FİLOGENİ ve HAYAT AĞACI

Save this PDF as:
 WORD  PNG  TXT  JPG

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "FİLOGENİ ve HAYAT AĞACI"

Transkript

1 FİLOGENİ ve HAYAT AĞACI Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER

2 Giriş Filogenetik veriler ile canlılar arasında oluşturulan akrabalık ilişkileri, canlılığın gelişimine dair bize akrabalık ağaçlarını yani bize hayatın izlediği yola dair fikir verir. Bu yol süresince görülen değişimler, evrimin mekanizması ve motifini anlamamızda yardımcı olur. Araştırıcıların türlerin yada tür gruplarının farklılaşma mekanizmalarını incelediği Filogeni bu anlamda önemli bir yardımcıdır. Örneğin ayaksız kertenkelelerden olan, doğu cam kertenkelesi (Ophisaurus ventralis) aynı yılan görünümüne sahiptir ama bir yılan değildir (Şekil 26.1). Yrd.Doç.Dr.Yosun MATER

3 Yrd.Doç.Dr.Yosun MATER

4 Filogeniye göre yılanlar ve kertenkeleler, buna bacaksız, doğu cam kertenkelesi de dahil olmak üzere, bacaklı kertenkelelerden farklılaşmışlardır (Şekil 26.2). Biyologlar aynı cinslerdeki farklı özelliklerden yola çıkarak evrimleşmelerini inceler ve o canlı genus una ait filogenetik ağaçları şekillendirirler.

5 1. Filogeni Evrimsel ilişkileri Gösterir. Linnaeus un binomial sınıflandırması, organizmaları iki isimle; yani cins (genus) ve tür (species) isimleri ile etiketlenmesine dayanır. Linnaean sisteminde türlerin sayıları arttığında gruplayarak takımlar-taksonlar (Taxa) oluşturulur. Cinslerine bağlı olarak, aynı ailede (Familia), aynı ailede olmalarına bağlı olarak aynı sınıfta (Classes), aynı sınıfta olmalarına bağlı olarak aynı şubede-filumda (Phylum), aynı filumda olmalarına bağlı olarak aynı alemde (kingdom) ve genellikle aynı alemde olmalarına bağlı olarak aynı üst alemde (domain) yer alırlar (Şekil 26.3). Yrd.Doç.Dr.Yosun MATER

6 Yrd.Doç.Dr.Yosun MATER

7 Sistematik ile çalışanlar, sistematikçiler; bir grup organizmanın evrimsel tarihi ve ilişkileri filogentik ağaçlar yardımıyla tanımlarlar. Çoğu sistematikçi, evrimsel ilişkileri sınıflandırmada bu ağaçları temel alır ve kullanırlar (Şekil 26.4). Yrd.Doç.Dr.Yosun MATER

8 Ne yazık ki bu dallanmış sistemde dalların uzunluğu zaman veya genetik değişikliklere bağlı olarak tanımlanmaya çalışsa da sadece köken motiflerini çıkarmada yardımcı olur (Şekil 26.5). Evrim tarihinde türlere dair öğrendiğimiz bilgilerin çoğu genel anlamda filogenik ağaçlarda kullanılabilir.

9 Filogentik uygulamalara baktığımızda en çok karşımıza çıkan uygulama alanı, bulunan bir canlıya ait DNA dizisindeki benzerlikler yardımıyla hangi türe akrabalığı olduğunu anlama çalışmaları yer alır. Örneğin Japonyada balina etleri üzerinde yapılan böyle denetlemelr koruma altındaki türlere ait balinalara zarar verilip verilmediği belirlenebilmektedir (Şekil 26.6). Yrd.Doç.Dr.Yosun MATER

10 2 Filogenik bilgiler morfolojik ve moleküler verilerden elde edilen çıkarımlarla yapılandırılır. Organizmalar çok benzer morfolojilere veya DNA dizilerine sahiplerse, farklı görünüş ve genetik dizilime sahip türlerden daha yakın akraba olabilirler. Filogenik çıkarımlar, homoloji (homology) yani aynı atasal canlıdan geliyorlarsa, benzer farklılıkları geçirmiş olmalılar yani analojiyi (analogy) göstemelidirler (Şekil 26.7). Diğer bir değişle farklılaşmalarında benzer olması beklenir.

11 2 Filogenik bilgiler morfolojik ve moleküler verilerden elde edilen çıkarımlarla yapılandırılır (Devam) Bu nedenle daha hassas karşılaştırmaların yapılabilmesi için çok uzun zamandır, bilgisayar programları kullanılarak elde edilen DNA dizileri karşılaştırılmakta ve moleküler homolojiler belirlemektedir (Şekil 26.8). Böylece, taksonlar arasında rastlantısal eşleşmeleri ayırmak da mümkün olmaktadır.

12 Böylece, taksonlar arasında görülebilen ve homoplazi (Homoplasy) adını alan rastlantısal eşleşmeler in varlığını belirlemek ve birbirinden ayırmak da mümkün olmaktadır (Şekil 26.9).

13 3.Paylaşılan karakterler filogenetik ağaçların oluşturulmasında kullanılır. Bir klad (Clade) yani aynı atadan gelen organizma, tek bir atadan farklılaşıp tek bir grup oluşturduysa monofilatik (monophyletic) grup adını alır. Bu grubun içinde ata tür ve ondan farklılaşan birden fazla tür bulunursa buna parafilatik (paraphyletic) grup adı verilir. Kladlar kendilerini ayıran temel karakterler ile çok sayıda gruptan oluşuyorsa da buda polifilatik (polyphyletic) grup adını alır (Şekil 26.10a,b,c).

14 Yrd.Doç.Dr.Yosun MATER

15 3.Paylaşılan karakterler filogenetik ağaçların oluşturulmasında kullanılır (Devam). Parafilatik ve polifilatik gruplar arasındaki fark kabaca şöyle özetlenebilir. Parafilatik grup, ata soydan gelen özellikleri daha fazla taşır ve birbirine benzer, polifilatik grupta ise temel özellikler esas alınır canlıların birbirine benzemesi çok beklenmez (Şekil 26.11).

16 Filogeniye göre, en kısıtlı ağaçlar bir türden çok az sayıda türleşmenin oluştuğu ağaçlardır. Bu ağaçların oluşturulmasında ata türe benzerlikler esas alınır ve özellikler olmaması (sıfır, 0) veya olmasına bağlı olarak (bir, 1) şeklinde değerlendirilir. Bu tablolarda ortaya çıkan benzerlikler, çoğu zaman DNA dizilerinde de benzerliklerin de azalması anlamına gelir (Şekil 26.12).

17 En bereketli ağaçlar ise çok sayıda türleşmenin gerçekleştiği ağaçlardır. İyi desteklenen filogenetik ağaçlara dair hipotezler ise geniş miktarda bilgi içeren ve çok sayıda veri ile geliştirilmiş ağaçlardır. Daha önce belirtildiği gibi burada cinsler arasında yer alan dallanmalar ve bu dalların uzunluğu tam zamansal karşılıklarını bize göstermez kabaca canlıların hangi canlılara göre önceliğini ve sonralığını verir (Şekil ve 26.14).

18

19 Yrd.Doç.Dr.Yosun MATER

20 Maksimum yakınlık (Maximum parsimony) ve maksimum benzerlik tespitleri, filogenetik ağaçların şekillendirilmesinde en önemli problemdir Bir kuş türü için yanda verilen örnekte hangi filogenetik dallanma kabul edilebilir? Sorusunda yola çıkarak yakınlık hesaplamalarına bakarsak (Şekil 26.15). Yrd.Doç.Dr.Yosun MATER

21

22 Yine benzer şeklide filogenetik ağaçlardan ve yakınlık ilkelerinden yola çıkarak, canlıların oluşmasında ata türleri olmasa da; ataya en yakın türleri belirlenmesi için hipotezlerin oluşturulmasında da kullanılabilir (Şekil ve 26.17).

23

24 4. Bir organizmanın evrimsel tarihi onun genomunda belgelenmiştir. Moleküler teknikler yardımıyla bazı genler arasında benzerlikler olduğu belirlenmiştir. Buna homolog genler (homologous genes)adı verilir (Şekil 26.18) ve iki tipi vardır. Ortalog genler (Orthologous genes) türleşme sonuçunda farklılaşmış türlerde olan ve onların farklılaşmasına neden olan genlerdir. Paralog genler (Paralogous genes) bir türde olan ve kendini çoğaltan benzer genlerdir. Bu genlerin farlılığı ve/veya benzerlikleri kazanılan yeni özelliklerin anlaşılmasında yardımcı olur. Uzaktan akraba türlerde pek çok ortolog genler yer alır. Farklı karmaşıklığa sahip çeşitli organizmalarda yer alan gen sayılarındaki farklılıklar çok çeşitli genler ile desteklenir ve çok farklı görevleri yerine getirebilir.

25 Yrd.Doç.Dr.Yosun MATER

26 5. Moleküler saat Evrim saatinin izlenmesine yardımcı olur. DNA nın bazı bölgelerindeki değişiklikler, oranlarına bağlı olarak moleküler saatler gibi hareket ederler. Bu bölgelerde olan değişiklikler geçmişte gerçekleşmiş olan evrimin tarihine dair tahminleri yapmak için kullanılabilir (Şekil 26.19). Diğer DNA bölgelerinde yer alan değişiklikler hakkında tahmin yapma şansı ise çok düşüktür. Örneğin moleküler saat analizleri sayesinde, en yaygın HIV ırklarının primatlardan-insanlara 1900 lü yıllarda yayıldığını söyleyebiliriz (Şekil 26.20).

27

28 6. Hayatın ağacını anlamamız yeni verilerde yer alan değişikliklerle devam etmektedir. Önceki sınıflandırma sistemleri hayatın akışını bize göstermenin yollarını içeriyordu, üç büyük üst alemden (domainden) oluşuyordu (Şekil 26.21). Bakteriler (Bacteria), Arkealar (Archaea) ve Ökaryalar (Eukarya). Filogeni temelli rrna parçalarının analizi ile ökaryaların arkealar ile bakterilerin arkealar ile olduğundan daha yakın ilişkili olduğu anlaşılmıştır. Genetik analizler bize evrimin oluşumunda yoğun, yatay (horizontal) bir gen akışı olduğunu işaret etmektedir (Şekil 26.22).

29

30 Kaynaklar Campbell Biology 10th ed.(2014) Neil A. Campbell, Jane B. Reece, Unit 5, Part:26, p: Pearson Benjamin Cummings, 1301 Sansome St., San Francisco, CA Yrd.Doç.Dr.Yosun MATER

ADIM ADIM YGS-LYS 41. ADIM CANLILARIN SINIFLANDIRILMASI- SINIFLANDIRMANIN TARİHÇESİ- ÇEŞİTLERİ

ADIM ADIM YGS-LYS 41. ADIM CANLILARIN SINIFLANDIRILMASI- SINIFLANDIRMANIN TARİHÇESİ- ÇEŞİTLERİ ADIM ADIM YGS-LYS 41. ADIM CANLILARIN SINIFLANDIRILMASI- SINIFLANDIRMANIN TARİHÇESİ- ÇEŞİTLERİ CANLILARIN SINIFLANDIRILMASI Dünyada keşfedilmiş çok fazla canlı çeşidi vardır. Bu canlıların araştırılmasını

Detaylı

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM VE FOSİL KANITLAR 4 Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM/DEĞİŞİM/GELİŞİM Bir prosestir. Yeryüzünde, yaşamın ilk formundan bugüne kadarki büyük değişimi karakterize eder. Genlerdeki

Detaylı

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği

EVRİM VE FOSİL KANITLAR 4. Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM VE FOSİL KANITLAR 4 Prof.Dr. Atike NAZİK Ç.Ü. Jeoloji Mühendisliği EVRİM/DEĞİŞİM/GELİŞİM Bir prosestir. Yeryüzünde, yaşamın ilk formundan bugüne kadarki büyük değişimi karakterize eder. Genlerdeki

Detaylı

Fosillerin Sınıflandırılması

Fosillerin Sınıflandırılması Fosillerin Sınıflandırılması Canlıların sınıflandırılması ve biyolojik çeşitlilik Amaç Bu etkinliğin amacı, öğrencilerin biyolojik sınıflandırma kavramını anlamalarını sağlamaktır. Materyal Farklı boyutlarda

Detaylı

Yaşam Ağacı, Sınıflandırma ve Filogeni

Yaşam Ağacı, Sınıflandırma ve Filogeni Yaşam Ağacı, Sınıflandırma ve Filogeni Yaşam Ağacı Darwin bugün var olan ve yok olmuş türlerin büyük bir yaşam ağacını ya da filogenetik ağaç oluşturduğunu belirtmiştir. Darwin in 1837 de çizdiği ilk yaşam

Detaylı

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM

FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM FRANSA DA ORTAÖĞRETİM İKİNCİ SINIF DERS KİTAPLARINDA EVRİM Burcu GÜNGÖR, Sami ÖZGÜR Balıkesir Üniversitesi Necatibey Eğitim OFMA Biyoloji Eğitimi A.B.D Özet Ders kitapları, hem öğretmenlerin hem öğrencilerin

Detaylı

CANLILARIN SINIFLANDIRILMASI

CANLILARIN SINIFLANDIRILMASI CANLILARIN SINIFLANDIRILMASI CANLILARIN SINIFLANDIRILMASI Dünya da henüz bilinmeyen çok sayıda canlı var. Bugün 1, 8 milyon farklı türün varlığı bilinmekte fakat, 3-10 milyon arasında farklı canlı türü

Detaylı

KONU 4 EVRİM AĞAÇLARI OLUŞTURMAK. Yrd. Doç. Dr. Aslı Sade Memişoğlu

KONU 4 EVRİM AĞAÇLARI OLUŞTURMAK. Yrd. Doç. Dr. Aslı Sade Memişoğlu KONU 4 EVRİM AĞAÇLARI OLUŞTURMAK Yrd. Doç. Dr. Aslı Sade Memişoğlu Başlıklar 4.1 Filogeni çıkarımının mantığı Sinapomorfiler Filogeni oluşturmada problemler 4.2 Balinaların Filogenisi Karakter seçimi:

Detaylı

Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER

Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER Virüsler Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Virüslere Giriş Virüsler genellikle ökaryotlardan ve prokaryotlardan çok daha küçük moleküllerdir. Genellikle enfeksiyon yeteneği olan

Detaylı

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı.

Populasyon Genetiği. Populasyonlardaki alel ve gen frekanslarının değişmesine neden olan süreçleri araştıran evrimsel bilim dalı. Bu dersin içeriği, Populasyonun tanımı, Alel ve genotip frekansı, Gen havuzu, Gen frekansı, Gerçek/Doğal populasyonlar ve ideal populasyonlar, Populasyon genetiğinin çalışma alanları, HW kanunu -giriş,

Detaylı

GENEL BİYOLOJİ LABORATUVARI (Zooloji) 1. Laboratuvar: Hayvan Sistematiği, Simetriler, Vücut Yönleri, Kesitler

GENEL BİYOLOJİ LABORATUVARI (Zooloji) 1. Laboratuvar: Hayvan Sistematiği, Simetriler, Vücut Yönleri, Kesitler B i y o 1 0 3. 0 1 G e n. B i y o. L a b. ( Z o o l o j i ) 1 GENEL BİYOLOJİ LABORATUVARI (Zooloji) 1. Laboratuvar: Hayvan Sistematiği, Simetriler, Vücut Yönleri, Kesitler Sistematik ve taksonomi nedir?...

Detaylı

TOHUMSUZ BİTKİLER SİSTEMATİĞİ

TOHUMSUZ BİTKİLER SİSTEMATİĞİ TOHUMSUZ BİTKİLER SİSTEMATİĞİ SİSTEMATİK VE TAKSONOMİ Sistematik, biyolojik çeşitliliği, organizmaların tarihini ve aralarındaki evrimsel ilişkileri araştıran bilim dalıdır.kısaca canlı çeşitliliğinin

Detaylı

Transkripsiyon ve Transkripsiyonun Düzenlenmesi

Transkripsiyon ve Transkripsiyonun Düzenlenmesi MBG 505 BAKTERİ GENETİĞİ Transkripsiyon ve Transkripsiyonun Düzenlenmesi Emrah ÖZÇELİK Ribonükleik asit (RNA) 3 tip RNA Mesajcı RNA (mrna) (genetik seviyede) Transfer RNA (trna) Ribozomal RNA (rrna) (fonksiyonel

Detaylı

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır.

BİYOLOJİYE GİRİŞ. Canlılığın bilimsel olarak araştırılmasıdır. BİYOLOJİYE GİRİŞ Canlılığın bilimsel olarak araştırılmasıdır. Biyolojik Organizasyon; Her düzeydeki biyolojik organizasyon belirgin özelliklere sahiptir. Her türlü maddenin kimyasal yapıtaşları olan ve

Detaylı

HÜCRE ve HÜCRE YAPISI

HÜCRE ve HÜCRE YAPISI HÜCRE ve HÜCRE YAPISI Kimya bilmi için maddelerin temel birimi atom ne ise Biyoloji bilmi için de canlılığın temel birimi Hücre dir. Yani tüm organizmalar hücrelerden oluşur. Hücreler iki şekilde karşımıza

Detaylı

Verilen tanımlar incelendiğinde seçeneklerde belirtilen bilim dallarından hangisine değinilmemiştir?

Verilen tanımlar incelendiğinde seçeneklerde belirtilen bilim dallarından hangisine değinilmemiştir? 1. Biyolojik Yorum, Yöntem ve Alt Bilim Dalları Testi 1 1 Canlının dış yapısını inceleyen bilim dalıdır. Canlılığı, DNA, RNA, gen gibi yapılarla moleküler düzeyde inceler. Canlıların birbirleri ve çevresiyle

Detaylı

Hayvanların Evrimi IV (İnsan) Yrd.Doç.Dr.Yosun MATER

Hayvanların Evrimi IV (İnsan) Yrd.Doç.Dr.Yosun MATER Hayvanların Evrimi IV (İnsan) Yrd.Doç.Dr.Yosun MATER Primatların Evrimi Primatların evriminde iki önemli yenilik çok önemlidir. Bunlar: el ve ayak parmaklarının kavrama kabiliyeti olması ve binoküler görme.

Detaylı

TÜRLERİN KÖKENİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

TÜRLERİN KÖKENİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER TÜRLERİN KÖKENİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER Giriş Charles Darwin, volkanik yapılı Galapagos Adalarına geldiğinde, gördüğü türlerden çok etkilendi. Günlüğüne, Zaman ve mekan içerisinde,

Detaylı

İNÖNÜ ÜNİVERSİTESİ SAĞLIK BİLİMLERİ Fakültesi/Enstitüsü Çocuk Gelişimi Programı

İNÖNÜ ÜNİVERSİTESİ SAĞLIK BİLİMLERİ Fakültesi/Enstitüsü Çocuk Gelişimi Programı İNÖNÜ ÜNİVERSİTESİ SAĞLIK BİLİMLERİ Fakültesi/Enstitüsü Çocuk Gelişimi Programı Dersin Adı: Biyoloji Sorumlu Öğretim Üyesi: Yrd.Doç.Dr. Ahmet Emre YAPRAK Ait Olduğu Programın Adı: ÇOCUK GELİŞİMİ Yarıyılı:

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

KOMPERATİF GENOMİK Principles of Genome Analysis and Genomics S.B. Primrose and R.M. Twyman Bölüm 7 s. 113-132 Amacı; farklı organizmaların genom yapısındaki farklılık ve benzerliklerin ortaya çıkarılmasıdır.

Detaylı

DÜNYADA YAŞAMIN TARİHİ

DÜNYADA YAŞAMIN TARİHİ DÜNYADA YAŞAMIN TARİHİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER Giriş Antartika da çalışmalar yapan araştırıcılar, bugün soğukluğu ve sıvı su bulunmaması nedeniyle çok fazla canlı formun yaşamadığı

Detaylı

12. SINIF KONU ANLATIMI 33 HAYATIN BAŞLANGICI

12. SINIF KONU ANLATIMI 33 HAYATIN BAŞLANGICI 12. SINIF KONU ANLATIMI 33 HAYATIN BAŞLANGICI Canlılar öldükten sonra yumuşak dokular saprofitler tarafından ayrıştırılır. Kemik ve kabuk gibi sert yapılar ise ayrıştırılamaz. Bu yapılar minerallerle kayaçlara

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler

Detaylı

CANLILARIN ÇEŞİTLİLİĞİ Canlıların dış görünüşüne ve yaşadıkları yere göre yapılan sınıflandırma..denir amp.yap. Kökenleri farklı görevleri aynı olan

CANLILARIN ÇEŞİTLİLİĞİ Canlıların dış görünüşüne ve yaşadıkları yere göre yapılan sınıflandırma..denir amp.yap. Kökenleri farklı görevleri aynı olan CANLILARIN ÇEŞİTLİLİĞİ Canlıların dış görünüşüne ve yaşadıkları yere göre yapılan sınıflandırma..denir amp.yap. Kökenleri farklı görevleri aynı olan organlara denir Analog organ Sineğin ve yarasanın kanadı.organdır

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Genomik ve Proteomik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

BİYOLOJİ EĞİTİMİNDE MOLEKÜLER EVRİM. Prof. Dr. Haluk Ertan İ.Ü. Moleküler Biyoloji ve Genetik Bölümü Biyologlar Derneği İstanbul Şubesi

BİYOLOJİ EĞİTİMİNDE MOLEKÜLER EVRİM. Prof. Dr. Haluk Ertan İ.Ü. Moleküler Biyoloji ve Genetik Bölümü Biyologlar Derneği İstanbul Şubesi BİYOLOJİ EĞİTİMİNDE MOLEKÜLER EVRİM Prof. Dr. Haluk Ertan İ.Ü. Moleküler Biyoloji ve Genetik Bölümü Biyologlar Derneği İstanbul Şubesi İKİ FARKLI DÜNYA GÖRÜŞÜ Statik bir evren, dünya ve doğa anlayışı Değişim=Doğaüstü

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

Prokaryotlar ve Arkealar. Yrd.Doç.Dr.Yosun MATER

Prokaryotlar ve Arkealar. Yrd.Doç.Dr.Yosun MATER Prokaryotlar ve Arkealar Yrd.Doç.Dr.Yosun MATER Prokaryotlar ve Arkealar (Archealar) 1.İlk Hücreler Mikrofosiller, ilk hücrelerin olasılıkla prokaryot olduğunu işaret eder. En eski mikrofosiller 3,5 milyar

Detaylı

LABORATUVAR 4: ÖKARYOTİK HÜCRELER

LABORATUVAR 4: ÖKARYOTİK HÜCRELER LABORATUVAR 4: ÖKARYOTİK HÜCRELER Ökaryotik hücreler, sahip oldukları hücre iskeleti, nüklear membran ve organelleri içeren bölümleri ile prokaryot hücrelerden ayırt edilebilmektedir. Kimyasal analizler

Detaylı

ADIM ADIM YGS LYS Adım EVRİM

ADIM ADIM YGS LYS Adım EVRİM ADIM ADIM YGS LYS 191. Adım EVRİM EVRİM İLE İLGİLİ GÖRÜŞLER Evrim, geçmiş ile gelecekteki canlıların ve olayların yorumlanmasını sağlayarak, bugün dünyada yaşayan canlılar arasındaki akrabalık derecesini

Detaylı

TEMEL VETERĠNER GENETĠK

TEMEL VETERĠNER GENETĠK DİKKATİNİZE: BURADA SADECE ÖZETİN İLK ÜNİTESİ SİZE ÖRNEK OLARAK GÖSTERİLMİŞTİR. ÖZETİN TAMAMININ KAÇ SAYFA OLDUĞUNU ÜNİTELERİ İÇİNDEKİLER BÖLÜMÜNDEN GÖREBİLİRSİNİZ. TEMEL VETERĠNER GENETĠK KISA ÖZET KOLAYAOF

Detaylı

CANLILARIN TANIMLANMASI ve ADLANDIRILMASI: TAKSONOMİ

CANLILARIN TANIMLANMASI ve ADLANDIRILMASI: TAKSONOMİ CANLILARIN TANIMLANMASI ve ADLANDIRILMASI: TAKSONOMİ 1969 Yılında Whittaker in geliştirdiği 5 li Alem sistemi kullanılmaktadır. Canlılar Monera ve Eukarya olmak üzere ikiye ayrılır. Sınıflandırma yani

Detaylı

EVRİM MÜHENDİSLİĞİ. Tuğrul Giray Porto Riko Üniversitesi (UPR) Orta Doğu Teknik Üniversitesi (ODTÜ)

EVRİM MÜHENDİSLİĞİ. Tuğrul Giray Porto Riko Üniversitesi (UPR) Orta Doğu Teknik Üniversitesi (ODTÜ) EVRİM MÜHENDİSLİĞİ Tuğrul Giray Porto Riko Üniversitesi (UPR) Orta Doğu Teknik Üniversitesi (ODTÜ) Bilim ve Teknoloji Basımevi Osmanlı da bir şeyhülislam fetvası ile 1727 de izin verilene kadar 300 yıl

Detaylı

ISPARTA HALIKENT ANADOLULİSESİ ÖĞRETİM YILI 9 A-B-C-D-E SINIFLAR BİYOLOJİ DERSİ 2. DÖNEM 3. YAZILI SINAVI RAKAMLA YAZIYLA PUAN

ISPARTA HALIKENT ANADOLULİSESİ ÖĞRETİM YILI 9 A-B-C-D-E SINIFLAR BİYOLOJİ DERSİ 2. DÖNEM 3. YAZILI SINAVI RAKAMLA YAZIYLA PUAN 1. Doğal sınıflandırmada aşağıdakilerden hangisi göz önünde bulundurulmamıştır? A) Genetik (soy) benzerliği B) Anatomik benzerlik C) Dünyadaki dağılımları D) Akrabalık derecesi E) Embriyonik benzerlik

Detaylı

BİYOLOJİYE GİRİŞ MBG 111 BİYOLOJİ I. Hazırlayan: Yrd.Doç.Dr. Yosun MATER. Yrd.Doç.Dr.Yosun MATER

BİYOLOJİYE GİRİŞ MBG 111 BİYOLOJİ I. Hazırlayan: Yrd.Doç.Dr. Yosun MATER. Yrd.Doç.Dr.Yosun MATER BİYOLOJİYE GİRİŞ MBG 111 BİYOLOJİ I Hazırlayan: Yrd.Doç.Dr. Yosun MATER DÜNYANIN OLUŞUMUNDA MOLEKÜLER EVRİM *Canlılar belirli bir büyüklükteki moleküler dizilimin ürünü olmak zorundadır. *Bunun nedeni

Detaylı

BİYOLOJİ SORU BANKASI

BİYOLOJİ SORU BANKASI BİYOLOJİ SORU BANKASI Bölüm: 1 Biyolojiye Giriş ve Bilimsel Düşünce ÖĞRETMENLİK ALAN BİLGİSİ TESTİ SORULAR 1. Biyoloji biliminin, bazı alt dallarına ait özellikler aşağıda verilmiştir; Hayatın başlangıcını

Detaylı

Gen Organizasyonu ve Genomların Evrimi

Gen Organizasyonu ve Genomların Evrimi GENETĐK 111-503 Gen Organizasyonu ve Genomların Evrimi Doç. Dr. Hilâl Özdağ 1 RNA nın Kendi Kendini Kopyalayabiliyor Olmalıydı Đlkin zamanlardaki RNA dünyasında RNA moleküllerinin kopyalanması. RNA polimerazlar

Detaylı

KALITIMIN İZLERİ MBG 111 BİYOLOJİ I. Hazırlayan: Yrd.Doç.Dr. Yosun MATER. Yrd.Doç.Dr.Yosun MATER

KALITIMIN İZLERİ MBG 111 BİYOLOJİ I. Hazırlayan: Yrd.Doç.Dr. Yosun MATER. Yrd.Doç.Dr.Yosun MATER KALITIMIN İZLERİ MBG 111 BİYOLOJİ I Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Kalıtımın Gizemi Eski bitki biyologları, melezler bitkilerle yaptıkları çalışmalarda şaşırtıcı sonuçlar ortaya

Detaylı

KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI

KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI KROMOZOM HARİTALARI ve MAYOZ BÖLÜNME HATALARI MBG 111 BİYOLOJİ I Hazırlayan: Yrd.Doç.Dr. Yosun MATER GİRİŞ Mendel kalıtımında eğer genler bağımsız ise kalıtıldıklarında kabaca belli oranlarda ve sıklıkla

Detaylı

Mustafa EMREM

Mustafa EMREM Mustafa EMREM 162161022 Bakterilerdeki transformasyonun ilk kanıtları İngiliz bilim adamı Frederick Griffith tarafından elde edilmiştir. Genetik materyal aktarımı Dikey Gen Transferi ebeveyn ile yavru

Detaylı

Ekolojik niş organizmanın ekolojik boşluğunu tanımlar.

Ekolojik niş organizmanın ekolojik boşluğunu tanımlar. NİŞ KAVRAMI Ekljik niş rganizmanın ekljik bşluğunu tanımlar. Kaynak Çevresel tlerans Ekljik rl Ekljik niş türün ppülasyn büyümesini sınırlayan temel faktörlerin ne lduğunu anlamamızı sağlar. Türün cğrafi

Detaylı

2007 ÖSS BİYOLOJİ SORULARI VE CEVAPLARI

2007 ÖSS BİYOLOJİ SORULARI VE CEVAPLARI 2007 ÖSS BİYOLOJİ SORULARI VE CEVAPLARI 1. BÖLÜM 1. Aşağıdaki tabloda bazı canlı türlerinin kromozom sayıları verilmiştir. Bu tablodaki bilgilere göre, I. İki canlı türünün kromozom sayılarına bakılarak

Detaylı

DNA barkodlama. Prof.Dr.Çağrı Ergin Pamukkale Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD - Denizli

DNA barkodlama. Prof.Dr.Çağrı Ergin Pamukkale Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD - Denizli DNA barkodlama Prof.Dr.Çağrı Ergin Pamukkale Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD - Denizli 8.Ulusal Tanısal ve Moleküler Mikrobiyoloji Kongresi Haziran 2014 Taksonomi Neler, neden değişiyor?

Detaylı

TIBBĠ BĠLĠMLERE GĠRĠġ DĠLĠMĠ MĠKROBĠYOLOJĠ ANABĠLĠM DALI

TIBBĠ BĠLĠMLERE GĠRĠġ DĠLĠMĠ MĠKROBĠYOLOJĠ ANABĠLĠM DALI TIBBĠ BĠLĠMLERE GĠRĠġ DĠLĠMĠ MĠKROBĠYOLOJĠ ANABĠLĠM DALI ÖĞRETĠM ÜYESĠ : Prof. Dr. O. ġadi Yenen Ders: VĠROLOJĠYE GĠRĠġ, TARĠHÇE ve EVRĠM 1. Virusların tanımlanması ve rolüne ilişkin önemli tarihsel gelişmelerin

Detaylı

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ

FEN ve TEKNOLOJİ / GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ. GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ GENETİK MÜHENDİSLİĞİ ve BİYOTEKNOLOJİ 1 Genetik mühendisliği canlıların kalıtsal özelliklerinin değiştirilerek onlara yeni işlevler kazandırılmasına yönelik araştırmalar yapan bilim dalıdır. Genetik mühendisleri

Detaylı

BULUNDUĞUMUZ MEKÂN ve ZAMAN

BULUNDUĞUMUZ MEKÂN ve ZAMAN 1.SINIFLAR PYP VELİ BÜLTENİ (28 EKİM -13 ARALIK 2013) Sayın Velimiz, Okulumuzda yürütülen PYP çalışmaları kapsamında 28 Ekim 2013-13 Aralık 2013 tarihleri arasında işlediğimiz ikinci temamıza ait bilgiler,

Detaylı

HAFTA II Mendel Genetiği

HAFTA II Mendel Genetiği GENETĐK 111-503 HAFTA II Mendel Genetiği Doç. Dr. Hilâl Özdağ 1865 Gregor Mendel kalıtım kurallarının temellerini attı. http://www.dnaftb.org/dnaftb/1/concept/ 1 Seçilen Özellikler Hartl DL, Jones EW,

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Evrimsel açıdan genlerin çoğaltılmasının önemi ilk defa Haldane (1932) ve Muller (1935 ) tarafından önerildi ve tanımlandı. *Evrimsel açıdan bir genin

Detaylı

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi

Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi BİYOLOJİDEKİ TEKNOLOJİK GELİŞMELER VE ÖNCELİKLERİMİZ Dr. Aslı Tolun Moleküler Biyoloji ve Genetik Bölümü Boğaziçi Üniversitesi KLONLAMA / KOPYALAMA Tanım Yöntem Amaç: Kopya birey yaratma Kök hücre oluşturma

Detaylı

Dersin Kodu

Dersin Kodu Genel Biyoloji I Dersin Adı Genel Biyoloji I Dersin Kodu 1206.3101 Dersin Türü Zorunlu Dersin Seviyesi Dersin AKTS Kredisi 5,00 Haftalık Ders Saati (Kuramsal) 4 Haftalık Uygulama Saati 0 Haftalık Laboratuar

Detaylı

Evrimsel Biyolojide Deney ve Kuram İlişkisi

Evrimsel Biyolojide Deney ve Kuram İlişkisi Evrimsel Biyolojide Deney ve Kuram İlişkisi Betul Kacar NASA Astrobiyoloji Ens0tusu Georgia Tech betul.kcr@gmail.com Matema0ksel Evrim Çalıştayı Matema0k Köyü, Şirince, İzmir Eylül 2013 Bölüm I: Atasal

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Kök Hücre Biyolojisi Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim(

Detaylı

127 - Twoing Algoritması ile Sınıflandırma Kalp Hastalığı Uygulaması MEHMET AKİF ERSOY ÜNİVERSİTESİ İLHAN UYSAL MEHMET BİLEN SAMİ ULUKUŞ

127 - Twoing Algoritması ile Sınıflandırma Kalp Hastalığı Uygulaması MEHMET AKİF ERSOY ÜNİVERSİTESİ İLHAN UYSAL MEHMET BİLEN SAMİ ULUKUŞ 127 - Twoing Algoritması ile Sınıflandırma Kalp Hastalığı Uygulaması MEHMET AKİF ERSOY ÜNİVERSİTESİ İLHAN UYSAL MEHMET BİLEN SAMİ ULUKUŞ Veri Madenciliği : Bir sistemin veri madenciliği sistemi olabilmesi

Detaylı

KARADENİZ İN TÜRKİYE KIYILARINDA DAĞILIM GÖSTEREN MERSİN BALIĞI TÜRLERİNİN MİTOKONDRİAL DNA SEKANS ANALİZİ YÖNTEMİYLE TANIMLANMASI

KARADENİZ İN TÜRKİYE KIYILARINDA DAĞILIM GÖSTEREN MERSİN BALIĞI TÜRLERİNİN MİTOKONDRİAL DNA SEKANS ANALİZİ YÖNTEMİYLE TANIMLANMASI MAKALE KARADENİZ İN TÜRKİYE KIYILARINDA DAĞILIM GÖSTEREN MERSİN BALIĞI TÜRLERİNİN MİTOKONDRİAL DNA SEKANS ANALİZİ YÖNTEMİYLE TANIMLANMASI Oğuzhan EROĞLU, SUMAE Mersin balıklarının Tethis Denizi kökenli

Detaylı

BİTKİ MATERYALİ II: ANGIOSPERMAE

BİTKİ MATERYALİ II: ANGIOSPERMAE BİTKİ MATERYALİ II: ANGIOSPERMAE Prof.Dr. Yahya AYAŞLIGİL Yrd.Doç.Dr. Doğanay YENER İstanbul Üniversitesi, Orman Fakültesi Peyzaj Mimarlığı Bölümü Bitki Materyali ve Yetiştirme Tekniği Anabilim Dalı 23.02.2015

Detaylı

Aşağıda mitoz bölünme safhaları karışık olarak verilmiştir.

Aşağıda mitoz bölünme safhaları karışık olarak verilmiştir. 2015/2016 EĞİTİM ÖĞRETİM YILI FEN VE TEKNOLOJİ DERSİ ÖRNEK 8.SINIFLAR 1.DÖNEM 1.YAZILI Adı Soyadı : No: Sınıf: Resimdeki türlerin bazı hücrelerindeki kromozom sayılarını yazınız. (4x2p) Aşağıda mitoz bölünme

Detaylı

SON NOKTA. Prof. Dr. Necmi GÜRSAKAL

SON NOKTA. Prof. Dr. Necmi GÜRSAKAL SON NOKTA Prof. Dr. Necmi GÜRSAKAL Öncelikle bu çalışmada vardığımız sonuçların ve yaptığımız yorumların, sadece BTSO nun 250 Büyük Firma araştırması verilerine dayandıklarını, bu nedenle Bursa geneli

Detaylı

-...sentezlenemezse; - ortamda... birikir. - ortamda... oluşmadığından

-...sentezlenemezse; - ortamda... birikir. - ortamda... oluşmadığından 2014 2015 MEV KOLEJİ ÖZEL ANKARA OKULLARI 9. SINIF BİYOLOJİ DERSİ YAZ TATİLİ EV ÇALIŞMASI Ödevin Veriliş Tarihi:12.06.2015 Ödevin Teslim Tarihi: 21.09.2015 1.Aşağıda verilen özelliklerden hangisi canlılarda

Detaylı

Editörler Prof.Dr. Cansu Filik İşçen & Prof.Dr. Lütfullah Türkmen EVRİM

Editörler Prof.Dr. Cansu Filik İşçen & Prof.Dr. Lütfullah Türkmen EVRİM Editörler Prof.Dr. Cansu Filik İşçen & Prof.Dr. Lütfullah Türkmen EVRİM Yazarlar Prof.Dr. Gazi Görür Doç.Dr. Bekir Doğan Doç.Dr. Meltem Atabay Doç.Dr. Yunus Esen Doç.Dr. Yunus Esen Doç.Dr. Zeha Yakar Yrd.Doç.Dr.

Detaylı

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11

2. BÖLÜM: POPULASYONLARDA ALEL VE GENOTİP FREKANSLARININ DEĞİŞİMİ... 11 İÇİNDEKİLER 1. BÖLÜM: EVRİME GİRİŞ...1 1.1. EVRİM VE BAŞLICA EVRİM TEORİLERİ...1 1.1.1. Darwin in Evrim Teorisi...2 1.1.2. Darwin Sonrasının Evrim Teorileri...4 1.1.3. Evrimsel Sentez Teorisi...5 1.2.

Detaylı

ZAR YAPISI ve FONKSİYONLARI

ZAR YAPISI ve FONKSİYONLARI ZAR YAPISI ve FONKSİYONLARI ZARLAR Zarlar yaşayan hücrede 5-10nm kalınlığında iki fosfolipit tabakadan oluşur. Burada yer alan fosfolipit tabaka amfipatik (amphipatic)bir özelliğe sahiptir. Amfipatik terimi,

Detaylı

GEN EKSPRESYONU: GENDEN PROTEİNE

GEN EKSPRESYONU: GENDEN PROTEİNE GENLER ve İŞLEVLERİ GEN EKSPRESYONU: GENDEN PROTEİNE Hazırlayan: Yrd.Doç.Dr. Yosun MATER Yrd.Doç.Dr.Yosun MATER Genlerin Doğası Şimdiye kadar öğrendiklerimiz bize canlıya ait bilgilerin DNA da yer aldığını

Detaylı

DİS 1 (11.2015) SINIF A DERS ÜNİTE KAZANIM. 8. sınıf 1 Türkçe Okuduğu metni anlama ve çözümleme Metne ilişkin sorular oluşturur.

DİS 1 (11.2015) SINIF A DERS ÜNİTE KAZANIM. 8. sınıf 1 Türkçe Okuduğu metni anlama ve çözümleme Metne ilişkin sorular oluşturur. 8. sınıf 1 Türkçe Okuduğu metni anlama ve çözümleme Metne ilişkin sorular oluşturur. 8. sınıf 2 Türkçe Okuduğu metni anlama ve çözümleme Metni oluşturan unsurlar arasındaki geçiş ve bağlantıları fark eder.

Detaylı

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ

KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ KALITSAL MOLEKÜLÜN BİÇİMİ ve ORGANİZASYONU PROF. DR. SERKAN YILMAZ Değişik canlı gruplarında kalıtsal molekülün çeşidi, sayısı, biçimi ve organizasyonu bakımından farklılıklar bulunur. Ortak özellik: nükleik

Detaylı

TÜRKİYE` DE ELEKTRİK PİYASA TAKAS FİYATI VE SİSTEM MARJİNAL FİYATI FARKI ÜZERİNE İSTATİSTİKSEL BİR ÇALIŞMA 1

TÜRKİYE` DE ELEKTRİK PİYASA TAKAS FİYATI VE SİSTEM MARJİNAL FİYATI FARKI ÜZERİNE İSTATİSTİKSEL BİR ÇALIŞMA 1 TÜRKİYE` DE ELEKTRİK PİYASA TAKAS FİYATI VE SİSTEM MARJİNAL FİYATI FARKI ÜZERİNE İSTATİSTİKSEL BİR ÇALIŞMA 1 Gökhan Ceyhan Yöneylem Araştırması Uzmanı, EPİAŞ ÖZET Bu çalışmada, Türkiye gün öncesi elektrik

Detaylı

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz İnsan Mikrobiyom Projesi Prof. Dr. Tanıl Kocagöz Human Microbiome Project İnsan Mikrobiyom Projesi (İMP) 2007 yılında NIH tarafından başlatıldı 300 gönüllünün 5 vücut bölgesinden değişik zamanlarda, toplam

Detaylı

Genetik Algoritmalar. Bölüm 1. Optimizasyon. Yrd. Doç. Dr. Adem Tuncer E-posta:

Genetik Algoritmalar. Bölüm 1. Optimizasyon. Yrd. Doç. Dr. Adem Tuncer E-posta: Genetik Algoritmalar Bölüm 1 Optimizasyon Yrd. Doç. Dr. Adem Tuncer E-posta: adem.tuncer@yalova.edu.tr Optimizasyon? Optimizasyon Nedir? Eldeki kısıtlı kaynakları en iyi biçimde kullanmak olarak tanımlanabilir.

Detaylı

FEN ve TEKNOLOJİ / KALITIM KALITIM İLE İLGİLİ KAVRAMLAR

FEN ve TEKNOLOJİ / KALITIM KALITIM İLE İLGİLİ KAVRAMLAR KALITIM İLE İLGİLİ KAVRAMLAR 1 Kalıtım : Bir canlının sahip olduğu özelliklerin nesilden nesile aktarılması olayına kalıtım denir. Genetik: Canlı soyları arasındaki benzerlik ve farklılıkların ortaya çıkmasını

Detaylı

EĞİTİM - ÖĞRETİM YILI 5. SINIF FEN BİLİMLERİ DERSİ DESTEKLEME VE YETİŞTİRME KURSU KAZANIMLARI VE TESTLERİ

EĞİTİM - ÖĞRETİM YILI 5. SINIF FEN BİLİMLERİ DERSİ DESTEKLEME VE YETİŞTİRME KURSU KAZANIMLARI VE TESTLERİ KASIM EKİM Ay Hafta Ders Saati 2017-2018 EĞİTİM - ÖĞRETİM YILI 5. SINIF FEN BİLİMLERİ DERSİ DESTEKLEME VE YETİŞTİRME KURSU KAZANIMLARI VE TESTLERİ Konu Adı Kazanımlar Test No Test Adı F.5.1.1.1. Güneş

Detaylı

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın

İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın İstanbul Tıp Fakültesi Tıbbi Biyoloji AD Prof. Dr. Filiz Aydın Dominant / resesif tanımları Otozomal ve gonozomal kalıtım nedir? İnkomplet dominant/ kodominant ne ifade eder? Pedigri nedir, Neden yapılır?

Detaylı

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır.

Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik. Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda bulunmasıdır. Allel: Bir genin seçenekli biçimi Wild Tip: Normal allel. Bireylerin çoğunda bulunan Mutasyon: DNA dizisinde meydana gelen kalıcı değişiklik Polimorfizm: iki veya daha fazla farklı fenotipin aynı tür popülasyonunda

Detaylı

Kalem ve kağıtla biyoinformatik: filogenetik ağaç oluşturma

Kalem ve kağıtla biyoinformatik: filogenetik ağaç oluşturma GÖRÜŞ Resim: hometowncd / istockphoto Kalem ve kağıtla biyoinformatik: filogenetik ağaç oluşturma Biyoinformatik genellikle güçlü bilgisayarlarla yapılır. Ancak burada Cleopatra Kozlowski nin yardımıyla

Detaylı

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu

Türkiye'de İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Türkiye'de 2015-2016 İnfluenza Sezonunda Görülen Influenza A(H1N1)pdm09 Virüsünün Moleküler Karakterizasyonu Dilek Güldemir 1,Ayşe Başak Altaş 1,Fatma Filiz Arı 1,Zekiye Bakkaloğlu 1,Özlem Ünaldı 1,Fatma

Detaylı

ALGORİTMA VE PROGRAMLAMA I

ALGORİTMA VE PROGRAMLAMA I ALGORİTMA VE PROGRAMLAMA I YZM 1101 Celal Bayar Üniversitesi Hasan Ferdi Turgutlu Teknoloji Fakültesi Genel Bakış 2 Karakter Dizileri Karakter Dizilerini Okumak ve Yazmak Karakter Dizilerinin Uzunluğunu

Detaylı

KALITIMIN MOLEKÜLER TEMELİ

KALITIMIN MOLEKÜLER TEMELİ KALITIMIN MOLEKÜLER TEMELİ MBG 111 BİYOLOJİ I Hazırlayan: Yrd.Doç.Dr. Yosun MATER Genetik Bilgi Kaynağımızın Doğası 1928 de Frederick Griffith bakteri hücrelerinin kendini transforme edilebildiğini gösterdi.

Detaylı

Hardy Weinberg Kanunu

Hardy Weinberg Kanunu Hardy Weinberg Kanunu Neden populasyonlarla çalışıyoruz? Popülasyonları analiz edebilmenin ilk yolu, genleri sayabilmekten geçer. Bu sayım, çok basit bir matematiksel işleme dayanır: genleri sayıp, tüm

Detaylı

Türkiye Tenthredopsis (Hymenoptera: Symphyta: Tenthredinidae) Tür Sınırlarının Barkodlama Yöntemi İle Saptanması

Türkiye Tenthredopsis (Hymenoptera: Symphyta: Tenthredinidae) Tür Sınırlarının Barkodlama Yöntemi İle Saptanması Türkiye Tenthredopsis (Hymenoptera: Symphyta: Tenthredinidae) Tür Sınırlarının Barkodlama Yöntemi İle Saptanması Sevda HASTAOĞLU ÖRGEN 1, Mahir BUDAK 2, E. Mahir KORKMAZ 2, Hasan H. BAŞIBÜYÜK 3 1 Sivas

Detaylı

ADIM ADIM YGS-LYS 43. ADIM CANLILARIN SINIFLANDIRILMASI-3 BAKTERİLER ALEMİ

ADIM ADIM YGS-LYS 43. ADIM CANLILARIN SINIFLANDIRILMASI-3 BAKTERİLER ALEMİ ADIM ADIM YGS-LYS 43. ADIM CANLILARIN SINIFLANDIRILMASI-3 BAKTERİLER ALEMİ BAKTERİLER ALEMİ Prokaryot hücre yapısına sahip olan tek hücreli canlıların oluşturduğu alemdir. Mikroskobun icadından sonra keşfedilmişlerdir.

Detaylı

FİLOGENETİK İLİŞKİLERİN BELİRLENMESİNDE DİZİ KULLANIMI

FİLOGENETİK İLİŞKİLERİN BELİRLENMESİNDE DİZİ KULLANIMI FİLOGENETİK İLİŞKİLERİN BELİRLENMESİNDE DİZİ KULLANIMI Biyolojide filogenetik çeşitli organizma grupları arasındaki evrimsel akrabalıkların araştırılmasıdır. Genomik bilgiyi kullanarak canlılar arasındaki

Detaylı

1. ÜNİTE: YAŞAM BİLİMİ BİYOLOJİ...10

1. ÜNİTE: YAŞAM BİLİMİ BİYOLOJİ...10 İçindekiler 1. ÜNİTE: YAŞAM BİLİMİ BİYOLOJİ...10 1. BÖLÜM: BİLİMSEL BİLGİNİN DOĞASI ve BİYOLOJİ... 12 A. BİLİMSEL ÇALIŞMA YÖNTEMİ... 12 1. Bilim İnsanı ve Bilim... 12 B. BİLİMSEL YÖNTEMİN AŞAMALARI...

Detaylı

Hacettepe Üniversitesi Fen Fakültesi, Biyoloji Bölümü Genel Biyoloji ABD, 06800 Beytepe/Ankara.

Hacettepe Üniversitesi Fen Fakültesi, Biyoloji Bölümü Genel Biyoloji ABD, 06800 Beytepe/Ankara. AYNI COĞRAFİK BÖLGEYE AİT İKİ KARDEŞ (SİBLİNG) DROSOPHILA TÜRÜNÜN GELİŞİM SÜRELERİNİN KALORİK KISITLANMAYA BAĞLI DEĞİŞİMİNİN ANALİZİ ÖNDER, B.Ş., YILMAZ, M., BOZCUK, A.N. Hacettepe Üniversitesi Fen Fakültesi,

Detaylı

Veritabanı Yönetim Sistemleri, 2. basım Zehra ALAKOÇ BURMA, 2009, Seçkin Yayıncılık

Veritabanı Yönetim Sistemleri, 2. basım Zehra ALAKOÇ BURMA, 2009, Seçkin Yayıncılık Veri Kaynaklar Veri Tabanı Sistemleri, 2. basım Prof. Dr. Ünal YARIMAĞAN, 2010, Akademi Yayınevi Veritabanı Yönetim Sistemleri, 2. basım Zehra ALAKOÇ BURMA, 2009, Seçkin Yayıncılık Veritabanı ve Uygulamaları

Detaylı

TRANSLASYON VE DÜZENLENMESİ

TRANSLASYON VE DÜZENLENMESİ TRANSLASYON VE DÜZENLENMESİ TRANSLASYON Translasyonda nükleik asit kullanılır fakat son ürün bir nükleik asit değil proteindir. Translasyon mekanizması 4 ana bileşenden oluşmaktadır: 1. mrnalar 2. trnalar

Detaylı

8. Sınıf Fen ve Teknoloji

8. Sınıf Fen ve Teknoloji Canlı vücudunu oluşturan karakterleri üremeyle nesilden nesile aktarılmasını inceleyen kalıtım birimine genetik denir. Anne ve babadan gelen eşey hücreleri zigotu oluşturur. Bu hücrelerle birlikte gelen

Detaylı

tree) nedir? Karar Ağacı (Decision Decisiontree

tree) nedir? Karar Ağacı (Decision Decisiontree Karar Ağacı (Decision Decisiontree tree) nedir? Bir işletme yönetimi tarafından tercihlerin, risklerin, kazançların, hedeflerin tanımlanmasında yardımcı olabilen ve birçok önemli yatırım alanlarında uygulanabilen,

Detaylı

An#k genler, astrobiyoloji ve deneysel evrim:

An#k genler, astrobiyoloji ve deneysel evrim: An#k genler, astrobiyoloji ve deneysel evrim: Peki bu bilgiler gerçek haya/a ne işimize yarayacak? Betül Kacar FF Seminerleri Mart 2013 (Bildiğimiz) HAYAT BiR RASTLANTIDAN MI ibaret? Evrimsel sureçlerde

Detaylı

KALITSAL MADDE PROF. DR. SERKAN YILMAZ

KALITSAL MADDE PROF. DR. SERKAN YILMAZ KALITSAL MADDE PROF. DR. SERKAN YILMAZ Kalıtsal madde (kalıtsal molekül, genetik materyal) (1) canlının yapı ve işlevlerinin belirlenmesinden, (2) canlının kendine benzer bir canlıyı meydana getirmesinden,

Detaylı

GEN EKSPRESYONUNUN KONTROLÜ

GEN EKSPRESYONUNUN KONTROLÜ GEN EKSPRESYONUNUN KONTROLÜ Hazırlayan: Yrd.Doç.Dr. Yosun MATER Gen Ekspresyonun Kontrolü Kontrol genellikle transkripsiyon başlangıç düzeyinde gerçekleşir. Transkripsiyonda düzenleyici proteinler tarafından

Detaylı

YGS YE HAZIRLIK DENEMESi #16

YGS YE HAZIRLIK DENEMESi #16 YGS YE HAZIRLIK DENEMESi #16 1) Topraktaki azotlu bileşik miktarını, I. Denitrifikasyon bakteri sayısındaki artış II. Saprofit bakterilerce gerçekleşen çürüme III. Şimşek ve yıldırım olaylarındaki artış

Detaylı

B Ö L Ü M ı Genomlar Hastalıkların Genetik Temellerinin Tanımlanması Özet Sorular Ek Kaynaklar Kaynakça Bir haplotip bloğunda desen saptama Tartışma

B Ö L Ü M ı Genomlar Hastalıkların Genetik Temellerinin Tanımlanması Özet Sorular Ek Kaynaklar Kaynakça Bir haplotip bloğunda desen saptama Tartışma DETAYLI İçerik Çeviri editörünün ön sözü xiii Ön söz xv Teşekkür xxi Editörler ve yazarlar xxiv Bilgisayarlı hesaplamaya giriş xxvi Çeviri: Ar. Gör. Aslı Özdilek, Ar. Gör. Yeliz Tümbilen Özer, Prof. Dr.

Detaylı

ALGORİTMA VE PROGRAMLAMA I

ALGORİTMA VE PROGRAMLAMA I ALGORİTMA VE PROGRAMLAMA I Yrd. Doç. Dr. Deniz KILINÇ deniz.kilinc@cbu.edu.tr YZM 1101 Celal Bayar Üniversitesi Hasan Ferdi Turgutlu Teknoloji Fakültesi Genel Bakış 2 Karakter Dizileri Karakter Dizilerini

Detaylı

Bakteriler ve Archaea

Bakteriler ve Archaea Bakteriler ve Archaea Yapısal ve işlevsel adaptasyonlar prokaryotik başarıya katkıda bulunur Hızlı üreme, mutasyon ve genetik rekombinasyon prokaryotlarda genetik çeşitliliği arttırır Çeşitli beslenme

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Domain Çoğalması ve Gen Uzaması *Ökaryotlarda modern genler üzerine yapılan bir araştırma gösteriyor ki, içsel duplikasyonlar evrim boyunca sık sık meydana

Detaylı

NEDEN BİYOİNFORMATİK?

NEDEN BİYOİNFORMATİK? 127 NEDEN BİYOİNFORMATİK? Rengün Çetin ATALAY* Recent progresses in molecular biology have revealed the large fractions of the genome sequences of several species during the last decades. Public sequence

Detaylı

Sistem Geliştirme Yaşam Döngüsü (The Systems Development Life Cycle) (SDLC)

Sistem Geliştirme Yaşam Döngüsü (The Systems Development Life Cycle) (SDLC) Sistem Geliştirme Yaşam Döngüsü (The Systems Development Life Cycle) (SDLC) Sistem analistlerinin ve kullanıcı faaliyetlerinin spesifik döngüsünün kullanılmasıyla En iyi geliştirilmiş sistemin oluşmasını

Detaylı