Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Save this PDF as:

Ebat: px
Şu sayfadan göstermeyi başlat:

Download "Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı"


1 Mikrobiyotanın En Etkili Analizi: Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji Anabilimdalı



4 Yeni Nesil Dizileme Sistemleri Dünya Sağlık Örgütü yeni nesil dizileme sistemlerinin mikrobiyolojide potansiyel kullanım alanlarını; tanısal mikrobiyoloji, yeni patojenlerin keşfi, antimikrobiyal duyarlılık ve moleküler epidemiyoloji olmak üzere dört ana başlık altında değerlendirmektedir. Mikrobiyota analizi

5 Mikrobiyomunu Keşfet

6 Mikrobiyota- arihsel Gelişimi Gastrointestinal sistemin mikrobiyotası. Yeni nesil dizileme sistemleri 4 Moleküler tekniklerin gelişimi 3 Bakterilerin Ilk defa izolasyonu 1 Anaerop bakterilerin izolasyonu 2 FEMS Microbiol Rev May 27. doi: / he First 1,000 Cultured Species of the Human Gastrointestinal Microbiota.

7 1975- Plus and Minus Yöntemi Sanger ve Coulson tarafından bu metod, sonraki 30 yıl süresince geliştirilerek modern dizileme yöntemleri için yol gösterici olmuştur. Kalıp DNA DNA polimeraz A G C G C 4 dnp Biri 32 P ile işaretli primer IIIIII IIIIII +C + +A +G -C - -A -G A G C G C A C G

8 1975- Plus and Minus Yöntemi ΦX174 Bakteriyofajının tümü genomu dizilendi.

9 1977-Maxam-Gilbert Yöntemi DNA nın kimyasal modifikasyonunu takiben DNA nın özgül bölgelerden kırılması prensibine dayanır. poliakrilamid jel

10 1977- Sanger Zincir Sonlandırma Yöntemi 5 3 A A C G G G C A C C G G G C G G C G A C G C A A primer A G C C C C G C A C G C A A A G A G C C C C G C A C G C A A A C C C G A G A G C C C C G C A C G C A A A G A C C C G A G A G C C C C G C A C G C A A dnp s P ddnp s 32 A G C

11 1977- Filogentik analizler için rrna dizileri

12 1986- İlk Otomatize Cihaz Leroy hood ve Aplied Biosystem tarafından tanıtıldı.

13 S rrna Dizileme

14 1990-İnsan Genom Projesinin Başlaması

15 1994-NCBI GenBank Kuruldu

16 1995- İlk Bakteriyel üm Genomun Dizilenmesi Haemophilus influenzae ve Mycoplasma genitalium un tüm genom dizilemesinin yapıldığı duyurulmuştur.

17 1995- İlk Bakteriyel üm Genomun Dizilenmesi Bu çalışmada; yeni nesil dizileme sistemlerine de temel oluşturacak shotgun dizileme yaklaşımı ortaya konmuştur. tüm genom AGCAG GCAGAGC GCGCAGC GCAGA ACGCGCGAACGGCCAAGGCGACGGAGCCCGGAGAGAGA

18 1995- İlk Bakteriyel üm Genomun Dizilenmesi Her bir DNA parçasının ayrı ayrı dizilenebilmesi için izole edilebilmesi gereklidir. tüm genom RE ile kesim RE RE RE RE RE RE RE parçaların plazmite aktarılması klonal çoğalma

19 1995- İlk Bakteriyel üm Genomun Dizilenmesi Yine bu çalışmada; yeni nesil dizileme sistemlerine de temel oluşturacak basamaklar belirlenmiştir. library construction DNA nın parçalara ayrılarak kütüphanenin oluşturulması high-throughput sequencing DNA parçalarının ayrı ayrı yüksek hacimli dizilenmesi assembly dizilerin bir araya getirilmesi

20 1998-Celera İnsan genom projesine, Craig Venter in kurduğu Celera adlı özel teşebbüs dahil olmuştur. Geliştirilen en kritik sistem 96 örneği 3 saat içinde çalışabilen ABI Prisim 3700 sistemidir. 3 ay içerisinde 20 Gb genom dizileme

21 1998-Metagenom erimi

22 1998-Metagenom erime

23 2001-İnsan Genom Projesinin amamlanması

24 2001-İnsan Genom Projesinin amamlanması Projenin tamamlanması; postgenomik alanın başlangıcını oluşturmuş. Yaklaşık 3 milyar dolar harcanmış ve 11 yıl süre geçmiştir Yöntemler; - yoğun emek gerektiren, - zaman alıcı ve oldukça maliyetli. İnsan genom projesi dizileme teknolojileri ile ilgili yeni yaklaşımlara ihtiyaç olduğunun fark edilmesine ve birçok yeni fikrin doğmasına da neden olmuştur.


26 Yeni Nesil Dizileme Sistemlerinin Doğuşu Bu dizileme sistemleriyle; yüksek doğrulukta ve hızda dizileme yapabilmekte ve genom dizi bilinmeyen bir canlının genom dizisinin ortaya çıkarılabilmektedir. (De Novo dizileme). Bu sistemlerin ortak özeliği; Aynı anda milyonlarca kısa dizilemenin yapılmasıdır. Massive Paralel Sequencing Bioinformatik analizlere ihtiyaç duyulması

27 Yeni Nesil Dizileme Sistemlerinin Doğuşu

28 454 Life Science Roche Applied Science Pirodizileme ile sentez yoluyla dizileme prensibine dayalıdır. Kütüphanenin hazırlanması Genomik DNA nın RE ile parçalara ayrılması adaptör moleküllerin eklenmesi ve denatürasyon dizileme primerinin bağlanacağı adaptör DNA parçalarının yakalanması ve zenginleştirme PCR primerinin bağlanacağı adaptör

29 454 Life Science Roche Applied Science Boncuklar santrifüj ile plak tabanına çöktürülür Pirodizileme reaksiyonu ve CCD kamera ile ışımanın tespiti A G C

30 454 Life Science Roche Applied Science Her okumada 200 baz ya da her 12 saatlik çalışma başına toplamda 20 megabaz olacak şekilde baz çiftinden fazla okuma yapabilmektedir. Bu sistemin 2007 de tanıtımının yapılmasından sonra cihazda şaşırtıcı yenilikler yapılmıştır.

31 Genome Sequencer FLX itanium Roche Applied Science Bu yeniliklerden bir tanesi; kuyucuk sayısı arttırılmış pikotitre plaklarıyla 500 baza kadar okuma yapılabilmesidir. Bu sistem 8 saatlik tek okumada 500 milyon baz dizileyebilmektedir.

32 Genome Sequencer FLX itanium Roche Applied Science

33 Genome Sequencer FLX itanium Roche Applied Science

34 Genome Analyzer Solexa-illumina Geliştirilen ikinci yeni nesil dizileme cihazıdır ve diğerinden farklı bir yöntem kullanılır. üm reaksiyon mikroskop slaytına benzer katı bir fazda gerçekleştirilir.

35 Genome Analyzer illumina tüm genom kütüphane oluşturulması ve adaptör moleküllerin eklenmesi bağlanma köprü PCR denatürasyon DNA pol Klonal çoğalma ve kümelerin oluşması

36 Genome Analyzer illumina Nükleotidlerin 3 OH uçları kimyasal olarak kapatılmış olduğundan zincir sonlanmasına neden olur. Yıkama ve 3 OH ucunun yeniden açılması G Yıkama G C Yıkama G C Yıkama G C A G C A

37 HiSeq 2000 illumina ek yükleme ile iki bireye ait genomu kişi başı dolarlık bir maliyetle dizileyebilmektedir. Kütüphane hazırlanması 1-14 gün Zenginleştirme 5 saat Sentez ile dizileme 2-10 gün Verilerin analizi 2 gün

38 HiSeq 2000 illumina 16S Yüksek hacimli dizileme ekstraksiyon mikrobiyom ekstraksiyon üm genom dizleme (metagenomik dizileme)

39 HiSeq 2000 illumina 206 tür 124 ü daha önce gösterilmemiş 36 tür Neden daha az?

40 HiSeq 2000 illumina Mikrobiyota çalışmalarında tüm genom dizileme yaklaşımında okunan dizilerin birleştirilme (assemble) şansı şu an için çok zor. AGC AGC AGC AGC AGC AGGAAGC AGGAAGC AGGAAGC AGGAAGC AGGAGCGC AGGAGCGCGAAGC AGGAGCGCGAAGC AGGAGCGCGAAGC AGGAGCGCGAAGC AGGAGCGCGAAGC AGGAGCGCGAAGC AGGAGCGCGAAGC AGGAGCGCGAAGC


42 HiSeq 2000 illumina Bu çalışmada 16S yüksek hacimli dizileme yaklaşımı ile tespit edilebilen bakteriler.

43 HiSeq 2000 illumina Virüsler ve fajlar sadece tüm genom dizileme yaklaşımı ile tespit edilebilir.

44 SOLID Applied Biosytem Örneğin hazırlık aşamaları, hedefin klonal (küme) olarak çoğaltılması ve emülsiyon PCR basamakları 454 sistemine oldukça benzerlik göstermektedir. adaptör adaptör DNA parçası DNA parçası DNA parçası iç adaptör adaptör adaptör

45 SOLID Applied Biosytem Bu dizileme yönteminde diğerlerinden farklı olarak, çoğalmış DNA, boncuklardan saflaştırılarak slayt yüzeyine kovalent olarak bağlanır.

46 SOLID Applied Biosytem 3 C--n-n-n -z-z 3 3 C-A-n-n -z-z-z G-G-n-n -z-z-z 3 G-C-n-n -z-z-z primer ligaz 3 p 5 G-A adaptör dizi kalıp dizi ayrılma 3 C--n-n-n -z-z G-A ayrılma 3 ligaz p C--n-n-n C-A-n-n -z-z-z G-A G-

47 SOLID Applied Biosytem Bu teknolojinin en farklı yanı ise prob bağlanma işleminin iki oligonükleotid tarafından kontrol edilmesidir. Bu metot sentezleyerek dizileme yaklaşımına göre belirleyici şekilde yüksek özgüllük ve yüksek doğruluk göstermektedir.

48 SOLID 3 Plus Applied Biosytem SOLID cihazı geliştirilerek her okumadaki baz sayısı artırılmış ve daha kolay iş akışı sağlanmıştır. ek slayt üzerinde okuma uzunluğu artırılarak 10 günde 60 gigabazdan fazla ve dizileme yapabilmektedir.

49 SOLID 4 HQ Applied Biosytem 2010 yılında yeni geliştirilen SOLID 4hq cihazı 14 günde 300 gigabaz okuma yapabilmektedir ve tek genom maliyeti yaklaşık 3000 dolardır.

50 A G C C A İon orrent Herhangi bir optik okuma veya floresan ışımanın yer almadığı bir sistem olan bu sistem 2010 yılında tanıtılmış diğerlerinden oldukça farklı bir sistemdir. A G C C A A G C C A A G C C A

51 İon orrent İyon yarı iletken dizilemesine dayalı bu dizileme yöntemi, DNA'nın polimerizasyonu sırasında açığa çıkan hidrojen iyonlarının tespitine dayalıdır.

52 İon orrent Cihazın en önemli bileşeni kimyasal değişimleri tespit etmek amacıyla kullanılan yarı iletken çiplerdir. Cihazın İyon Proton II çipine sahip modeli, 660 milyon çipten oluşmakta ve tüm insan genomunun dizilenmesi için kullanılabilmektedir.

53 İon orrent

54 İon orrent

55 İon orrent

56 Yeni Nesil Dizileme Cihazları: İlk yeni nesil dizileme sistemleri, yüksek doğruluk, hız ve düşük fiyata tahminden daha hızlı eriştiler. Yöntem iki dezavantaja Yöntem iki dezavantaja sahipti. sahipti. PCR ın pahalı ve zaman alıcı bir işlem olmasıdır. Moore yasası PCR ın pahalı ve Diğeri ise bu aşamada hatalı bazların çoğaltılmasıdır. zaman alıcı bir işlem olmasıdır. Diğeri ise bu aşamada hatalı bazların çoğaltılmasıdır.

57 İkinci Yeni Nesil Dizileme Cihazları: ek molekül dizileme sistemleri

58 Helicos Genetic Analysis Helicos BioSciences

59 Helicos Genetic Analysis Helicos BioSciences Bu sistemde, poly(da) kuyruğu eklenen DNA parçaları, katı yüzeye bağlanmış oligo(d) primerleri ile yakalanır.

60 katı yüzey A A A A A A G C G C A A A A A A A C A C G A A A A A A G C A C C Helicos Genetic Analysis BioSciences Bu sistemde, poly(da) kuyruğu eklenen DNA parçaları, katı yüzeye bağlanmış oligo(d) primerleri ile yakalanır. C G A A

61 Helicos Genetic Analysis Helicos BioSciences Cihazın fiyatı 1.3 milyon dolar ve çok fazla hata oranı olması ve çok kısa okumalar yapmasından dolayı popülaritesi sınırlıdır.

62 Pacific Biosciences Sıfır mod dalga alanı (zero-mode waveguide ZMW) olarak adlandırılan, optik kuyucuk tabanına tek bir DNA polimeraz bağlanmıştır.

63 Pacific Biosciences Sıfır mod dalga alanı (zero-mode waveguide ZMW) olarak adlandırılan, optik kuyucuk tabanına tek bir DNA polimeraz bağlanmıştır. DNA pol uyarım ışıma

64 Pacific Biosciences

65 Daha da Yeni Nesil Dizileme Sistemleri

66 Oxford Nanopore echnology

67 IBM DNA ransitstor echnology DNA nın (sadece tek iplik halde geçebileceği) karbon nano tüplerden (elektron tünelleri) geçerken meydana gelen elektrik akımını ölçülmesi prensibine dayalıdır.

68 Yeni Nesil Dizileme Sistemleri üm bu üstün özelliklerine rağmen, bu sistemlerin rutin mikrobiyoloji laboratuvarlarında yerini alması için henüz erken dönemlerde olduğumuz söylenebilir.

69 milyar dolar Yeni Nesil Dizileme Pazarı 2018 de tahmin edilen pazar payı 4 milyar dolar. cihaz sarf malzeme

70 Yeni Nesil Dizileme Sistemlerini Kim Üretiyor? Bu çalışmalara başlamadan önce, iyi hipotezler kurup, yeni nesil dizileme cihazlarının ürettiği milyonlarca veriyi nasıl işleyeceğimizi öğrenmek.

Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı

Yeni Nesil Dizileme Sistemleri. Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilimdalı Yeni Nesil Dizileme Sistemleri Barış Otlu İnönü Üniversitesi ıp Fakültesi ıbbi Mikrobiyoloji nabilimdalı 5. Yeni Nesil Dizileme Kongresi Yeni Nesil Dizileme Pazarı 2018 de tahmin edilen pazar payı4 milyar


Metagenom Analiz Stratejileri

Metagenom Analiz Stratejileri Metagenom Analiz Stratejileri Prof.Dr. Engin Yılmaz Acıbadem Üniversitesi Tıbbi Biyoloji AD 1. Ulusal İnsan Mikrobiyotası ve Sağlığımıza Etkileri Kongresi 8-10 Aralık 2016, Ankara İnsan Genom Projesi İnsan


Yeni Nesil Dizileme Prensipleri

Yeni Nesil Dizileme Prensipleri 1 2 3 7 8 9 4 5 6 Yeni Nesil Dizileme Prensipleri Doç.Dr.Hüseyin Onay Ege Üniversitesi Tıp Fakültesi Tıbbi Genetik AD NGS Yeni Nesil Dizi Analizi Next Generation Sequencing Massively Parallel Sequencing


HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN

HLA Tiplendirmesinde Yeni Nesil Dizileme. Dr. Türker DUMAN HLA Tiplendirmesinde Yeni Nesil Dizileme Dr. Türker DUMAN MHC MHC bölgesi Kr. 6p21 de lokalize olan 4 mega baz yaklaşık 220 gen Genomunun en yoğun bölgesidir, genomun büyüklük olarak yaklaşık % 0.1 ine


Yeni Nesil Genomik Sistemler. ve Uygulamaları

Yeni Nesil Genomik Sistemler. ve Uygulamaları Yeni Nesil Genomik Sistemler ve Uygulamaları Sunum Başlıkları Mikroarray Sistemleri (iscan) Ekspresyon Array SNP Array Metilasyon Array Yeni Nesil Dizileme Teknolojileri Ekspresyon Array Tüm Genom Gen


Hafta VIII Rekombinant DNA Teknolojileri

Hafta VIII Rekombinant DNA Teknolojileri GENETĐK 111-503 Hafta VIII Rekombinant DNA Teknolojileri Doç.Dr. Hilâl Özdağ Rekombinant DNA Teknolojisi Amaç Spesifik DNA dizilerinin yerlerinin belirlenmesi. DNA nın belirli noktalardan kesilmesi Belirli



Uzm. Bio. NUR YILDIRIM Uzm. Bio. NUR YILDIRIM Genlerin çok büyük ve çok sayıda ekzondan oluştuğu göz önüne alındığında, bu genleri Sanger sekanslama ve genom boyu SNP genotiplemesi gibi klasik genetik metodlarla taramak hem


GENETİK TANI YÖNTEMLERİ. Prof.Dr.Mehmet Alikaşifoğlu

GENETİK TANI YÖNTEMLERİ. Prof.Dr.Mehmet Alikaşifoğlu GENETİK TANI YÖNTEMLERİ Prof.Dr.Mehmet Alikaşifoğlu S Genetik Tanı Yöntemleri S Sitogenetik Tanı Yöntemleri S Moleküler Sitogenetik Tanı Yöntemleri S Moleküler Genetik Tanı Yöntemleri Sitogenetik Tanı


Moleküler Dizileme Teknolojileri

Moleküler Dizileme Teknolojileri Moleküler Dizileme Teknolojileri Dr. Güven Toksoy, PhD İstanbul Üniversitesi İstanbul Tıp Fakültesi Tıbbi Genetik AD 31.10.2014 22:44 1 Klasik dizileme Sanger dizileme Maxim Gilbert dizileme tekniği Yeni


İşlevsel Genomik Nedir?

İşlevsel Genomik Nedir? İşlevsel Genomik Nedir? İşlevsel Genomik, yapısal genomik tarafından sağlanan bileşenlerin ve bilginin kullanımı ile gen işlevinin değerlendirilmesinde, deneysel yaklaşımların (genom veya sistem boyunca)






REKOMBİNANT DNA TEKNOLOJİSİ. Araş. Gör. Dr. Öğünç MERAL Araş. Gör. Dr. Öğünç MERAL 1960 lardan bu yana genetik ve moleküler biyolojideki kavrayışımızın hızla artması, biyoteknolojide heyecan verici buluşlar ve uygulamalara yol açtı. DNA yapısı ve fonksiyonlarının


Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ

Replikasyon, Transkripsiyon ve Translasyon. Yrd. Doç. Dr. Osman İBİŞ Replikasyon, Transkripsiyon ve Translasyon Yrd. Doç. Dr. Osman İBİŞ DNA replikasyonu DNA nın replikasyonu, DNA molekülünün, sakladığı genetik bilgilerin sonraki nesillere aktarılması için kendi kopyasını


Rekombinant DNA Teknolojisi-II

Rekombinant DNA Teknolojisi-II BYM613 Genetik MühendisliM hendisliği Rekombinant DNA Teknolojisi-II Hacettepe Üniversitesi Biyomühendislik BölümüB 2012-2013 2013 Güz G z DönemiD Dr. Eda Çelik-AKDUR edacelik@hacettepe.edu.tr İçerik (2


Niçin PCR? Dr. Abdullah Tuli

Niçin PCR? Dr. Abdullah Tuli Niçin PCR? Dr. Abdullah Tuli 1980 lerin Başı Bir yöntem düşünün Tepkimeyi gerçekleştirmek kolay mıdır? Bu yöntem çok mu karmaşıktır, yoksa basit mi? Yöntemde kullanılan örnek, saf mı ya da son derece karmaşık


Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D

Mikrobiyolojide Moleküler Tanı Yöntemleri. Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D Mikrobiyolojide Moleküler Tanı Yöntemleri Dr.Tuncer ÖZEKİNCİ Dicle Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji A.D 1 Enfeksiyonun Özgül Laboratuvar Tanısı Mikroorganizmanın üretilmesi Mikroorganizmaya


Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu

Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Maya ve maya benzeri mantarların sekans analizi ile identifikasyonu Dr. Ayşe KALKANCI Gazi Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, Ankara 24-25 Şubat 2011, İzmir Sunum Planı Teorik


İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz

İnsan Mikrobiyom Projesi. Prof. Dr. Tanıl Kocagöz İnsan Mikrobiyom Projesi Prof. Dr. Tanıl Kocagöz Human Microbiome Project İnsan Mikrobiyom Projesi (İMP) 2007 yılında NIH tarafından başlatıldı 300 gönüllünün 5 vücut bölgesinden değişik zamanlarda, toplam


Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız:

Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Ara Sınav Soruları Soru 1: DNA miktarını saptamak için spektrofotometrik yöntemin arkasındaki prensibi açıklayınız: Cevap1: 260 nm de 1 cm yol uzunluğundaki OD = 50 μ g/ml çift sarmal DNA için, 40 μ g/ml


Tüm Genom Analizi ve Klinik Mikrobiyoloji. Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD.

Tüm Genom Analizi ve Klinik Mikrobiyoloji. Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD. Tüm Genom Analizi ve Klinik Mikrobiyoloji Dr. Burak Aksu M.Ü. Tıp Fakültesi T.Mikrobiyoloji AD. Tüm Genom Analizi ve Klinik Mikrobiyoloji DNA dizileme yöntemleri Tüm genom analizi Mikrobiyolojide kullanım


Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması

Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması Nonalkolik Karaciğer Yağlanması Olan Hastalar ve Sağlıklı Kontrollerde Bağırsak Mikrobiyotasının Yeni Nesil Dizi Analizi İle Karşılaştırılması Erdogdu C, Yalinay M, Karakan T, Battaglia T, Blaser MJ Ceren


Genetik materyal: DNA replikasyonu

Genetik materyal: DNA replikasyonu Genetik materyal: DNA replikasyonu Umut Fahrioglu, PhD MSc DNA Replikasyonu DNA replikasyonu genomların ve içerdikleri genlerin nesilden nesile aktarılmasında çok önemli bir rol oynar. Hücreden hücreye


En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test

En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test En Etkili Kemoterapi İlacı Seçimine Yardımcı Olan Moleküler Genetik Test Yeni Nesil DNA Dizileme (NGS), İmmünHistoKimya (IHC) ile Hastanızın Kanser Tipinin ve Kemoterapi İlacının Belirlenmesi Kanser Tanı



MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ MOLEKÜLER DNA DİZİ ANALİZ YÖNTEMLERİ DNA dizi analizleri ya da sekanslama; DNA birincil (temel) yapılarının belirlenmesinde kullanılan yöntemlerdir, DNA nın nukleotid dizilerinin saptanması anlamına gelir.


Genom analizi için belirteç olarak kullanılan DNA dizileri

Genom analizi için belirteç olarak kullanılan DNA dizileri Salgınların Araştırılmasında Hızlı Genotiplendirme Yöntemleri Avantajları-Dezavantajları Doç. Dr. Z. Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobioyoloji Anabilim Dalı Moleküler Genetik





Rekombinant DNA teknolojisi ve genomik

Rekombinant DNA teknolojisi ve genomik C H A P T E R 3 Rekombinant DNA teknolojisi ve genomik Dr. Aslı Sade Memişoğlu PowerPoint Lecture by: Melissa Rowland-Goldsmith Chapman University Başlıklar 3.1 Rekombinant DNA teknolojisi ve klonlamaya



SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ SALGIN ARAŞTIRMASINDA KULLANILAN TİPLENDİRME YÖNTEMLERİ Prof.Dr. Meltem Yalınay Çırak Gazi Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji A.D. fenotipik yöntemler genotipik yöntemler



ETKEN BELİRLEMEDE KLASİK YÖNTEMLER, MOLEKÜLER YÖNTEMLER. Doç. Dr. Gönül ŞENGÖZ 9 Mayıs 2014 ETKEN BELİRLEMEDE KLASİK YÖNTEMLER, MOLEKÜLER YÖNTEMLER Doç. Dr. Gönül ŞENGÖZ 9 Mayıs 2014 DM ve diyabetik ayak «1960 yılından sonra doğan her iki kadından biri 100 yaşını görecektir.» Age and Ageing Toplumda





SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI

SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi. Prof.Dr. Nermin GÖZÜKIRMIZI SADE ve SAGE ve Gen Ekspresyonunun Seri Analizi Prof.Dr. Nermin GÖZÜKIRMIZI Gen Anlatımının Belirlenmesi DNA mikroçalışmaları Makroçalışmaları EST (Expressed sequence tag) Gen anlatımının seri analizi


DNA Dizileme (Sekanslama)

DNA Dizileme (Sekanslama) T.C GIDA TARIM VE HAYVANCILIK BAKANLIĞI PENDİK VETERİNER KONTROL ENSTİTÜSÜ DNA Dizileme (Sekanslama) Dr. Eray ATIL Vet. Hekim, Mikrobiyolog Pendik Veteriner Kontrol Enstitüsü Eğitim Bilgileri Eğitim süresi



TRANSLASYON VE DÜZENLENMESİ TRANSLASYON VE DÜZENLENMESİ TRANSLASYON Translasyonda nükleik asit kullanılır fakat son ürün bir nükleik asit değil proteindir. Translasyon mekanizması 4 ana bileşenden oluşmaktadır: 1. mrnalar 2. trnalar


KRAS Mutasyon Tespit Kiti Teknik Şartnamesi

KRAS Mutasyon Tespit Kiti Teknik Şartnamesi KRAS Mutasyon Tespit Kiti Teknik Şartnamesi 1. KRAS testi ile insan KRAS geninin kodon 12, kodon 13 ve kodon 61 deki mutasyonlarının kantitatif ölçümü 2. Yöntem dizi analizine dayalı pyrosequencing metodu


III-Hayatın Oluşturan Kimyasal Birimler

III-Hayatın Oluşturan Kimyasal Birimler III-Hayatın Oluşturan Kimyasal Birimler MBG 111 BİYOLOJİ I 3.1.Karbon:Biyolojik Moleküllerin İskeleti *Karbon bütün biyolojik moleküllerin omurgasıdır, çünkü dört kovalent bağ yapabilir ve uzun zincirler



BAKTERİLERİN GENETİK KARAKTERLERİ BAKTERİLERİN GENETİK KARAKTERLERİ GENETİK MATERYALLER VE YAPILARI HER HÜCREDE Genetik bilgilerin kodlandığı bir DNA genomu bulunur Bu genetik bilgiler mrna ve ribozomlar aracılığı ile proteinlere dönüştürülür


DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi

DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; a-) Manuel (Radyoaktif İşaretleme) Dizi Analizi SEKANS TEKNİKLERİ DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem; 1- Maxam ve Gilbert in kimyasal kırılma yöntemi (Maxam et al.,1977). 2- Sanger-Coulson un





Hücrede Genetik Bilgi Akışı

Hücrede Genetik Bilgi Akışı Hücrede Genetik Bilgi Akışı 1) Genomun korunması DNA nın tam olarak kopyalanması ve hücre bölünmesiyle yeni kuşak hücrelere aktarılması 2) Genetik bilginin çevrimi Hücre içerisinde bilginin DNA dan RNA



KAPİLLER ELEKTROFOREZ DNA SEKANSLAMA İçerik Giriş...2 Deney İçin Gerekli Olan Malzemeler...3 Deneyin Yapılışı... 4-9 Genomik DNA Kalıbının Hazırlanması...4 PCR Amplifikasyonu... 4-5 DNA Miktarının Belirlenmesi...6 Sekans Reaksiyonunun Hazırlanması...7


Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler

Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler ADANA BİLİM ve TEKNOLOJİ ÜNİVERSİTESİ Gıdalarda Tağşişin Belirlenmesinde Kullanılan Moleküler Yöntemler Ar. Gör. Sevgin DIBLAN Yrd. Doç. Dr. Pınar KADİROĞLU 1 İçerik Tağşiş nedir ve etkileri Gıda tağşişinin


İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır.

İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. DNA dizi analizleri yada sekanslama DNA birincil yapılarının tayininde ve nükleotid baz diziliminin belirlenmesinde kullanılan yöntemdir. Analiz bir nükleik asit dizisinin diğerine hibridizasyonuna dayanır.


Laboratuvar bilgi sistemini mikrobiyolojide ne kadar uygulayabiliyoruz? Dr. Alper AKÇALI Çanakkale Onsekiz Mart Üniversitesi, Tıp Fakültesi

Laboratuvar bilgi sistemini mikrobiyolojide ne kadar uygulayabiliyoruz? Dr. Alper AKÇALI Çanakkale Onsekiz Mart Üniversitesi, Tıp Fakültesi Laboratuvar bilgi sistemini mikrobiyolojide ne kadar uygulayabiliyoruz? Dr. Alper AKÇALI Çanakkale Onsekiz Mart Üniversitesi, Tıp Fakültesi Laboratuvar Bilgi Sistemleri Laboratuvarlar Çok sayıda ve farklı



DİZİ ANALİZİ (SEKANS) TEKNİKLERİ DİZİ AALİZİ (SEKAS) TEKİKLERİ DA dizi analizi, gen yapısı ve genetik kontrol mekanizmaları hakkında bir çok bilgi edinmemizi sağlamıştır. erhangi bir organizmadan çok miktarda saf DA elde edilmesini sağlayan





Bakteri Hücrelerinde Bölünme

Bakteri Hücrelerinde Bölünme Bakteri Hücrelerinde Bölünme Bakteri hücrelerinde eşeysiz çoğalma görülür. Bu da ana hücrenin DNA miktarını ikiye (replikasyon) çıkardıktan sonra yaşadığı bir sitokinezle gerçekleşir. Yrd.Doç.Dr. Yosun






9- RADYASYONUN ETKİ MEKANİZMALARI 9.1- RADYASYONUN İNDİREKT (DOLAYLI) ETKİSİ 9- RADYASYONUN ETKİ MEKANİZMALARI 9.1- RADYASYONUN İNDİREKT (DOLAYLI) ETKİSİ Radyasyonun indirekt etkisi iyonlaştırdığı su moleküllerinin oluşturdukları serbest radikaller aracılığıyla olmaktadır. Çünkü



15- RADYASYONUN NÜKLEİK ASİTLER VE PROTEİNLERE ETKİLERİ 15- RADYASYONUN NÜKLEİK ASİTLER VE PROTEİNLERE ETKİLERİ İyonlaştırıcı radyasyonların biyomoleküllere örneğin nükleik asitler ve proteinlere olan etkisi hakkında yeterli bilgi yoktur. Ancak, nükleik asitlerden


Sekansın Temelleri ve Sekans Bazlı Çalışma Doç. Dr. Fatih Özaltın Hacettepe Üniversitesi Tıp Fakültesi Pediatrik Nefroloji Ünitesi Nefrogenetik Laboratuvarı TİGED-24 Nisan 2011 Dalaman Çekirdekte DNA kromatin


Hücre Üzerine Mikrocerrahi Uygulamaları Hücrenin altbirimlerine ayrılması Moleküllerin analizi. Prof. Dr. Müjgan Cengiz

Hücre Üzerine Mikrocerrahi Uygulamaları Hücrenin altbirimlerine ayrılması Moleküllerin analizi. Prof. Dr. Müjgan Cengiz Hücre Üzerine Mikrocerrahi Uygulamaları Hücrenin altbirimlerine ayrılması Moleküllerin analizi Prof. Dr. Müjgan Cengiz Canlı Hücrelerdeki Moleküllerin İzlenmesi Mikroskopla inceleme hücrede belli düzeyde



GENETİK I BİY 301 DERS 6 GENETİK I BİY 301 DERS 6 İçerik Kısım 1: Genler, Kromozomlar ve Kalıtım Kısım 2: DNA-Yapısı, Replikasyonu ve Varyasyonu Kısım 3: Genetik bilginin ifadesi ve düzenlenmesi Kısım 4: Genomik Analiz Kısım 5:


yapılabilmelidir. 2- Yöntem dizi analizine dayalı olmalıdır ve bilinmeyen mutasyonları da tespit etmeye olanak

yapılabilmelidir. 2- Yöntem dizi analizine dayalı olmalıdır ve bilinmeyen mutasyonları da tespit etmeye olanak Glivec Direnci Mutasyon Analizi Testi Teknik Özellikleri 1- Glivec Direnci pyrosequencing testi ile BCR-ABL genindeki Y253H, Y253F, E255K, E255V,V299L, T315A, T3 l 5I, F3 l 7L, F3 l 7V, F359V, F359C mutasyonlarının





REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No

REVİZYON DURUMU. Revizyon Tarihi Açıklama Revizyon No REVİZYON DURUMU Revizyon Tarihi Açıklama Revizyon No Hazırlayan: Onaylayan: Onaylayan: Prof. Dr. Nedime Serakıncı, Yrd. Doç. Dr. Umut Fahrioğlu Adem Aköl Kalite Konseyi Başkanı Sinan Özyavaş Kalite Koordinatörü


Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.

Laboratuvar Tekniği. Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji Bölümü TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03. Laboratuvar Tekniği Adnan Menderes Üniversitesi Tarımsal Biyoteknoloji TBY 118 Muavviz Ayvaz (Yrd. Doç. Dr.) 5. Hafta (14.03.2014) 1 5. Haftanın Ders İçeriği DNA ekstraksiyonu DNA ekstraksiyonunun amacı


Konak ve Patojen İlişkisinde Genom, Metagenom ve Transkriptomik İnceleme

Konak ve Patojen İlişkisinde Genom, Metagenom ve Transkriptomik İnceleme Konak ve Patojen İlişkisinde Genom, Metagenom ve Transkriptomik İnceleme Barış Otlu İnönü Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Konak-Patojen İlişkisi- Biyolojik Yolaklar - Big Data


NTSE - Nano Technology Science Education Project No: 511787-LLP-1-2010-1-TR-KA3-KA3MP ÖĞRENCİ KILAVUZU NANO BOYUT VE NANOTEKNOLOJİ

NTSE - Nano Technology Science Education Project No: 511787-LLP-1-2010-1-TR-KA3-KA3MP ÖĞRENCİ KILAVUZU NANO BOYUT VE NANOTEKNOLOJİ NTSE - Nano Technology Science Education Project No: 511787-LLP-1-2010-1-TR-KA3-KA3MP ÖĞRENCİ KILAVUZU NAN BYUT VE NANTEKNLJİ KUMA PARÇASI Nanoboyut Nano ön eki Yunanca cüce anlamına gelen kelimeden türemiştir.


İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya.

İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler. Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. İnfeksiyon tanısında yeni yaklaşımlar Biyosensörler Barış OTLU İnönü Üniversitesi Tıp Fakültesi, Tıbbi Mikrobiyoloji Anabilim Dalı, Malatya. Bakterilerin tanımlanması Bakterilerin tanımlanması Bakterilerin


Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak

Amaç. Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak BİYOFİZİK 2015 1 Amaç Bu pratiğin amacı öğrencilerin polimeraz zincir reaksiyonu ve kullanım alanları hakkında bilgi sahibi olmalarını sağlamak 2 Hedefler Bu pratiğin sonunda öğrenciler, polimeraz zincir



ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ ÜNİTE 12:GENETİK MÜHENDİSLİĞİ VE BİYOTEKNOLOJİ Genetik mühendisliği gelişmeden önce insanlar yapay seçilim yoluyla istenen özelliklerin yavru canlılarda görülmesini sağlamışlardır. Örneğin seçici üretim


Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler

Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Gen Arama Yordamı ve Nörolojik Hastalıklarla İlgili Gen Keşfi Çalışmalarına Türkiye den Örnekler Doç. Dr. Sibel Aylin Uğur İstanbul Üniversitesi Deneysel Tıp Araştırma Enstitüsü-Genetik 13. Ulusal Sinirbilim





Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Nilgün Çerikçioğlu Marmara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Kandolaşımı Enfeksiyonları %10 Kandidemi Ölüm hızı : % 50 (YBÜ) Erken tanı (?), tedavinin önemi Etken: Candida allbicans



REKOMBİNANT DNA TEKNİKLERİ I DR. ONUR YILMAZ 2017 REKOMBİNANT DNA TEKNİKLERİ I DR. ONUR YILMAZ 2017 Rekombinasyon: Yenibileşim - yenidenoluşum. Bir molekülün-hücrenin, atasal wild type yada ilkin (orijinal) yapısından farklılık göstermesi durumudur. I


24 Eylül 2018 Pazartesi UYUM PROGRAMI

24 Eylül 2018 Pazartesi UYUM PROGRAMI 24 Eylül 2018 Pazartesi 08.40-09.30 UYUM PROGRAMI 25 Eylül 2018 Salı Tıbbi Terminoloji: Giriş, Kavramlar ve Tarihsel Gelişim Anatomi Prof. Dr. Hasan OZAN Tıbbi Terminoloji: Giriş, Kavramlar ve Tarihsel


Protokolü PD S001 01. 50 Reaksiyon

Protokolü PD S001 01. 50 Reaksiyon Salmonella sp. Real time PCR Tespit Kiti Protokolü PD S001 01 50 Reaksiyon REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen


16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı

16S rrna Analizi. Doç. Dr. Zeynep Ceren KARAHAN. Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı 16S rrna Analizi Doç. Dr. Zeynep Ceren KARAHAN Ankara Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı Sunum içeriği Genel bilgi Uygulanışı Kullanım alanları Avantajları Dezavantajları Neden


SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT

SSO Yöntemiyle HLA Tiplendirmesi. Gürbüz POLAT SSO Yöntemiyle HLA Tiplendirmesi Gürbüz POLAT SSO Diziye özgü oligonükleotid problarıyla PCR da çoğaltılmış DNA nın hibridizasyonu ile HLA allellerini saptamak için kullanılan moleküler tipleme yöntemidir.



REAKSİYON PRENSİPLERİ REAKSİYON PRENSİPLERİ Reaksiyon Bileşenleri: qpcr Master Mix (PMM) Hedef probe Mix (HPM) Zenginleştirilmiş gıda ürünleri kültüründen izole edilen DNA örneği Polimerase Chain Reaction (PCR): Son yıllarda


Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı:

Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Moleküler Patoloji Doktora Programı 2013 Bahar Dönemi Ders Programı: Derslik: Yıldırım Beyazıt Üniversitesi Etlik Yerleşkesi 1. Kat Sağlık Bilimleri Enstitüsü Dersliği Açılan Dersler: 3 adet Zorunlu Ders:


GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER

GENOM ve EVRİMİ. Yrd.Doç.Dr.Yosun MATER. Yrd.Doç.Dr.Yosun MATER GENOM ve EVRİMİ Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr.Yosun MATER 1. Genlerin Haritalanması 1.1.Genlere ait Farklı Şekilde Fiziksel Haritalar oluşturulabilir. Yapılan çalışmalar ve gelişen yeni teknolojiler


Agaroz jel elektroforezi

Agaroz jel elektroforezi MOLEKÜLER TEKNİKLER Dr. Naşit İĞCİ Nevşehir Hacı Bektaş Veli Üniversitesi Moleküler Biyoloji ve Genetik Bölümü 4. Sınıf (2017-2018 Bahar) 2. NOT Agaroz jel elektroforezi PAGE daha çok proteinlerin ve küçük


GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ

GENOM PROJELERĐ. Doç. Dr. Hilâl Özdağ GENOM PROJELERĐ Doç. Dr. Hilâl Özdağ Genom Projeleri Dizileme Klon kütüphaneleri Stratejiler Genom Dizilemesi Tekrar eden DNA dizileri Biraraya getirme (Assembly) PHRAP, PHRED,CONSED Bitiş Boşlukların


RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri

RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA Yapısı ve Katlanması, Hücrede Bulunan RNA Çeşitleri RNA (Ribonükleik Asit) Nükleik asitler, Friedrich Miescher tara2ndan 1869'da keşfedildi. İl=haplı bandajlardan izole edilen bu maddeye nüklein adını


Mikrobiyom Çalışmaları. Tanıl Kocagöz

Mikrobiyom Çalışmaları. Tanıl Kocagöz Mikrobiyom Çalışmaları Tanıl Kocagöz İnsan Mikrobiyomu İnsan vücudu 10 13 hücreden oluşmaktadır İnsan vücudu 10 14 mikroorganizma taşımaktadır. Mikroorganizmalar insan hücrelerinden 10 kat daha fazladır.





Kistik Fibrozis DNA Analiz Paneli

Kistik Fibrozis DNA Analiz Paneli FAST-CFTR Sequencing Kit Kistik Fibrozis DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR...


SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006

SEKANS TEKNİKLERİ. Ders Sorumlusu: Doç.Dr. Hatice MERGEN. Hazırlayan: Levent ZORBEK Ankara,2006 SEKANS TEKNİKLERİ GENOMİK-PROTEOMİK Ders Sorumlusu: Doç.Dr. Hatice MERGEN Hazırlayan: Levent ZORBEK Ankara,2006 DNA Dizi Analizi için geliştirilen birbirinden farklı iki yöntem bulunmaktadır. Bu iki yöntem;


NRAS Mutasyon Kiti Teknik Şartnamesi

NRAS Mutasyon Kiti Teknik Şartnamesi NRAS Mutasyon Kiti Teknik Şartnamesi 1- Sistem ile PCR ürünlerinden direkt olarak dizi analizi yapılabilmeli, ayrıca cycle sequencing işlemine gerek kalmamalıdır. 2- Sistemde dizinin sentezi ile deteksiyonu


BRCA 1/2 DNA Analiz Paneli

BRCA 1/2 DNA Analiz Paneli FAST-BRCA Sequencing Kit BRCA 1/2 DNA Analiz Paneli Dizi Analizi Amaçlı Kullanım İçin KULLANIM KILAVUZU İÇİNDEKİLER 1 GİRİŞ... 3 2 KİT İÇERİĞİ... 3 3 SAKLAMA... 3 4 GEREKLİ MATERYAL VE CİHAZLAR... 3 5


Biochemistry Chapter 4: Biomolecules. Hikmet Geçkil, Professor Department of Molecular Biology and Genetics Inonu University

Biochemistry Chapter 4: Biomolecules. Hikmet Geçkil, Professor Department of Molecular Biology and Genetics Inonu University Biochemistry Chapter 4: Biomolecules, Professor Department of Molecular Biology and Genetics Inonu University Biochemistry/Hikmet Geckil Chapter 4: Biomolecules 2 BİYOMOLEKÜLLER Bilim adamları hücreyi


Epigenetik modifikasyonlarla çalışma yöntemleri.

Epigenetik modifikasyonlarla çalışma yöntemleri. Epigenetik modifikasyonlarla çalışma yöntemleri www.plantcell.org/cgi/doi/10.1105/tpc.110.tt0110b Epigenetik modifikasyonlarla çalışma yöntemleri DNA metilasyonu bisülfit dizileme TTCGCCGACTAA TTCGCCGAuTAA


DNA REPLİKASYONU. Dr. Mahmut Cerkez Ergoren

DNA REPLİKASYONU. Dr. Mahmut Cerkez Ergoren DNA REPLİKASYONU Dr. Mahmut Cerkez Ergoren Arthur Kornberg 1959 Nobel Ödülü "the mechanisms in the biological synthesis of DNA DNA Replikasyonu Replikasyon genetik materyalin tamamen kendi benzeri yeni





Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri

Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Gıda Örneklerinde Genetiği Değiştirilmiş Organizma Analizleri Çalışma Programı Örneği (Bir Haftalık Kurs) M. Querci WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR EUROPE ORGANISATION MONDIALE DE LA SANTE


Yoğun Bakımlarda İnfeksiyon Kontrolü: Haricen Klorheksidin Uygulanmalı mı?

Yoğun Bakımlarda İnfeksiyon Kontrolü: Haricen Klorheksidin Uygulanmalı mı? Yoğun Bakımlarda İnfeksiyon Kontrolü: Haricen Klorheksidin Uygulanmalı mı? Dr. Funda YETKİN İnönü Üniversitesi Tıp Fakültesi İnfeksiyon Hastalıkları ve Klinik Mikrobiyoloji Anabilim Dalı Sunum Planı Klorheksidin


DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY

DNA Sekanslama ve Filogenetik Analizler. Dr. Eda UĞURTAY DNA Sekanslama ve Filogenetik Analizler Dr. Eda UĞURTAY DNA baz dizilimlerinin belirlenmesidir. İlk dizi analiz çalışmaları 1960 lı yılların başında 75-80 nükleotitlik trna larla başlanmıştır. Kullanım


GIDA LABORATUVARLARI. 2015 Yılı Eğitim Programı

GIDA LABORATUVARLARI. 2015 Yılı Eğitim Programı GIDA LABORATUVARLARI 2015 Yılı Eğitim Programı Gıda Laboratuvarları Eğitim Hizmetleri Intertek, sağladığı eğitim hizmetleri ile teknik farkındalık yaratmakta ve sektörde faaliyet gösteren şirketlere uzman


Mikobakteriyolojide yeni nesil dizileme ile analiz

Mikobakteriyolojide yeni nesil dizileme ile analiz Mikobakteriyolojide yeni nesil dizileme ile analiz Prof. Dr. Cengiz ÇAVUŞOĞLU Ege Üniversitesi Tıp Fakültesi Tıbbi Mikrobiyoloji Anabilim Dalı, İzmir Mikobakteriyolojide kullanım alanları Moleküller epidemiyoloji





Nadir hastalıkların tanısında yeni nesil dizi analizi uygulamalarına klinik yaklaşım: Sonuçların değerlendirilmesi

Nadir hastalıkların tanısında yeni nesil dizi analizi uygulamalarına klinik yaklaşım: Sonuçların değerlendirilmesi Nadir hastalıkların tanısında yeni nesil dizi analizi uygulamalarına klinik yaklaşım: Sonuçların değerlendirilmesi Uzm.Dr.Kadri Karaer Gaziantep Dr.Ersin Arslan Eği6m Araş8rma Hastanesi Gene6k Hastalıklar


OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD

OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD OMİK(S)LER Genomik(s), Transkriptomik(s), Proteomik(s) Doç. Dr. Murat Kasap KOU Tıp Fak. Tıbbi Biyoloji AD Genomiks Temeli DNA nın dizilenmesi ve elde edilen dizilerin biyoinformatiksel metotlar kullanılarak


GEN KLONLAMASI. copyright cmassengale

GEN KLONLAMASI. copyright cmassengale GEN KLONLAMASI copyright cmassengale 1 Klonlama nedir? Bir genin vekto re yerleştirilmesi ve bu vekto ru n bakteri hu crelerine transformasyonu sonucunda hu crelerin bo lu nmesi sırasında vekto ru n de



VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ VİRUS HASTALIKLARINDA TANI YÖNTEMLERİ Doç. Dr. Koray Ergünay MD PhD Hacettepe Üniversitesi Tıp Fakültesi Mikrobiyoloji ve Klinik Mikrobiyoloji Anabilim Dalı, Viroloji Ünitesi Viral Enfeksiyonlar... Klinik


DÖNEM 1- A, 3. DERS KURULU (2015-2016)

DÖNEM 1- A, 3. DERS KURULU (2015-2016) DÖNEM 1- A, 3. DERS KURULU (2015-2016) DERS SAATİ DERS ADI DERS KONUSU DERSİ VEREN ÖĞRETİM ÜYESİ 4. DK 1. Hafta 07 Aralık Pazartesi Mikrobiyoloji Mikrobiyolojinin tarihçesi ve mikroorganizmalara genel


Yrd.Doç.Dr. Yosun MATER

Yrd.Doç.Dr. Yosun MATER * Yrd.Doç.Dr.Yosun MATER Yrd.Doç.Dr. Yosun MATER *Bitki nüklear, mitokondriyal ve kloroplast DNA'ları *Burada yer alan bugünkü bilgilerimizin çoğu, moleküler evrim mekanizması ve oranları kullanılarak



HIZLI YÖNTEMLER (III) 1 Doç.. Dr. Serap COŞANSU AKDEMİR HIZLI YÖNTEMLER (III) 2 MOLEKÜLER GENETİK YÖNTEMLER Gıda kaynaklı patojenlerin tanımlanmasında ve karakterizasyonunda fenotipik yöntemler halen yaygın olarak kullanılmakla
