RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği"

Transkript

1 RNAi Teknolojisinin Deneysel Aşamaları ve Tedavideki Geleceği sirna Doç.Dr. Metiner Tosun EÜ Eczacılık Fakültesi Farmakoloji AD Trabzon Ekim 07 Geleneksel ilaç geliştirme fazları: Doğrusal süreç 1-5 yıl 2-10 yıl 2 ay-7 yıl 1

2 MOLEKÜLER TEMELLER GENOMİK ANATOMİ (DNA dizi analizi) Bireyler arası ve etnografik farklılıklar EKSPRESYON ŞEKİLLERİ (RNA-proteinmetabolitler) Fizyolojik, patolojik, gelişimsel farklılıklar Farmakogenetik PRENSİP ve TEKNİKLER İLAÇ DUYARLIK PROFİLLERİ GENOTİP-FENOTİP KARŞILAŞTIRMALARI (Proteinler) Hücresel lokasyon Mekanizmalar Yolaklar HEDEFLER KİŞİYE-ÖZEL İLAÇ VE TEDAVİ YENİ İLAÇ KEŞFİ ve KLİNİK DENEMELER İlaç geliştirme fazları (yeni yaklaşım) ADMET, ADME + Toxicity; IND, investigational new drug; NDA, new drug application; PGx, pharmacogenomics. 2

3 Petunyadan öğrenilen: Reversible co-suppression of homologous genes Napoli et al., The Plant Cell,

4 4

5 Fire, A. et al. Nature 391, (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Elbashir, S.M. et al. Nature 411, (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. 5

6 RNA interferans (Metaforik animasyon), NOVA ScienceNow 2006 Hücre çekirdeği, NOVA ScienceNOW 6

7 Transkripsiyon (mrna oluşumu), NOVA ScienceNOW Translasyon (protein sentezi), NOVA ScienceNOW 7

8 Viral genomun girişi, NOVA ScienceNOW Küçük müdahale-edici RNA (small interfering RNA, sirna) oluşumu, NOVA ScienceNOW 8

9 Post-transkripsiyonel gen susturma Viral şifre taşıyan elçinin imhası, NOVA ScienceNOW NATURE CHEM. BIOL. DECEMBER

10 NATURE Rev Drug Disc sirna tasarımı: Genel yönergeler I Hedeflenecek dizi genellikle 21 nt olmalı Başlangıç ve bitiş kodonlarından bp dizileri arasında olmamalı İntron bölgelerini içermemeli AAAA, CCCC gibi 4 veya daha uzun baz tekrarları içermemeli GC içeriği %30 dan az %60 tan fazla olmamalı Dizi tekrarları olmamalı SNP bölgeleri içermemeli 10

11 sirna tasarımı: Genel yönergeler II Diğer genler ve diziler üzerindeki off-target etkilerden sakınmak için BLAST homoloji araştırması yapılmalı Her zaman sirna içeriğindeki dizileri karıştırarak en azından 4-5 eşleşmeyen mismatched baz dizisi içerecek negatif kontrol sirna tasarlanmalı. Çırpma işleminin yeni dizilere homoloji göstermemesine dikkat edilmeli. TRPC1 sirna BLAST analizi /seq/blastgen/blastgen.cgi?taxid=10116; BLASTN (Aug ) Reference: Altschul SF, TL Madden, AA Schäffer, J Zhang, Z Zhang, W Miller, and DJ Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: RID: HGVD1E6M012 Database: Rattus norvegicus RefSeq RNA 35,902 sequences; 72,405,186 total letters >ref NM_ Rattus norvegicus transient receptor potential cation channel, subfamily C, member 1 (Trpc1), mrna Length=4015 Score = 38.2 bits (19), Expect = Identities = 19/19 (100%), Gaps = 0/19 (0%) Strand=Plus/Plus Query 1 GAACATAAATTGCGTAGAT 19 Sbjct 246 GAACATAAATTGCGTAGAT

12 Hedef mrna sına spesifik sirna 2. Pozitif kontrol (siklofilin B, CyPB sirna) 3. Negatif kontrol (non-targeting NT, hiçbir genomik diziyi hedeflemeyen sirna) 4. Yalancı transfeksiyon (sadece transfeksiyon ajanı) (mock, M) 5. Hiçbir uygulama yapılmamış (untreated, UT) hücreler NATURE Rev Drug Disc

13 NATURE Rev Drug Disc Geleneksel ilaçlar (küçük moleküller, proteinler) ve RNAi NATURE CHEM. BIOL. DEC Agonist Antagonist Ekstraselüler hedef İntraselüler hedef Seçicilik Potentlik Optimizasyon Sentez kolaylığı 13

14 Klinikte RNAi-terapötikler Tedavi Hedef Hastalık Faz Bevasiranib (Acuity) Sirna-027 (Sirna) VEGF VEGF reseptör-1 Yaşa-bağlı maküler dejenerasyon Diyabetik maküler ödem Yaşa-bağlı maküler dejenerasyon II I ALN RSV01 (Alnylam) Respiratuvar sinsitial virüs RSV enfeksiyonu I PTC-299 (PTC Therapeutics) VEGF Kanser (Katı tümörler) I Nature Rev., Temmuz

15 RNAi uygulanabilirliğinin kanıtlandığı organlar NATURE CHEM. BIOL. DECEMBER 2006 NOVA ScienceNOW 15

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi

Biyoteknoloji ve Genetik I Hafta 13. Ökaryotlarda Gen İfadesinin Düzenlenmesi Biyoteknoloji ve Genetik I Hafta 13 Ökaryotlarda Gen İfadesinin Düzenlenmesi Prof. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/125 Eposta: hilalozdag@gmail.com Gen İfadesi

Detaylı

Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen

Detaylı

Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti

Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti Makine Öğrenimi Yaklaşımı ile Homolog Protein Tespiti, Gökmen Zararsız, Dinçer Göksülük, Osman Saraçbaşı Hacettepe Üniversitesi Tıp Fakültesi Biyoistatistik Anabilim Dalı XVI. Ulusal Biyoistatistik Kongresi,

Detaylı

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA (Ribonükleik Asit) Nükleik asitler, Friedrich Miescher tara2ndan 1869'da keşfedildi. İl=haplı bandajlardan izole edilen bu maddeye nüklein adını

Detaylı

Antimikrobiyaller için Yeni Hedefler. Prof. Dr. Tanıl Kocagöz Tıp Fakültesi, Tıbbi Mikrobiyoloji A.D.

Antimikrobiyaller için Yeni Hedefler. Prof. Dr. Tanıl Kocagöz Tıp Fakültesi, Tıbbi Mikrobiyoloji A.D. Antimikrobiyaller için Yeni Hedefler Prof. Dr. Tanıl Kocagöz Tıp Fakültesi, Tıbbi Mikrobiyoloji A.D. Fleming 1929 Antimikrobiyaller Penicillium kolonisi Bakteri üreyemiyor Bakteri Davies J, and Davies

Detaylı

KANSEROLOJİDE FARMAKOGENOMİ

KANSEROLOJİDE FARMAKOGENOMİ KANSEROLOJİDE FARMAKOGENOMİ Prof.Dr. Işık TUĞLULAR Ege Üniversitesi İlaç Geliştirme ve Farmakokinetik Araştırma - Uygulama Merkezi ( ARGEFAR ) Müdürü Farmakogenomik Kursu 24 Mart 2010 ANTALYA İLAÇ Klinik

Detaylı

Genetikten Genombilime Geçişte Transkriptom Analizleri

Genetikten Genombilime Geçişte Transkriptom Analizleri Genetikten Genombilime Geçişte Transkriptom Analizleri Doç.Dr. Hilâl Özdağ AÜ iyoteknoloji Enstitüsü Mammals Other chordates Other eukaryotes Homo sapiens [NCI 35] Vega Gallus gallus [WASHUC1] Drosophila

Detaylı

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu

hendisliği BYM613 Genetik MühendisliM Tanımlar: Gen, genom DNA ve yapısı, Nükleik asitler Genetik şifre DNA replikasyonu BYM613 Genetik MühendisliM hendisliği Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Salı 9.00-11.45, D9 Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik Tanımlar: Gen,

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM)

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA (5. BÖLÜM) TRANSKRİPSİYONU (ÖKARYOTİK) STOPLAZMA DNA Transkripsiyon hnrna RNA nın işlenmesi mrna G AAA Eksport G AAA NÜKLEUS TRANSKRİPSİYONU (PROKARYOTİK) Stoplazma

Detaylı

Yard. Doç. Dr. Ercan ARICAN. İ.Ü. FEN FAKÜLTESİ, Moleküler Biyoloji ve Genetik Bölümü

Yard. Doç. Dr. Ercan ARICAN. İ.Ü. FEN FAKÜLTESİ, Moleküler Biyoloji ve Genetik Bölümü KANSER OLUŞUMUNDA ROL OYNAYAN EPİGENETİK MEKANİZMALAR Yard. Doç. Dr. Ercan ARICAN İ.Ü. FEN FAKÜLTESİ, Moleküler Biyoloji ve Genetik Bölümü Epigenetik Nedir? Gen ekspresyonuna dayanan kalıtsal bilgi epigenetik

Detaylı

İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi Prof. Dr. Demir Budak Dekan

İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi Prof. Dr. Demir Budak Dekan İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi Prof. Dr. Demir Budak Dekan Eğitim Koordinatörü: Prof. Dr. Asiye Nurten 2015 / 2016 EĞİTİM ÖĞRETİM YILI DERS KURULU 3 (TIP 132) TEMEL TIP BİLİMLERİNE GİRİŞ

Detaylı

Moleküler Yöntemlerin Tanımlanması

Moleküler Yöntemlerin Tanımlanması Moleküler Yöntemlerin Tanımlanması Uğur Özbek İstanbul Üniversitesi DETAE, Genetik A.D. 2. Ulusal Lenfoma Myeloma Kongresi Lenfomalarda Moleküler Patogenez ve Hematopatoloji 16.04.2011 Sunum I. İnsan Genomu

Detaylı

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı

Detaylı

Gen Đfadesi, tespiti ve ölçülmesi

Gen Đfadesi, tespiti ve ölçülmesi Gen Đfadesi, tespiti ve ölçülmesi Doç. Dr. Hilâl Özdağ Eposta: ozdag@medicine.ankara.edu.tr Tel: 2225826/202 Ders Notları Đçin: http://bteml.biotek.ankara.edu.tr/wiki/index.php/ana_sayfa adresinden Genombilimde

Detaylı

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL

GOÜ TIP FAKÜLTESİ DÖNEM I III. KURUL III. Kurul Hücresel Metabolizma ve Moleküler Tıp III. Kurul Süresi: 6 hafta III. Kurul Başlangıç Tarihi: 23 Aralık 2009 III. Kurul Bitiş ve Sınav Tarihi: 1 2 Şubat 2010 Ders Kurulu Sorumlusu: Yrd. Doç.

Detaylı

Bakteriyofaj ve Mikro-RNA Kullanımı

Bakteriyofaj ve Mikro-RNA Kullanımı İnfeksiyonlara Antibiyotik Dıșı Tedavi Yaklașımları: Bakteriyofaj ve Mikro-RNA Kullanımı Doç. Dr. Kenan MİDİLLİ İ.Ü. Cerrahpașa Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Faj Açmazlar Panresistan

Detaylı

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta:

DNA Replikasyonu. Doç. Dr. Hilal Özdağ. A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: /202 Eposta: DNA Replikasyonu Doç. Dr. Hilal Özdağ A.Ü Biyoteknoloji Enstitüsü Merkez Laboratuvarı Tel: 2225826/202 Eposta: hilalozdag@gmail.com 1 Watson ve Crick Gözümüzden kaçmamış olan bir nokta da.. Replikasyon

Detaylı

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ

BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ BĐYOLOJĐK VERĐ TABANLARINA GĐRĐŞ Bu bölümde, Biyoenformatiğin, Moleküler Biyolojik araştırma alanlarında sıklıkla kullanılan uygulama alanlarından biri olan veri tabanlarını ve bu veri tabanlarında nasıl

Detaylı

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ

MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ MEME KANSERİ KÖK HÜCRELERİNİN GEN EKSPRESYON PROFİLİ Sait Murat Doğan, A. Pınar Erçetin, Zekiye Altun, Duygu Dursun, Safiye Aktaş Dokuz Eylül Üniversitesi Onkoloji Enstitüsü, İzmir Slayt 1 / 14 Meme Kanseri

Detaylı

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK

Evrimsel Perspektifte ILAŞTIRMALI GENOMİK Evrimsel Perspektifte KARŞILA ILAŞTIRMALI GENOMİK http://cigbrowser.berkeley.edu/ Fatih Dikmen CGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAG AAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGC GTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGAT

Detaylı

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü

Epigenetik ve Kanser. Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü Epigenetik ve Kanser Tayfun ÖZÇELİK Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü tozcelik@fen.bilkent.edu.tr Conrad Waddington (1905-1975) Edinburgh Üniversitesi Embriyoloji ve Genetik Profesörü

Detaylı

DNA TEKNOLOJİSİNİN GELİŞİMİ

DNA TEKNOLOJİSİNİN GELİŞİMİ İLERİ TEKNOLOJİK YÖNTEMLER PROF.DR. MEHMET ALİKAŞİFOĞLU DNA TEKNOLOJİSİNİN GELİŞİMİ 1869 Miescher DNA izolasyonu 1944 Avery Genetik bilginin taş y c s : DNA 1953 Watson & Crick DNA n n Double-helix yap

Detaylı

cdna Kitaplık Hazırlanışı

cdna Kitaplık Hazırlanışı cdna Kitaplık Hazırlanışı Uzm.Bio.Veysel Sabri HANÇER İstanbul Üniversitesi Moleküler Biyoloji ve Genetik Doktora Programı 2602043040 Genetik Bilginin İki Kaynağı Vardır; Genomik DNA mrna Ökaryotlardaki

Detaylı

Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak

Detaylı

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS)

SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) SNP TEK NÜKLEOTİD POLİMORFİZMLERİ (SINGLE NUCLEOTIDE POLYMORPHISMS) Herhangi iki bireyin DNA dizisi %99.9 aynıdır. %0.1 = ~3x10 6 nükleotid farklılığı sağlar. Genetik materyalde varyasyon : Polimorfizm

Detaylı

TLERDE SEROLOJİK/MOLEK HANGİ İNCELEME?) SAPTANMASI

TLERDE SEROLOJİK/MOLEK HANGİ İNCELEME?) SAPTANMASI * VİRAL V HEPATİTLERDE TLERDE SEROLOJİK/MOLEK K/MOLEKÜLER LER TESTLER (NE ZAMANHANG HANGİ İNCELEME?) *VİRAL HEPATİTLERDE TLERDE İLAÇ DİRENCİNİN SAPTANMASI *DİAL ALİZ Z HASTALARININ HEPATİT T AÇISINDAN

Detaylı

DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ. Betül Çavuşoğlu. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi

DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ. Betül Çavuşoğlu. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ Betül Çavuşoğlu İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi DENEYDEN TEDAVİYE RNA SESSİZLEŞTİRİLMESİ Betül Çavuşoğlu, İstanbul Üniversitesi, Cerrahpaşa Tıp Fakültesi,

Detaylı

GENDEN TEDAVİYE YENİ YAKLAŞIMLAR: KODLAMAYAN NÜKLEİK ASİTLER New Approaches from Gene to therapies: Non-Coding Nucleic Acids

GENDEN TEDAVİYE YENİ YAKLAŞIMLAR: KODLAMAYAN NÜKLEİK ASİTLER New Approaches from Gene to therapies: Non-Coding Nucleic Acids Derleme / Review Hasret ECEVİT ve Ark27 GENDEN TEDAVİYE YENİ YAKLAŞIMLAR: KODLAMAYAN NÜKLEİK ASİTLER New Approaches from Gene to therapies: Non-Coding Nucleic Acids Hasret Ecevit *, Sedat Motor **, Müzeyyen

Detaylı

KAFKAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM III DERS YILI DOKU ZEDELENMESİ, ENFEKSİYON VE HALK SAĞLIĞI DERS KURULU

KAFKAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM III DERS YILI DOKU ZEDELENMESİ, ENFEKSİYON VE HALK SAĞLIĞI DERS KURULU KAFKAS ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM III 2015-2016 DERS YILI DOKU ZEDELENMESİ, ENFEKSİYON VE DERS KURULU DERSLER TEORİK PRATİK TOPLAM Mikrobiyoloji 30 14 44 Halk Sağlığı 30 14 44 Patoloji 23 14 37 Farmakoloji

Detaylı

Kodlanmayan Rna ların İşlevi ve Tıpda Kullanım Alanları

Kodlanmayan Rna ların İşlevi ve Tıpda Kullanım Alanları Kodlanmayan Rna ların İşlevi ve Tıpda Kullanım Alanları Yüksek Lisans Öğr. Figen GÜZELGÜL* Prof. Dr. Kıymet AKSOY* 1. KODLANMAYAN RNA LAR Yüksek organizmalı canlılarda genetik materyal DNA olup, DNA daki

Detaylı

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2

Teori (saat/hafta) Laboratuar (saat/hafta) BES114 2. BAHAR 3 0 0 2 TIBBİ BİYOLOJİ VE GENETİK Dersin Adı Kodu Yarıyıl TIBBİ BİYOLOJİ VE GENETİK Önkoşullar Dersin dili Dersin Türü Dersin öğrenme ve öğretme teknikleri Dersin sorumlusu(ları) Dersin amacı Dersin öğrenme çıktıları

Detaylı

Biyobankalar. Prof.Dr.Meral Özgüç

Biyobankalar. Prof.Dr.Meral Özgüç Biyobankalar Prof.Dr.Meral Özgüç Hacettepe Üniversitesi, Tıp Fakültesi, Tıbbi Biyoloji Anabilim Dalı 14.05.2014 Genetik Genombilim Yüksek ölçekli teknolojiler Örnek kalite sayı Biyobankalar & Çerçeve Kuralları

Detaylı

RNA İNTERFERANS (RNAi) RNA INTERFERENCE (RNAi)

RNA İNTERFERANS (RNAi) RNA INTERFERENCE (RNAi) Erciyes Üniversitesi Fen Bilimleri Enstitüsü Dergisi 25 (1-2) 34 47 (2009) http://fbe.erciyes.edu.tr/ ISSN 1012-2354 RNA İNTERFERANS (RNAi) Ramazan GÜNDOĞDU 1, Venhar ÇELİK 1,* 1 Fırat Üniversitesi, Fen-Edebiyat

Detaylı

Prokaryotik promotor

Prokaryotik promotor Transkripsiyon Transkripsiyon-Replikasyon Farkları 1.Replikasyon sırasında tüm kromozom kopyalanır fakat transkripsiyonda sadece bir gen bölgesi kopyalanabilir. 2. Transkripsiyon düzeyi organizmanın o

Detaylı

GENETİK ŞİFRE. Prof. Dr. Filiz ÖZBAŞ GERÇEKER

GENETİK ŞİFRE. Prof. Dr. Filiz ÖZBAŞ GERÇEKER GENETİK ŞİFRE Prof. Dr. Filiz ÖZBAŞ GERÇEKER Genetik Bilgi Akışı Genetik kodun özellikleri 1. Genetik şifre, harfler halinde gösterilen mrna moleküllerini oluşturan ribonükleotid bazları kullanılarak,

Detaylı

TTOD MEME KANSERİ GÜNCELLEME KURSU 13-14 HAZİRAN 2015 İSTANBUL 08:25-08:30 Açılış 08:00-08:30 Pratiği değiştiren çalışmalar. (salonda kahvaltı ile)

TTOD MEME KANSERİ GÜNCELLEME KURSU 13-14 HAZİRAN 2015 İSTANBUL 08:25-08:30 Açılış 08:00-08:30 Pratiği değiştiren çalışmalar. (salonda kahvaltı ile) TTOD MEME KANSERİ GÜNCELLEME KURSU 13-14 HAZİRAN 2015 İSTANBUL 08:25-08:30 Açılış 08:00-08:30 Pratiği değiştiren çalışmalar. (salonda kahvaltı ile) 1. Gün 1. Oturum: Meme kanserine giriş, Patoloji ve Alt

Detaylı

ECZACILIK FAKÜLTESİ BİYOKİMYA

ECZACILIK FAKÜLTESİ BİYOKİMYA PROGRAM KOORDİNATÖRÜ Prof. Dr. Güldal MEHMETÇİK, gmehmetcik@neu.edu.tr YÜKSEK LİSANS DERSLERİ EBM 600 Uzmanlık Alanı Dersi Z 4 0 4 EBM 601 Biyokimya I S 3 0 3 EBM 602 Biyokimya I Laboratuvar S 0 3 1 EBM

Detaylı

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2

12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 12. SINIF KONU ANLATIMI 6 GENETİK ŞİFRE VE PROTEİN SENTEZİ 2 SANTRAL DOGMA Hücredeki bilgi aktarım mekanizmasının tamamına SANTRAL DOGMA denir. Santral dogma tek yönlü bilgi aktarımıdır. Geri dönüşümü

Detaylı

NEDEN BİYOİNFORMATİK?

NEDEN BİYOİNFORMATİK? 127 NEDEN BİYOİNFORMATİK? Rengün Çetin ATALAY* Recent progresses in molecular biology have revealed the large fractions of the genome sequences of several species during the last decades. Public sequence

Detaylı

Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I -

Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I - Ders 5 - mrna yapısı, İşlenmesi ve İşlevleri - I - Pre-mRNA (hnrna) cap mrna AAAAAAAAAAAAA REPLİKASYON DNA nın kendini eşlemesi TRANSKİPSİYON DNA dan RNA ya gene

Detaylı

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi

Detaylı

Prof. Dr. Demir Budak Dekan. Eğitim Koordinatörü: Prof. Dr. Asiye Nurten DERS KURULU 1 KLİNİK BİLİMLERE GİRİŞ

Prof. Dr. Demir Budak Dekan. Eğitim Koordinatörü: Prof. Dr. Asiye Nurten DERS KURULU 1 KLİNİK BİLİMLERE GİRİŞ Yeni Yüzyıl Üniversitesi TIP FAKÜLTESİ Prof. Dr. Demir Budak Dekan Eğitim Koordinatörü: Prof. Dr. Asiye Nurten DERS KURULU YÜRÜTME KURULU DÖNEM I KOORDİNATÖRÜ: KURUL I KOORDİNATÖRÜ: 214 215 EĞİTİM ÖĞRETİM

Detaylı

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ

HPV Moleküler Tanısında Güncel Durum. DNA bazlı Testler KORAY ERGÜNAY 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ 1.ULUSAL KLİNİK MİKROBİYOLOJİ KONGRESİ HPV Moleküler Tanısında Güncel Durum DNA bazlı Testler KORAY ERGÜNAY Hacettepe Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji AD Viroloji Ünitesi HPV tanısı... Sitolojik/Patolojik

Detaylı

İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi. Prof. Dr. Demir Budak Dekan

İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi. Prof. Dr. Demir Budak Dekan DERS KURULU YÜRÜTME KURULU DÖNEM I KOORDİNATÖRÜ: Prof. Dr. Mine KÜÇÜKER KURUL III KOORDİNATÖRÜ: Prof. Dr. Mine KÜÇÜKER İstanbul Yeni Yüzyıl Üniversitesi Tıp Fakültesi Prof. Dr. Demir Budak Dekan Eğitim

Detaylı

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler)

PROKARYOTLARDA GEN EKSPRESYONU. ve REGÜLASYONU. (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) PROKARYOTLARDA GEN EKSPRESYONU ve REGÜLASYONU (Genlerin Gen Ürünlerine Dönüşümünü Kontrol Eden Süreçler) Nihal EYVAZ (050559015) Şerife OKAY (050559025) Prof. Dr. Figen ERKOÇ Gazi Eğitim Fakültesi Gen

Detaylı

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD

MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ. SERPİL ERASLAN, PhD β-talaseminin MOLEKÜLER TANISI DÜZEN GENETİK HASTALIKLAR TANI MERKEZİ SERPİL ERASLAN, PhD BETA TALASEMİ HEMOGLOBİNOPATİLER Otozomal resesif (globin gen ailesi) Özellikle Çukurova, Akdeniz kıyı şeridi,

Detaylı

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE

YAZILIYA HAZIRLIK SORULARI. 12. Sınıf 1 GENDEN PROTEİNE YAZILIYA HAZIRLIK SORULARI 12. Sınıf 1 GENDEN PROTEİNE Protein sentezini tüm canlılar gerçekleştirir. Bir mrna molekülünde en fazla 64 çeşit kodon bulunur. DOĞRU YANLIŞ SORULARI Canlıların heterotrof beslenenleri

Detaylı

T. C. İZMİR KÂTİP ÇELEBİ ÜNİVERSİTESİ TIP FAKÜLTESİ

T. C. İZMİR KÂTİP ÇELEBİ ÜNİVERSİTESİ TIP FAKÜLTESİ T. C. İZMİR KÂTİP ÇELEBİ ÜNİVERSİTESİ TIP FAKÜLTESİ DÖNEM I EĞİTİM-ÖĞRETİM PROGRAMI (2012 2013) DEKAN BAŞ KOORDİNATÖR DÖNEM I KOORDİNATÖRÜ DÖNEM I KOORDİNATÖR YRD. Prof. Dr. Mehmet Ali MALAS Prof. Dr.

Detaylı

Farmakolojide Yeni Hedefler: Tanı ve Tedavide mikrorna'ların Potansiyel Değeri ve Araştırma Yöntemleri

Farmakolojide Yeni Hedefler: Tanı ve Tedavide mikrorna'ların Potansiyel Değeri ve Araştırma Yöntemleri Türk Farmakoloji Derneği XXI. Eğitim Sempozyumu Ege Üniversitesi Eczacılık Fakültesi Farmakoloji Anabilim Dalı işbirliğiyle Farmakolojide Yeni Hedefler: Tanı ve Tedavide mikrorna'ların Potansiyel Değeri

Detaylı

Doç. Dr. Z. Ceren KARAHAN

Doç. Dr. Z. Ceren KARAHAN Viral Salgınların Araştırılması Sekans Temelli Genotiplendirme Yöntemleri Doç. Dr. Z. Ceren KARAHAN Genotipleme Genomun genetik karakterizasyonu Bir bireyi/suşu, diğerlerinden ayıran mutasyonları (nt dizisi

Detaylı

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD Genomiks Temeli DNA nın dizilenmesi ve elde edilen dizilerin biyoinformatiksel metotlar kullanılarak

Detaylı

Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA

Detaylı

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen

Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı. B. Aysin Sermen Tıbbın Geleceğine dair.. Genetik Testler ve Kişiselleşmiş Tıp Anlayışı B. Aysin Sermen Daha güçlü.. Daha atletik.. Daha genç.. Daha huzurlu.. Daha mutlu.. Daha akıllı.. Daha sağlıklı.. Daha akıllı ve sağlıklı

Detaylı

A. DNA NIN KEŞFİ VE ÖNEMİ

A. DNA NIN KEŞFİ VE ÖNEMİ DNA nın Yapısı ve Replikasyonu Biyoloji Ders Notları A. DNA NIN KEŞFİ VE ÖNEMİ İlk olarak Friedrich Miescher (1869) akyuvar hücreleri ve balık sperminde yönetici molekülleri tespit etmiştir. Çekirdekte

Detaylı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı

ÇANAKKALE ONSEKİZ MART ÜNİVERSİTESİ TIP FAKÜLTESİ Eğitim Yılı Dönem I. 2. Ders Kurulu II. HÜCRE BİLİMLERİ-I Eğitim Programı Eğitim Başkoordinatörü: Dönem Koordinatörü: Koordinatör Yardımcısı: Doç. Dr. Erkan Melih ŞAHİN Prof. Dr. Alirıza ERDOĞAN Yrd. Doç. Ders Kurulu

Detaylı

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi

Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi Bugün gelinen noktada genetik Artan bilgi ile birlikte hasta ve ailelerin bilinçlendirilmesi «Genetik bilgiden hastaların ve ailelerin yararlanması için tüm sağlık çalışanları insan genetiğinin temelinde

Detaylı

TRANSLASYON VE TRANKRİPSİYON

TRANSLASYON VE TRANKRİPSİYON TRANSLASYON VE TRANKRİPSİYON GEN İFADESİ (GEN EKSPRESYONU) Gen ifadesinin düzenlenmesi çeşitli aşamalarda olur: 1) Primer transkriptlerin oluşumu 2) Primer mrna dan matür (olgun) mrna oluşumu 3) mrna nın

Detaylı

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI

Moleküler biyolojiye giriş. Doç.Dr.Pınar AKSOY SAĞIRLI Moleküler biyolojiye giriş Doç.Dr.Pınar AKSOY SAĞIRLI Molecular biology terimi ilk kez Warren Weaver tarafından 1938 de kullanıldı. Hayatın fiziksel ve kimyasal olarak açıklanması olarak tanımlandı. 1977

Detaylı

Bir enzim olarak RNA ve Riboşalterler

Bir enzim olarak RNA ve Riboşalterler Bir enzim olarak RNA ve Riboşalterler RNA Doğada mevcut en az 8 çeşit RNA enzim vardır. Bu RNA enzimlerinin RNA Dünyasında var olan bir yaşam formunun kalınaları oldukları düşünülmektedir. RNA RNA nın

Detaylı

Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi

Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi Servikal Erozyon Bulgusu Olan Kadınlarda HPV nin Araştırılması ve Genotiplerinin Belirlenmesi Doç Dr Ayşen BAYRAM Gaziantep Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D. GİRİŞ İnsan Papilloma Virus

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece,biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

BAKTERİLERİN GENETİK KARAKTERLERİ

BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür

Detaylı

MİDE KANSERİNDE APOPİTOZİSİN BİYOLOJİK BELİRTEÇLERİNİN PROGNOSTİK ÖNEMİ

MİDE KANSERİNDE APOPİTOZİSİN BİYOLOJİK BELİRTEÇLERİNİN PROGNOSTİK ÖNEMİ MİDE KANSERİNDE APOPİTOZİSİN BİYOLOJİK BELİRTEÇLERİNİN PROGNOSTİK ÖNEMİ Cem Sezer 1, Mustafa Yıldırım 2, Mustafa Yıldız 2, Arsenal Sezgin Alikanoğlu 1,Utku Dönem Dilli 1, Sevil Göktaş 1, Nurullah Bülbüller

Detaylı

Nükleotid Dizilerinin Aminoasit Formatına Dönüştürülmesi ve Dünya Veri Tabanlarındaki Verilerle Karşılaştırılması

Nükleotid Dizilerinin Aminoasit Formatına Dönüştürülmesi ve Dünya Veri Tabanlarındaki Verilerle Karşılaştırılması Kafkas Univ Vet Fak Derg 19 (2): 359-363, 2013 DOI: 10.9775/kvfd.2012.7909 Journal Home-Page: http://vetdergi.kafkas.edu.tr Online Submission: http://vetdergikafkas.org REVIEW * ** Nükleotid Dizilerinin

Detaylı

KAHRAMANMARAġ SÜTÇÜ ĠMAM ÜNĠVERSĠTESĠ TIP FAKÜLTESĠ DÖNEM I EĞĠTĠM - ÖĞRETĠM YILI Biyomolekülden Hücreye Ders Kurulu DERS KURULU-II

KAHRAMANMARAġ SÜTÇÜ ĠMAM ÜNĠVERSĠTESĠ TIP FAKÜLTESĠ DÖNEM I EĞĠTĠM - ÖĞRETĠM YILI Biyomolekülden Hücreye Ders Kurulu DERS KURULU-II KAHRAMANMARAġ SÜTÇÜ ĠMAM ÜNĠVERSĠTESĠ TIP FAKÜLTESĠ DÖNEM I 2016-2017 EĞĠTĠM - ÖĞRETĠM YILI Biyomolekülden Hücreye Ders Kurulu DERS KURULU-II 05 ARALIK 2016 10 ġubat 2017 (8 HAFTA) DERSLER TEORĠK PRATĠK

Detaylı

PI3K/AKT/mTOR Yolağı

PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı PI3K/AKT/mTOR Yolağı Phospha'dilinositol 3-kinaz/protein kinaz B/mammalian target of rapamycin (PI3K/Akt/mTOR) Normal hücresel fonksiyonların yerine ge'rilebilmesi için gerekli olan

Detaylı

NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller)

NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller) NÜKLEİK ASİTLER ( DNA VE RNA)(Yönetici Moleküller) NÜKLEİK ASİTLERİN KEŞFİ *FRIEDRICH MIESCHER * Balık spermlerinin çekirdeklerini ve akyuvar çekirdeklerini ayrıştırarak yaptığı çalışmalarda, bu hücrelerin

Detaylı

TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS. Reha Aydın. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi

TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS. Reha Aydın. İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS Reha Aydın İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi TÜMÖR ANJiYOGENEZİ TUMOR ANGIOGENESIS Reha Aydın, İstanbul Üniversitesi, Cerrahpaşa Tıp Fakültesi Türkçe

Detaylı

Transforming growth factor ß. Sinyal molekülleri, reseptör ve ko-reseptörler C. elegans tan insana kadar korunmuştur.

Transforming growth factor ß. Sinyal molekülleri, reseptör ve ko-reseptörler C. elegans tan insana kadar korunmuştur. Transforming growth factor ß Hem omurgalılarda hem de omurgasızlarda gelişimin düzenlenmesinde önemli işlevleri vardır. Sinyal molekülleri, reseptör ve ko-reseptörler C. elegans tan insana kadar korunmuştur.

Detaylı

Tüm Genom Analizi ve Klinik Mikrobiyoloji. Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD.

Tüm Genom Analizi ve Klinik Mikrobiyoloji. Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD. Tüm Genom Analizi ve Klinik Mikrobiyoloji Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD. Tüm Genom Analizi ve Klinik Mikrobiyoloji DNA dizileme yöntemleri Tüm genom analizi Mikrobiyolojide kullanım

Detaylı

İlaçta Ar Ge Kamu Üniversite Sanayi İşbirliğinin Önemi. Prof. Dr. Sedef Kır Hacettepe Üniversitesi Eczacılık Fakültesi

İlaçta Ar Ge Kamu Üniversite Sanayi İşbirliğinin Önemi. Prof. Dr. Sedef Kır Hacettepe Üniversitesi Eczacılık Fakültesi İlaçta Ar Ge Kamu Üniversite Sanayi İşbirliğinin Önemi Prof. Dr. Sedef Kır Hacettepe Üniversitesi Eczacılık Fakültesi Hacettepe Üniversitesi Eczacılık Fakültesi Misyonumuz Evrensel bilim ve teknolojiyi

Detaylı

HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı

HALK SAĞLIĞI ANABĠLĠM DALI. Ders adı : Endokrin çevre bozucular ve tarama programı HALK SAĞLIĞI ANABĠLĠM DALI Ders adı : Endokrin çevre bozucular ve tarama programı Öğretim Üyesi : Prof. Dr. A. Emel ÖNAL Endokrin sistemin çalışmasını değiştiren, sağlıklı insanda veya çocuklarında sağlık

Detaylı

AFYON KOCATEPE ÜNİVERSİTESİ

AFYON KOCATEPE ÜNİVERSİTESİ AFYON KOCATEPE ÜNİVERSİTESİ SAĞLIK BİLİMLERİ ENSTİTÜSÜ DERS TANITIM FORMU Dersin Kodu / Adı : Bölüm / Anabilim Dalı : 122643 BİYOKİMYA TIBBİ GENETİK (TIP) Öğretim Dili : Türkçe Yarıyılı : 1 Türü (Zorunlu

Detaylı

Mustafa EMREM

Mustafa EMREM Mustafa EMREM 162161022 Bakterilerdeki transformasyonun ilk kanıtları İngiliz bilim adamı Frederick Griffith tarafından elde edilmiştir. Genetik materyal aktarımı Dikey Gen Transferi ebeveyn ile yavru

Detaylı

MESANE TÜMÖRLERİNİN DOĞAL SEYRİ

MESANE TÜMÖRLERİNİN DOĞAL SEYRİ MESANE TÜMÖRLERİNİN DOĞAL SEYRİ ve MOLEKÜLER PROGNOSTİK FAKTÖRLER Prof. Dr. Levent Türkeri Üroloji Anabilim Dalı Marmara Üniversitesi Tıp Fakültesi Mesane Tümörü (Transizyonel Hücreli Karsinom) Yüzeyel

Detaylı

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri

Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri Ders 8 trna-rrna yapısı, İşlenmesi ve İşlevleri mrna trna - rrna Taşıyıcı (transfer) RNA (trna) Nispeten küçük moleküllerdir. Bir öncu molekülün nükleusta işlenmesiyle oluşurlar. trna molekülleri, mrna

Detaylı

ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER

ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER ADIM ADIM YGS-LYS 55. ADIM CANLILARIN SINIFLANDIRILMASI-15 VİRÜSLER Virüsler Hücresel yapı da dahil olmak üzere canlıların ortak özelliklerini göstermeyen canlılardır. Prokaryotlardan daha küçüklerdir.

Detaylı

1. Giriş - Mesane kanseri - Tanı ve evrelendirme - Mesane kanseri ve iyon kanalları 3. Gereç ve yöntem 4. Bulgular 5. Tartışma

1. Giriş - Mesane kanseri - Tanı ve evrelendirme - Mesane kanseri ve iyon kanalları 3. Gereç ve yöntem 4. Bulgular 5. Tartışma Dr. GÜLAY GÜLEÇ CEYLAN, MD, PhD Yıldırım Beyazıt Üniversitesi Tıp Fakültesi Tıbbi Genetik ABD, Ankara 1. Giriş - Mesane kanseri - Tanı ve evrelendirme - Mesane kanseri ve iyon kanalları 3. Gereç ve yöntem

Detaylı

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA

MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA MOLEKÜLER BİYOLOJİ DOÇ. DR. MEHMET KARACA RİBOZOMLAR Ribozom RİBONÜKLEOPROTEİN (RNP) yapısındadır. Ribozomlar hem protein hem de RNA moleküllerinden oluşur. Ribozomlar protein ve RNA moleküllerinden oluşan

Detaylı

Gen İfadesi Belirleme Çalışmaları. Doç. Dr. Feray KÖÇKAR, Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Biyoloji Bölümü fkockar@balikesir.edu.

Gen İfadesi Belirleme Çalışmaları. Doç. Dr. Feray KÖÇKAR, Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Biyoloji Bölümü fkockar@balikesir.edu. Gen İfadesi Belirleme Çalışmaları Doç. Dr. Feray KÖÇKAR, Balıkesir Üniversitesi, Fen-Edebiyat Fakültesi Biyoloji Bölümü fkockar@balikesir.edu.tr Özet Gen nedir? Gen Ekspresyonu nedir? Gen ifadesinin düzenlenmesi

Detaylı

Romalılara ait yollar, tren istasyonları ve kontrolörler: RNA araştırmalarında son buluşlar

Romalılara ait yollar, tren istasyonları ve kontrolörler: RNA araştırmalarında son buluşlar Romalılara ait yollar, tren istasyonları ve kontrolörler: RNA araştırmalarında son buluşlar RNA çok önemli bir biyolojik molekül olup ders kitaplarında bu molekülden nadiren detaylı bahsedilir. Bu yazı

Detaylı

Tarımsal Biyoteknolojiye Giriş

Tarımsal Biyoteknolojiye Giriş Tarımsal Biyoteknolojiye Giriş Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TAB 101 Muavviz Ayvaz (Yrd. Doç. Dr.) 12. Hafta (03.12.2013) 1 Genetiği Değiştirilmiş Organizmalar (GDO) 2 Genetik: Biyolojinin

Detaylı

ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ

ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ ARI ÜRÜNLERİNİN SAĞLIK ÜZERİNE ETKİLERİ PROF.DR.OĞUZ ÖZTÜRK İSTANBUL ÜNİVERSİTESİ DENEYSEL TIP ARAŞTIRMA ENSTİTÜSÜ (DETAE) MOLEKÜLER TIP ANABİLİM DALI Bal ve Diğer Arı Ürünleri ile Sağlıklı Yaşam Platformu

Detaylı

DÖNEM I KTO KARATAY ÜNİVERSİTESİ TIP FAKÜLTESİ DERS KURULU 3

DÖNEM I KTO KARATAY ÜNİVERSİTESİ TIP FAKÜLTESİ DERS KURULU 3 DEKAN BAŞKOORDİNATÖR BAŞKOORDİNATÖR YARDIMCILARI DÖNEM 1 KOORDİNATÖRÜ DÖNEM 1 KOORDİNATÖR YARCIMCILARI Prof. Dr. Neyhan ERGENE Prof. Dr. Taner ZİYLAN Prof. Dr. S. Sennur DEMİREL Arş. Gör. Seda ÇETİNKAYA

Detaylı

Kanser Tedavisi: Günümüz

Kanser Tedavisi: Günümüz KANSER TEDAVİSİNDE MOLEKÜLER HEDEFLER Doç. Dr. Işık G. YULUĞ Bilkent Üniversitesi Moleküler Biyoloji ve Genetik Bölümü yulug@fen.bilkent.edu.tr Kanser Tedavisi: Günümüz Geleneksel sitotoksik ilaçlar ve

Detaylı

İ İ ö ö ğ ğ ö İ İ ğç İ İç ğç İ ö İ ğ ö ğ ö İ Ş ğç İ ğ ğ Ö Ç ğ İ ö ö ö ö Ö ç ç ğ ğ ç ç ö Ç ğ ğ ö Ç Ç ç ö ğ ç ö ç ç ğ Ö ç ç ğ ç ç ğ ğ ö ç ğ Ş ç ç ğ Ş ç ğ ö ç ö Ş ğ ğ ğ ğ ğ Ş Ş Ö ç ç Ç ç İ İİ ğ ö ç İ ö ö

Detaylı

MICROARRAY TEKNOLOJİSİ

MICROARRAY TEKNOLOJİSİ MICROARRAY TEKNOLOJİSİ Bilgisayar teknolojisinin moleküler biyolojiye paralel olarak hızla gelişmesi, iki disiplini birbirine yaklaştırmıştır. Böylece, biyoteknolojinin kavramsal olarak ulasabileceği son

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Biyoinformatik Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş

Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar. Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Telomeraz enzim eksikliğinin tedavisinde yeni yaklaşımlar Prof. Dr. Fatma İnanç Tolun 08.11.2013 / Kahramanmaraş Sunum Akışı DNA replikasyonu Telomer Telomeraz Telomeraz eksikliğinde görülen hastalıklar

Detaylı

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:

Detaylı

DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi

Detaylı

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik

Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik Genden proteine Genler, transkripsiyon ve translasyon yolu ile proteinleri belirler Transkripsiyon, DNA yönetiminde RNA sentezidir Ökaryotik hücreler, transkripsiyondan sonra RNA yı değişikliğe uğratırlar

Detaylı

SOLİT ORGAN TRANSPLANTASYONU ve BK VİRUS ENFEKSİYONLARI Doç. Dr. Derya Mutlu Güçlü immunsupresifler Akut, Kronik rejeksiyon Graft yaşam süresi? Eskiden bilinen veya yeni tanımlanan enfeksiyon etkenleri:

Detaylı

ÖZGEÇMİŞ. Araştırma/ İş Deneyimi. Yardimci Docent (Assistant Professor) Research Fellow Research fellow

ÖZGEÇMİŞ. Araştırma/ İş Deneyimi. Yardimci Docent (Assistant Professor) Research Fellow Research fellow Adı Soyadı E-mail ÖZGEÇMİŞ MERYEM ALAGOZ malagoz@biruni.edu.tr Araştırma/ İş Deneyimi Kurumun/Şirketin Adı Pozisyonu Tarih Aralığı Biruni Üniversitesi, Molecüler Biyoloji ve Genetik Bölümü Genom Merkezinin

Detaylı

Çukurova Üniversitesi

Çukurova Üniversitesi Gen Ekspresyonu (Kalıtsal Bilginin anlatımı) DNA molekülünün taşıdığı bilginin protein moleküllerine çevrilmesine Gen ekspresyonu denir. Gen ekspresyonu 2 aşamada gerçekleşir: 1.Transkripsiyon (Yazılım):

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili Kanser Biyolojisi ve Genetiği Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan

Detaylı

Hücre Proliferasyonu ve Testleri

Hücre Proliferasyonu ve Testleri 1 Hücre Proliferasyonu ve Testleri Normal Hücre Çoğalması Normal dokularda, hücre bölünmesi ve çoğalması organizmanın devamlılığı için bir gereklilik;r. Hücre çoğalmasının olması gerekenden farklı olması

Detaylı

AVRASYA ÜNİVERSİTESİ

AVRASYA ÜNİVERSİTESİ Ders Tanıtım Formu Dersin Adı Öğretim Dili RNA Dünyası Türkçe Dersin Verildiği Düzey Ön Lisans () Lisans (X) Yüksek Lisans( ) Doktora( ) Eğitim Öğretim Sistemi Örgün Öğretim (X) Uzaktan Öğretim( ) Diğer

Detaylı

GENETİK. Öğt. Gör. Meltem KÖKDENER

GENETİK. Öğt. Gör. Meltem KÖKDENER GENETİK Öğt. Gör. Meltem KÖKDENER 2 5.1. TRANSKRİPSİYONUN AŞAMALARI 5.2. PROTEİN SENTEZİ (Translasyon ) 5.3. GENETİK İFADENİN DÜZENLENMESİ 5 GENETİK TRANSKRİPSİYON ÜNİTE 5 TRANSKRİPSİYON Öğr. Gör. Meltem

Detaylı

Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık

Detaylı