu nedenle ortolog ve parologları protein düzeyinde saptamak daha kolay olduğu için protein dizilerinin karşılaştırılması ile daha fazla ilgilenilmektedir. DNA dizilerinin karşılaştırılması bilgilendirici olabilir, çünkü gen sekansları, kodlanmayan DNA dizilerinden daha yavaş evrimleşme eğilimindedir. Komperatif DNA sekans analizi genler, düzenleyici diziler, splays bölgeler ve bağlanma bölgeleri gibi fonksiyonel elementleri tanımlamak için mutasyon oranlarındaki bu lokal farklılıktan faydalanır. Bu, filogenetik footprinting olarak bilinen bir işlem olan ortolog DNA sekanslarının saptanması ile gerçekleştirilir.

31 Yeni genlerin kaynağı nedir? Sekanslanmış ökaryotik genomların analizleri prokaryotlarda karşılığı olmayan binlerce geni kodladığını göstermektedir. Bu genlerin kaynakları nelerdir? Çoğu yeni gen modifiye edilmiş eski bir gen olabilir. *von Willebrand A, fibronektin tip III, immünoglobulin ve SH3 modülleri gibi protein-protein etkileşimlerinde yer alan domainler yüksek ökaryotlarda büyük proliferasyon gösterir, fakat prokaryotlar ve düşük ökaryotlarda homologlara sadece uzak bir akrabalık vardır.

32 Yeni ökaryotik domainlerin çoğunun α- helikal yapıda olması, bu domainlerin, prokaryotlarda ve özellikle ökaryotlarda çok fazla bulunan, kondanse sarılmış yapılardan yavaş yavaş evrimleşmiş olabileceğini gösterir. Yeni genlerin bir kaynağı transpozable elementler olabilir. *Nekrutenko & Li (2001) protein kodlayan bölgelerde bir yada birçok transpozable elementlere sahip ve insan ve rat ortologları olmayan iki fare geni bulmuşlardır. Bu nedenle, transpozable elementlerin insersiyonu yeni genler oluşturabilmektedir.

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Gen Organizasyonu ve Genomların Evrimi

Gen Organizasyonu ve Genomların Evrimi GENETĐK 111-503 Gen Organizasyonu ve Genomların Evrimi Doç. Dr. Hilâl Özdağ 1 RNA nın Kendi Kendini Kopyalayabiliyor Olmalıydı Đlkin zamanlardaki RNA dünyasında RNA moleküllerinin kopyalanması. RNA polimerazlar

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Evrimsel açıdan genlerin çoğaltılmasının önemi ilk defa Haldane (1932) ve Muller (1935 ) tarafından önerildi ve tanımlandı. *Evrimsel açıdan bir genin

Detaylı

FİLOGENİ ve HAYAT AĞACI

FİLOGENİ ve HAYAT AĞACI FİLOGENİ ve HAYAT AĞACI Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER Giriş Filogenetik veriler ile canlılar arasında oluşturulan akrabalık ilişkileri, canlılığın gelişimine dair bize akrabalık ağaçlarını

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky.

Fatih Dikmen. Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky. Evrimsel Perspektifte KARŞILAŞTIRMALI GENOMİK Fatih Dikmen http://cigbrowser.berkeley.edu/ Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky Santral Dogma kavramı 1958

Detaylı

TRANSLASYON ve PROTEİNLER

TRANSLASYON ve PROTEİNLER TRANSLASYON ve PROTEİNLER Prof. Dr. Sacide PEHLİVAN 13 Aralık 2016 mrna daki baz sırasının kullanılarak amino asitlerin doğru sıra ile proteini oluşturmasını kapsayan olayların tümüne Translasyon veya

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

LABORATUVAR 4: ÖKARYOTİK HÜCRELER

LABORATUVAR 4: ÖKARYOTİK HÜCRELER LABORATUVAR 4: ÖKARYOTİK HÜCRELER Ökaryotik hücreler, sahip oldukları hücre iskeleti, nüklear membran ve organelleri içeren bölümleri ile prokaryot hücrelerden ayırt edilebilmektedir. Kimyasal analizler

Detaylı

Model Organizmalar. Yusuf DOĞAN

Model Organizmalar. Yusuf DOĞAN Model Organizmalar Yusuf DOĞAN Model Organizma Nedir? Model organizmalar çeşitli biyolojik olayların anlaşılması için üzerinde çalışılan bir türdür. Bu organizmaları laboratuvar ortamında üretmek ve üretimlerini

Detaylı

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik hücreler, transkripsiyondan sonra RNA yı değişikliğe uğratırlar

Detaylı

Mustafa EMREM

Mustafa EMREM Mustafa EMREM 162161022 Bakterilerdeki transformasyonun ilk kanıtları İngiliz bilim adamı Frederick Griffith tarafından elde edilmiştir. Genetik materyal aktarımı Dikey Gen Transferi ebeveyn ile yavru

Detaylı

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI Moleküler biyolojiye giriş Doç.Dr.Pınar AKSOY SAĞIRLI Molecular biology terimi ilk kez Warren Weaver tarafından 1938 de kullanıldı. Hayatın fiziksel ve kimyasal olarak açıklanması olarak tanımlandı. 1977

Detaylı

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını

Detaylı

Transkripsiyon ve Transkripsiyonun Düzenlenmesi

Transkripsiyon ve Transkripsiyonun Düzenlenmesi MBG 505 BAKTERİ GENETİĞİ Transkripsiyon ve Transkripsiyonun Düzenlenmesi Emrah ÖZÇELİK Ribonükleik asit (RNA) 3 tip RNA Mesajcı RNA (mrna) (genetik seviyede) Transfer RNA (trna) Ribozomal RNA (rrna) (fonksiyonel

Detaylı

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM Burcu GÜNGÖR, Sami ÖZGÜR Balıkesir Üniversitesi Necatibey Eğitim OFMA Biyoloji Eğitimi A.B.D Özet Ders kitapları, hem öğretmenlerin hem öğrencilerin

Detaylı

Ders 10 - Diğer küçük kodlamayan RNA lar

Ders 10 - Diğer küçük kodlamayan RNA lar Ders 10 - Diğer küçük kodlamayan RNA lar ü Yüksek organizmalar ait proteomlar nispeten durağandır. ü Bir bireyde diğer insanlara göre her haploid genomun ~3.000.000 dizisinin farklı olmasına rağmen, bu

Detaylı

VEKTÖRLER Halime Nebioğlu

VEKTÖRLER Halime Nebioğlu VEKTÖRLER Halime Nebioğlu İstanbul Üniversitesi Gen klonlamasında kullanılan aracı moleküllere vektör denir. Vektörler konakçı organizmada, konakçı organizmadan bağımsız olarak replikasyon (çoğalma) gösterirler.

Detaylı

Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli

Detaylı

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır.

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır. BİYOLOJİYE GİRİŞ Canlılığın bilimsel olarak araştırılmasıdır. Biyolojik Organizasyon; Her düzeydeki biyolojik organizasyon belirgin özelliklere sahiptir. Her türlü maddenin kimyasal yapıtaşları olan ve

Detaylı

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ

ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ ÇOK HÜCRELİ ORGANİZMALARIN GELİŞİMİ Seçici gen ifadesi embriyonun gelişmesini sağlayan 4 temel işlevi denetler: 1. Hücre çoğalması 2. Hücre farklılaşması 3. Hücre etkileşimleri 4. Hücre hareketi HÜCRE

Detaylı

Ökaryotlarda transkripsiyon. Dr. İSMAİL BEZIRGANOĞLU

Ökaryotlarda transkripsiyon. Dr. İSMAİL BEZIRGANOĞLU Ökaryotlarda transkripsiyon Dr. İSMAİL BEZIRGANOĞLU Transkripsiyonal Düzenlemeye Genel Bakış Ökaryotlarda mrna ve protein sentezi iki farklı hücresel organelde gerçekleşir. Transkripsiyon nukleusta translasyon

Detaylı

TRANSLASYON VE DÜZENLENMESİ

TRANSLASYON VE DÜZENLENMESİ TRANSLASYON VE DÜZENLENMESİ TRANSLASYON Translasyonda nükleik asit kullanılır fakat son ürün bir nükleik asit değil proteindir. Translasyon mekanizması 4 ana bileşenden oluşmaktadır: 1. mrnalar 2. trnalar

Detaylı

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER

BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER BAKTERİLERDE EKSTRAKROMOZAL GENETİK ELEMENTLER Plazmid ve Epizomlar Bakterilerin kendi kromozomlarının yanı sıra, kromozom dışı bazı genetik parçacıklar bulunmaktadır Bakteri kromozomundan daha küçük yapıda

Detaylı

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler)

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) PROKARYOTLARDA GEN EKSPRESYONU ve REGÜLASYONU (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) Nihal EYVAZ (050559015) Şerife OKAY (050559025) Prof. Dr. Figen ERKOÇ Gazi Eğitim Fakültesi Gen

Detaylı

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın

İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın İ. Ü İstanbul Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı Prof. Dr. Filiz Aydın Genetik nedir? Biyolojinin kalıtım ve varyasyonlarla (çeşitlilikle) ilgilenen bilim dalıdır. Genetik yaşayan tüm organizmalarda

Detaylı

Non-coding RNA Molekülleri

Non-coding RNA Molekülleri Non-coding RNA Molekülleri Dersin Sorumlusu: Dr. Hatice MERGEN Dersin adı: Proteomik ve Genomik Hazırlayan: Çiğdem KAPLAN 2004 2005 GÜZ Non-Coding RNAs (Kodlama Yapmayan RNA lar) Genom projesinin ilk hedefi,

Detaylı

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN

MİTOKONDRİ Doç. Dr. Mehmet GÜVEN MİTOKONDRİ Doç.. Dr. Mehmet GÜVENG Hemen hemen bütün b ökaryotik hücrelerde ve ökaryotik mikroorganizmalarda bulunur. Eritrositlerde, bakterilerde ve yeşil alglerde mitokondri yoktur. Şekilleri (küremsi

Detaylı

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler

Detaylı

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S.

Giriş. İlgi çekici ve hızla gelişen bu bilim dalına genomikler adı verilmektedir. Kaynak: Biotechnology (An Introduction) - Susan S. BİYOİNFORMATİK Giriş Son 15 yılda çeşitli organizmalara ait genomun tamamının klonlanması, sekansının belirlenmesi ve analiz edilmesi yolunda önemli gelişmeler kaydedilmiştir. İlgi çekici ve hızla gelişen

Detaylı

GENETİK ŞİFRE. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK ŞİFRE. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK ŞİFRE Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genetik Bilgi Akışı Genetik kodun özellikleri 1. Genetik şifre, harfler halinde gösterilen mrna moleküllerini oluşturan ribonükleotid bazları kullanılarak,

Detaylı

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ Değişik canlı gruplarında kalıtsal molekülün çeşidi, sayısı, biçimi ve organizasyonu bakımından farklılıklar bulunur. Ortak özellik: nükleik

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA (Ribonükleik Asit) Nükleik asitler, Friedrich Miescher tara2ndan 1869'da keşfedildi. İl=haplı bandajlardan izole edilen bu maddeye nüklein adını

Detaylı

Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON

Biyoteknoloji ve Genetik II. Hafta 8 TRANSLASYON Biyoteknoloji ve Genetik II Hafta 8 TRANSLASYON Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com TRANSLASYON Translasyon a. mrna ribozoma

Detaylı

1 Canlı Bilimine Giriş 2. 2 Yaşamın Kimyası 18

1 Canlı Bilimine Giriş 2. 2 Yaşamın Kimyası 18 1 Canlı Bilimine Giriş 2 1.1 Tüm yaşayan organizmaların belirli özellikleri ortaktır 2 1.2 Yaşam bir çok seviyede incelenebilir 4 1.3 Bilim insanları doğal dünyayı araştırmak için iyi yapılandırılmış yöntemler

Detaylı

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces

YAPAY KROMOZOMLAR. cerevisiae. de kurulmuştur. Halkasal. Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces YAPAY KROMOZOMLAR Yapay kromozomlar ilk defa tomurcuklanan maya olan Saccharomyces cerevisiae. de kurulmuştur. Halkasal plazmid maya sentromerinden,replikasyon orijininden, seçici bir işaret geninden ve

Detaylı

Kök Hücre ve Farklılaşma

Kök Hücre ve Farklılaşma Kök Hücre ve Farklılaşma Kök Hücre Erişkin ve embriyonik kök hücreler farklılaşarak soma7k hücreleri oluştururlar. Kök hücre Progenitör hücre Farklılaşmış hücre Neden Farklılaşmaya İh7yaç Duyulur Tek hücreli

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

KONU 4 EVRİM AĞAÇLARI OLUŞTURMAK. Yrd. Doç. Dr. Aslı Sade Memişoğlu

KONU 4 EVRİM AĞAÇLARI OLUŞTURMAK. Yrd. Doç. Dr. Aslı Sade Memişoğlu KONU 4 EVRİM AĞAÇLARI OLUŞTURMAK Yrd. Doç. Dr. Aslı Sade Memişoğlu Başlıklar 4.1 Filogeni çıkarımının mantığı Sinapomorfiler Filogeni oluşturmada problemler 4.2 Balinaların Filogenisi Karakter seçimi:

Detaylı

TEST 1. Hücre Solunumu. 4. Aşağıda verilen moleküllerden hangisi oksijenli solunumda substrat olarak kullanılamaz? A) Glikoz B) Mineral C) Yağ asidi

TEST 1. Hücre Solunumu. 4. Aşağıda verilen moleküllerden hangisi oksijenli solunumda substrat olarak kullanılamaz? A) Glikoz B) Mineral C) Yağ asidi 1. Termometre Çimlenen bezelye tohumlar Termos Çimlenen bezelye tohumları oksijenli solunum yaptığına göre yukarıdaki düzenekle ilgili, I. Termostaki oksijen miktarı azalır. II. Termometredeki sıcaklık

Detaylı

Tanımlamalar PROTEİN SENTEZİ; TRANSLASYON. Protein sentezi ;translasyon. mrna ; Genetik şifre 1/30/2012. Prof Dr.Dildar Konukoğlu

Tanımlamalar PROTEİN SENTEZİ; TRANSLASYON. Protein sentezi ;translasyon. mrna ; Genetik şifre 1/30/2012. Prof Dr.Dildar Konukoğlu PROTEİN SENTEZİ; TRANSLASYON Prof Dr.Dildar Konukoğlu DNA SENTEZİ DNA DNA RNA sentezi DNA mrna Protein sentezi mrna Protein Tanımlamalar Replikasyon Replikasyon Transkripsiyon Transkripsiyon Translasyon

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

DNA Tamiri ve Rekombinasyonu

DNA Tamiri ve Rekombinasyonu DNA Tamiri ve Rekombinasyonu Bitkilerdeki 3 genom UV ve radyosyonun diğer formları, kimyasallar, ve diğer streslerle (örneğin oksidatif, ısı vb.) devamlı hasar görür. Bazı proteinler onarımda ve rekombinasyonda

Detaylı

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005

DNA ONARIMI VE MUTASYON. Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 DNA ONARIMI VE MUTASYON Merve Tuzlakoğlu Öztürk Bakteri genetiği dersi Sunum-2 18.11.2005 *DNA nın dölden döle değişmeden aktarımı için 2 süreç önemlidir: DNA ONARIMI 1. Replikasyon sürecinin doğru yapılması

Detaylı

DÖNEM I DERS KURULU I

DÖNEM I DERS KURULU I DÖNEM I DERS KURULU I KONU: Hücre, Hücre Organelleri, Nükleus AMAÇ: Öğrenciler bu dersin sonunda, hücreyi, hücre organellerinin yapı ve işlevlerini tanımlayabilecek, hücre tiplerinin özelliklerini ve arasındaki

Detaylı

GEN EKSPRESYONUNUN KONTROLÜ VE DÜZENLENMESİ GEN İFADESİ

GEN EKSPRESYONUNUN KONTROLÜ VE DÜZENLENMESİ GEN İFADESİ GEN EKSPRESYONUNUN KONTROLÜ VE DÜZENLENMESİ GEN İFADESİ Bir organizmanın genetik yapısını DNA da bulunan dntp dizileri belirler ve bu bilginin ifade edilmesi ise (Protein sentezi) RNA lar ile sağlanır.

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

00220 Gıda Biyokimyası

00220 Gıda Biyokimyası 00220 Gıda Biyokimyası Hazırlayan: Doç.Gökhan DURMAZ 00220 Gıda Biyokimyası-Şubat 2013 1 Bu notların hazırlanmasında aşağıdaki eserlerden yararlanılmıştır; Biyokimya, Engin Gözükara, Nobel Tip Kitabevi,

Detaylı

CANLILARDA ÜREME. Üreme canlıların ortak özelliğidir. Her canlının kendine benzer canlı meydana getirebilmesi üreme ile gerçekleşir

CANLILARDA ÜREME. Üreme canlıların ortak özelliğidir. Her canlının kendine benzer canlı meydana getirebilmesi üreme ile gerçekleşir CANLILARDA ÜREME EYLÜL 3.HAFTA MİTOZ VE EŞEYSİZ ÜREME Her canlının kendine benzer canlı meydana getirebilmesi üreme ile gerçekleşir Üreme canlıların ortak özelliğidir 3 4 Canlılar hücrelerden meydana gelir

Detaylı

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D

ayxmaz/biyoloji 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki ana DNAdan yeni DNA molekülleri hangi sonulca üretilir A B C D 1. DNA replikasyonu.. için gereklidir A) sadece mitoz B) sadece mayoz C) mitoz ve mayoz D) sadece gamet oluşumu E) sadece protein sentezi 2. DNA aşağıdaki sonuçlardan hangisi ile üretilir Kalıp DNA yukarıdaki

Detaylı

12. SINIF KONU ANLATIMI 2 DNA VE RNA

12. SINIF KONU ANLATIMI 2 DNA VE RNA 12. SINIF KONU ANLATIMI 2 DNA VE RNA DNA (DEOKSİRİBONÜKLEİK ASİT) Temel nükleik asittir. Prokaryot hücrelerin sitoplazmasında, ökaryot hücrelerde çekirdek, mitokondri ve kloroplast organelinde bulunur.

Detaylı

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri mrna trna - rrna Taşıyıcı (transfer) RNA (trna) Nispeten küçük moleküllerdir. Bir öncu molekülün nükleusta işlenmesiyle oluşurlar. trna molekülleri, mrna

Detaylı

YGS YE HAZIRLIK DENEMESi #18

YGS YE HAZIRLIK DENEMESi #18 YGS YE HAZIRLIK DENEMESi #18 1) Bakterilerin gerçekleştirdiği, I. Kimyasal enerji sayesinde besin sentezleme II. Işık enerjisini kimyasal bağ enerjisine dönüştürme III. Kimyasal bağ enerjisini ATP enerjisine

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için

8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için 8. KONU: VİRAL KOMPONENTLERİN BİYOLOJİK FONKSİYONU Kodlama: Her virüs kendine özgü proteini oluşturmakla birlikte, proteinde nükleik asidi için koruyucu kalkan görevi görmektedir. Protein kendi kendine

Detaylı

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü

İNSAN GENOM PROJESİ. * Doç. Dr., Bilkent Üniversitesi, Moleküler Biyoloji ve Genetik Bölümü 7 İNSAN GENOM PROJESİ Ifl k YULU * In this article, the author has summarized the Human Genome Project and what it aims to achieve. Following the description of the human genome the history, applications,

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

2. Histon olmayan kromozomal proteinler

2. Histon olmayan kromozomal proteinler 12. Hafta: Nükleik Asitler: Nükleik asitlerin yapısal üniteleri, nükleozitler, nükleotidler, inorganik fosfat, nükleotidlerin fonksiyonları, nükleik asitler, polinükleotidler, DNA nın primer ve sekonder

Detaylı

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 12. Prokaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 12 Prokaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

-...sentezlenemezse; - ortamda... birikir. - ortamda... oluşmadığından

-...sentezlenemezse; - ortamda... birikir. - ortamda... oluşmadığından 2014 2015 MEV KOLEJİ ÖZEL ANKARA OKULLARI 9. SINIF BİYOLOJİ DERSİ YAZ TATİLİ EV ÇALIŞMASI Ödevin Veriliş Tarihi:12.06.2015 Ödevin Teslim Tarihi: 21.09.2015 1.Aşağıda verilen özelliklerden hangisi canlılarda

Detaylı

BAKTERİLERİN GENETİK KARAKTERLERİ

BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür

Detaylı

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI

TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI TIBBİ BİYOLOJİ VE GENETİK ANABİLİM DALI Programın Yürütücüsü Programın Kadrolu Öğretim Üyeleri : Prof. Dr. Elif YEŞİLADA : Prof. Dr. Başak KAYHAN Doç. Dr. Yılmaz ÇİĞREMİŞ Doç. Dr.Şengül YÜKSEL Doç. Dr.

Detaylı

Mikroorganizmalara giriş. Yrd.Doç.Dr. Sema CAMCI ÇETİN

Mikroorganizmalara giriş. Yrd.Doç.Dr. Sema CAMCI ÇETİN Mikroorganizmalara giriş Yrd.Doç.Dr. Sema CAMCI ÇETİN CANLILAR ALEMİ Hayvanlar Bitkiler Protistler Prokaryotlar: ilkel tek hücreli bakteriler mavi algler Ökaryotlar: hücre yapısı hayvan ve bitkilere benzer

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

Mikobakteriyolojide yeni nesil dizileme ile analiz

Mikobakteriyolojide yeni nesil dizileme ile analiz Mikobakteriyolojide yeni nesil dizileme ile analiz Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, İzmir Mikobakteriyolojide kullanım alanları Moleküller epidemiyoloji

Detaylı

ECZACILIK FAKÜLTESİ BİYOKİMYA

ECZACILIK FAKÜLTESİ BİYOKİMYA PROGRAM KOORDİNATÖRÜ Prof. Dr. Güldal MEHMETÇİK, gmehmetcik@neu.edu.tr YÜKSEK LİSANS DERSLERİ EBM 600 Uzmanlık Alanı Dersi Z 4 0 4 EBM 601 Biyokimya I S 3 0 3 EBM 602 Biyokimya I Laboratuvar S 0 3 1 EBM

Detaylı

A. DNA NIN KEŞFİ VE ÖNEMİ

A. DNA NIN KEŞFİ VE ÖNEMİ DNA nın Yapısı ve Replikasyonu Biyoloji Ders Notları A. DNA NIN KEŞFİ VE ÖNEMİ İlk olarak Friedrich Miescher (1869) akyuvar hücreleri ve balık sperminde yönetici molekülleri tespit etmiştir. Çekirdekte

Detaylı

YGS YE HAZIRLIK DENEMESi #19

YGS YE HAZIRLIK DENEMESi #19 YGS YE HAZIRLIK DENEMESi #19 1) X Ağız Mide İnce bağırsak Şekildeki grafikte insanın sindirim kanalındaki X maddesinin değişimi gösterilmiştir. Buna göre X maddesi aşağıdakilerden hangisidir? A) Glikojen

Detaylı

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE YAZILIYA HAZIRLIK SORULARI 12. Sınıf 1 GENDEN PROTEİNE Protein sentezini tüm canlılar gerçekleştirir. Bir mrna molekülünde en fazla 64 çeşit kodon bulunur. DOĞRU YANLIŞ SORULARI Canlıların heterotrof beslenenleri

Detaylı

CANLILARIN ORTAK ÖZELLİKLERİ

CANLILARIN ORTAK ÖZELLİKLERİ 1 CANLILARIN ORTAK ÖZELLİKLERİ 1.Hücresel yapıdan oluşur 2.Beslenir 3.Solunum yapar 4.Boşaltım yapar 5.Canlılar hareket eder 6.Çevresel uyarılara tepki gösterir 7.Büyür ve gelişir (Organizasyon) 8.Üreme

Detaylı

ÜNİTE 1: BİYOLOJİYE GİRİŞ

ÜNİTE 1: BİYOLOJİYE GİRİŞ ÜNİTE 1: BİYOLOJİYE GİRİŞ Anahtar kavramlar 1.1 Biyologlar mikroskobik türlerden dev türlere kadar bütün canlıları inceler. 1.2 Biyologlar yaşamdaki çeşitliliği açıklamaya çalışırlar. 1.3 Biyoloji de son

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK POLİMORFİZMLER. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK POLİMORFİZMLER Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genomu bir kitap olarak düşünürsek... (Ridley, 2000) Kromozom olarak adlandırılan 23 bölüm Her bölüm birkaç bin hikayeden oluşur ki bunlar genlerdir.

Detaylı

Mutasyon ve Genetik Sürüklenme

Mutasyon ve Genetik Sürüklenme Mutasyon ve Genetik Sürüklenme Bir popülasyondaki alel frekanslarını değiştiren doğal sebepler Doğal seçilim Mutasyon Genetik sürüklenme Kurucu etki (Founder effect) Popülasyon darboğazı, MUTASYON Genel

Detaylı

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı.

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı. Bu dersin içeriği, Populasyonun tanımı, Alel ve genotip frekansı, Gen havuzu, Gen frekansı, Gerçek/Doğal populasyonlar ve ideal populasyonlar, Populasyon genetiğinin çalışma alanları, HW kanunu -giriş,

Detaylı

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır.

b. Amaç: Gen anatomisi ile ilgili genel bilgi öğretilmesi amaçlanmıştır. TIBBİ GENETİK I-DERS TANIMLARI 1-Tanım: DNA ve RNA yapısının öğretilmesi. b. Amaç: DNA nın genetik materyal olmasında moleküler yapısının önemi ve RNA yapısının proteine geçiş ve gen ekspresyonu kontrolündeki

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı Dönem I. 2. Ders Kurulu II. HÜCRE BİLİMLERİ-I Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Prof. Dr. Alirıza ERDOĞAN Yrd. Doç. Ders Kurulu

Detaylı

HÜCRESEL EVRİM. Prof. Dr. Müjgan Cengiz Prof. Dr. Ayhan Deviren

HÜCRESEL EVRİM. Prof. Dr. Müjgan Cengiz Prof. Dr. Ayhan Deviren HÜCRESEL EVRİM Prof. Dr. Müjgan Cengiz Prof. Dr. Ayhan Deviren 1. Maddenin Oluşumu 2. Atomik Evrim 3. Moleküler evrim 4. Hücresel evrim Prof. Dr. Müjgan Cengiz MADDENİN OLUŞUMU Enerji Doymuşluğundan Madde

Detaylı

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin.

GENOMUN YAPISI. Genom Nedir? Gen ve Genomun tanımı Genom Büyüklükleri DNA Dizi Tipleri 11/11/14. Doç. Dr. Metin Aytekin www.metinaytekin. GENOMUN YAPISI Gen ve un tanımı Büyüklükleri Dizi Tipleri Doç. Dr. Metin Aytekin www.metinaytekin.com Erciyes Üniversitesi Tıp Fakültesi Tıbbi Biyoloji Anabilim Dalı 11 Kasım 2014 Nedir? Bir organizmanın

Detaylı

ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER

ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER Virüsler Hücresel yapı da dahil olmak üzere canlıların ortak özelliklerini göstermeyen canlılardır. Prokaryotlardan daha küçüklerdir.

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Domain Çoğalması ve Gen Uzaması *Ökaryotlarda modern genler üzerine yapılan bir araştırma gösteriyor ki, içsel duplikasyonlar evrim boyunca sık sık meydana

Detaylı

TEMEL VETERĠNER GENETĠK

TEMEL VETERĠNER GENETĠK DİKKATİNİZE: BURADA SADECE ÖZETİN İLK ÜNİTESİ SİZE ÖRNEK OLARAK GÖSTERİLMİŞTİR. ÖZETİN TAMAMININ KAÇ SAYFA OLDUĞUNU ÜNİTELERİ İÇİNDEKİLER BÖLÜMÜNDEN GÖREBİLİRSİNİZ. TEMEL VETERĠNER GENETĠK KISA ÖZET KOLAYAOF

Detaylı

Gen Klonlama ve Uygulamaları. Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı

Gen Klonlama ve Uygulamaları. Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı Gen Klonlama ve Uygulamaları Fatma Savran Oğuz İstanbul Tı Fakültesi Tıbbi Biyoloji Anabilim Dalı Klonlama Gen klonlaması : DNA segmentleri veya bir genin kopyalarının Reproduktif klonlama : Bir canlının

Detaylı

Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın

Hücre Nükleusu, Nükleus Membranı, Nükleus Porları. Doç. Dr. Ahmet Özaydın Hücre Nükleusu, Nükleus Membranı, Nükleus Porları Doç. Dr. Ahmet Özaydın Nükleus (çekirdek) ökaryotlar ile prokaryotları ayıran temel özelliktir. Çekirdek hem genetik bilginin deposu hem de kontrol merkezidir.

Detaylı

ADIM ADIM YGS-LYS 32. ADIM HÜCRE 9- SİTOPLAZMA

ADIM ADIM YGS-LYS 32. ADIM HÜCRE 9- SİTOPLAZMA ADIM ADIM YGS-LYS 32. ADIM HÜCRE 9- SİTOPLAZMA 2) Sitoplazma Hücrenin içini dolduran sıvıdır. İçinde inorganik ve organik maddeler vardır. Ayrıca görevleri birbirinden farklı olan organeller de bulunur.

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA RİBOZOMLAR Ribozom RİBONÜKLEOPROTEİN (RNP) yapısındadır. Ribozomlar hem protein hem de RNA moleküllerinden oluşur. Ribozomlar protein ve RNA moleküllerinden oluşan

Detaylı

ADIM ADIM YGS-LYS 43. ADIM CANLILARIN SINIFLANDIRILMASI-3 BAKTERİLER ALEMİ

ADIM ADIM YGS-LYS 43. ADIM CANLILARIN SINIFLANDIRILMASI-3 BAKTERİLER ALEMİ ADIM ADIM YGS-LYS 43. ADIM CANLILARIN SINIFLANDIRILMASI-3 BAKTERİLER ALEMİ BAKTERİLER ALEMİ Prokaryot hücre yapısına sahip olan tek hücreli canlıların oluşturduğu alemdir. Mikroskobun icadından sonra keşfedilmişlerdir.

Detaylı

1. ÜNİTE: YAŞAM BİLİMİ BİYOLOJİ...10

1. ÜNİTE: YAŞAM BİLİMİ BİYOLOJİ...10 İçindekiler 1. ÜNİTE: YAŞAM BİLİMİ BİYOLOJİ...10 1. BÖLÜM: BİLİMSEL BİLGİNİN DOĞASI ve BİYOLOJİ... 12 A. BİLİMSEL ÇALIŞMA YÖNTEMİ... 12 1. Bilim İnsanı ve Bilim... 12 B. BİLİMSEL YÖNTEMİN AŞAMALARI...

Detaylı

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM VE FOSİL KANITLAR 4 Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM/DEĞİŞİM/GELİŞİM Bir prosestir. Yeryüzünde, yaşamın ilk formundan bugüne kadarki büyük değişimi karakterize eder. Genlerdeki

Detaylı

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM VE FOSİL KANITLAR 4 Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM/DEĞİŞİM/GELİŞİM Bir prosestir. Yeryüzünde, yaşamın ilk formundan bugüne kadarki büyük değişimi karakterize eder. Genlerdeki

Detaylı

cdna Kitaplık Hazırlanışı

cdna Kitaplık Hazırlanışı cdna Kitaplık Hazırlanışı Uzm.Bio.Veysel Sabri HANÇER İstanbul Üniversitesi Moleküler Biyoloji ve Genetik Doktora Programı 2602043040 Genetik Bilginin İki Kaynağı Vardır; Genomik DNA mrna Ökaryotlardaki

Detaylı

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz İnsan Mikrobiyom Projesi Prof. Dr. Tanıl Kocagöz Human Microbiome Project İnsan Mikrobiyom Projesi (İMP) 2007 yılında NIH tarafından başlatıldı 300 gönüllünün 5 vücut bölgesinden değişik zamanlarda, toplam

Detaylı

GENETİK ŞİFRE PROF. DR. SERKAN YILMAZ

GENETİK ŞİFRE PROF. DR. SERKAN YILMAZ GENETİK ŞİFRE PROF. DR. SERKAN YILMAZ Genetik Şifre (Kod) Organizmalardaki proteinlerin birincil yapılarının (amino asit dizilerinin), DNA molekülündeki genlerin nükleotid dizisi tarafından tayin edilmesi

Detaylı

Bakteriler ve Archaea

Bakteriler ve Archaea Bakteriler ve Archaea Yapısal ve işlevsel adaptasyonlar prokaryotik başarıya katkıda bulunur Hızlı üreme, mutasyon ve genetik rekombinasyon prokaryotlarda genetik çeşitliliği arttırır Çeşitli beslenme

Detaylı

Mendel Dışı kalıtım. Giriş

Mendel Dışı kalıtım. Giriş Mendel Dışı kalıtım DR. UMUT FAHRİOĞLU, PHD MSC Giriş Bir organizmanın fenotipinin genotipin bakarak tahmin edilebilmesi için birçok farklı faktörün çok iyi anlaşılabilmesi lazım. Mendel kalıtım modellerindeki

Detaylı

YGS YE HAZIRLIK DENEMESi #2

YGS YE HAZIRLIK DENEMESi #2 YGS YE HAZIRLIK DENEMESi #2 1) Aşağıdaki grafikte, ph derecesi ile X, Y ve Z enzimlerin tepkime hızı arasındaki ilişki gösterilmiştir. 2) Aşağıdaki şemada kloroplast ile mitokondri arasındaki madde alış

Detaylı